DOCSLIB.ORG

Molecular Signatures of Survival in Pancreatic Ductal Adenocarcinoma

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Molecular Signatures of Survival in Pancreatic Ductal Adenocarcinoma Molecular signatures of survival in pancreatic ductal adenocarcinoma Why do some patients live longer than others, and how can we identify them? Mark Pinese A thesis in fulfilment of the requirements for the degree of Doctor of Philosophy St. Vincent's Clinical School Faculty of Medicine March 2015 PLEASE TYPE THE UNIVERSITY OF NEW SOUTH WALES Thesis/Dissertation Sheet Surname or Fami ly name: Pinese First name: M ark Other name/s: Abbreviation for degree as given in the University calendar: PhD School: St . Vincent's C linical Sc ho ol Faculty: Medic ine Title: Molecu lar signatures of surviva l in pancr eatic ductal adenocarcinoma: why d o some patients live lo n ger than o thers, and h ow can we identi fy them ? Abstract 350 words maximum: (PLEASE TYPE) Pa nc reatic duct a l ad enocarcinoma (PDAC) is t he m ost deadly commo n cancer, wit h fewer tha n ten per­ cen t of pa t.ients s urv iving five years fro m d iagnosis. In cont rast to many other cancers, tbe g rim prognosis of PDAC has remained la rgely the same over the past tbirt.y years . reflecting o ur relatively poor unders ta nding of the disease. This situa tion may soon change: recent la rge-scale effo rts have produced deta iled molecula r a nd clinical d a ta for a lmost a tho usand cas es of PDAC, finally enabling det ailed dissection of the cancer 's molecula r basis. This work used t hese new d a t a t o directly address two questions linked to PDAC's excep­ t.iona lly poor prog·nosis: what are tlle biological processes t hat drive poor prognosis in PDAC? and can we develo p a p ractical and effective prognostic staging system t o better g uide PDAC treatment? Cha pter 2 cons idered the firs t question , using a gene expressio n fact.o risation approach to ident.i fy two m eta­ genes tha t det ermine s urvival in PDAC . These met agenes we re linked t o the biological processes of prolifera­ t ion , a nd the EMT, and were a lso prognostic in a number of other solid t umours, revealing t hese processes as gene ra lly in1p o rta nt t o cancer pa tient s urvival. C ha pter 3 addressed the second question, develo ping a pilo t t.ool to estima te the prognosis of a PDAC pa­ tient, and gu ide the decisio n of whe ther to resect. that patient's tumo ur. Tbe tool is unique in that it can b e a pplied prio r to resectio n , and its valid a tion p erfo rmance was competitive with gold st a ndard post-resectio n met.hod s. This perfo rmance might be improved thro ug h better selectio n of prognostic bioma rke rs: this is the s ubject o f C ha pte r 4, which describes a method fo r the ide nt ification of biomarkers t hat a re well-s uited fo r deve lopment. into clinica l t ests. PDAC has a n exceptio na lly poor prognosis . but bett.er unders t.a nding of t he disease, a nd improvem ents in its ma nagem ent. can y ie ld incrementa lly better o utcom es. The work presented here focused o n unde rstanding a nd predicting prognosis in PDAC . It. identified two metageues t ha t we re strongly linked to o utcome. indicat­ ing va lua bl e therapeutic di rections to improve the s urvival of patients with particula rly aggressive tu1no ursi a nd it provided a proo f- of-concept, a nd a m e thod fo r develo pment, of a biomarker-based preoperative prog­ nostic tool fo r t he improved management of PDAC. Declaration relating to disposition of project thesis/dissertation I hereby grant to the University of New South Wales or its agents the right to archive and to make available my thesis or dissertation in whole or in part in the University librari es in all forms of media, now or here after known, subject to the provisions of the Copyright Act 1968. I retain all property rights, such as patent rights. I also retain the right to use in future works (such as articles or books) all or part of th is thesis or dissertation. 1 also authorise University Microfilms to use the 350 word abstract of my thesis in Dissertation Abstracts International (this is applicable to doctoral theses only). ~~......._ .... H. .~ ...~ .. ............. .. ..... .......... ....... ....... Signature Wit s Date The University recognises that there may be exceptional circumstances requiring restrictions on copying or conditions on use. Requests for restriction .for a period of up to 2 years must be made in wri ting. Requests for a longer period of restriction may be considered in exceptional circumstances and require the approval of the Dean of Graduate Research. FOR OFFICE USE ONLY Date of completion of requirements for Award: THIS SHEET IS TO BE GLUED TO THE INSIDE FRONT COVER OF THE THESIS ORIGINALITY STATEMENT 'I hereby declare that this submission is my own work and to the best of my knowledge it contains no materials previously published or written by another person , or substantial proportions of material which have been accepted for the award of any other degree or diploma at UNSW or any other educational institution, except where due acknowledgement is made in the thesis. Any contribution made to the research by others, with whom I have worked at UNSW or elsewhere, is expli citly acknowledged in the thesis. I also declare that the intellectual content of this thesis is the product of my own work, except to the extent that assistance from others in the project's design and conception or in style, presentation and linguistic expression is acknowledged .' Signed ..... H~...... f.~ .... ............. .. ... .. Date .... ... !.~/!./~ . ~ - '·· ~ · ·· ······ · · · ·· ·· ··· · .. ..... ..... .. COPYRIGHT STATEMENT 'I hereby grant the University of New South Wales or its agents the right to archive and to make available my thesis or dissertation in whole or part in the University libraries in all forms of media, now or here after known , subject to the provisions of the Copyright Act 1968. I retain all proprietary rights , such as patent rights. I also retain the right to use in future works (such as articles or books) all or part of this thesis or dissertation. I also authorise University Microfilms to use the 350 word abstract of my thesis in Dissertation Abstract International (this is applicable to doctoral theses only). I have either used no substantial portions of copyright material in my thesis or I have obtained permission to use copyright material; where permission has not been granted I have applied/will apply for a partial restriction of the digital copy of my thesis or dissertation.' Signed ... H~ ... .... b ... ................................. Date ..... ( .~/~ . 1~ . '? ..1 . ~ ..... ..... .... .. .... ...... ...... .......... ...... AUTHENTICITY STATEMENT 'I certify that the Library deposit digital copy is a direct equivalent of the final officially approved version of my thesis. No emendation of content has occurred and if there are any minor variations in formatting, they are the result of the conversion to digital format. ' Signed Date To Emma and Eva { it's done now! Acknowledgements As tempted as I was at times to follow the path of Shivers' outstand- ing non-acknowledgement [94], in truth this work would simply not be without the myriad contributions of friends, family, and colleagues. I am indebted to Prof. Andrew Biankin, for teaching me some of the rules of professional science, and for his great accomplishment in piloting the APGI to success; without the data generated by that project, this dissertation would not have been possible. Likewise, Prof. Sean Grimmond and his group at the Institute of Molecular Bioscience were instrumental in generating the lion's share of the expression data upon which I worked. Survival analysis requires exacting interpretation, coding, and follow-up of clinical records; laborious and difficult work that is too often left unacknowledged. I am very grateful to the entire clini- cal data team of the APGI/NSWPCN, for thanklessly collating the high-quality data which I required, and for humouring my continual requests for data. In particular, this work would be far weaker with- out the substantial contributions of Clare Watson, Skye Simpson, Mary-Anne Brancato, and Amber Johns. Dr. David Chang taught me so much about true translational research; his work and guidance continues to transform the predictor of Chapter 3 from an academic exercise, into something that could truly make a positive difference for patients. His contributions to the greater prognostic predictor project far outweigh mine, and his long efforts on molecular prognostics in pancreas cancer enabled the small work I describe here. Dr. Mark Cowley, I suspect, was not quite aware of the task ahead when he kindly agreed to supervise me following Prof. Biankin's departure. This dissertation is stronger for his critical input, and his patient help and encouragement at all times was far better than I think I deserved. Friends and family have given support, both overt and covert, freely through the last four years. In particular, Aaron Statham, Al- iii ison Ferguson, and Drs. Hugh French and Brian Gloss, have made contributions to my mental health { usually administered at Darlo Bar { that go beyond the call of duty. I have also been very fortu- nate to have had the unquestioning support of the Pinese and Scott families. Scholarships from the Australian government, UNSW Australia, and the Garvan Institute meant that I did not need to cut back on my food habit in order to meet my basic coffee needs.
Load more

Recommended publications
  • SEC23IP (NM 007190) Human Recombinant Protein – TP309056
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TP309056 SEC23IP (NM_007190) Human Recombinant Protein Product data: Product Type: Recombinant Proteins Description: Recombinant protein of human SEC23 interacting protein (SEC23IP) Species: Human Expression Host: HEK293T Tag: C-Myc/DDK Predicted MW: 110.9 kDa Concentration: >50 ug/mL as determined by microplate BCA method Purity: > 80% as determined by SDS-PAGE and Coomassie blue staining Buffer: 25 mM Tris.HCl, pH 7.3, 100 mM glycine, 10% glycerol Preparation: Recombinant protein was captured through anti-DDK affinity column followed by conventional chromatography steps. Storage: Store at -80°C. Stability: Stable for 12 months from the date of receipt of the product under proper storage and handling conditions. Avoid repeated freeze-thaw cycles. RefSeq: NP_009121 Locus ID: 11196 UniProt ID: Q9Y6Y8 RefSeq Size: 7306 Cytogenetics: 10q26.11-q26.12 RefSeq ORF: 3000 Synonyms: iPLA1beta; MSTP053; P125; P125A Summary: This gene encodes a member of the phosphatidic acid preferring-phospholipase A1 family. The encoded protein is localized to endoplasmic reticulum exit sites and plays a critical role in ER-Golgi transport as part of the multimeric coat protein II complex. An orthologous gene in frogs is required for normal neural crest cell development, suggesting that this gene may play a role in Waardenburg syndrome neural crest defects. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Feb 2011] This product is to be used for laboratory only.
    [Show full text]
  • Genetic Variant in 3' Untranslated Region of the Mouse Pycard Gene
    bioRxiv preprint doi: https://doi.org/10.1101/2021.03.26.437184; this version posted March 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 2 3 Title: 4 Genetic Variant in 3’ Untranslated Region of the Mouse Pycard Gene Regulates Inflammasome 5 Activity 6 Running Title: 7 3’UTR SNP in Pycard regulates inflammasome activity 8 Authors: 9 Brian Ritchey1*, Qimin Hai1*, Juying Han1, John Barnard2, Jonathan D. Smith1,3 10 1Department of Cardiovascular & Metabolic Sciences, Lerner Research Institute, Cleveland Clinic, 11 Cleveland, OH 44195 12 2Department of Quantitative Health Sciences, Lerner Research Institute, Cleveland Clinic, Cleveland, OH 13 44195 14 3Department of Molecular Medicine, Cleveland Clinic Lerner College of Medicine of Case Western 15 Reserve University, Cleveland, OH 44195 16 *, These authors contributed equally to this study. 17 Address correspondence to Jonathan D. Smith: email [email protected]; ORCID ID 0000-0002-0415-386X; 18 mailing address: Cleveland Clinic, Box NC-10, 9500 Euclid Avenue, Cleveland, OH 44195, USA. 19 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.03.26.437184; this version posted March 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 20 Abstract 21 Quantitative trait locus mapping for interleukin-1 release after inflammasome priming and activation 22 was performed on bone marrow-derived macrophages (BMDM) from an AKRxDBA/2 strain intercross.
    [Show full text]
  • TITLE PAGE Oxidative Stress and Response to Thymidylate Synthase
    Downloaded from molpharm.aspetjournals.org at ASPET Journals on October 2, 2021 -Targeted -Targeted 1 , University of of , University SC K.W.B., South Columbia, (U.O., Carolina, This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted.
    [Show full text]
  • SEC23IP (NM 007190) Human Tagged ORF Clone – RG209056
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG209056 SEC23IP (NM_007190) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: SEC23IP (NM_007190) Human Tagged ORF Clone Tag: TurboGFP Symbol: SEC23IP Synonyms: iPLA1beta; MSTP053; P125; P125A Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 SEC23IP (NM_007190) Human Tagged ORF Clone – RG209056 ORF Nucleotide >RG209056 representing NM_007190 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCGAGAGAAAACCTAACGGTGGCAGCGGCGGCGCCTCCACTTCCTCATCGGGCACTAACTTACTTT TCTCCTCCTCGGCCACGGAGTTCAGCTTCAATGTGCCCTTCATCCCAGTCACCCAGGCCTCCGCTTCTCC GGCCTCCCTGCTCTTACCGGGAGAGGATTCCACAGATGTTGGTGAGGAGGACAGCTTCCTTGGTCAGACT TCTATTCACACATCTGCCCCACAGACATTTAGTTACTTCTCTCAGGTATCAAGCAGCAGTGATCCTTTTG GGAATATTGGACAGTCACCATTAACAACTGCAGCAACCTCAGTTGGACAATCAGGATTCCCCAAGCCCCT GACTGCTCTCCCTTTTACAACTGGATCCCAAGATGTCTCGAATGCATTTTCACCATCCATTTCGAAGGCT CAACCTGGTGCTCCACCTTCCTCACTGATGGGAATAAATTCTTATCTGCCTTCTCAGCCAAGTAGTCTCC CTCCTTCATATTTTGGGAACCAACCCCAAGGAATTCCCCAACCAGGATACAATCCATATCGCCATACCCC TGGCAGCAGCAGGGCTAATCCTTACATTGCACCACCCCAGCTGCAGCAGTGCCAAACACCAGGCCCTCCT
    [Show full text]
  • Supplementary Table 1
    Supplementary Table 1. 492 genes are unique to 0 h post-heat timepoint. The name, p-value, fold change, location and family of each gene are indicated. Genes were filtered for an absolute value log2 ration 1.5 and a significance value of p ≤ 0.05. Symbol p-value Log Gene Name Location Family Ratio ABCA13 1.87E-02 3.292 ATP-binding cassette, sub-family unknown transporter A (ABC1), member 13 ABCB1 1.93E-02 −1.819 ATP-binding cassette, sub-family Plasma transporter B (MDR/TAP), member 1 Membrane ABCC3 2.83E-02 2.016 ATP-binding cassette, sub-family Plasma transporter C (CFTR/MRP), member 3 Membrane ABHD6 7.79E-03 −2.717 abhydrolase domain containing 6 Cytoplasm enzyme ACAT1 4.10E-02 3.009 acetyl-CoA acetyltransferase 1 Cytoplasm enzyme ACBD4 2.66E-03 1.722 acyl-CoA binding domain unknown other containing 4 ACSL5 1.86E-02 −2.876 acyl-CoA synthetase long-chain Cytoplasm enzyme family member 5 ADAM23 3.33E-02 −3.008 ADAM metallopeptidase domain Plasma peptidase 23 Membrane ADAM29 5.58E-03 3.463 ADAM metallopeptidase domain Plasma peptidase 29 Membrane ADAMTS17 2.67E-04 3.051 ADAM metallopeptidase with Extracellular other thrombospondin type 1 motif, 17 Space ADCYAP1R1 1.20E-02 1.848 adenylate cyclase activating Plasma G-protein polypeptide 1 (pituitary) receptor Membrane coupled type I receptor ADH6 (includes 4.02E-02 −1.845 alcohol dehydrogenase 6 (class Cytoplasm enzyme EG:130) V) AHSA2 1.54E-04 −1.6 AHA1, activator of heat shock unknown other 90kDa protein ATPase homolog 2 (yeast) AK5 3.32E-02 1.658 adenylate kinase 5 Cytoplasm kinase AK7
    [Show full text]
  • SCAP/SREBP Pathway Is Required for the Full Steroidogenic Response To
    SCAP/SREBP pathway is required for the full PNAS PLUS steroidogenic response to cyclic AMP Masami Shimizu-Alberginea,b,c, Brian Van Yserloob,c, Martin G. Golkowskia, Shao-En Onga, Joseph A. Beavoa,1,2, and Karin E. Bornfeldtb,c,d,1,2 aSchool of Medicine, Department of Pharmacology, University of Washington, Seattle, WA 98195; bSchool of Medicine, Department of Medicine, Division of Metabolism, Endocrinology and Nutrition, University of Washington, Seattle, WA 98109; cUniversity of Washington Diabetes Institute, School of Medicine, University of Washington, Seattle, WA 98109; and dSchool of Medicine, Department of Pathology, University of Washington Diabetes Institute, University of Washington, Seattle, WA 98109 Contributed by Joseph A. Beavo, July 19, 2016 (sent for review May 14, 2016; reviewed by Marco Conti, Donald Maurice, and Timothy Osborne) Luteinizing hormone (LH) stimulates steroidogenesis largely through Cellular cholesterol levels are controlled in part by several a surge in cyclic AMP (cAMP). Steroidogenic rates are also critically transcription factors, including sterol-regulatory element-binding dependent on the availability of cholesterol at mitochondrial sites of proteins (SREBPs) 2 and 1a, that promote cholesterol bio- synthesis. This cholesterol is provided by cellular uptake of lipoproteins, synthetic gene expression when cellular cholesterol levels are too mobilization of intracellular lipid, and de novo synthesis. Whether low to meet demand (9, 10). The activities of the SREBPs are and how these pathways are coordinated by cAMP are poorly un- precisely controlled by an escort protein, SREBP cleavage-acti- derstood. Recent phosphoproteomic analyses of cAMP-dependent vating protein (SCAP), and the insulin-inducible gene product phosphorylation sites in MA10 Leydig cells suggested that cAMP (Insig) (11–13).
    [Show full text]
  • ID AKI Vs Control Fold Change P Value Symbol Entrez Gene Name *In
    ID AKI vs control P value Symbol Entrez Gene Name *In case of multiple probesets per gene, one with the highest fold change was selected. Fold Change 208083_s_at 7.88 0.000932 ITGB6 integrin, beta 6 202376_at 6.12 0.000518 SERPINA3 serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 1553575_at 5.62 0.0033 MT-ND6 NADH dehydrogenase, subunit 6 (complex I) 212768_s_at 5.50 0.000896 OLFM4 olfactomedin 4 206157_at 5.26 0.00177 PTX3 pentraxin 3, long 212531_at 4.26 0.00405 LCN2 lipocalin 2 215646_s_at 4.13 0.00408 VCAN versican 202018_s_at 4.12 0.0318 LTF lactotransferrin 203021_at 4.05 0.0129 SLPI secretory leukocyte peptidase inhibitor 222486_s_at 4.03 0.000329 ADAMTS1 ADAM metallopeptidase with thrombospondin type 1 motif, 1 1552439_s_at 3.82 0.000714 MEGF11 multiple EGF-like-domains 11 210602_s_at 3.74 0.000408 CDH6 cadherin 6, type 2, K-cadherin (fetal kidney) 229947_at 3.62 0.00843 PI15 peptidase inhibitor 15 204006_s_at 3.39 0.00241 FCGR3A Fc fragment of IgG, low affinity IIIa, receptor (CD16a) 202238_s_at 3.29 0.00492 NNMT nicotinamide N-methyltransferase 202917_s_at 3.20 0.00369 S100A8 S100 calcium binding protein A8 215223_s_at 3.17 0.000516 SOD2 superoxide dismutase 2, mitochondrial 204627_s_at 3.04 0.00619 ITGB3 integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) 223217_s_at 2.99 0.00397 NFKBIZ nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta 231067_s_at 2.97 0.00681 AKAP12 A kinase (PRKA) anchor protein 12 224917_at 2.94 0.00256 VMP1/ mir-21likely ortholog
    [Show full text]
  • UNIVERSITY of CALIFORNIA Los Angeles a Sterile Alpha Motif
    UNIVERSITY OF CALIFORNIA Los Angeles A Sterile Alpha Motif Domain Network Involved in Kidney Development A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Biochemistry and Molecular Biology by Catherine Nicole Leettola 2015 ABSTRACT OF THE DISSERTATION A Sterile Alpha Motif Domain Network Involved in Kidney Development by Catherine Nicole Leettola Doctor of Philosophy in Biochemistry and Molecular Biology University of California, Los Angeles, 2015 Professor James U. Bowie, Chair Cystic kidney diseases including polycystic kidney disease (PKD) and nephronophthisis (NPHP) are the most common genetic disorders leading to end-stage renal failure in humans. Animal models and human cases of PKD and NPHP have implicated the sterile alpha motif (SAM) domain containing proteins bicaudal C homolog 1 (BICC1) and ankyrin repeat and SAM- domain containing protein 6 (ANKS6) as being involved in these conditions and important for renal development. SAM domains are known protein-protein interaction domains that are capable of binding each other to form polymers and heterodimers. Using a negGFP native gel assay, we have identified the SAM domain of the previously uncharacterized protein ankyrin repeat and SAM-domain containing protein 3 (ANKS3) as a direct binding partner of the BICC1 and ANKS6 SAM domains. We found the ANKS3 SAM domain to polymerize with moderate affinity and determined the ANKS6 SAM domain can bind to a single end of this polymer. Crystal structures of the ANKS3 SAM domain polymer and the ANKS3 SAM-ANKS6 SAM ii heterodimer are presented to reveal typical ML-EH SAM domain interaction interfaces with a pronounced charge complementarity.
    [Show full text]
  • Diagnostic Yield and Novel Candidate Genes by Exome Sequencing in 152 Consanguineous Families with Neurodevelopmental Disorders
    Research JAMA Psychiatry | Original Investigation Diagnostic Yield and Novel Candidate Genes by Exome Sequencing in 152 Consanguineous Families With Neurodevelopmental Disorders Miriam S. Reuter, MD; Hasan Tawamie, MA; Rebecca Buchert, MA; Ola Hosny Gebril, MD; Tawfiq Froukh, PhD; Christian Thiel, MD; Steffen Uebe, PhD; Arif B. Ekici, PhD; Mandy Krumbiegel, PhD; Christiane Zweier, MD; Juliane Hoyer, MD; Karolin Eberlein, MD; Judith Bauer, MD; Ute Scheller, MD; Tim M. Strom, MD; Sabine Hoffjan, MD; Ehab R. Abdelraouf, MD; Nagwa A. Meguid, MD, PhD; Ahmad Abboud, MD; Mohammed Ayman Al Khateeb, MD; Mahmoud Fakher, MD; Saber Hamdan, MD; Amina Ismael, MD; Safia Muhammad, MD; Ebtessam Abdallah, MD, PhD; Heinrich Sticht, PhD; Dagmar Wieczorek, MD; André Reis, MD; Rami Abou Jamra, MD Supplemental content IMPORTANCE Autosomal recessive inherited neurodevelopmental disorders are highly heterogeneous, and many, possibly most, of the disease genes are still unknown. OBJECTIVES To promote the identification of disease genes through confirmation of previously described genes and presentation of novel candidates and provide an overview of the diagnostic yield of exome sequencing in consanguineous families. DESIGN, SETTING, AND PARTICIPANTS Autozygosity mapping in families and exome sequencing of index patients were performed in 152 consanguineous families (the parents descended from a same ancestor) with at least 1 offspring with intellectual disability (ID). The study was conducted from July 1, 2008, to June 30, 2015, and data analysis was conducted from July 1, 2015, to August 31, 2016. RESULTS Of the 152 consanguineous families enrolled, 1 child (in 45 families [29.6%]) or multiple children (107 families [70.4%]) had ID; additional features were present in 140 of the families (92.1%).
    [Show full text]
  • Renoprotective Effect of Combined Inhibition of Angiotensin-Converting Enzyme and Histone Deacetylase
    BASIC RESEARCH www.jasn.org Renoprotective Effect of Combined Inhibition of Angiotensin-Converting Enzyme and Histone Deacetylase † ‡ Yifei Zhong,* Edward Y. Chen, § Ruijie Liu,*¶ Peter Y. Chuang,* Sandeep K. Mallipattu,* ‡ ‡ † | ‡ Christopher M. Tan, § Neil R. Clark, § Yueyi Deng, Paul E. Klotman, Avi Ma’ayan, § and ‡ John Cijiang He* ¶ *Department of Medicine, Mount Sinai School of Medicine, New York, New York; †Department of Nephrology, Longhua Hospital, Shanghai University of Traditional Chinese Medicine, Shanghai, China; ‡Department of Pharmacology and Systems Therapeutics and §Systems Biology Center New York, Mount Sinai School of Medicine, New York, New York; |Baylor College of Medicine, Houston, Texas; and ¶Renal Section, James J. Peters Veterans Affairs Medical Center, New York, New York ABSTRACT The Connectivity Map database contains microarray signatures of gene expression derived from approximately 6000 experiments that examined the effects of approximately 1300 single drugs on several human cancer cell lines. We used these data to prioritize pairs of drugs expected to reverse the changes in gene expression observed in the kidneys of a mouse model of HIV-associated nephropathy (Tg26 mice). We predicted that the combination of an angiotensin-converting enzyme (ACE) inhibitor and a histone deacetylase inhibitor would maximally reverse the disease-associated expression of genes in the kidneys of these mice. Testing the combination of these inhibitors in Tg26 mice revealed an additive renoprotective effect, as suggested by reduction of proteinuria, improvement of renal function, and attenuation of kidney injury. Furthermore, we observed the predicted treatment-associated changes in the expression of selected genes and pathway components. In summary, these data suggest that the combination of an ACE inhibitor and a histone deacetylase inhibitor could have therapeutic potential for various kidney diseases.
    [Show full text]
  • Diagnosis of Metastatic Melanoma and Monitoring
    (19) TZZ ZZ_Z_T (11) EP 2 080 140 B1 (12) EUROPEAN PATENT SPECIFICATION (45) Date of publication and mention (51) Int Cl.: of the grant of the patent: G06F 19/00 (2011.01) 24.04.2013 Bulletin 2013/17 (86) International application number: (21) Application number: 07871360.9 PCT/US2007/083555 (22) Date of filing: 03.11.2007 (87) International publication number: WO 2008/100352 (21.08.2008 Gazette 2008/34) (54) DIAGNOSIS OF METASTATIC MELANOMA AND MONITORING INDICATORS OF IMMUNOSUPPRESSION THROUGH BLOOD LEUKOCYTE MICROARRAY ANALYSIS DIAGNOSE VON METASTASIERENDEM MELANOM UND ÜBERWACHUNG VON IMMUNSUPPRESSIONSINDIKATOREN MITTTELS LEUKOZYTEN-MIKROARRAY DIAGNOSTIC DE MELANOME METASTATIQUE ET SURVEILLANCE D’INDICATEURS D’IMMUNOSUPPRESSION PAR ANALYSE DE MICRORESEAUX DE LEUCOCYTES SANGUINS (84) Designated Contracting States: • PAVEY SANDRA ET AL: "Microarray expression AT BE BG CH CY CZ DE DK EE ES FI FR GB GR profiling in melanoma reveals a BRAF mutation HU IE IS IT LI LT LU LV MC MT NL PL PT RO SE signature", ONCOGENE, vol. 23, no. 23, 20 May SI SK TR 2004 (2004-05-20), pages 4060-4067, XP002644753, ISSN: 0950-9232 (30) Priority: 03.11.2006 US 856406 P • ZHOU YOUWEN ET AL: "Osteopontin expression correlates with melanoma invasion", JOURNAL (43) Date of publication of application: OF INVESTIGATIVE DERMATOLOGY, vol. 124, 22.07.2009 Bulletin 2009/30 no. 5, May 2005 (2005-05), pages 1044-1052, XP002644754, ISSN: 0022-202X (60) Divisional application: • BITTNER M ET AL: "MOLECULAR 12152482.1 / 2 506 172 CLASSIFICATION OF CUTANEOUS MALIGNANT 12196231.0 / 2 579 174 MELANOMA BY GENE EXPRESSION 12196232.8 / 2 570 951 PROFILING", NATURE, NATURE PUBLISHING GROUP, LONDON, GB, vol.
    [Show full text]
  • Gene Identification in Hereditary Spastic Paraplegias and Characterization of Spastic Paraplegia Type 58 (SPG58)
    Gene identification in Hereditary Spastic Paraplegias and characterization of spastic paraplegia type 58 (SPG58) Dissertation zur Erlangung des Grades eines Doktors der Naturwissenschaften der Mathematisch-Naturwissenschaftlichen Fakultät und der Medizinischen Fakultät der Eberhard-Karls-Universität Tübingen vorgelegt von Andrés Caballero García de Oteyza aus Madrid, Spanien Oktober - 2016 Tag der mündlichen Prüfung: 14 Oktober 2016 Dekan der Math.-Nat. Fakultät: Prof. Dr. W. Rosenstiel Dekan der Medizinischen Fakultät: Prof. Dr. I. B. Autenrieth 1. Berichterstatter: Prof. Dr. Ludger Schöls 2. Berichterstatter: Prof. Dr. Doron Rapaport Prüfungskommission: Prof. Dr. Peter Heutink Prof. Dr. Thomas Gasser Prof. Dr. Ludger Schöls Dr. Michela Deleidi 2 I hereby declare that I have produced the work entitled: “Gene Identification in Hereditary Spastic Paraplegias and Characterization of spastic paraplegia type 58 (SPG58)”, submitted for the award of a doctorate, on my own (without external help), have used only the sources and aids indicated and have marked passages included from other works, whether verbatim or in content, as such. I swear upon oath that these statements are true and that I have not concealed anything. I am aware that making a false declaration under oath is punishable by a term of imprisonment of up to three years or by a fine. Tübingen, October 21st 2016 Andrés Caballero García de Oteyza Date Signature 3 Acknowledgements I would like to start thanking Dr. Rebecca Schüle for having given me the opportunity to start such an exciting project together. I also thank her because she believed in me even though I had little experience when I started. She has guided and taught me patiently as much as I have asked for.
    [Show full text]