Pufc Gene Targeted PCR Primers for Identification and Classification of Marine Photosynthetic Bacterium Rhodovulum Sulfidophilum

Acta Scientific MICROBIOLOGY (ISSN: 2581-3226) Volume 4 Issue 2 February 2021

Research Article pufC Rhodovulum sulfidophilum Gene Targeted PCR Primers for Identification and Classification of Marine Photosynthetic Bacterium Aoi Koga, Nao Yamauchi, Mayu Imamura, Mina Urata, Tomomi Received: Kurayama, Ranko Iwai, Shuhei Hayashi, Shinjiro Yamamoto and January 28, 2021 Hitoshi Miyasaka* Published: December 30, 2020 © All rights are reserved by Hitoshi Department of Applied Life Science, Sojo University, Nishiku, Japan Miyasaka., et al. *Corresponding Author: Sojo University, Nishiku, Japan. Hitoshi Miyasaka, Department of Applied Life Science, DOI:

10.31080/ASMI.2020.04.0770

Abstract Rhodovulum sulfidophilum - The marine non-sulfur purple photosynthetic bacterium has a wide application potential in the fields sify various R. sulfidophilum strains, we designed a PCR primer set targeting pufC of aquaculture, renewable energy production, environmental protection, and biomaterial production. To detect, identify and clas pufC R. sulfidophilum gene encoding one of the photosystem proteins. - Nucleotide sequence alignment of the genes from five strains revealed that the 3’ region of this gene is rich in ious R. sulfidophilum pufC gene. For the validation of this nucleotide substitutions (approximately 10 substitutions/100 bp), making it suitable for the identification and classification of var R. sulfidophilum strains. strains. We designed a primer set that amplified 0.7 kb of the 3’ region of primerKeywords: set, we used fish fecal DNA as Rhodovulumthe PCR templates, sulfidophilum and successfully identified and classified several

Photosynthetic Bacteria; ; PCR; Fish Fecal DNA

Introduction R. sulfidophilum Rho- Marsupenaeus japonicus classified several strains from the intestinal tracts dovulum sulfidophilum The marine non-sulfur purple photosynthetic bacterium of some fish and kuruma shrimps ( ). [1,2], bioremediation Materials and Methods has a wide variety of application potential, , wastewater treatment [4], nitrogenase-mediated Bacterial strains such as in probiotics for marine aquaculture [5,6] - pufM-pufC region of mercury [3] , RNA-drug [8] and spider silk [9], of R. sulfidophilum hydrogen production , and production of biomaterials, includ For the nucleotide sequence alignment of the and biosensors [10] R. sulfidophilum ing biodegradable plastics [7] , sequence data from our three original isolates, R. sulfidophilum strains may be a useful . The PCR-based method for the detection and and 2 sequence data of strains MB263 (accession classification of various number CP020384) and DSM 1374 (accession number CP015418) primers targeting pufC - tool in many fields of applications. In this study, we designed PCR fromOur the original public databaseisolates, were used.R. sulfidophilum OKHT16, KKMI01, R. sulfidophilum that encodes one of the photosynthetic cy and KHHN01 strains. OKHT16 was isolated from strains from environmental samples. R. sulfidophilum tochrome proteins to detect and classify various [11], and R. sulfidophilum KKMI01 and KHHN01 were isolated from the seashore area Osaka Bay, Japan as described previously To validate this primer set, we used fecal DNA from some fish and shrimps as the PCR templates, and successfully detected and

Citation: Hitoshi Miyasaka., et al. “pufC Rhodovulum sulfidophilum". Acta Scientific Microbiology Gene Targeted PCR Primers for Identification and Classification of Marine Photosynthetic Bacterium 4.2 (2021): 69-75. pufC Gene Targeted PCR Primers for Identification and Classification of Marine Photosynthetic Bacterium Rhodovulum sulfidophilum

- 70 - R. sulfidophilum of Amakusa, Kumamoto, Japan. The GenBank/EMBL/DDBJ acces by agarose gel electrophoresis, and DNA sequencing were per sion numbers for the 16S rRNA gene sequences of formed as described in section 2.2. pufC frag- OKHT16, KKMI01 and KHHN01 are LC037397, LC596063 and LC596064, respectively. The GenBank/EMBL/DDBJ accession numbers for the PCR amplification of the pufM-pufC region of R. sulfidophilum ments obtained by PCR amplification from fecal DNA are shown in strains the figure legend of figure 3. Phylogenetic analysis pufM-pufC regions of R. sulfidophilum - PCR amplification of the [12] using its default setting. strains was performed by using genomic DNA as the templates. The Phylogenetic analysis was performed on the Phylogeny.fr plat - - PCR primers used were pufM588F (5’- TACTACAACCCGTTCCACGC form (http://www.phylogeny.fr) ture of the pufM-pufC -3’) and pufC1031R (5’- CATGTCATGGCCGTTCAG -3’). The struc Branch support in the maximum likelihood (ML) tree was estimat region and the location of the primers are edResults with 100 bootstrap replicates. shown in Fig. 1. KOD-Plus DNA Polymerase (Toyobo Life Science, PCR primer design for the amplification of a part of pufC gene Osaka, Japan) was used for PCR, and the reaction was carried out of R. sulfidophilum on a Biometra TOne 96 thermal cycler (Analytik Jena GmbH, Jena, R. sulfidophilum, we designed Germany) under the following conditions: pre-denaturation at 94 pufC To detect, identify and classify °C (2 min), denaturation at 94 °C (30 s), annealing at 62 °C (30 s), a PCR primer set for the amplification of a part of encoding and extension at 68 °C (40 s) for 30 cycles, followed by one cycle of pufM-pufC gene fragments one of the cytochrome proteins involved in electron transfer to the final extension at 68 °C (10 min). PCR products were separated by pufL-pufM region of the puf photosynthetic reaction center [13]. For the identification of PSB 1% agarose gel electrophoresis, and the has been used [14,15] pufL-pufM from non-purified cultures, the cluster were purified. DNA sequence analyses were performed using a , because nucleotide sequences of commercial DNA sequence analysis service (Eurofins Genomics identify R. sulfidophilum strains, pufC - for the pufM-pufC gene fragments of R. sulfidophilum OKHT16, are well conserved among various PSB. In this study, to detect and Inc., Tokyo, Japan). The GenBank/EMBL/DDBJ accession numbers puf R. sulfidophi- gene was selected as the tar lum the get, because of its unique location in the cluster in KKMI01 and KHHN01 are LC596067, LC596065 and LC596066, - compared to other genera of photosynthetic bacteria, and respectively. teria . Shrimp and fish samples absence of this gene in several closely related photosynthetic bac M. japonicus [13] pufM-pufC from Live kuruma shrimps ( ) for laboratory experiments our three original isolates, we designed a primer set. To design First, to obtain the nucleotide sequence data of were provided by the shrimp pond of Takusui Co. Ltd. located in the forward primer in the pufM Imari, Saga, Japan. Wild-caught kuruma shrimps from Oita Bay of pufM genes from seven Rhodovulum sp., namely R. sulfidophilum Etrumeus teres - region, the nucleotide sequences and Seto Inland Sea, Japan, were purchased by online. Wild-caught R. sulfidophilum R. kholense Konosirus punctatus Pseudo- ocean fish such as round herring ( ), konoshiro giz R. visakhapatnamense type strain pleuronectes herzensteini Cyp- (AB020784), DSM 2351 (AP014800), zard shad ( ), and righteye flounder ( R. sp. R. euryhali- rinus carpio Salvelinus leucomaenis Misgurnus type strain JA297T (FM208076), ) and freshwater fish such as carp ( num R. marinum anguillicaudatus JA181T (AM944097), MTCH3IM048 (FN984739), ), iwana ( ) and loach ( (AF486825), and type strain JA128T (AM944096) ) were purchased from local markets or online. - Isolation of fecal DNA from shrimps and fish, and PCR amplifi- were aligned using CLUSTAL W (1.83) multiple sequence alignment - cation of the 3’ region of pufC program. The forward primer pufM588F (5’- TACTACAACCCGTTC ment. To design the reverse primer in the pufC - CACGC -3’) was designed in the well-conserved region in the align Rhodovulum sp., namely R. sulfidophilum region, the nucleo Isolation of fecal DNA was performed using the ISOFECAL kit R. sulfidophilum Rhodovulum tide sequences of three (Nippon Gene, Tokyo, Japan). PCR amplification, DNA purification (AB020784), DSM 2351 (AP014800),

sp. sulfidophilum from both R. sulfidophilum-fed shrimps and non-fed71 R. sul- OG-KC1M (AB088691) were aligned using CLUSTAL W (2.1) pufC gene, and designed the fidophilum multiple sequence alignment program. Based on these alignments, (control) shrimps (data not shown). This result suggests that pufC from we found several conserved regions in may commonly inhabit in the intestinal tract of kuruma reverse primer pufC1031R (5’- CATGTCATGGCCGTTCAG -3’). The shrimps. Based on this finding, we next tried to amplify will be provided on request. R. alignment data for the design of pufM588F and pufC1031R primers the fecal DNA of wild-caught kuruma shrimps as well as from some sulfidophilum other wild-caught ocean fish. As expected, being a marine PSB, pufM-pufC from the three original - did not inhabit in the intestinal tracts of freshwater R. sulfidophilum E. teres The nucleotide sequences of fish, and the fecal DNA of some freshwater fish was used as a nega K. punctatus P. herzensteini isolates (strains OKHT16, KKMI01 and KHHN01), tive control. As for ocean fish, round herring ( ), konoshiro C. carpio S. leu- were determined by PCR amplification of the genes with pufM588F gizzard shad ( ), and righteye flounder ( ) comaenis M. anguillicaudatus and pufC1031R primers. pufC R. sulfidophilum strains were studied, and for freshwater fish, carp ( ), iwana ( OKHT16, KKMI01 and KHHN01, and two R. sulfidophilum strains ) and loach ( ) were examined. Next we aligned the sequences of

- in the database to design the primers (The alignment data will be R. sulfidophilum strains, we determined the region provided on request). To attain a higher resolution for the classifi of pufC cation of various - gene with many nucleotide substitutions. Fig. 1 shows the R. sulfidophilum strains. numbers of nucleotide substitution positions (substitution posi - tions/50 bp) found in the alignment of five R. sul- We found that the 3’ region of this gene is rich in nucleotide sub fidophilum stitutions, and is suitable for the classification of different pufC, and two of these strains. Additionally, we found several well-conserved - (less number of substitutions) regions in regions were found to contain heme-binding sites (indicated by ar - rows in Fig. 1). Based on these findings, we designed the forward Figure 1: pufM - pufC substitution positions in pufM - pufC Rhodovulum primer pufC336F (5’-AACTTCGACCAGCTCACCAA -3’) in the con Structure of , and numbers of nucleotide of R. sulfidophilum - sulfidophilum strains. served region as shown in Fig. 1. PCR amplification of genomic DNA among five pufC with pufC336F and pufC1031R primers gener pufM - pufC region of R. sulfidoph- R. sulfidophilum strains, making it ated 690 bp of the 3’ region of . The targeted region is rich in ilum R. sulfi- The nucleotide sequences of the nucleotide substitutions among R. sulfidophilum dophilum strains. DSM 2351 (AP014800) and DSM 1374 (CP015418) in the suitable for the identification and classification of various database, and those from our original isolates ( Validation of the primer set OKHT16, KKMI01, and KHHN01) were aligned using ClustalW, and the numbers of nucleotide substitution positions per 50 bp region of pufC were counted. The arrows show the positions of the primers. The For the validation of the primer set, we amplified the target R. sulfidophilum - heme-binding sites of PufC are indicated by vertical arrows. by using fecal DNA from shrimps and fish as PCR [1,2]. Initially, we maintained templates, because is one of the promising candi M. japonicus dates for probiotics in aquaculture R. sul- pufC genes from all the kuruma shrimps ( ) from a commercial shrimp pond Figure 2 shows the results of agarose gel electrophoresis of the fidophilum R. sulfidophilum from in laboratory aquaria, and fed them with a diet containing PCR products. We successfully amplified R. pufC C. carpio as probiotics, and tried to detect fecal DNA samples of wild-caught kuruma shrimps and ocean fish. their fecal DNA. As a result, however, we unexpectedly detected For freshwater fish, was not amplified from carp ( ),

S. leucomaenis 72 M. anguillicaudatus - but was unexpectedly amplified from iwana ( ) and - loach ( ). In addition, we performed PCR ampli Hemibarbus barbus fication of DNA from two freshwater fish belonging to the Cyprini Carassius cuvieri pufC dae family, barbel steed ( ) and Japanese crucian carp ( ), and was not amplified from the fecal DNA of these fish (data not shown).

Figure 3: -

Phylogenetic tree constructed by the maximum likeli fragments of pufC hood (ML) method based on the nucleotide sequences of PCR genes obtained from the fecal DNA of wild-caught fish and shrimps. pufC gene - The GenBank/EMBL/DDBJ accession numbers for fragments are LC596358 (Round herring), LC596359 (Ko noshiro), LC596360 (Loach), LC596361 (Shrimp -1), LC596362 Figure 2: pufC pufC genes (Shrimp -3), LC596363 (Shrimp -2), and LC596364 (Iwana). gene. of R. sulfidophilum - Agarose gel electrophoresis of PCR fragments of The GenBank/EMBL/DDBJ accession numbers for strains are CP015418 (DSM 1374 type cul from Rhodovulum The fecal DNA form six wild-caught kuruma shrimps (three ture), AP014800 (DSM 2351), LC596067 (OKHT16), LC596065 iodosum Seto Inland Sea and three from Oita Bay), three ocean fish (KKMI01) and LC596066 (KHHN01), and that for

(round herring, konoshiro gizzard shad, and righteye flounder), (out group) is AB088689. and three freshwater fish (carp, iwana and loach) were amplified using PCR with the primer set of pufC336F and pufC1031R. The Discussion 690 bp PCR fragments are indicated by a white box. R. sulfidophilum, has a The marine photosynthetic bacterium, R. high potential for practical applications in various fields. In this pufC R. sulfidophi- sulfidophilum - Figure 3 shows the phylogenic tree drawn with the nucleotide study, a PCR primer set to detect, identify and classify various lum strains. ment of pufC R. sulfidophilum strains revealed the substitu- sequences of PCR-amplified fragments of of five strains was designed. The nucleotide sequence align good resolution, and most R. sulfidophilum - All the PCR-amplified fragments were separated at a of five R. sulfidophi- strains detected from tion-rich part in the 3’ region of this gene, and a primer set target lum - R. sulfidophilum, from samples fish and shrimp fecal DNA were in the same group as ing this region was designed. This primer set can be used for the pufC R. sulfidophilum R. KKMI01 and KHHN01 strains. The GenBank/EMBL/DDBJ ac identification and classification of sulfidophilum cession numbers for fragments amplified from the fecal DNA of i) pure cultures, ii) non-purified cultures of from fish and shrimps are shown in the figure legend of figure 3. , and iii) environmental samples, such as fecal DNA.

pufC S. leucomaenis M. anguillicaudatus 73 of R. sulfidophilum in Cyprinidae C. carpio As a validation of this primer set, we successfully amplified ( ) and loach ( ), and the absence H. barbus C. cuvieri from the fecal DNA of some fish and kuruma shrimps, and classified fish, carp ( ), barbel steed shown in the present study are still at a preliminary stage, and the nucleotide sequences of PCR fragments, as shown in Fig. 3. In ( ) and Japanese crucian carp ( ). The results R. sulfidophilum - R. addition, in the process of validation, we obtained some interesting sulfidophilum findings. First, our results suggest that can com more detailed studies are required to clarify the distribution of - monly inhabit in the intestinal tract of some ocean fish and shrimps. in the intestinal tracts of freshwater fish. - Conclusion We did not expect this result, but recent metagenomic studies indi Rho- cated that a relatively large population of PSB was present in the in Rhodovulum sulfidophilum Alphapro- dovulum sulfidophilum testinal tract of some aquatic animals [16,17], consistent with our The marine non-sulfur purple photosynthetic bacterium teobacteria, order Rhodobacterales, and family Rhodobacteraceae. - findings. belongs to the class has a wide potential in biotechnological ing pufC Litopenaeus van- applications. In this study, we designed a PCR primer set target namei, Rhodobacter Rhodobacteracea R. sulfidophilum strains. For the valida- In the intestinal tracts of pacific white shrimps, gene encoding one of the photosystem proteins to detect, (a PSB belonging to family) identify and classify various [18], R. sulfidophilum populates in healthy shrimps, and when the shrimps are affected tion of this primer set, we used fish fecal DNA as the PCR templates, suggesting that Rhodobacter - by white feces syndrome, its population was much decreases and successfully identified and classified several et al. [19] R. sulfidophilum R. sulfidophi- has some beneficial effects on the strains. This primer set can be used for the identification and clas of Rhodobacterales - lum R. sulfidophilum health of shrimps. Yamazaki., reported that the presence sification of , from samples of i) pure Apostichopus japonicus, in the intestinal tracts was related to the en cultures, ii) non-purified cultures of , and iii) - hancement of the growth of sea cucumber, environmentalAcknowledgements samples, such as fecal DNA. Rhodobacterales suggesting that the polyhydroxybutyrate (PHB) produced by bacte growth [20] - We would like to thank Takusui Co. Ltd., Fukuoka, Japan, for pro- rial cells of might have some beneficial effects on [21] viding kuruma shrimps from their shrimp ponds. . PHB is a biopolymer produced by some types of bacte ria as a storage compound , and the beneficial effects of PHB as . Rhodovulum sulfidophilum feed additives for fish and shrimps have also been well investigated language editing. - We would like to thank Editage (www.editage.com) for English [22,23] is a PHB-producing bacterium tiane., et al. reported that Rhodovulum [7], and may have some beneficial effects on fish and shrimps. Cris Conflict of Interest - was a relevant constituent of - the sponge-associated microbiome, and its versatile metabolic ac [24]. The results of The authors declare that there are no conflicts of interest re tivities involved in carbon, nitrogen, and sulfate metabolism might gardingBibliography the publication of this article. have various beneficial effects on host sponges Rhodovulum 1. Loo PL., et al. “Rhodovulum sulfidophilum - the present study and previous metagenomic studies suggest that in the intestinal tracts of aquatic animals has some , A Phototrophic Bac R. sulfidophilum beneficial effects on the host, and is a good candidate for probiotics terium, Grown in Palm Oil Mill Effluent Improves the Larval R. sulfidophilum Aquaculture Research in aquaculture. Among the strains shown in figure Survival of Marble Goby Oxyeleotris Marmorata (Bleeker)”. R. sulfidophilum 3, KHHN01 and KKMI01 are closely related to the 2. et al 44.3 (2013): 495-507. from the fish and shrimps. Thus these two strains Rho- R. sulfidophilum KKMI01 on kuruma shrimps Chang BV., . “Investigation of a Farm-Scale Multitrophic may be promising candidates as probiotics in aquaculture. The dovulum sulfidophilum Chanos chanos Recirculating Aquaculture System with the Addition of probiotic effects of Sustainability (Switzerland) ponds. for Milkfish ( ) Coastal are being examined in our laboratory and also in outdoor shrimp MukkataAquaculture”. K., et al 11.7 (2019). R. sulfidophi- Saudi Journal of lum 3. . “Diversity of Purple Nonsulfur Bacteria in Another interesting finding was the detection of Biological Sciences Shrimp Ponds with Varying Mercury Levels”. , a marine PSB, from the fecal DNA of two freshwater fish, iwana 23.4 (2016): 478-487.

4. et al. “Rhodovulum sulfidophilum in the Treatment 14. Tank M., et al 74 - Letters in Inter- Azad SA., . “Phylogenetic Relationship of Phototrophic Pur Applied Microbiology national Microbiology and Utilization of Sardine Processing Wastewater”. ple Sulfur Bacteria According to PufL and PufM Genes”. 5. Maeda I., et al 38.1 (2004): 13-18. - 15. Yutin N., et al. “Novel 12.3Primers (2009): Reveal 175-185. Wider Diversity among ity in High-Density Suspension of Rhodovulum sulfidophilum Applied and Envi- . “Maximization of Hydrogen Production Abil - ronmental Microbiology Marine Aerobic Anoxygenic Phototrophs”. Biotechnology and Bioengineering Cells Using Intracellular Poly(3-Hydroxybutyrate) as Sole Sub 16. et al 71.12(2005): 8958-8962. 481. strate”. 81.4 (2003): 474- - Baldo L., . “Phylogeography and Ecological Niche Shape 6. - Frontiers in Microbiology the Cichlid Fish Gut Microbiota in Central American and Afri Rhodovulum sulfidophilum P5, Isolated Cai J and Guangce W. “Hydrogen Production by a Marine Pho Yecan Q., Lakes”. et al Gelsemium 10 (2019): elegans 1-19. Alkaloids on International Journal of Hydrogen Energy tosynthetic Bacterium, 17. . “Effects of Dietary from a Shrimp Pond”. Megalobrama amblycephala Fish and Shell- Intestinal Morphology, Antioxidant Status, Immune Responses Foong37.20 (2012):CP., et 15070-15080.al fish Immunology and Microbiota of ”. 7. . “Optimal Iron Concentrations for Growth- 18. Huang Z., et al 94 (2019): 464-78. Rhodovulum sulfidophilum Associated Polyhydroxyalkanoate Biosynthesis in the Marine PLoS ONE . “Microecological Koch’s Postulates Reveal That Photosynthetic Purple Bacterium Microbiome 1-12. Intestinal Microbiota Dysbiosis Contributes to Shrimp White under Photoheterotrophic Condition”. 14.4 (2019): 19. Feces Syndrome”.et al 8.1 (2020): 1-13. 8. Envi- Rhodovulum sulfidophilum - Yamazaki Y., . “Repeated Selective Enrichment Process of Kikuchi Y and Umekage S. “Extracellular Nucleic Acids of the ronmental Microbiology Reports FEMS Micro- Sediment Microbiota Occurred in Sea Cucumber Guts”. Marine Bacterium and Recombi biology Letters 11.6 (2019): 797-807. nant RNA Production Technology Using Bacteria”. 20. et al. “Individual Apostichopus japonicus - 9. Foong CP., et al 365.3 (2018). - Yamazaki Y., Fecal Mi Scientific Reports Communications crobiome Reveals a Link with Polyhydroxybutyrate Producers . “A Marine Photosynthetic Microbial Cell Fac Biology in Host Growth Gaps”. 6 (2016): 1-10. tory as a Platform for Spider Silk Production”. 21. Reddy CSK., et al Bio- resource Technology 10. Fujimoto 3.1 H., (2020). et al - . “Polyhydroxyalkanoates: An Overview”. Applied 87.2 (2003): 137-146. . “Whole-Cell Arsenite Biosensor Using Pho 22. et al Microbiology and Biotechnology tosynthetic Bacterium Rhodovulum Sulfidophilum”. Schryver PD., . “Poly-β-Hydroxybutyrate (PHB) Increases Dicentrarchus labrax 11. et al. “Isolation of 73.2 A Marine (2006): Purple 332-338. Non-Sulfur Growth Performance and Intestinal Bacterial Range-Weighted Applied Microbiology and Biotechnology - Richness in Juvenile European Sea Bass, ”. Yamauchi N., 1541. International Journal of Plant, Animal and Environ- 86.5 (2010): 1535- Photosynthetic Bacterium With A High Ability of Glycerol As mental Sciences similation”. Duan Y., et al 12. Dereeper A., et al 9.4 (2019): 214-221. 23. . “Effect of Dietary Poly-β-Hydroxybutyrate (PHB) Litopenaeus vannamei Nucleic Acids Research on Growth Performance, Intestinal Health Status and Body . “Phylogeny.Fr: Robust Phylogenetic Analysis Fish and Shellfish Immunology Composition of Pacific White Shrimp Masudafor the Non-Specialist”. S., et al 36 (2008). 528. (Boone, 1931)”. 60 (2017): 520- Rho- 13. . “A New Cytochrome Subunit Bound to the 24. Cristiane CP., et al - dovulum sulfidophilum Journal of Biological Chemistry Photosynthetic Reaction Center in the Purple Bacterium, PLoS . “Phylogenetically and Spatially Close Ma ”. 274.16 ONE rine Sponges Harbour Divergent Bacterial Communities”. (1999): 10795-10801. 7.12 (2012).

Assets from publication with us • • Thorough Double blinded peer review Prompt Acknowledgement after receiving the article • • Rapid Publication • High visibility of your Published work Issue of Publication Certificate Website: Submit Article: www.actascientific.com/ Email us: www.actascientific.com/submission.php Contact us: [email protected] +91 9182824667