DOCSLIB.ORG

Pufc Gene Targeted PCR Primers for Identification and Classification of Marine Photosynthetic Bacterium Rhodovulum Sulfidophilum

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Pufc Gene Targeted PCR Primers for Identification and Classification of Marine Photosynthetic Bacterium Rhodovulum Sulfidophilum Acta Scientific MICROBIOLOGY (ISSN: 2581-3226) Volume 4 Issue 2 February 2021 Research Article pufC Rhodovulum sulfidophilum Gene Targeted PCR Primers for Identification and Classification of Marine Photosynthetic Bacterium Aoi Koga, Nao Yamauchi, Mayu Imamura, Mina Urata, Tomomi Received: Kurayama, Ranko Iwai, Shuhei Hayashi, Shinjiro Yamamoto and January 28, 2021 Hitoshi Miyasaka* Published: December 30, 2020 © All rights are reserved by Hitoshi Department of Applied Life Science, Sojo University, Nishiku, Japan Miyasaka., et al. *Corresponding Author: Sojo University, Nishiku, Japan. Hitoshi Miyasaka, Department of Applied Life Science, DOI: 10.31080/ASMI.2020.04.0770 Abstract Rhodovulum sulfidophilum - The marine non-sulfur purple photosynthetic bacterium has a wide application potential in the fields sify various R. sulfidophilum strains, we designed a PCR primer set targeting pufC of aquaculture, renewable energy production, environmental protection, and biomaterial production. To detect, identify and clas pufC R. sulfidophilum gene encoding one of the photosystem proteins. - Nucleotide sequence alignment of the genes from five strains revealed that the 3’ region of this gene is rich in ious R. sulfidophilum pufC gene. For the validation of this nucleotide substitutions (approximately 10 substitutions/100 bp), making it suitable for the identification and classification of var R. sulfidophilum strains. strains. We designed a primer set that amplified 0.7 kb of the 3’ region of primerKeywords: set, we used fish fecal DNA as Rhodovulumthe PCR templates, sulfidophilum and successfully identified and classified several Photosynthetic Bacteria; ; PCR; Fish Fecal DNA Introduction R. sulfidophilum Rho- Marsupenaeus japonicus classified several strains from the intestinal tracts dovulum sulfidophilum The marine non-sulfur purple photosynthetic bacterium of some fish and kuruma shrimps ( ). [1,2], bioremediation Materials and Methods has a wide variety of application potential, , wastewater treatment [4], nitrogenase-mediated Bacterial strains such as in probiotics for marine aquaculture [5,6] - pufM-pufC region of mercury [3] , RNA-drug [8] and spider silk [9], of R. sulfidophilum hydrogen production , and production of biomaterials, includ For the nucleotide sequence alignment of the and biosensors [10] R. sulfidophilum ing biodegradable plastics [7] , sequence data from our three original isolates, R. sulfidophilum strains may be a useful . The PCR-based method for the detection and and 2 sequence data of strains MB263 (accession classification of various number CP020384) and DSM 1374 (accession number CP015418) primers targeting pufC - tool in many fields of applications. In this study, we designed PCR fromOur the original public databaseisolates, were used.R. sulfidophilum OKHT16, KKMI01, R. sulfidophilum that encodes one of the photosynthetic cy and KHHN01 strains. OKHT16 was isolated from strains from environmental samples. R. sulfidophilum tochrome proteins to detect and classify various [11], and R. sulfidophi- lum KKMI01 and KHHN01 were isolated from the seashore area Osaka Bay, Japan as described previously To validate this primer set, we used fecal DNA from some fish and shrimps as the PCR templates, and successfully detected and Citation: Hitoshi Miyasaka., et al. “pufC Rhodovulum sulfidophilum". Acta Scientific Microbiology Gene Targeted PCR Primers for Identification and Classification of Marine Photosynthetic Bacterium 4.2 (2021): 69-75. pufC Gene Targeted PCR Primers for Identification and Classification of Marine Photosynthetic Bacterium Rhodovulum sulfidophilum - 70 - R. sulfidophilum of Amakusa, Kumamoto, Japan. The GenBank/EMBL/DDBJ acces by agarose gel electrophoresis, and DNA sequencing were per sion numbers for the 16S rRNA gene sequences of formed as described in section 2.2. pufC frag- OKHT16, KKMI01 and KHHN01 are LC037397, LC596063 and LC596064, respectively. The GenBank/EMBL/DDBJ accession numbers for the PCR amplification of the pufM-pufC region of R. sulfidophilum ments obtained by PCR amplification from fecal DNA are shown in strains the figure legend of figure 3. Phylogenetic analysis pufM-pufC regions of R. sulfidophilum - PCR amplification of the [12] using its default setting. strains was performed by using genomic DNA as the templates. The Phylogenetic analysis was performed on the Phylogeny.fr plat - - PCR primers used were pufM588F (5’- TACTACAACCCGTTCCACGC form (http://www.phylogeny.fr) ture of the pufM-pufC -3’) and pufC1031R (5’- CATGTCATGGCCGTTCAG -3’). The struc Branch support in the maximum likelihood (ML) tree was estimat region and the location of the primers are edResults with 100 bootstrap replicates. shown in Fig. 1. KOD-Plus DNA Polymerase (Toyobo Life Science, PCR primer design for the amplification of a part of pufC gene Osaka, Japan) was used for PCR, and the reaction was carried out of R. sulfidophilum on a Biometra TOne 96 thermal cycler (Analytik Jena GmbH, Jena, R. sulfidophilum, we designed Germany) under the following conditions: pre-denaturation at 94 pufC To detect, identify and classify °C (2 min), denaturation at 94 °C (30 s), annealing at 62 °C (30 s), a PCR primer set for the amplification of a part of encoding and extension at 68 °C (40 s) for 30 cycles, followed by one cycle of pufM-pufC gene fragments one of the cytochrome proteins involved in electron transfer to the final extension at 68 °C (10 min). PCR products were separated by pufL-pufM region of the puf photosynthetic reaction center [13]. For the identification of PSB 1% agarose gel electrophoresis, and the has been used [14,15] pufL-pufM from non-purified cultures, the cluster were purified. DNA sequence analyses were performed using a , because nucleotide sequences of commercial DNA sequence analysis service (Eurofins Genomics identify R. sulfidophilum strains, pufC - for the pufM-pufC gene fragments of R. sulfidophilum OKHT16, are well conserved among various PSB. In this study, to detect and Inc., Tokyo, Japan). The GenBank/EMBL/DDBJ accession numbers puf R. sulfidophi- gene was selected as the tar lum the get, because of its unique location in the cluster in KKMI01 and KHHN01 are LC596067, LC596065 and LC596066, - compared to other genera of photosynthetic bacteria, and respectively. teria . Shrimp and fish samples absence of this gene in several closely related photosynthetic bac M. japonicus [13] pufM-pufC from Live kuruma shrimps ( ) for laboratory experiments our three original isolates, we designed a primer set. To design First, to obtain the nucleotide sequence data of were provided by the shrimp pond of Takusui Co. Ltd. located in the forward primer in the pufM Imari, Saga, Japan. Wild-caught kuruma shrimps from Oita Bay of pufM genes from seven Rhodovulum sp., namely R. sulfidophilum Etrumeus teres - region, the nucleotide sequences and Seto Inland Sea, Japan, were purchased by online. Wild-caught R. sulfidophilum R. kholense Konosirus punctatus Pseudo- ocean fish such as round herring ( ), konoshiro giz R. visakhapatnamense type strain pleuronectes herzensteini Cyp- (AB020784), DSM 2351 (AP014800), zard shad ( ), and righteye flounder ( R. sp. R. euryhali- rinus carpio Salvelinus leucomaenis Misgurnus type strain JA297T (FM208076), ) and freshwater fish such as carp ( num R. marinum anguillicaudatus JA181T (AM944097), MTCH3IM048 (FN984739), ), iwana ( ) and loach ( (AF486825), and type strain JA128T (AM944096) ) were purchased from local markets or online. - Isolation of fecal DNA from shrimps and fish, and PCR amplifi- were aligned using CLUSTAL W (1.83) multiple sequence alignment - cation of the 3’ region of pufC program. The forward primer pufM588F (5’- TACTACAACCCGTTC ment. To design the reverse primer in the pufC - CACGC -3’) was designed in the well-conserved region in the align Rhodovulum sp., namely R. sulfidophilum region, the nucleo Isolation of fecal DNA was performed using the ISOFECAL kit R. sulfidophilum Rhodovulum tide sequences of three (Nippon Gene, Tokyo, Japan). PCR amplification, DNA purification (AB020784), DSM 2351 (AP014800), Citation: Hitoshi Miyasaka., et al. “pufC Rhodovulum sulfidophilum". Acta Scientific Microbiology Gene Targeted PCR Primers for Identification and Classification of Marine Photosynthetic Bacterium 4.2 (2021): 69-75. pufC Gene Targeted PCR Primers for Identification and Classification of Marine Photosynthetic Bacterium Rhodovulum sulfidophilum sp. sulfidophilum from both R. sulfidophilum-fed shrimps and non-fed71 R. sul- OG-KC1M (AB088691) were aligned using CLUSTAL W (2.1) pufC gene, and designed the fidophilum multiple sequence alignment program. Based on these alignments, (control) shrimps (data not shown). This result suggests that pufC from we found several conserved regions in may commonly inhabit in the intestinal tract of kuruma reverse primer pufC1031R (5’- CATGTCATGGCCGTTCAG -3’). The shrimps. Based on this finding, we next tried to amplify will be provided on request. R. alignment data for the design of pufM588F and pufC1031R primers the fecal DNA of wild-caught kuruma shrimps as well as from some sulfidophilum other wild-caught ocean fish. As expected, being a marine PSB, pufM-pufC from the three original - did not inhabit in the intestinal tracts of freshwater R. sulfidophilum E. teres The nucleotide sequences of fish, and the fecal DNA of some freshwater fish was used as a nega K. punctatus P. herzensteini isolates (strains OKHT16, KKMI01 and KHHN01), tive control. As for ocean fish, round herring ( ), konoshiro C. carpio
Load more

Recommended publications
  • Developing a Genetic Manipulation System for the Antarctic Archaeon, Halorubrum Lacusprofundi: Investigating Acetamidase Gene Function
    www.nature.com/scientificreports OPEN Developing a genetic manipulation system for the Antarctic archaeon, Halorubrum lacusprofundi: Received: 27 May 2016 Accepted: 16 September 2016 investigating acetamidase gene Published: 06 October 2016 function Y. Liao1, T. J. Williams1, J. C. Walsh2,3, M. Ji1, A. Poljak4, P. M. G. Curmi2, I. G. Duggin3 & R. Cavicchioli1 No systems have been reported for genetic manipulation of cold-adapted Archaea. Halorubrum lacusprofundi is an important member of Deep Lake, Antarctica (~10% of the population), and is amendable to laboratory cultivation. Here we report the development of a shuttle-vector and targeted gene-knockout system for this species. To investigate the function of acetamidase/formamidase genes, a class of genes not experimentally studied in Archaea, the acetamidase gene, amd3, was disrupted. The wild-type grew on acetamide as a sole source of carbon and nitrogen, but the mutant did not. Acetamidase/formamidase genes were found to form three distinct clades within a broad distribution of Archaea and Bacteria. Genes were present within lineages characterized by aerobic growth in low nutrient environments (e.g. haloarchaea, Starkeya) but absent from lineages containing anaerobes or facultative anaerobes (e.g. methanogens, Epsilonproteobacteria) or parasites of animals and plants (e.g. Chlamydiae). While acetamide is not a well characterized natural substrate, the build-up of plastic pollutants in the environment provides a potential source of introduced acetamide. In view of the extent and pattern of distribution of acetamidase/formamidase sequences within Archaea and Bacteria, we speculate that acetamide from plastics may promote the selection of amd/fmd genes in an increasing number of environmental microorganisms.
    [Show full text]
  • Title a Marine Photosynthetic Microbial Cell Factory As a Platform
    A marine photosynthetic microbial cell factory as a platform Title for spider silk production Foong, Choon Pin; Higuchi-Takeuchi, Mieko; Malay, Ali D.; Author(s) Oktaviani, Nur Alia; Thagun, Chonprakun; Numata, Keiji Citation Communications Biology (2020), 3 Issue Date 2020-07-08 URL http://hdl.handle.net/2433/252537 © The Author(s) 2020. This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included Right in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/. Type Journal Article Textversion publisher Kyoto University ARTICLE https://doi.org/10.1038/s42003-020-1099-6 OPEN A marine photosynthetic microbial cell factory as a platform for spider silk production Choon Pin Foong1,2, Mieko Higuchi-Takeuchi1, Ali D. Malay 1, Nur Alia Oktaviani1, Chonprakun Thagun1 & ✉ Keiji Numata 1,2 1234567890():,; Photosynthetic microorganisms such as cyanobacteria, purple bacteria and microalgae have attracted great interest as promising platforms for economical and sustainable production of bioenergy, biochemicals, and biopolymers.
    [Show full text]
  • Horizontal Operon Transfer, Plasmids, and the Evolution of Photosynthesis in Rhodobacteraceae
    The ISME Journal (2018) 12:1994–2010 https://doi.org/10.1038/s41396-018-0150-9 ARTICLE Horizontal operon transfer, plasmids, and the evolution of photosynthesis in Rhodobacteraceae 1 2 3 4 1 Henner Brinkmann ● Markus Göker ● Michal Koblížek ● Irene Wagner-Döbler ● Jörn Petersen Received: 30 January 2018 / Revised: 23 April 2018 / Accepted: 26 April 2018 / Published online: 24 May 2018 © The Author(s) 2018. This article is published with open access Abstract The capacity for anoxygenic photosynthesis is scattered throughout the phylogeny of the Proteobacteria. Their photosynthesis genes are typically located in a so-called photosynthesis gene cluster (PGC). It is unclear (i) whether phototrophy is an ancestral trait that was frequently lost or (ii) whether it was acquired later by horizontal gene transfer. We investigated the evolution of phototrophy in 105 genome-sequenced Rhodobacteraceae and provide the first unequivocal evidence for the horizontal transfer of the PGC. The 33 concatenated core genes of the PGC formed a robust phylogenetic tree and the comparison with single-gene trees demonstrated the dominance of joint evolution. The PGC tree is, however, largely incongruent with the species tree and at least seven transfers of the PGC are required to reconcile both phylogenies. 1234567890();,: 1234567890();,: The origin of a derived branch containing the PGC of the model organism Rhodobacter capsulatus correlates with a diagnostic gene replacement of pufC by pufX. The PGC is located on plasmids in six of the analyzed genomes and its DnaA- like replication module was discovered at a conserved central position of the PGC. A scenario of plasmid-borne horizontal transfer of the PGC and its reintegration into the chromosome could explain the current distribution of phototrophy in Rhodobacteraceae.
    [Show full text]
  • Assessing Diversity and Biogeography of Aerobic
    Assessing diversity and biogeography of aerobic anoxygenic phototrophic bacteria in surface waters of the Atlantic and Pacific Oceans using the Global Ocean Sampling expedition metagenomes Natalya Yutin, Marcelino Suzuki, Hanno Teeling, Marc Weber, J Venter, Douglas Rusch, Oded Béjà To cite this version: Natalya Yutin, Marcelino Suzuki, Hanno Teeling, Marc Weber, J Venter, et al.. Assessing diversity and biogeography of aerobic anoxygenic phototrophic bacteria in surface waters of the Atlantic and Pacific Oceans using the Global Ocean Sampling expedition metagenomes. Environmental Microbiology, Society for Applied Microbiology and Wiley-Blackwell, 2007, 9, pp.1464 - 1475. 10.1111/j.1462- 2920.2007.01265.x. hal-03012626 HAL Id: hal-03012626 https://hal.archives-ouvertes.fr/hal-03012626 Submitted on 18 Nov 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. emi_1265 Environmental Microbiology (2007) doi:10.1111/j.1462-2920.2007.01265.x Assessing diversity and biogeography of aerobic anoxygenic phototrophic bacteria in surface waters of the Atlantic and Pacific Oceans using the Global Ocean Sampling expedition metagenomes Natalya Yutin,1 Marcelino T. Suzuki,2* phs were detected using various techniques ranging Hanno Teeling,3 Marc Weber,3 J.
    [Show full text]
  • Limibaculum Halophilum Gen. Nov., Sp. Nov., a New Member of the Family Rhodobacteraceae
    TAXONOMIC DESCRIPTION Shin et al., Int J Syst Evol Microbiol 2017;67:3812–3818 DOI 10.1099/ijsem.0.002200 Limibaculum halophilum gen. nov., sp. nov., a new member of the family Rhodobacteraceae Yong Ho Shin,1 Jong-Hwa Kim,1 Ampaitip Suckhoom,2 Duangporn Kantachote2 and Wonyong Kim1,* Abstract A Gram-stain-negative, cream-pigmented, aerobic, non-motile, non-spore-forming and short-rod-shaped bacterial strain, designated CAU 1123T, was isolated from mud from reclaimed land. The strain’s taxonomic position was investigated by using a polyphasic approach. Strain CAU 1123T grew optimally at 37 C and at pH 7.5 in the presence of 2 % (w/v) NaCl. Phylogenetic analysis based on the 16S rRNA gene sequence revealed that strain CAU 1123T formed a monophyletic lineage within the family Rhodobacteraceae with 93.8 % or lower sequence similarity to representatives of the genera Rubrimonas, Oceanicella, Pleomorphobacterium, Rhodovulum and Albimonas. The major fatty acids were C18 : 1 !7c and 11-methyl C18 : 1 !7c and the predominant respiratory quinone was Q-10. The polar lipids were phosphatidylethanolamine, phosphatidylglycerol, two unidentified phospholipids, one unidentified aminolipid and one unidentified lipid. The DNA G+C content was 71.1 mol%. Based on the data from phenotypic, chemotaxonomic and phylogenetic studies, it is proposed that strain CAU 1123T represents a novel genus and novel species of the family Rhodobacteraceae, for which the name Limibaculumhalophilum gen. nov., sp. nov. The type strain is CAU 1123T (=KCTC 52187T, =NBRC 112522T). The family Rhodobacteraceae was first established by Garr- chemotaxonomic properties along with a detailed phyloge- ity et al.
    [Show full text]
  • Photosynthesis Is Widely Distributed Among Proteobacteria As Demonstrated by the Phylogeny of Puflm Reaction Center Proteins
    fmicb-08-02679 January 20, 2018 Time: 16:46 # 1 ORIGINAL RESEARCH published: 23 January 2018 doi: 10.3389/fmicb.2017.02679 Photosynthesis Is Widely Distributed among Proteobacteria as Demonstrated by the Phylogeny of PufLM Reaction Center Proteins Johannes F. Imhoff1*, Tanja Rahn1, Sven Künzel2 and Sven C. Neulinger3 1 Research Unit Marine Microbiology, GEOMAR Helmholtz Centre for Ocean Research, Kiel, Germany, 2 Max Planck Institute for Evolutionary Biology, Plön, Germany, 3 omics2view.consulting GbR, Kiel, Germany Two different photosystems for performing bacteriochlorophyll-mediated photosynthetic energy conversion are employed in different bacterial phyla. Those bacteria employing a photosystem II type of photosynthetic apparatus include the phototrophic purple bacteria (Proteobacteria), Gemmatimonas and Chloroflexus with their photosynthetic relatives. The proteins of the photosynthetic reaction center PufL and PufM are essential components and are common to all bacteria with a type-II photosynthetic apparatus, including the anaerobic as well as the aerobic phototrophic Proteobacteria. Edited by: Therefore, PufL and PufM proteins and their genes are perfect tools to evaluate the Marina G. Kalyuzhanaya, phylogeny of the photosynthetic apparatus and to study the diversity of the bacteria San Diego State University, United States employing this photosystem in nature. Almost complete pufLM gene sequences and Reviewed by: the derived protein sequences from 152 type strains and 45 additional strains of Nikolai Ravin, phototrophic Proteobacteria employing photosystem II were compared. The results Research Center for Biotechnology (RAS), Russia give interesting and comprehensive insights into the phylogeny of the photosynthetic Ivan A. Berg, apparatus and clearly define Chromatiales, Rhodobacterales, Sphingomonadales as Universität Münster, Germany major groups distinct from other Alphaproteobacteria, from Betaproteobacteria and from *Correspondence: Caulobacterales (Brevundimonas subvibrioides).
    [Show full text]
  • Genomic Analysis of the Evolution of Phototrophy Among Haloalkaliphilic Rhodobacterales
    GBE Genomic Analysis of the Evolution of Phototrophy among Haloalkaliphilic Rhodobacterales Karel Kopejtka1,2,Ju¨rgenTomasch3, Yonghui Zeng4, Martin Tichy1, Dimitry Y. Sorokin5,6,and Michal Koblızek1,2,* 1Laboratory of Anoxygenic Phototrophs, Institute of Microbiology, CAS, Center Algatech, Trebon, Czech Republic 2Faculty of Science, University of South Bohemia, Ceske ´ Budejovice, Czech Republic 3Research Group Microbial Communication, Helmholtz Centre for Infection Research, Braunschweig, Germany 4Aarhus Institute of Advanced Studies, Aarhus, Denmark 5Winogradsky Institute of Microbiology, Research Centre of Biotechnology, Russian Academy of Sciences, Moscow, Russia 6Department of Biotechnology, Delft University of Technology, The Netherlands *Corresponding author: E-mail: [email protected]. Accepted: July 26, 2017 Data deposition: This project has been deposited at NCBI GenBank under the accession numbers: GCA_001870665.1, GCA_001870675.1, GCA_001884735.1. Abstract A characteristic feature of the order Rhodobacterales is the presence of a large number of photoautotrophic and photo- heterotrophic species containing bacteriochlorophyll. Interestingly, these phototrophic species are phylogenetically mixed with chemotrophs. To better understand the origin of such variability, we sequenced the genomes of three closely related haloalkaliphilic species, differing in their phototrophic capacity and oxygen preference: the photoheterotrophic and faculta- tively anaerobic bacterium Rhodobaca barguzinensis, aerobic photoheterotroph Roseinatronobacter
    [Show full text]
  • Rhodovulum Visakhapatnamense Sp. Nov
    International Journal of Systematic and Evolutionary Microbiology (2007), 57, 1762–1764 DOI 10.1099/ijs.0.65076-0 Rhodovulum visakhapatnamense sp. nov. T. N. R. Srinivas,1 P. Anil Kumar,1 Ch. Sasikala,1 Ch. V. Ramana2 and J. F. Imhoff3 Correspondence 1Bacterial Discovery Laboratory, Centre for Environment, Institute of Science and Technology, JNT Ch. Sasikala University, Kukatpally, Hyderabad 500 085, India [email protected] 2Department of Plant Sciences, School of Life Sciences, University of Hyderabad, PO Central or University, Hyderabad 500 046, India [email protected] 3Leibniz-Institut fu¨r Meereswissenschaften IFM-GEOMAR, Marine Mikrobiologie, Du¨sternbrooker Weg 20, 24105 Kiel, Germany A Gram-negative, rod-shaped, phototrophic bacterium (JA181T) was isolated from a tidal water sample. On the basis of 16S rRNA gene sequence similarity, strain JA181T was shown to belong to the class Alphaproteobacteria, most closely related to Rhodovulum sulfidophilum (97.8 % similarity to the type strain), Rhodovulum adriaticum (93 %), Rhodovulum robiginosum (93 %), Rhodovulum iodosum (94 %), Rhodovulum imhoffii (94 %), Rhodovulum strictum (95 %), Rhodovulum euryhalinum (94.6 %) and Rhodovulum marinum (94.6 %). DNA–DNA hybridization with Rdv. sulfidophilum DSM 1374T (relatedness of 39 % with strain JA181T) and physiological and biochemical tests allowed genotypic and phenotypic differentiation of strain JA181T from the eight Rhodovulum species with validly published names. Strain JA181T therefore represents a novel species, for which the name Rhodovulum visakhapatnamense sp. nov. is proposed (type strain JA181T 5JCM 13531T 5ATCC BAA-1274T 5DSM 17937T). The genus Rhodovulum currently comprises eight species During the characterization of anoxygenic phototrophic with validly published names, which include two described bacteria isolated from marine habitats, strain JA181T was by our group, Rhodovulum marinum (Srinivas et al., 2006) recovered from phototrophic enrichments (with 2 % NaCl) and Rhodovulum imhoffii (Srinivas et al., 2007).
    [Show full text]
  • How to Define and Study Structural Proteins As Biopolymer Materials
    Polymer Journal (2020) 52:1043–1056 https://doi.org/10.1038/s41428-020-0362-5 FOCUS REVIEW How to define and study structural proteins as biopolymer materials Keiji Numata 1,2 Received: 1 April 2020 / Revised: 25 April 2020 / Accepted: 27 April 2020 / Published online: 22 May 2020 © The Author(s) 2020. This article is published with open access Abstract Structural proteins, including silk fibroins, play an important role in shaping the skeletons and structures of cells, tissues, and organisms. The amino acid sequences of structural proteins often show characteristic features, such as a repeating tandem motif, that are notably different from those of functional proteins such as enzymes and antibodies. In recent years, materials composed of or containing structural proteins have been studied and developed as biomedical, apparel, and structural materials. This review outlines the definition of structural proteins, methods for characterizing structural proteins as polymeric materials, and potential applications. Definition considered [3], defining a structural protein is even more 1234567890();,: 1234567890();,: difficult and complicated. Therefore, in this focus review, I Proteins are polymers in which the 20 natural amino acids would like to define a structural protein as “a protein that are linked by amide bonds. In addition to the 20 natural possesses a characteristic amino acid sequence or motif amino acids, there are amino acids that are not directly that repeats and forms a skeleton or contributes to the synthesized from ribosomes, such as L-3,4-dihydrox- mechanical properties of a living organism, cell, or mate- yphenylalanine (DOPA), hydroxyproline (Hyp), dityrosine, rial” (Fig. 1). Structural proteins can be globular or fibrillar and selenomethionine, and these compounds are synthe- proteins.
    [Show full text]
  • Delft University of Technology Genomic Analysis of the Evolution
    Delft University of Technology Genomic analysis of the evolution of phototrophy among haloalkaliphilic rhodobacterales Kopejtka, Karel; Tomasch, Jürgen; Zeng, Yonghui; Tichý, Martin; Sorokin, Dimitry Y.; Koblížek, Michal DOI 10.1093/gbe/evx141 Publication date 2017 Document Version Final published version Published in Genome Biology and Evolution Citation (APA) Kopejtka, K., Tomasch, J., Zeng, Y., Tichý, M., Sorokin, D. Y., & Koblížek, M. (2017). Genomic analysis of the evolution of phototrophy among haloalkaliphilic rhodobacterales. Genome Biology and Evolution, 9(7), 1950-1962. https://doi.org/10.1093/gbe/evx141 Important note To cite this publication, please use the final published version (if applicable). Please check the document version above. Copyright Other than for strictly personal use, it is not permitted to download, forward or distribute the text or part of it, without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license such as Creative Commons. Takedown policy Please contact us and provide details if you believe this document breaches copyrights. We will remove access to the work immediately and investigate your claim. This work is downloaded from Delft University of Technology. For technical reasons the number of authors shown on this cover page is limited to a maximum of 10. GBE Genomic Analysis of the Evolution of Phototrophy among Haloalkaliphilic Rhodobacterales Karel Kopejtka1,2,Ju¨rgenTomasch3, Yonghui Zeng4, Martin Tichy1, Dimitry Y. Sorokin5,6,and Michal Koblızek1,2,*
    [Show full text]
  • Super Bacteria: a New Hope of Manufacturing Spider Silk in an Efficient Way
    International Journal for Research in ISSN: 2349-8889 Applied Sciences and Biotechnology Volume-8, Issue-2 (March 2021) www.ijrasb.com https://doi.org/10.31033/ijrasb.8.2.28 Super Bacteria: A New Hope of Manufacturing Spider Silk in an Efficient Way Chandrayee Talukdar1 and Swastik Sastri2 1B.Sc., Department of Microbiology, Dumdum Motijheel College, INDIA 2B.Sc., Department of Microbiology, Dumdum Motijheel College, INDIA 2Corresponding Author: [email protected] ABSTRACT to produce because spider feed each other. Some The important properties of spider dragline silk photosynthetic microorganisms such as cyano bacteria, and other protein polymers will find many applications. purple bacteria and microalgae has great value in We have demonstrated the production of spider silk, which promising platforms for biochemicals and polymers. has many important properties, are produced from the bacteria including Escherichia coli. The productions of high molecular weight spider drag line encoded by synthetic II. METHODOLOGY genes. Silk protein can be efficiently produced by the microbial system has become an advantageous method like The scientist has observed that R. sulphidofilum quick secretion and simple product recovery has become an which has qualities that make ideal for establishing a efficient method .From the observation of various sustainable biofactory. This bacteria grows in sea water, experiments done by several scientists has shown silk made requires carbon dioxide and nitrogen from the in laboratory. The study of RIKEN centre for sustainable atmosphere and uses solar energy which is inexhaustible resource science has shown that spider silk can be produce huge amount. Observation shown that joining of the and it present in the environment as abundantly.
    [Show full text]
  • Complete Assimilation of Cysteine by a Newly Isolated Non-Sulfur Purple Bacterium Resembling Rhodovulum Sulfidophilum (Rhodobacter Sulfidophilus)
    Silke Heising · Waltraud Dilling · Sylvia Schnell · Bernhard Schink Complete assimilation of cysteine by a newly isolated non-sulfur purple bacterium resembling Rhodovulum sulfidophilum (Rhodobacter sulfidophilus) Abstract A rod-shaped, motile, phototrophic bacterium, strain SiCys, was enriched and isolated from a marine mi- Introduction crobial mat, with cysteine as sole substrate. During pho- totrophic anaerobic growth with cysteine, sulfide was pro- Since Andreae (1985) discovered a significant impact of duced as an intermediate, which was subsequently oxi- methylated sulfur compounds from marine environments dized to sulfate. The molar growth yield with cysteine on the global sulfur cycle, interest in the cycling of was 103 g mol–1, in accordance with complete assimila- organosulfur compounds has increased. Salt marshes ex- tion of electrons from the carbon and the sulfur moiety hibit high rates of dimethylsulfide, dimethyldisulfide, and into cell material. Growth yields with alanine and serine methanethiol emission (Cooper et al. 1987; Steudler and were proportionally lower. Thiosulfate, sulfide, hydrogen, Peterson 1984). Sources of these methylated organosulfur and several organic compounds were used as electron compounds are dimethylsulfoniopropionate, an osmolyte donors in the light, whereas cystine, sulfite, or elemental of marine algae, and sulfur-containing amino acids (Tay- sulfur did not support phototrophic anaerobic growth. lor 1993). Some phototrophic bacteria growing with Aerobic growth in the dark was possible with fructose as organosulfur compounds have been isolated from micro- substrate. Cultures of strain SiCys were yellowish-brown bial mats. Dimethylsulfide is oxidized to dimethylsulfox- in color and contained bacteriochlorophyll a, spheroidene, ide by purple bacteria (Zeyer et al. 1987; Visscher and spheroidenone, and OH-spheroidene as major photosyn- Van Gemerden 1991, Hanlon et al.
    [Show full text]