DOCSLIB.ORG

Pulmonary Arteriole Gene Expression Signature in Idiopathic Pulmonary Fibrosis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Pulmonary Arteriole Gene Expression Signature in Idiopathic Pulmonary Fibrosis Pulmonary Arteriole Gene Expression Signature in Idiopathic Pulmonary Fibrosis Nina M. Patel1, Steven M. Kawut2, Selim M. Arcasoy1, Sanja Jelic1, David J. Lederer1, Alain C. Borczuk1 Division of Pulmonary, Allergy & Critical Care Medicine, Columbia University, College of Physicians and Surgeons1 Department of Medicine and the Center for Clinical Epidemiology and Biostatistics, University of Pennsylvania School of Medicine, Philadelphia, PA2 Online Data Supplement Methods: RNA Isolation, Microarray processing The RNAqueous-Micro Kit (Ambion) was utilized to isolate RNA. The Agilent Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA) was used to assess the quantity, quality and purity of the extracted RNA. The modified Eberwine procedure was used to amplify and biotinylate RNA for a minimum goal of 15 g RNA for hybridization. Target cRNA was hybridized to Affymetrix Hu133 2.0 Plus oligonucleotide arrays and processed at the Herbert Irving Comprehensive Cancer Center. Microarray Analysis Quality assessment was performed using Bioconductor. BRB array tools software v3.7.2. (National Cancer Institute, Dr. Richard Simon and Dr. Amy Lam) was used for normalization, filtering and initial quality control assessment of the genechip data. The Robust Multi-Array Average (RMA) algorithm was used to quantify the expression values for each probe set. Unsupervised clustering was performed using BRB array tools. Supervised analyses of differential gene expression between class assignments was performed using univariate analyses with a p < 0.001. The univariate analyses were performed utilizing 10,000 random permutations, with a global p < 0.01. The false discovery rate for all comparisons was set at a q < 10%. Supervised clustering of genes and scatterplot analysis between class assignments was also performed using BRB array tools software. Gene lists generated by the supervised analyses were further categorized into biological pathways using Ingenuity Pathways Analysis (IPA, Ingenuity Systems, www.ingenuity.com). The IPA Functional Analysis identified the biological functions and/or diseases that were most significant to the data set. Molecules from the dataset that were associated with biological functions and/or diseases in Ingenuity’s Knowledge Base were considered for the analysis. Two-tailed Fisher’s exact test was used to calculate a p- value determining the probability that each biological function and/or disease assigned to that data set is due to chance alone. A data set containing gene identifiers and corresponding expression values was uploaded into the IPA application. Each identifier was mapped to its corresponding object in Ingenuity's Knowledge Base. Molecules, whose expression was significantly differentially regulated, called Network Eligible molecules, were overlaid onto a global molecular network developed from information contained in Ingenuity’s Knowledge Base. Networks of Network Eligible Molecules were then algorithmically generated based on their connectivity. Immunohistochemical staining (IHC) Paraffinized tissue blocks of IPF and normal lung were sectioned at thickness of < 5 m. Immunohistochemistry was performed on 10 IPF cases and 5 normal donor lungs using antibodies against SFRP2 (Sigma, monoclonal Rabbit anti-human, 1:75 dilution), SMOC2 (Lifespan Biosciences, polyclonal Rabbit anti human, 1:50 dilution) and STAT1 (Sigma rabbit anti human, monoclonal, 1:50 dilution). Antigen retrieval was performed using DAKO pH 6 (SFRP2 and SMOC2) or pH 9 (STAT1) retrieval buffer. Primary antibodies were incubated at room temperature for 1 hour, and developed using the DAKO Envision Dual Link kit (Dako, Denmark) with DAB substrate and hematoxylin counterstain. Examination for statistical significance was performed using the Fisher’s Exact Test (SPSS, v16.0). Supplemental Table E1: Gene Names Expression Values Endothelial Genes adrenomedullin 1532 ± 943 thrombomodulin 1110 ± 575 endothelin receptor type A 3623 ± 1236 SMAD family member 6 744 ± 368 Epithelial Genes keratin 15 72 ± 176 mucin 4, cell surface associated 77 ± 258 keratin 7 189 ± 190 surfactant protein A1B 39 ± 114 Values are mean normalized expression values rounded to the nearest integer ± standard deviation Supplemental Table E2: Univariate analysis comparing gene expression in NPH-IPF vs. PH-IPF arterioles Gene symbol Probe set Description Parametric FDR Fold- p-value change CCR1 205099_s_at chemokine (C-C motif) receptor 1 0.001158 0.9913072 0.4500061 PTMS 218045_x_at parathymosin 0.0011904 0.9913072 1.7440695 NPL 240440_at N-acetylneuraminate pyruvate lyase 0.0016084 0.9913072 0.5080298 (dihydrodipicolinate synthase) NA 241838_at NA 0.0022076 0.9913072 0.5771265 NA 238156_at NA 0.0029903 0.9913072 0.388007 PDGFRA 203131_at platelet-derived growth factor receptor, 0.0031531 0.9913072 0.6256235 alpha polypeptide FLT1 222033_s_at fms-related tyrosine kinase 1 (vascular 0.0033705 0.9913072 0.5934558 endothelial growth factor/vascular permeability factor receptor) TEF 225840_at thyrotrophic embryonic factor 0.0033854 0.9913072 2.3365277 NA 239808_at NA 0.0036163 0.9913072 0.395203 NA 1568983_a_at NA 0.0040027 0.9913072 0.5144699 NA 235172_at NA 0.0040874 0.9913072 0.3932263 NA 240690_at NA 0.0041938 0.9913072 0.5613011 NLGN4X 221933_at neuroligin 4, X-linked 0.0043912 0.9913072 0.4889389 ELTD1 219134_at EGF, latrophilin and seven transmembrane 0.0045867 0.9913072 0.4041308 domain containing 1 NA 239862_at NA 0.0045982 0.9913072 0.595371 B2M 232311_at beta-2-microglobulin 0.0046597 0.9913072 0.438037 ND6 1553575_at NADH dehydrogenase, subunit 6 (complex 0.0046924 0.9913072 0.5143606 I) NA 1564077_at NA 0.0048054 0.9913072 0.4258312 SPTBN1 226765_at spectrin, beta, non-erythrocytic 1 0.0048557 0.9913072 0.4490491 ZNF827 226764_at zinc finger protein 827 0.0048903 0.9913072 1.8218937 NEURL1B 225355_at neuralized homolog 1B (Drosophila) 0.0050316 0.9913072 1.49516 CDC14A 210742_at CDC14 cell division cycle 14 homolog A (S. 0.0053101 0.9913072 0.314476 cerevisiae) POM121L9P 222253_s_at POM121 membrane glycoprotein-like 9 (rat) 0.0053544 0.9913072 0.4984525 pseudogene 6-Sep 212413_at septin 6 0.0057778 0.9913072 0.5310485 NA 235274_at NA 0.0057811 0.9913072 0.5455783 NA 236592_at NA 0.0059805 0.9913072 0.5788008 PNKP 218961_s_at polynucleotide kinase 3@#$%&- 0.0062114 0.9913072 1.6995573 phosphatase THSD7A 214920_at thrombospondin, type I, domain containing 0.0062364 0.9913072 0.3822614 7A CPM 235019_at carboxypeptidase M 0.0066804 0.9913072 0.3709829 KCTD11 235857_at potassium channel tetramerisation domain 0.0067233 0.9913072 2.0062071 containing 11 KRR1 232441_at KRR1, small subunit (SSU) processome 0.00704 0.9913072 0.5056537 component, homolog (yeast) PITPNC1 219155_at phosphatidylinositol transfer protein, 0.0073711 0.9913072 0.5961627 cytoplasmic 1 NA 213705_at NA 0.007495 0.9913072 0.4530666 LOC100132430 214182_at hypothetical LOC100132430 0.0078264 0.9913072 0.5352828 HP1BP3 229204_at heterochromatin protein 1, binding protein 3 0.00794 0.9913072 0.58305 TNFRSF10A 231775_at tumor necrosis factor receptor superfamily, 0.0080608 0.9913072 0.5099776 member 10a NA 231484_at NA 0.0082447 0.9913072 0.4695896 PRMT1 206445_s_at protein arginine methyltransferase 1 0.0085897 0.9913072 1.7887033 CNN3 228297_at calponin 3, acidic 0.0088275 0.9913072 0.455391 STAT3 243213_at signal transducer and activator of 0.0088678 0.9913072 0.4965778 transcription 3 (acute-phase response factor) FAM86B1 65585_at family with sequence similarity 86, member 0.0091584 0.9913072 1.85688 B1 SH3KBP1 235692_at SH3-domain kinase binding protein 1 0.0093252 0.9913072 0.591637 NA 239907_at NA 0.0093355 0.9913072 0.3655385 HGF 209960_at hepatocyte growth factor (hepapoietin A; 0.0093767 0.9913072 0.4720159 scatter factor) NA 242397_at NA 0.0095407 0.9913072 0.377448 CATSPER2 1561405_s_at cation channel, sperm associated 2 0.0098016 0.9913072 1.6568168 ERO1L 222646_s_at ERO1-like (S. cerevisiae) 0.0099056 0.9913072 0.6118214 IDH3G 202471_s_at isocitrate dehydrogenase 3 (NAD+) gamma 0.0103207 0.9913072 1.5550527 NA 226365_at NA 0.0105412 0.9913072 0.6073307 GPRIN3 1556698_a_at GPRIN family member 3 0.0105564 0.9913072 0.6549646 NA 1566342_at NA 0.0108587 0.9913072 0.4650578 PPP2R5C 1557718_at protein phosphatase 2, regulatory subunit 0.0110155 0.9913072 0.5251526 B@#$%&, gamma isoform FYB 211794_at FYN binding protein (FYB-120/130) 0.0112537 0.9913072 0.5614993 TWIST1 213943_at twist homolog 1 (Drosophila) 0.0116602 0.9913072 0.5350974 OBFC2A 233085_s_at oligonucleotide/oligosaccharide-binding fold 0.0118959 0.9913072 0.4534448 containing 2A NA 232835_at NA 0.0119891 0.9913072 0.6310771 DNAJC13 1560020_at DnaJ (Hsp40) homolog, subfamily C, 0.0123426 0.9913072 1.5664626 member 13 SYK 244023_at spleen tyrosine kinase 0.0124291 0.9913072 0.3928391 SYNPO2L 243313_at synaptopodin 2-like 0.0124683 0.9913072 1.6573898 STEAP1 205542_at six transmembrane epithelial antigen of the 0.0125049 0.9913072 0.4392555 prostate 1 ACOX2 205364_at acyl-Coenzyme A oxidase 2, branched chain 0.0127468 0.9913072 1.5880573 CTSC 225646_at cathepsin C 0.0130762 0.9913072 0.4501248 DCP2 244777_at DCP2 decapping enzyme homolog (S. 0.0130986 0.9913072 0.6262102 cerevisiae) FBXL3 242829_x_at F-box and leucine-rich repeat protein 3 0.0132872 0.9913072 0.3470831 NA 236921_at NA 0.0134885 0.9913072 0.5898935 ZC3H12D 1559263_s_at zinc finger CCCH-type containing 12D 0.0135231 0.9913072 0.6001638 DLC1 220512_at deleted in liver cancer 1 0.013525 0.9913072 0.5404732 HIVEP3 235122_at human immunodeficiency virus type I 0.0136699
Load more

Recommended publications
  • Supplementary Data
    Figure 2S 4 7 A - C 080125 CSCs 080418 CSCs - + IFN-a 48 h + IFN-a 48 h + IFN-a 72 h 6 + IFN-a 72 h 3 5 MRFI 4 2 3 2 1 1 0 0 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 7 B 13 080125 FBS - D 080418 FBS - + IFN-a 48 h 12 + IFN-a 48 h + IFN-a 72 h + IFN-a 72 h 6 080125 FBS 11 10 5 9 8 4 7 6 3 MRFI 5 4 2 3 2 1 1 0 0 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 Molecule Molecule FIGURE 4S FIGURE 5S Panel A Panel B FIGURE 6S A B C D Supplemental Results Table 1S. Modulation by IFN-α of APM in GBM CSC and FBS tumor cell lines. Molecule * Cell line IFN-α‡ HLA β2-m# HLA LMP TAP1 TAP2 class II A A HC§ 2 7 10 080125 CSCs - 1∞ (1) 3 (65) 2 (91) 1 (2) 6 (47) 2 (61) 1 (3) 1 (2) 1 (3) + 2 (81) 11 (80) 13 (99) 1 (3) 8 (88) 4 (91) 1 (2) 1 (3) 2 (68) 080125 FBS - 2 (81) 4 (63) 4 (83) 1 (3) 6 (80) 3 (67) 2 (86) 1 (3) 2 (75) + 2 (99) 14 (90) 7 (97) 5 (75) 7 (100) 6 (98) 2 (90) 1 (4) 3 (87) 080418 CSCs - 2 (51) 1 (1) 1 (3) 2 (47) 2 (83) 2 (54) 1 (4) 1 (2) 1 (3) + 2 (81) 3 (76) 5 (75) 2 (50) 2 (83) 3 (71) 1 (3) 2 (87) 1 (2) 080418 FBS - 1 (3) 3 (70) 2 (88) 1 (4) 3 (87) 2 (76) 1 (3) 1 (3) 1 (2) + 2 (78) 7 (98) 5 (99) 2 (94) 5 (100) 3 (100) 1 (4) 2 (100) 1 (2) 070104 CSCs - 1 (2) 1 (3) 1 (3) 2 (78) 1 (3) 1 (2) 1 (3) 1 (3) 1 (2) + 2 (98) 8 (100) 10 (88) 4 (89) 3 (98) 3 (94) 1 (4) 2 (86) 2 (79) * expression of APM molecules was evaluated by intracellular staining and cytofluorimetric analysis; ‡ cells were treatead or not (+/-) for 72 h with 1000 IU/ml of IFN-α; # β-2 microglobulin; § β-2 microglobulin-free HLA-A heavy chain; ∞ values are indicated as ratio between the mean of fluorescence intensity of cells stained with the selected mAb and that of the negative control; bold values indicate significant MRFI (≥ 2).
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • The Aldehyde Dehydrogenase ALDH2*2 Allele Exhibits Dominance Over ALDH2*1 in Transduced Hela Cells
    The aldehyde dehydrogenase ALDH2*2 allele exhibits dominance over ALDH2*1 in transduced HeLa cells. Q Xiao, … , T Johnston, D W Crabb J Clin Invest. 1995;96(5):2180-2186. https://doi.org/10.1172/JCI118272. Research Article Individuals heterozygous or homozygous for the variant aldehyde dehydrogenase (ALDH2) allele (ALDH2*2), which encodes a protein differing only at residue 487 from the normal protein, have decreased ALDH2 activity in liver extracts and experience cutaneous flushing when they drink alcohol. The mechanisms by which this allele exerts its dominant effect is unknown. To study this effect, the human ALDH2*1 cDNA was cloned and the ALDH2*2 allele was generated by site-directed mutagenesis. These cDNAs were transduced using retroviral vectors into HeLa and CV1 cells, which do not express ALDH2. The normal allele directed synthesis of immunoreactive ALDH2 protein (ALDH2E) with the expected isoelectric point. Extracts of these cells contained increased aldehyde dehydrogenase activity with low Km for the aldehyde substrate. The ALDH2*2 allele directed synthesis of mRNA and immunoreactive protein (ALDH2K), but the protein lacked enzymatic activity. When ALDH2*1-expressing cells were transduced with ALDH2*2 vectors, both mRNAs were expressed and immunoreactive proteins with isoelectric points ranging between those of ALDH2E and ALDH2K were present, indicating that the subunits formed heteromers. ALDH2 activity in these cells was reduced below that of the parental ALDH2*1-expressing cells. Thus, the ALDH2*2 allele is sufficient to cause ALDH2 deficiency in vitro. Find the latest version: https://jci.me/118272/pdf The Aldehyde Dehydrogenase ALDH2*2 Allele Exhibits Dominance over ALDH2*1 in Transduced HeLa Cells Qing Xiao, * Henry Weiner,* Timothy Johnston,* and David W.
    [Show full text]
  • An Order Estimation Based Approach to Identify Response Genes
    AN ORDER ESTIMATION BASED APPROACH TO IDENTIFY RESPONSE GENES FOR MICRO ARRAY TIME COURSE DATA A Thesis Presented to The Faculty of Graduate Studies of The University of Guelph by ZHIHENG LU In partial fulfilment of requirements for the degree of Doctor of Philosophy September, 2008 © Zhiheng Lu, 2008 Library and Bibliotheque et 1*1 Archives Canada Archives Canada Published Heritage Direction du Branch Patrimoine de I'edition 395 Wellington Street 395, rue Wellington Ottawa ON K1A0N4 Ottawa ON K1A0N4 Canada Canada Your file Votre reference ISBN: 978-0-494-47605-5 Our file Notre reference ISBN: 978-0-494-47605-5 NOTICE: AVIS: The author has granted a non­ L'auteur a accorde une licence non exclusive exclusive license allowing Library permettant a la Bibliotheque et Archives and Archives Canada to reproduce, Canada de reproduire, publier, archiver, publish, archive, preserve, conserve, sauvegarder, conserver, transmettre au public communicate to the public by par telecommunication ou par Plntemet, prefer, telecommunication or on the Internet, distribuer et vendre des theses partout dans loan, distribute and sell theses le monde, a des fins commerciales ou autres, worldwide, for commercial or non­ sur support microforme, papier, electronique commercial purposes, in microform, et/ou autres formats. paper, electronic and/or any other formats. The author retains copyright L'auteur conserve la propriete du droit d'auteur ownership and moral rights in et des droits moraux qui protege cette these. this thesis. Neither the thesis Ni la these ni des extraits substantiels de nor substantial extracts from it celle-ci ne doivent etre imprimes ou autrement may be printed or otherwise reproduits sans son autorisation.
    [Show full text]
  • ZNF652, a Novel Zinc Finger Protein, Interacts with the Putative Breast Tumor Suppressor CBFA2T3 to Repress Transcription
    ZNF652, A Novel Zinc Finger Protein, Interacts with the Putative Breast Tumor Suppressor CBFA2T3 to Repress Transcription Raman Kumar,1 Jantina Manning,1 Hayley E. Spendlove,3 Gabriel Kremmidiotis,4 Ross McKirdy,1 Jaclyn Lee,1 David N. Millband,1 Kelly M. Cheney,1 Martha R. Stampfer,5 Prem P. Dwivedi,2 Howard A. Morris,2 and David F. Callen1 1Breast Cancer Genetics Group, Dame Roma Mitchell Cancer Research Laboratories, Department of Medicine, University of Adelaide and Hanson Institute; 2Endocrine Bone Laboratory, Hanson Institute, Adelaide, South Australia, Australia; 3Department of Laboratory Genetics, Women’s and Children’s Hospital, North Adelaide, South Australia, Australia; 4Bionomics, Ltd., Thebarton, South Australia, Australia; and 5Lawrence Berkeley National Laboratory, Berkeley, California Abstract gene effector zinc finger proteins may specifically The transcriptional repressor CBFA2T3is a putative interact with one or more of the ETO proteins to generate breast tumor suppressor. To define the role of CBFA2T3, a defined range of transcriptional repressor complexes. we used a segment of this protein as bait in a yeast (Mol Cancer Res 2006;4(9):655–65) two-hybrid screen and identified a novel uncharacterized protein, ZNF652. In general, primary tumors and cancer Introduction cell lines showed lower expression of ZNF652 than Tumor growth, characterized by unchecked cell division, normal tissues. Together with the location of this gene results from both the overexpression of growth-promoting on the long arm of chromosome 17q, a region of frequent oncogenes and the reduced expression of growth-inhibiting loss of heterozygosity in cancer, these results suggest tumor suppressor genes. These genes often encode proteins that In silico a possible role of ZNF652 in tumorigenesis.
    [Show full text]
  • Edinburgh Research Explorer
    Edinburgh Research Explorer International Union of Basic and Clinical Pharmacology. LXXXVIII. G protein-coupled receptor list Citation for published version: Davenport, AP, Alexander, SPH, Sharman, JL, Pawson, AJ, Benson, HE, Monaghan, AE, Liew, WC, Mpamhanga, CP, Bonner, TI, Neubig, RR, Pin, JP, Spedding, M & Harmar, AJ 2013, 'International Union of Basic and Clinical Pharmacology. LXXXVIII. G protein-coupled receptor list: recommendations for new pairings with cognate ligands', Pharmacological reviews, vol. 65, no. 3, pp. 967-86. https://doi.org/10.1124/pr.112.007179 Digital Object Identifier (DOI): 10.1124/pr.112.007179 Link: Link to publication record in Edinburgh Research Explorer Document Version: Publisher's PDF, also known as Version of record Published In: Pharmacological reviews Publisher Rights Statement: U.S. Government work not protected by U.S. copyright General rights Copyright for the publications made accessible via the Edinburgh Research Explorer is retained by the author(s) and / or other copyright owners and it is a condition of accessing these publications that users recognise and abide by the legal requirements associated with these rights. Take down policy The University of Edinburgh has made every reasonable effort to ensure that Edinburgh Research Explorer content complies with UK legislation. If you believe that the public display of this file breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. Download date: 02. Oct. 2021 1521-0081/65/3/967–986$25.00 http://dx.doi.org/10.1124/pr.112.007179 PHARMACOLOGICAL REVIEWS Pharmacol Rev 65:967–986, July 2013 U.S.
    [Show full text]
  • Genetic Variability in the Italian Heavy Draught Horse from Pedigree Data and Genomic Information
    Supplementary material for manuscript: Genetic variability in the Italian Heavy Draught Horse from pedigree data and genomic information. Enrico Mancin†, Michela Ablondi†, Roberto Mantovani*, Giuseppe Pigozzi, Alberto Sabbioni and Cristina Sartori ** Correspondence: [email protected] † These two Authors equally contributed to the work Supplementary Figure S1. Mares and foal of Italian Heavy Draught Horse (IHDH; courtesy of Cinzia Stoppa) Supplementary Figure S2. Number of Equivalent Generations (EqGen; above) and pedigree completeness (PC; below) over years in Italian Heavy Draught Horse population. Supplementary Table S1. Descriptive statistics of homozygosity (observed: Ho_obs; expected: Ho_exp; total: Ho_tot) in 267 genotyped individuals of Italian Heavy Draught Horse based on the number of homozygous genotypes. Parameter Mean SD Min Max Ho_obs 35,630.3 500.7 34,291 38,013 Ho_exp 35,707.8 64.0 35,010 35,740 Ho_tot 50,674.5 93.8 49,638 50,714 1 Definitions of the methods for inbreeding are in the text. Supplementary Figure S3. Values of BIC obtained by analyzing values of K from 1 to 10, corresponding on the same amount of clusters defining the proportion of ancestry in the 267 genotyped individuals. Supplementary Table S2. Estimation of genomic effective population size (Ne) traced back to 18 generations ago (Gen. ago). The linkage disequilibrium estimation, adjusted for sampling bias was also included (LD_r2), as well as the relative standard deviation (SD(LD_r2)). Gen. ago Ne LD_r2 SD(LD_r2) 1 100 0.009 0.014 2 108 0.011 0.018 3 118 0.015 0.024 4 126 0.017 0.028 5 134 0.019 0.031 6 143 0.021 0.034 7 156 0.023 0.038 9 173 0.026 0.041 11 189 0.029 0.046 14 213 0.032 0.052 18 241 0.036 0.058 Supplementary Table S3.
    [Show full text]
  • Supplementary Data
    Supplemental Data A novel mouse model of X-linked nephrogenic diabetes insipidus: Phenotypic analysis and therapeutic implications Jian Hua Li, Chung-Lin Chou, Bo Li, Oksana Gavrilova, Christoph Eisner, Jürgen Schnermann, Stasia A. Anderson, Chu-Xia Deng, Mark A. Knepper, and Jürgen Wess Supplemental Methods Metabolic cage studies. Animals were maintained in mouse metabolic cages (Hatteras Instruments, Cary, NC) under controlled temperature and light conditions (12 hr light and dark cycles). Mice received a fixed daily ration of 6.5 g of gelled diet per 20 g of body weight per day. The gelled diet was composed of 4 g of Basal Diet 5755 (Test Diet, Richmond, IN), 2.5 ml of deionized water, and 65 mg agar. Preweighted drinking water was provided ad libitum during the course of the study. Mice were acclimated in the metabolic cages for 1-2 days. Urine was collected under mineral oil in preweighted collection vials for successive 24 hr periods. Analysis of GPCR expression in mouse IMCD cells via TaqMan real-time qRT-PCR. Total RNA prepared from mouse IMCD tubule suspensions was reverse transcribed as described under Experimental Procedures. Tissues from ten 10-week old C57BL/6 WT mice were collected and pooled for each individual experiment. cDNA derived from 640 ng of RNA was mixed with an equal volume of TaqMan gene expression 2 x master mix (Applied Biosystems, Foster City, CA). 100 μl-aliquots of this mixture (corresponding to 80 ng of RNA) were added to each of the 8 fill ports of a 384-well plate of a mouse GPCR array panel (Applied Biosystems).
    [Show full text]
  • (12) United States Patent (10) Patent No.: US 9.284.609 B2 Tomlins Et Al
    USOO9284609B2 (12) United States Patent (10) Patent No.: US 9.284.609 B2 Tomlins et al. (45) Date of Patent: Mar. 15, 2016 (54) RECURRENT GENE FUSIONS IN PROSTATE 4,683, 195 A 7, 1987 Mullis et al. CANCER 4,683.202 A 7, 1987 Mullis et al. 4,800,159 A 1/1989 Mullis et al. 4,873,191 A 10/1989 Wagner et al. (75) Inventors: Scott Tomlins, Ann Arbor, MI (US); 4,965,188 A 10/1990 Mullis et al. Daniel Rhodes, Ann Arbor, MI (US); 4,968,103 A 1 1/1990 McNab et al. Arul Chinnaiyan, Ann Arbor, MI (US); 5,130,238 A 7, 1992 Malek et al. Rohit Mehra, Ann Arbor, MI (US); 5,225,326 A 7/1993 Bresser 5,270,184 A 12/1993 Walker et al. Mark Rubin New York, NY (US); 5,283,174. A 2/1994 Arnold, Jr. et al. Xiao-Wei Sun, New York, NY (US); 5,283,317. A 2/1994 Saifer et al. Sven Perner, Ellwaugen (DE); Charles 5,399,491 A 3, 1995 Kacian et al. Lee, Marlborough, MA (US); Francesca 5,455,166 A 10/1995 Walker Demichelis, New York, NY (US) 5,480,784. A 1/1996 Kacian et al. s s 5,545,524 A 8, 1996 Trent 5,614,396 A 3/1997 Bradley et al. (73) Assignees: THE BRIGHAMAND WOMENS 5,631, 169 A 5/1997 Lakowicz et al. HOSPITAL, INC., Boston, MA (US); 5,710,029 A 1/1998 Ryder et al. THE REGENTS OF THE 5,776,782 A 7/1998 Tsuji UNIVERSITY OF MICHIGAN, Ann 5,814,447 A 9/1998 Ishiguro et al.
    [Show full text]
  • Gelişimsel Çocuk Nörolojisi 2017
    Baskı Mart, 2017 Bu yayının telif hakları Düzen Laboratuvarlar Grubu’na aittir. Bu yayının tümü ya da bir bölümü Düzen Laboratuvarlar Grubu’nun yazılı izni olmadan kopya edilemez. Bu yayın Düzen Laboratuvarlar Grubu tarafından tanıtım ve bilgilendirme amacıyla hazırlanmış olup hazırlanma ve basım esnasında metin ya da grafiklerde oluşabilecek her türlü hata ve eksikliklerden Düzen Laboratuvarlar Grubu sorumlu tutulamaz. Kaynak göstermek ve Düzen Laboratuvarlar Grubu’ndan yazılı izin almak suretiyle bu yayında alıntı yapılabilir. Düzen Laboratuvarlar Grubu Tunus Cad. No. 95 Kavaklıdere Çankaya 06680 Ankara www.duzen.com.tr VİZYONUMUZ Hasta haklarına saygılı, bilgilendirmeyi esas alan, testleri en doğru, izlenebilir ve tekrarlanabilir yöntemlerle çalışmak ve en az hatayı esas kabul edip, iç ve dış kalite kontrolleri ile bu kavramın gerçekleştiğini göstermektedir. MİSYONUMUZ Test sonuçları üzerinde laboratuvarmızın sorumluluğu, testin klinik laboratuvarcılık standartları ve iyi laboratuvar uygulamaları sınırları içinde, tüm kontoller yapılarak çalışılması ile sınırlıdır. Test sonuçları klinik bulgular ve diğer tüm yardımcı veriler dikkate alınarak değerlendirilmektedir. AKREDİTASYON Laboratuvarımız 2004 yılında Türk Akreditasyon Kurumu (TÜRKAK) tarafından TS EN IS IEC 17025 kapsamında akredite edilmiş, 2011 yılından itibaren ise ISO15189 kapsamında akreditasyona hak kazanmıştır. Hasta kayıt, numune alma, raporlama, kurumsal hizmetler ve tüm işletim sistemi akreditasyon kapsamındadır. GÜVENİRLİLİK Laboratuvarımız CLSI programlarına üyedir
    [Show full text]
  • Differential Patterns of Allelic Loss in Estrogen Receptor-Positive Infiltrating Lobular and Ductal Breast Cancer
    GENES, CHROMOSOMES & CANCER 47:1049–1066 (2008) Differential Patterns of Allelic Loss in Estrogen Receptor-Positive Infiltrating Lobular and Ductal Breast Cancer L. W. M. Loo,1 C. Ton,1,2 Y.-W. Wang,2 D. I. Grove,2 H. Bouzek,1 N. Vartanian,1 M.-G. Lin,1 X. Yuan,1 T. L. Lawton,3 J. R. Daling,2 K. E. Malone,2 C. I. Li,2 L. Hsu,2 and P.L. Porter1,2,3* 1Division of Human Biology,Fred Hutchinson Cancer Research Center,Seattle,WA 2Division of Public Health Sciences,Fred Hutchinson Cancer Research Center,Seattle,WA 3Departmentof Pathology,Universityof Washington,Seattle,WA The two main histological types of infiltrating breast cancer, lobular (ILC) and the more common ductal (IDC) carcinoma are morphologically and clinically distinct. To assess the molecular alterations associated with these breast cancer subtypes, we conducted a whole-genome study of 166 archival estrogen receptor (ER)-positive tumors (89 IDC and 77 ILC) using the Affy- metrix GeneChip® Mapping 10K Array to identify sites of loss of heterozygosity (LOH) that either distinguished, or were shared by, the two phenotypes. We found single nucleotide polymorphisms (SNPs) of high-frequency LOH (>50%) common to both ILC and IDC tumors predominately in 11q, 16q, and 17p. Overall, IDC had a slightly higher frequency of LOH events across the genome than ILC (fractional allelic loss 5 0.186 and 0.156). By comparing the average frequency of LOH by chro- mosomal arm, we found IDC tumors with significantly (P < 0.05) higher frequency of LOH on 3p, 5q, 8p, 9p, 20p, and 20q than ILC tumors.
    [Show full text]
  • Integrating Single-Step GWAS and Bipartite Networks Reconstruction Provides Novel Insights Into Yearling Weight and Carcass Traits in Hanwoo Beef Cattle
    animals Article Integrating Single-Step GWAS and Bipartite Networks Reconstruction Provides Novel Insights into Yearling Weight and Carcass Traits in Hanwoo Beef Cattle Masoumeh Naserkheil 1 , Abolfazl Bahrami 1 , Deukhwan Lee 2,* and Hossein Mehrban 3 1 Department of Animal Science, University College of Agriculture and Natural Resources, University of Tehran, Karaj 77871-31587, Iran; [email protected] (M.N.); [email protected] (A.B.) 2 Department of Animal Life and Environment Sciences, Hankyong National University, Jungang-ro 327, Anseong-si, Gyeonggi-do 17579, Korea 3 Department of Animal Science, Shahrekord University, Shahrekord 88186-34141, Iran; [email protected] * Correspondence: [email protected]; Tel.: +82-31-670-5091 Received: 25 August 2020; Accepted: 6 October 2020; Published: 9 October 2020 Simple Summary: Hanwoo is an indigenous cattle breed in Korea and popular for meat production owing to its rapid growth and high-quality meat. Its yearling weight and carcass traits (backfat thickness, carcass weight, eye muscle area, and marbling score) are economically important for the selection of young and proven bulls. In recent decades, the advent of high throughput genotyping technologies has made it possible to perform genome-wide association studies (GWAS) for the detection of genomic regions associated with traits of economic interest in different species. In this study, we conducted a weighted single-step genome-wide association study which combines all genotypes, phenotypes and pedigree data in one step (ssGBLUP). It allows for the use of all SNPs simultaneously along with all phenotypes from genotyped and ungenotyped animals. Our results revealed 33 relevant genomic regions related to the traits of interest.
    [Show full text]