DOCSLIB.ORG

Mouse Sec23ip Conditional Knockout Project (CRISPR/Cas9)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mouse Sec23ip Conditional Knockout Project (CRISPR/Cas9) https://www.alphaknockout.com Mouse Sec23ip Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Sec23ip conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Sec23ip gene (NCBI Reference Sequence: NM_001029982 ; Ensembl: ENSMUSG00000055319 ) is located on Mouse chromosome 7. 19 exons are identified, with the ATG start codon in exon 1 and the TGA stop codon in exon 18 (Transcript: ENSMUST00000042942). Exon 2 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Sec23ip gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP23-121G8 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Male mice homozygous for a null allele display reduced fertility with globozoospermia and impaired fertilization. Exon 2 starts from about 5.28% of the coding region. The knockout of Exon 2 will result in frameshift of the gene. The size of intron 1 for 5'-loxP site insertion: 4880 bp, and the size of intron 2 for 3'-loxP site insertion: 2120 bp. The size of effective cKO region: ~1027 bp. The cKO region does not have any other known gene. Page 1 of 7 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele gRNA region 5' gRNA region 3' 1 2 3 19 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Exon of mouse Sec23ip Homology arm cKO region loxP site Page 2 of 7 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis. Overview of the GC Content Distribution Window size: 300 bp Sequence 12 Summary: Full Length(7527bp) | A(26.01% 1958) | C(19.89% 1497) | T(30.81% 2319) | G(23.29% 1753) Note: The sequence of homologous arms and cKO region is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Page 3 of 7 https://www.alphaknockout.com BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr7 + 128746810 128749809 3000 browser details YourSeq 91 614 1813 3000 93.3% chr1 - 180962655 181116259 153605 browser details YourSeq 88 1701 1843 3000 91.6% chr1 + 194569193 194569336 144 browser details YourSeq 78 1701 1811 3000 88.5% chr1 - 87293398 87293506 109 browser details YourSeq 78 303 711 3000 72.2% chr3 + 94694996 94695139 144 browser details YourSeq 78 1701 1807 3000 85.8% chr1 + 6156110 6156210 101 browser details YourSeq 75 88 705 3000 81.4% chr1 + 9420320 9559156 138837 browser details YourSeq 74 1739 1834 3000 89.8% chr13 - 67790053 67790147 95 browser details YourSeq 74 1735 1834 3000 88.9% chr1 + 82331218 82331316 99 browser details YourSeq 73 1723 1814 3000 90.3% chr18 - 34793721 34793815 95 browser details YourSeq 72 1735 1843 3000 92.8% chr12 + 67779913 67780229 317 browser details YourSeq 71 1740 1831 3000 89.2% chr13 - 119118970 119119062 93 browser details YourSeq 71 566 682 3000 82.6% chr17 + 79113774 79113881 108 browser details YourSeq 70 1700 1811 3000 90.0% chr5 + 137724886 137724995 110 browser details YourSeq 69 615 711 3000 79.8% chr17 + 65631180 65631268 89 browser details YourSeq 68 1737 1835 3000 87.3% chr7 - 40208458 40208568 111 browser details YourSeq 67 1734 1817 3000 94.8% chr11 - 113736196 113736281 86 browser details YourSeq 66 1754 1831 3000 92.4% chr5 - 88741759 88741836 78 browser details YourSeq 64 623 711 3000 82.4% chrX - 50403243 50403328 86 browser details YourSeq 63 614 711 3000 81.6% chr13 + 61755134 61755223 90 Note: The 3000 bp section upstream of Exon 2 is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr7 + 128750837 128753836 3000 browser details YourSeq 88 1003 1500 3000 89.2% chr7 - 97763389 97763891 503 browser details YourSeq 87 1003 1532 3000 71.5% chr6 - 125418460 125418590 131 browser details YourSeq 78 861 1101 3000 89.6% chr11 - 57822166 57822717 552 browser details YourSeq 74 1003 1101 3000 85.4% chr17 - 23589968 23590055 88 browser details YourSeq 72 1003 1101 3000 81.6% chr8 + 96315442 96315534 93 browser details YourSeq 71 1003 1160 3000 93.9% chr2 - 131226655 131227003 349 browser details YourSeq 71 1003 1101 3000 84.6% chr14 - 81320344 81320436 93 browser details YourSeq 70 1003 1102 3000 84.8% chr5 - 31960854 31960948 95 browser details YourSeq 70 1003 1102 3000 83.2% chr13 - 73156148 73156242 95 browser details YourSeq 70 1003 1102 3000 82.5% chr10 - 128185213 128185307 95 browser details YourSeq 70 1009 1121 3000 79.2% chr8 + 88235398 88235501 104 browser details YourSeq 70 1003 1513 3000 70.4% chr4 + 46441625 46441746 122 browser details YourSeq 68 1003 1161 3000 86.2% chr15 - 98461351 98461509 159 browser details YourSeq 68 1003 1102 3000 81.4% chr11 + 116044041 116044135 95 browser details YourSeq 67 1003 1102 3000 79.8% chr11 + 20126569 20126663 95 browser details YourSeq 66 1003 1097 3000 83.0% chr5 - 99244285 99244376 92 browser details YourSeq 66 1003 1097 3000 80.9% chr1 - 144968824 144968913 90 browser details YourSeq 66 1003 1097 3000 80.9% chr9 + 107067620 107067709 90 browser details YourSeq 65 1003 1102 3000 77.5% chrX - 117781577 117781670 94 Note: The 3000 bp section downstream of Exon 2 is BLAT searched against the genome. No significant similarity is found. Page 4 of 7 https://www.alphaknockout.com Gene and protein information: Sec23ip Sec23 interacting protein [ Mus musculus (house mouse) ] Gene ID: 207352, updated on 12-Aug-2019 Gene summary Official Symbol Sec23ip provided by MGI Official Full Name Sec23 interacting protein provided by MGI Primary source MGI:MGI:2450915 See related Ensembl:ENSMUSG00000055319 Gene type protein coding RefSeq status VALIDATED Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Also known as p125; D7Ertd373e Expression Ubiquitous expression in testis adult (RPKM 24.2), thymus adult (RPKM 11.5) and 28 other tissues See more Orthologs human all Genomic context Location: 7 F3; 7 70.51 cM See Sec23ip in Genome Data Viewer Exon count: 19 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) 7 NC_000073.6 (128744862..128784836) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) 7 NC_000073.5 (135888384..135928350) Chromosome 7 - NC_000073.6 Page 5 of 7 https://www.alphaknockout.com Transcript information: This gene has 4 transcripts Gene: Sec23ip ENSMUSG00000055319 Description Sec23 interacting protein [Source:MGI Symbol;Acc:MGI:2450915] Gene Synonyms D7Ertd373e, p125 Location Chromosome 7: 128,744,943-128,784,836 forward strand. GRCm38:CM001000.2 About this gene This gene has 4 transcripts (splice variants), 199 orthologues, 2 paralogues, is a member of 1 Ensembl protein family and is associated with 5 phenotypes. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Sec23ip- ENSMUST00000042942.9 4505 998aa ENSMUSP00000035610.8 Protein coding CCDS21900 G3X928 TSL:1 201 GENCODE basic APPRIS P1 Sec23ip- ENSMUST00000206986.1 399 56aa ENSMUSP00000145911.1 Protein coding - A0A0U1RPB3 CDS 3' 204 incomplete TSL:2 Sec23ip- ENSMUST00000205856.1 444 97aa ENSMUSP00000145816.1 Nonsense mediated - A0A0U1RP39 CDS 5' 202 decay incomplete TSL:3 Sec23ip- ENSMUST00000206504.1 4604 No - Retained intron - - TSL:NA 203 protein 59.89 kb Forward strand 128.74Mb 128.75Mb 128.76Mb 128.77Mb 128.78Mb 128.79Mb Genes (Comprehensive set... Sec23ip-201 >protein coding Sec23ip-203 >retained intron Sec23ip-202 >nonsense mediated decay Sec23ip-204 >protein coding Contigs < AC136741.24 Genes < Mcmbp-201protein coding< Gm44672-201lncRNA < n-R5s158-201rRNA (Comprehensive set... < Mcmbp-202protein coding Regulatory Build 128.74Mb 128.75Mb 128.76Mb 128.77Mb 128.78Mb 128.79Mb Reverse strand 59.89 kb Regulation Legend CTCF Enhancer Open Chromatin Promoter Promoter Flank Transcription Factor Binding Site Gene Legend Protein Coding Ensembl protein coding merged Ensembl/Havana Non-Protein Coding processed transcript RNA gene Page 6 of 7 https://www.alphaknockout.com Transcript: ENSMUST00000042942 39.89 kb Forward strand Sec23ip-201 >protein coding ENSMUSP00000035... MobiDB lite Low complexity (Seg) Coiled-coils (Ncoils) Superfamily Sterile alpha motif/pointed domain superfamily SMART DDHD domain Sterile alpha motif domain Pfam DDHD domain Sterile alpha motif domain PROSITE profiles DDHD domain PANTHER PTHR23509:SF4 PTHR23509 Gene3D Sterile alpha motif/pointed domain superfamily All sequence SNPs/i... Sequence variants (dbSNP and all other sources) Variant Legend missense variant splice region variant synonymous variant Scale bar 0 100 200 300 400 500 600 700 800 998 We wish to acknowledge the following valuable scientific information resources: Ensembl, MGI, NCBI, UCSC. Page 7 of 7.
Load more

Recommended publications
  • SEC23IP (NM 007190) Human Recombinant Protein – TP309056
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TP309056 SEC23IP (NM_007190) Human Recombinant Protein Product data: Product Type: Recombinant Proteins Description: Recombinant protein of human SEC23 interacting protein (SEC23IP) Species: Human Expression Host: HEK293T Tag: C-Myc/DDK Predicted MW: 110.9 kDa Concentration: >50 ug/mL as determined by microplate BCA method Purity: > 80% as determined by SDS-PAGE and Coomassie blue staining Buffer: 25 mM Tris.HCl, pH 7.3, 100 mM glycine, 10% glycerol Preparation: Recombinant protein was captured through anti-DDK affinity column followed by conventional chromatography steps. Storage: Store at -80°C. Stability: Stable for 12 months from the date of receipt of the product under proper storage and handling conditions. Avoid repeated freeze-thaw cycles. RefSeq: NP_009121 Locus ID: 11196 UniProt ID: Q9Y6Y8 RefSeq Size: 7306 Cytogenetics: 10q26.11-q26.12 RefSeq ORF: 3000 Synonyms: iPLA1beta; MSTP053; P125; P125A Summary: This gene encodes a member of the phosphatidic acid preferring-phospholipase A1 family. The encoded protein is localized to endoplasmic reticulum exit sites and plays a critical role in ER-Golgi transport as part of the multimeric coat protein II complex. An orthologous gene in frogs is required for normal neural crest cell development, suggesting that this gene may play a role in Waardenburg syndrome neural crest defects. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Feb 2011] This product is to be used for laboratory only.
    [Show full text]
  • Genetic Variant in 3' Untranslated Region of the Mouse Pycard Gene
    bioRxiv preprint doi: https://doi.org/10.1101/2021.03.26.437184; this version posted March 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 2 3 Title: 4 Genetic Variant in 3’ Untranslated Region of the Mouse Pycard Gene Regulates Inflammasome 5 Activity 6 Running Title: 7 3’UTR SNP in Pycard regulates inflammasome activity 8 Authors: 9 Brian Ritchey1*, Qimin Hai1*, Juying Han1, John Barnard2, Jonathan D. Smith1,3 10 1Department of Cardiovascular & Metabolic Sciences, Lerner Research Institute, Cleveland Clinic, 11 Cleveland, OH 44195 12 2Department of Quantitative Health Sciences, Lerner Research Institute, Cleveland Clinic, Cleveland, OH 13 44195 14 3Department of Molecular Medicine, Cleveland Clinic Lerner College of Medicine of Case Western 15 Reserve University, Cleveland, OH 44195 16 *, These authors contributed equally to this study. 17 Address correspondence to Jonathan D. Smith: email [email protected]; ORCID ID 0000-0002-0415-386X; 18 mailing address: Cleveland Clinic, Box NC-10, 9500 Euclid Avenue, Cleveland, OH 44195, USA. 19 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.03.26.437184; this version posted March 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 20 Abstract 21 Quantitative trait locus mapping for interleukin-1 release after inflammasome priming and activation 22 was performed on bone marrow-derived macrophages (BMDM) from an AKRxDBA/2 strain intercross.
    [Show full text]
  • TITLE PAGE Oxidative Stress and Response to Thymidylate Synthase
    Downloaded from molpharm.aspetjournals.org at ASPET Journals on October 2, 2021 -Targeted -Targeted 1 , University of of , University SC K.W.B., South Columbia, (U.O., Carolina, This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted. The final version may differ from this version. This article has not been copyedited and formatted.
    [Show full text]
  • SEC23IP (NM 007190) Human Tagged ORF Clone – RG209056
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG209056 SEC23IP (NM_007190) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: SEC23IP (NM_007190) Human Tagged ORF Clone Tag: TurboGFP Symbol: SEC23IP Synonyms: iPLA1beta; MSTP053; P125; P125A Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 SEC23IP (NM_007190) Human Tagged ORF Clone – RG209056 ORF Nucleotide >RG209056 representing NM_007190 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCGAGAGAAAACCTAACGGTGGCAGCGGCGGCGCCTCCACTTCCTCATCGGGCACTAACTTACTTT TCTCCTCCTCGGCCACGGAGTTCAGCTTCAATGTGCCCTTCATCCCAGTCACCCAGGCCTCCGCTTCTCC GGCCTCCCTGCTCTTACCGGGAGAGGATTCCACAGATGTTGGTGAGGAGGACAGCTTCCTTGGTCAGACT TCTATTCACACATCTGCCCCACAGACATTTAGTTACTTCTCTCAGGTATCAAGCAGCAGTGATCCTTTTG GGAATATTGGACAGTCACCATTAACAACTGCAGCAACCTCAGTTGGACAATCAGGATTCCCCAAGCCCCT GACTGCTCTCCCTTTTACAACTGGATCCCAAGATGTCTCGAATGCATTTTCACCATCCATTTCGAAGGCT CAACCTGGTGCTCCACCTTCCTCACTGATGGGAATAAATTCTTATCTGCCTTCTCAGCCAAGTAGTCTCC CTCCTTCATATTTTGGGAACCAACCCCAAGGAATTCCCCAACCAGGATACAATCCATATCGCCATACCCC TGGCAGCAGCAGGGCTAATCCTTACATTGCACCACCCCAGCTGCAGCAGTGCCAAACACCAGGCCCTCCT
    [Show full text]
  • Supplementary Table 1
    Supplementary Table 1. 492 genes are unique to 0 h post-heat timepoint. The name, p-value, fold change, location and family of each gene are indicated. Genes were filtered for an absolute value log2 ration 1.5 and a significance value of p ≤ 0.05. Symbol p-value Log Gene Name Location Family Ratio ABCA13 1.87E-02 3.292 ATP-binding cassette, sub-family unknown transporter A (ABC1), member 13 ABCB1 1.93E-02 −1.819 ATP-binding cassette, sub-family Plasma transporter B (MDR/TAP), member 1 Membrane ABCC3 2.83E-02 2.016 ATP-binding cassette, sub-family Plasma transporter C (CFTR/MRP), member 3 Membrane ABHD6 7.79E-03 −2.717 abhydrolase domain containing 6 Cytoplasm enzyme ACAT1 4.10E-02 3.009 acetyl-CoA acetyltransferase 1 Cytoplasm enzyme ACBD4 2.66E-03 1.722 acyl-CoA binding domain unknown other containing 4 ACSL5 1.86E-02 −2.876 acyl-CoA synthetase long-chain Cytoplasm enzyme family member 5 ADAM23 3.33E-02 −3.008 ADAM metallopeptidase domain Plasma peptidase 23 Membrane ADAM29 5.58E-03 3.463 ADAM metallopeptidase domain Plasma peptidase 29 Membrane ADAMTS17 2.67E-04 3.051 ADAM metallopeptidase with Extracellular other thrombospondin type 1 motif, 17 Space ADCYAP1R1 1.20E-02 1.848 adenylate cyclase activating Plasma G-protein polypeptide 1 (pituitary) receptor Membrane coupled type I receptor ADH6 (includes 4.02E-02 −1.845 alcohol dehydrogenase 6 (class Cytoplasm enzyme EG:130) V) AHSA2 1.54E-04 −1.6 AHA1, activator of heat shock unknown other 90kDa protein ATPase homolog 2 (yeast) AK5 3.32E-02 1.658 adenylate kinase 5 Cytoplasm kinase AK7
    [Show full text]
  • SCAP/SREBP Pathway Is Required for the Full Steroidogenic Response To
    SCAP/SREBP pathway is required for the full PNAS PLUS steroidogenic response to cyclic AMP Masami Shimizu-Alberginea,b,c, Brian Van Yserloob,c, Martin G. Golkowskia, Shao-En Onga, Joseph A. Beavoa,1,2, and Karin E. Bornfeldtb,c,d,1,2 aSchool of Medicine, Department of Pharmacology, University of Washington, Seattle, WA 98195; bSchool of Medicine, Department of Medicine, Division of Metabolism, Endocrinology and Nutrition, University of Washington, Seattle, WA 98109; cUniversity of Washington Diabetes Institute, School of Medicine, University of Washington, Seattle, WA 98109; and dSchool of Medicine, Department of Pathology, University of Washington Diabetes Institute, University of Washington, Seattle, WA 98109 Contributed by Joseph A. Beavo, July 19, 2016 (sent for review May 14, 2016; reviewed by Marco Conti, Donald Maurice, and Timothy Osborne) Luteinizing hormone (LH) stimulates steroidogenesis largely through Cellular cholesterol levels are controlled in part by several a surge in cyclic AMP (cAMP). Steroidogenic rates are also critically transcription factors, including sterol-regulatory element-binding dependent on the availability of cholesterol at mitochondrial sites of proteins (SREBPs) 2 and 1a, that promote cholesterol bio- synthesis. This cholesterol is provided by cellular uptake of lipoproteins, synthetic gene expression when cellular cholesterol levels are too mobilization of intracellular lipid, and de novo synthesis. Whether low to meet demand (9, 10). The activities of the SREBPs are and how these pathways are coordinated by cAMP are poorly un- precisely controlled by an escort protein, SREBP cleavage-acti- derstood. Recent phosphoproteomic analyses of cAMP-dependent vating protein (SCAP), and the insulin-inducible gene product phosphorylation sites in MA10 Leydig cells suggested that cAMP (Insig) (11–13).
    [Show full text]
  • ID AKI Vs Control Fold Change P Value Symbol Entrez Gene Name *In
    ID AKI vs control P value Symbol Entrez Gene Name *In case of multiple probesets per gene, one with the highest fold change was selected. Fold Change 208083_s_at 7.88 0.000932 ITGB6 integrin, beta 6 202376_at 6.12 0.000518 SERPINA3 serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 1553575_at 5.62 0.0033 MT-ND6 NADH dehydrogenase, subunit 6 (complex I) 212768_s_at 5.50 0.000896 OLFM4 olfactomedin 4 206157_at 5.26 0.00177 PTX3 pentraxin 3, long 212531_at 4.26 0.00405 LCN2 lipocalin 2 215646_s_at 4.13 0.00408 VCAN versican 202018_s_at 4.12 0.0318 LTF lactotransferrin 203021_at 4.05 0.0129 SLPI secretory leukocyte peptidase inhibitor 222486_s_at 4.03 0.000329 ADAMTS1 ADAM metallopeptidase with thrombospondin type 1 motif, 1 1552439_s_at 3.82 0.000714 MEGF11 multiple EGF-like-domains 11 210602_s_at 3.74 0.000408 CDH6 cadherin 6, type 2, K-cadherin (fetal kidney) 229947_at 3.62 0.00843 PI15 peptidase inhibitor 15 204006_s_at 3.39 0.00241 FCGR3A Fc fragment of IgG, low affinity IIIa, receptor (CD16a) 202238_s_at 3.29 0.00492 NNMT nicotinamide N-methyltransferase 202917_s_at 3.20 0.00369 S100A8 S100 calcium binding protein A8 215223_s_at 3.17 0.000516 SOD2 superoxide dismutase 2, mitochondrial 204627_s_at 3.04 0.00619 ITGB3 integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) 223217_s_at 2.99 0.00397 NFKBIZ nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta 231067_s_at 2.97 0.00681 AKAP12 A kinase (PRKA) anchor protein 12 224917_at 2.94 0.00256 VMP1/ mir-21likely ortholog
    [Show full text]
  • UNIVERSITY of CALIFORNIA Los Angeles a Sterile Alpha Motif
    UNIVERSITY OF CALIFORNIA Los Angeles A Sterile Alpha Motif Domain Network Involved in Kidney Development A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Biochemistry and Molecular Biology by Catherine Nicole Leettola 2015 ABSTRACT OF THE DISSERTATION A Sterile Alpha Motif Domain Network Involved in Kidney Development by Catherine Nicole Leettola Doctor of Philosophy in Biochemistry and Molecular Biology University of California, Los Angeles, 2015 Professor James U. Bowie, Chair Cystic kidney diseases including polycystic kidney disease (PKD) and nephronophthisis (NPHP) are the most common genetic disorders leading to end-stage renal failure in humans. Animal models and human cases of PKD and NPHP have implicated the sterile alpha motif (SAM) domain containing proteins bicaudal C homolog 1 (BICC1) and ankyrin repeat and SAM- domain containing protein 6 (ANKS6) as being involved in these conditions and important for renal development. SAM domains are known protein-protein interaction domains that are capable of binding each other to form polymers and heterodimers. Using a negGFP native gel assay, we have identified the SAM domain of the previously uncharacterized protein ankyrin repeat and SAM-domain containing protein 3 (ANKS3) as a direct binding partner of the BICC1 and ANKS6 SAM domains. We found the ANKS3 SAM domain to polymerize with moderate affinity and determined the ANKS6 SAM domain can bind to a single end of this polymer. Crystal structures of the ANKS3 SAM domain polymer and the ANKS3 SAM-ANKS6 SAM ii heterodimer are presented to reveal typical ML-EH SAM domain interaction interfaces with a pronounced charge complementarity.
    [Show full text]
  • Diagnostic Yield and Novel Candidate Genes by Exome Sequencing in 152 Consanguineous Families with Neurodevelopmental Disorders
    Research JAMA Psychiatry | Original Investigation Diagnostic Yield and Novel Candidate Genes by Exome Sequencing in 152 Consanguineous Families With Neurodevelopmental Disorders Miriam S. Reuter, MD; Hasan Tawamie, MA; Rebecca Buchert, MA; Ola Hosny Gebril, MD; Tawfiq Froukh, PhD; Christian Thiel, MD; Steffen Uebe, PhD; Arif B. Ekici, PhD; Mandy Krumbiegel, PhD; Christiane Zweier, MD; Juliane Hoyer, MD; Karolin Eberlein, MD; Judith Bauer, MD; Ute Scheller, MD; Tim M. Strom, MD; Sabine Hoffjan, MD; Ehab R. Abdelraouf, MD; Nagwa A. Meguid, MD, PhD; Ahmad Abboud, MD; Mohammed Ayman Al Khateeb, MD; Mahmoud Fakher, MD; Saber Hamdan, MD; Amina Ismael, MD; Safia Muhammad, MD; Ebtessam Abdallah, MD, PhD; Heinrich Sticht, PhD; Dagmar Wieczorek, MD; André Reis, MD; Rami Abou Jamra, MD Supplemental content IMPORTANCE Autosomal recessive inherited neurodevelopmental disorders are highly heterogeneous, and many, possibly most, of the disease genes are still unknown. OBJECTIVES To promote the identification of disease genes through confirmation of previously described genes and presentation of novel candidates and provide an overview of the diagnostic yield of exome sequencing in consanguineous families. DESIGN, SETTING, AND PARTICIPANTS Autozygosity mapping in families and exome sequencing of index patients were performed in 152 consanguineous families (the parents descended from a same ancestor) with at least 1 offspring with intellectual disability (ID). The study was conducted from July 1, 2008, to June 30, 2015, and data analysis was conducted from July 1, 2015, to August 31, 2016. RESULTS Of the 152 consanguineous families enrolled, 1 child (in 45 families [29.6%]) or multiple children (107 families [70.4%]) had ID; additional features were present in 140 of the families (92.1%).
    [Show full text]
  • Renoprotective Effect of Combined Inhibition of Angiotensin-Converting Enzyme and Histone Deacetylase
    BASIC RESEARCH www.jasn.org Renoprotective Effect of Combined Inhibition of Angiotensin-Converting Enzyme and Histone Deacetylase † ‡ Yifei Zhong,* Edward Y. Chen, § Ruijie Liu,*¶ Peter Y. Chuang,* Sandeep K. Mallipattu,* ‡ ‡ † | ‡ Christopher M. Tan, § Neil R. Clark, § Yueyi Deng, Paul E. Klotman, Avi Ma’ayan, § and ‡ John Cijiang He* ¶ *Department of Medicine, Mount Sinai School of Medicine, New York, New York; †Department of Nephrology, Longhua Hospital, Shanghai University of Traditional Chinese Medicine, Shanghai, China; ‡Department of Pharmacology and Systems Therapeutics and §Systems Biology Center New York, Mount Sinai School of Medicine, New York, New York; |Baylor College of Medicine, Houston, Texas; and ¶Renal Section, James J. Peters Veterans Affairs Medical Center, New York, New York ABSTRACT The Connectivity Map database contains microarray signatures of gene expression derived from approximately 6000 experiments that examined the effects of approximately 1300 single drugs on several human cancer cell lines. We used these data to prioritize pairs of drugs expected to reverse the changes in gene expression observed in the kidneys of a mouse model of HIV-associated nephropathy (Tg26 mice). We predicted that the combination of an angiotensin-converting enzyme (ACE) inhibitor and a histone deacetylase inhibitor would maximally reverse the disease-associated expression of genes in the kidneys of these mice. Testing the combination of these inhibitors in Tg26 mice revealed an additive renoprotective effect, as suggested by reduction of proteinuria, improvement of renal function, and attenuation of kidney injury. Furthermore, we observed the predicted treatment-associated changes in the expression of selected genes and pathway components. In summary, these data suggest that the combination of an ACE inhibitor and a histone deacetylase inhibitor could have therapeutic potential for various kidney diseases.
    [Show full text]
  • Diagnosis of Metastatic Melanoma and Monitoring
    (19) TZZ ZZ_Z_T (11) EP 2 080 140 B1 (12) EUROPEAN PATENT SPECIFICATION (45) Date of publication and mention (51) Int Cl.: of the grant of the patent: G06F 19/00 (2011.01) 24.04.2013 Bulletin 2013/17 (86) International application number: (21) Application number: 07871360.9 PCT/US2007/083555 (22) Date of filing: 03.11.2007 (87) International publication number: WO 2008/100352 (21.08.2008 Gazette 2008/34) (54) DIAGNOSIS OF METASTATIC MELANOMA AND MONITORING INDICATORS OF IMMUNOSUPPRESSION THROUGH BLOOD LEUKOCYTE MICROARRAY ANALYSIS DIAGNOSE VON METASTASIERENDEM MELANOM UND ÜBERWACHUNG VON IMMUNSUPPRESSIONSINDIKATOREN MITTTELS LEUKOZYTEN-MIKROARRAY DIAGNOSTIC DE MELANOME METASTATIQUE ET SURVEILLANCE D’INDICATEURS D’IMMUNOSUPPRESSION PAR ANALYSE DE MICRORESEAUX DE LEUCOCYTES SANGUINS (84) Designated Contracting States: • PAVEY SANDRA ET AL: "Microarray expression AT BE BG CH CY CZ DE DK EE ES FI FR GB GR profiling in melanoma reveals a BRAF mutation HU IE IS IT LI LT LU LV MC MT NL PL PT RO SE signature", ONCOGENE, vol. 23, no. 23, 20 May SI SK TR 2004 (2004-05-20), pages 4060-4067, XP002644753, ISSN: 0950-9232 (30) Priority: 03.11.2006 US 856406 P • ZHOU YOUWEN ET AL: "Osteopontin expression correlates with melanoma invasion", JOURNAL (43) Date of publication of application: OF INVESTIGATIVE DERMATOLOGY, vol. 124, 22.07.2009 Bulletin 2009/30 no. 5, May 2005 (2005-05), pages 1044-1052, XP002644754, ISSN: 0022-202X (60) Divisional application: • BITTNER M ET AL: "MOLECULAR 12152482.1 / 2 506 172 CLASSIFICATION OF CUTANEOUS MALIGNANT 12196231.0 / 2 579 174 MELANOMA BY GENE EXPRESSION 12196232.8 / 2 570 951 PROFILING", NATURE, NATURE PUBLISHING GROUP, LONDON, GB, vol.
    [Show full text]
  • Gene Identification in Hereditary Spastic Paraplegias and Characterization of Spastic Paraplegia Type 58 (SPG58)
    Gene identification in Hereditary Spastic Paraplegias and characterization of spastic paraplegia type 58 (SPG58) Dissertation zur Erlangung des Grades eines Doktors der Naturwissenschaften der Mathematisch-Naturwissenschaftlichen Fakultät und der Medizinischen Fakultät der Eberhard-Karls-Universität Tübingen vorgelegt von Andrés Caballero García de Oteyza aus Madrid, Spanien Oktober - 2016 Tag der mündlichen Prüfung: 14 Oktober 2016 Dekan der Math.-Nat. Fakultät: Prof. Dr. W. Rosenstiel Dekan der Medizinischen Fakultät: Prof. Dr. I. B. Autenrieth 1. Berichterstatter: Prof. Dr. Ludger Schöls 2. Berichterstatter: Prof. Dr. Doron Rapaport Prüfungskommission: Prof. Dr. Peter Heutink Prof. Dr. Thomas Gasser Prof. Dr. Ludger Schöls Dr. Michela Deleidi 2 I hereby declare that I have produced the work entitled: “Gene Identification in Hereditary Spastic Paraplegias and Characterization of spastic paraplegia type 58 (SPG58)”, submitted for the award of a doctorate, on my own (without external help), have used only the sources and aids indicated and have marked passages included from other works, whether verbatim or in content, as such. I swear upon oath that these statements are true and that I have not concealed anything. I am aware that making a false declaration under oath is punishable by a term of imprisonment of up to three years or by a fine. Tübingen, October 21st 2016 Andrés Caballero García de Oteyza Date Signature 3 Acknowledgements I would like to start thanking Dr. Rebecca Schüle for having given me the opportunity to start such an exciting project together. I also thank her because she believed in me even though I had little experience when I started. She has guided and taught me patiently as much as I have asked for.
    [Show full text]