i
EVOLUTIONARY INVESTIGATION OF GROUP I INTRONS IN NUCLEAR RIBOSOMAL INTERNAL TRANSCRIBED SPACERS IN NEOSELACHII
Lizette Cooper
A Thesis
Submitted to the Graduate College of Bowling Green State University in partial fulfillment of The requirements for the degree of
MASTER OF SCIENCE
December 2018
Committee:
Scott Rogers, Advisor
Paul Morris
Vipaporn Phuntumart ii
©2018
Lizette Cooper
All Rights Reserved iii
ABSTRACT
Scott Rogers, Advisor
In an ongoing study of nuclear ribosomal DNA (rDNA) in fishes, unusually large (970 -
1418 bp) internal transcribed spacer (ITS1 and ITS2) regions were discovered in a wide diversity of members of the clade, Neoselachii (sharks, skates, and rays). This contrasts with the lengths for rDNA ITS regions in other eukaryotes, being larger by 30 to over 1000%. The additional segments of between 303 to 653 bp were due to insertions of single elements that have characteristics of group I introns, including conservation of structural and catalytic core regions.
These spacer introns (spintrons) appear to be closest to the IC1 subgroup, although group I introns of any subtype have never been previously reported in the rRNA gene locus of any animal taxon. The aim for this study is to analyze the evolution of these spintrons. The current hypotheses are that these spintrons were inserted into an ancestor of Neoselachii and Batoidea, moved from one ITS region to the other, and then each evolved independently.
iv
I dedicate this thesis to all of my family and friends, especially, my parents, Jared Prange,
Aaron Kuhman, my fraternity chapter, and my students, who have supported me through this
arduous journey. v
ACKNOWLEDGMENTS I acknowledge Mahmood Shivji for the acquisition of the shark muscle tissue utilized in this study and Scott Rogers who has provided the necessary DNA sequences. I also acknowledge all previous students who were working on this project before me, including Nancy Walker,
Armeria Vicol, and Veena Prabhu. vi
TABLE OF CONTENTS
Page
INTRODUCTION...... 1
Neoselachii and Batoidea ...... 2
Identification of Introns ...... 2
Group I Intron Structures...... 3
Hypothesis...... 3
Objectives...... 3
CHAPTER I. THE STUDY...... 5
Materials and Methods...... 5
DNA Extraction...... 5
PCR Amplification...... 6
DNA Sequencing and Alignments...... 6
Spintron Structure Analyses...... 7
Phylogenetic Analysis...... 8
CHAPTER II. RESULTS...... 9
DNA Alignments ...... 9
Phylogenetic Analysis...... 9
Spintron Structure Analyses...... 10
CHAPTER III. DISCUSSION...... 11
REFERENCES……………………………………………………………………………… 14
APPENDIX A. FIGURES ...... …………………………………………………………… 18
APPENDIX B. TABLE OF SPECIES AND ACCESSION NUMBERS FOR THE SPINTRONS
STUDIED……………………………………………………… ...... 23 1
INTRODUCTION
Group I introns interrupt expressed gene regions and are characterized by areas of conserved secondary structure and short sequences that are essential for splicing (Cech 1988,
1990; Cech and Bass 1986; Cech, Damberg, and Gutell 1994; Cech and Herschlag 1997; Jaeger,
Michel, and Westof 1997; Lambowitz and Belfort 1993; Shinohara, LoBuglio, and Rogers
1993). While many group I introns are capable of self-splicing in vitro when provided with the proper pH and free guanosine, chaperone proteins in vivo accelerate the reaction significantly
(Lambowitz and Belfort 1993). Group I introns are the most diverse class of introns. They have been divided into twelve subgroups (designated IA1, IA2, IA3, IB1, IB2, IB3, IB4, IC1, IC2,
IC3, ID and IE) based on sequence and structural differences (Michel and Westof 1990). Despite the broad phylogenetic distribution of these elements in viruses and bacteria, as well as in the chloroplast, mitochondrial, and nuclear genomes of lower eukaryotes, group I introns have thus far been conspicuously absent from animal nuclear genomes (Cech 1988; Michel and Westof
1990; Gargas, DePriest, and Taylor 1995; Michel and Westof 1996; Beagley, Okada, and
Wolstenholme 1996; Rogers et al. 1993). It has been reported that group I intron elements are present within the shark ITS1 and ITS2 regions of nuclear rDNA (ribosomal DNA). These group
I introns are present in all seven extant Orders of Neoselachii (within Elasmobranchii) and
Myliobatiformes of Batoidea (Douday et al. 2003). The presence of these group I introns are novel, because they interrupt non-genic spacer regions of the internal transcribed spacers (ITS), rather than expressed genic regions as in other organisms (Beagley, C.T. 1996). In light of this unusual location, they have been termed "spintrons" (for spacer introns (Scott Rogers)) to reflect a previously undocumented spacer insertion. This study serves to investigate the nature of these spintrons. 2
Neoselachii and Batoidea
One of the aims of this study is to gain a better understanding of the evolutionary history of the spintrons present in the sharks of Neoselachii, but to do so, the evolutionary history of
Neoselachii and Batoidea must first be described.
The traditional evolutionary tree of sharks most often commences at the Chondrichthyes during the Cambrian period around 500 mya (million years ago) with the first major divergence of an ancestor of living sharks called Elasmobranchii emerging around 440 mya. The next event is the divergence of Neoselachii, comprised of seven extant Orders of sharks and one Order of skates and rays, which appeared around 270 mya (Long 1995, Capetta 1987, Martin 1995).
However, a more recent phylogram study was done using mitochondrial DNA to explore the relatedness of Batoidea with the Orders of extant shark, and the data strongly supported shark monophyly and infers that Batoidea diverged earlier than Neoselachii (Douady, C. 2003).
Another study observed the LSU and SSU rRNA genes from twenty-two elasmobranchs, two chimeras, and two bony fishes, which fortified the separation of Batoidea and Neoselachii
(Winchell, C. 2004). The monophyly of sharks data shaped the hypotheses of this study.
Identification of Introns
It was previously observed that the ITS regions of sharks were quite large (Figure 1), and an investigation to explore these large ITS regions was conducted by using Mfold to analyze the secondary structures as described elsewhere (Shivji, Rogers, Stanhope 1996). Upon closer inspection, the large ITS regions was attributed to the presence of an intron. This intron’s structure was confirmed to be a group I intron by Nancy Walker and Scott Rogers in an unpublished study. 3
Group I Intron Structures
Group I introns interrupt expressed gene regions and are characterized by areas of conserved secondary structure and short sequences that are essential for splicing (Cech 1988,
1990; Cech and Bass 1986; Cech, Damberg, and Gutell 1994; Cech and Herschlag 1997; Jaeger,
Michel, and Westof 1997; Lambowitz and Belfort 1993; Shinohara, LoBuglio, and Rogers
1993). The secondary structure of a group I intron is folded by domains labeled P1-P10 as depicted in Figure 3. The P4-P5-P6 domain serves as a scaffold of group I introns to aid in lining up the exons that are included in P1 and P10 (Cech 1988). The P-9-P7-P3-P8 domain is the catalytic domain, and thus performs a vital function in intron splicing. P7 holds the free guanosine that initiates the first reaction of the two-reaction process of splicing (Cech 1988).
To summarize, the discovery of these novel spintrons in the ITS regions of sharks encouraged a further investigation of spintron sequence morphology, structure analysis, and phylogenetic analyses. The following hypotheses were constructed to test.
Hypothesis
1. The first appearance of these spintrons was seen in an ancestor to both Neoselachii and
Batoidea.
2. The initial insertion of the spintron was into ITS1, and then a copy inserted into ITS2 in
an early Elasmobranch lineage.
3. The spintrons in ITS1 and ITS2 evolved independently after the initial insertions.
Objectives
1. Align the ITS regions of Neoselachii species from all seven extant Orders with Orders
from Batoidea. This allows for the comparison of conserved and non-conserved regions
of ITS1 and ITS2 spintrons to address the third hypothesis. Through further sequence 4
analyses on NCBI (National Center for Biotechnology Information), the first hypothesis
will be addressed.
2. Perform phylogenetic analyses based on the spintron regions. This provides insights into
the evolutionary history of the spintrons to address hypotheses one, two, and three.
3. Determine the spintron structures. This addresses hypotheses one, two, and three through
analyses of the physical structures of the spintrons. The structural changes paired with the
phylogenetic analyses provide a view of the structural evolution of the spintrons. 5
CHAPTER I. THE STUDY Materials and Methods
DNA Extraction
DNA was extracted from muscle and fin tissue of twenty-three Neoselachii species from seven Orders obtained by Mahmood Shivji [Isurus oxyrinchus (Shortfin Mako), Lamna nasus
(Porbeagle), Carcharodon carcharias (Great White), Order Lamniformes; Hexanchus griseus
(Sixgill), Notorynchus cepedianus (Broadnose), Order Hexanchiformes; Ginglymostoma cirratum (Nurse), Chiloscyllium plagiosum (Whitespotted Bamboo), Rhincodon typus (Whale),
Order Orectolobiformes; Carcharhinus leucas (Bull), C. obscurus (Dusky), C. brevipinna
(Spinner), C. falciformis (Silky), C. plumbeus (Sandbar), C. limbatus (Blacktip), C. acronotus
(Blacknose), Prionace glauca (Blue), Cephaloscyllium ventriosum (Swell), Sphyrna lewini
(Scalloped Hammerhead), all Order Carcharhiniformes; Squalus acanthias (Spiny Dogfish),
Order Squaliformes; Squatina californica (Pacific Angel), Order Squatiniformes; Pristiophorus japonicus (Japanese Saw), P. nudipinnis Shortnose Saw), Order Pristiophoriformes;
Heterodontus francisci (Horn), Order Heterodontiformes] using a CTAB
(cetyltrimethylammonium bromide) method (Rogers and Bendich 1985, 1994; Rogers et al.
1989). The quantity of DNA was estimated by UV fluorescence on 0.6% agarose gels in TBE
(89 mM Tris-base, 89 mM boric acid, 2 mM EDTA, pH 8.0) containing 0.5 µg/ml ethidium bromide, following electrophoresis at 6 V/cm for 2 h. The sequences for Neotrygon kuhlii
(bluespotted stingray, KC204929.1), Bathyraja abyssicola (deepsea skate, AB375547.1), and
Eptatretus stouti (pacific hagfish, AF061797.1) of the Orders Myliobatiformes, Rajiformes, and
Myxiniformes, respectively, were obtained from the NCBI (National Center for Biotechnology
Information, U.S. National Library of Medicine, Bethesda, MD). 6
PCR Amplification
The nuclear rDNA regions containing ITS1, ITS2 and the 5.8S gene from each shark species were amplified using PCR (polymerase chain reaction) with primers, ITS5
(GGAAGTAAAAGTCGTAACAAGG), ITS4 (TCCTCCGCTTATTGATATGC), ITS2
(GCTGCGTTCTTCATCGATGC), ITS3 (GCATCGATGAAGAACGCAGC), ITS2R
(ATATGCTTAAATTCAGCGGG) and ITS2F (CTACGCCTGTCTGAGTGTC) composed by
Scott Rogers (Shivji, Rogers, Stanhope 1996). DNA was amplified using a GeneAmp PCR
Reagent Kit (Perkin Elmer, Foster City, CA). Each reaction consisted of 5-10 ng genomic DNA,
25 pmol of each primer, 5 pmol of each dNTP, 1 U Taq DNA polymerase, 10 mM Tris-HCl (pH
8.2), 50 mM KCl, 1.5 mM MgCl2, and 0.0001% (w/v) gelatin. The total volume of each reaction was 25 µl, overlaid with 50 µl light mineral oil (Sigma-Aldrich, St. Louis, MO). The thermal cycling program (using a PTC-100 Thermal Controller, MJ Research, Watertown, Mass.) was:
95 ℃ for 3 min, then 30 cycles of 1 min at 95°C, 45 s at 55°C, and 2 min at 72 ℃. This was followed by a 5 min incubation at 72°C.
DNA Sequencing and Alignments
Single PCR amplification bands were purified and isolated on 1.5% low-melting-point agarose gels (NuSive GTG, FMC BioProducts, Rockland, ME) using a freeze and centrifugation method (Tautz and Renz 1983; Thuring, Sanders, and Borst 1975) to separate the DNA from the agarose. Sequences were determined in both directions with the same primers (above) using a
Perkin Elmer Applied Biosystems (Foster City, CA) PRISM Ready Reaction DiDeoxy
Terminator Cycle DNA Sequencing kit and a Perkin Elmer Applied Biosystems Automated
DNASequencer (Model 310). Sequences were aligned, after confirmation of spintron structure, using CLUSTALW (Larkin MA, et al. (2007)) via Internet 7
(http://dot.imgen.bcm.tmc.edu.9331/multi-align/multi-align.html at (Kyoto University
Bioinformatics Center) and adjusted manually with the following priority order applied to each nucleotide: 1. Identical sections of nucleotides are aligned with each other, 2. Transition mutation, 3. Transversion mutation, and 4. Addition of a gap in the sequence.
Spintron Structure Analyses
In order to locate the ITS1 and ITS2 regions, the SSU (small subunit), 5.8S, and LSU
(large subunit) gene regions, were first located (using conserved regions from Shinohara,
LoBuglio, and Rogers 1999; van Nuess et al. 1994; van der Sande et al. 1992). Some species had longer ITS regions (e.g., the long ITS2 from Carcharhinus leucas) which were compared to those with shorter sequences (e.g., the short ITS2 from Sphyrna lewini). In each case, those with longer ITS regions had single large insertions near the middle of the ITS regions. They were examined for the presence of conserved group I intron structures. The core regions (P3, P7, P, Q,
R, and S) of these introns were located using criteria from other studies (Cech 1988, 1990; Cech and Bass 1986; Cech, Damberg, and Gutell 1994; Cech and Herschlag 1997; Jaeger, Michel, and
Westof 1997; Lambowitz and Belfort 1993; Shinohara, LoBuglio, and Rogers 1993; Michel and
Westof 1990, 1996). Next, the secondary structures for all of the introns and for several of the
ITS2 regions were predicted for each sequence using Mfold (Jaeger, Turner, and Zucker 1989a,
1989b; Zucker 1989). This was done using sections up to 300 nt in length, that were overlapping by approximately 25 to 200 nt with adjacent sections. Separated segments (e.g., those for P3, P4, and P7) were also examined to search for long-range interactions. The best secondary structures were derived from these composites, and the final spintron and ITS2 structures were constructed manually. RNA structures were derived by using Mfold (Jaeger, Turner, and Zucker 1989a,
1989b; Zucker 1989) with the following parameters: 1. Percent optimality at 25%; 2. Upper 8
bound at 20; 3. Window parameter at 2; 4. Maximum loop size was set to 20; 5. Maximum asymmetry was set to 30; 6. Other parameters were left on the default setting. Structures were chosen from a ΔG ranging between -20.20 and -5.00 kcal/mol.
Phylogenetic Analysis
Evolutionary analyses were conducted in MEGA7 (Kumar, 2015). The evolutionary history was inferred using the Neighbor-Joining method (Saitou, 1987). The optimal tree with the sum of branch lengths = 13.81462036 is shown (Figure 2). The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) are shown next to the branches (Felenstein, 1985). The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the Maximum Composite Likelihood method
(Tamura, 2004) and are in the units of the number of base substitutions per site. There were a total of 1001 nucleotide positions in the final dataset. 9
CHAPTER II. RESULTS
DNA Alignments
Figure 1 is a schematic diagram of the location of each ITS region and its spintron.
Spintron lengths from thirty-three sequences derived from sharks representing all seven extant
Orders and a sequence from the bluespotted ray representing one Order from Batoidea are indicated. Table 1 is a composite of all of the species and their respective NCBI reference numbers for those ITS regions with spintrons present used in this study. No spintron was observed in the ITS2 of Eptatretus stouti or in the ITS1 of Bathyraja abyssicola. There was no sequence data present for the ITS1 of the pacific hagfish and N. kuhlii or the ITS2 of the deepsea skate. ITS1 spintron sequence is not as conserved against other ITS1 spintrons and spintron sequences from ITS2. See supplemental material for the complete sequence alignment.
Phylogenetic Analysis
Figure 2 is a neighbor-joining phylogram with bootstrap replications of 1000, and bootstrap values below 50 are not shown. ITS1 spintrons and ITS2 spintrons observed in this study are diverged, and has been directly indicated by the most right vertical lines. The longest external branch of the phylogram is the ITS2 spintron of N. kuhlii, which indicates the number of nucleotide changes that has occurred is greater in the ITS2 spintron of N. kuhlii than the rest of the spintrons studied. The internal nodes of the phylogram are bifurcated, and the internal branches of the ITS1 spintrons are generally longer than the internal branches of the ITS2 spintrons. The species of shark are organized by Orders for both ITS1 spintrons and ITS2 spintrons within the same clade. 10
Spintron Structure Analyses
Secondary RNA structures of the spintrons studied are similar among species within the same Order for ITS1 and ITS2 spintrons. They have the group I intron structure and contain the standard 10 pairing regions (P1-P10) (Figure 3). Generally, the ITS1 spintrons have longer P6 and P8 domains than the ITS2 spintrons (Figures 4 and 5). A visual comparison of all of the
ITS1 spintron structures together indicate little variance in structure, and exhibits only slight variations in lengths among the P6, P8, and P9 domains. The only species with a visual difference in the ITS1 spintron structure is C. leucas where the two side stem-loops at the end of
P5 are missing (Figure 4).
The ITS2 spintrons for species in the Carcharhiniformes all have similar structures
(Figure 5). In P. glauca, P9 is shorter than in other members of the Carcharhiniformes. In C. acronotus, C. falciformis, C. obscurus, and C. plumbeus, the left arm stem-loop at the end of P5 is longer than for others within the Carcharhiniformes. Compared to the Carcharhiniformes, the
Lamniformes have shorter P1, P6, and P9 domains, and the P5 domain lacks two stem-loops and its left stem-loop is longer. In H. francisci, C. ventriosum, H. griseus, and N. cepedianus, only a single end stem-loop on P5 is present with varying lengths. In C. ventriosum, there is a longer
P1, shorter P6 and P9 domains, and lacks a mid-loop on P4. Compared to the Carchariniformes, the Hexanchiformes have shorter P2, P8, and P9 domains. P. japonicas, P. nudipinnis, S. acanthias, and S. californica share the same structures, and when compared to the
Carcarhiniformes, they have shorter P2, P8, and P9 domains and a longer end stem-loop on P5.
G. cirratum and R. typus have a shorter P9 and a shorter right end stem-loop on P5 compared to the Carchariniformes. 11
CHAPTER III. DISCUSSION Group I introns were widely absent from animal species, yet this study investigated the members of Neoselachii and Batoidea as it was previously discovered and confirmed as described above (Rogers, S. 1996, Rogers, S. and Nancy Walker) that group I introns exist in the
ITS1 and ITS2 of the nuclear rDNA (Cech 1988; Michel and Westof 1990; Gargas, DePriest, and Taylor 1995; Michel and Westof 1996; Beagley, Okada, and Wolstenholme 1996; Rogers et al. 1993). The group I introns found are present in all seven extant Orders of sharks, as well as in
Myliobatiformes, and are novel, because they interrupt the non-genic spacer regions, ITS1 and
ITS2, located between the rRNA genes, instead of in them. These group I introns were aptly named spintrons, to signify they are spacer introns, and this study aimed to investigate the initial appearance of these spintrons and their evolution rates by aligning the spintron DNA sequences, composing a phylogram, and constructing secondary RNA structures.
Reviewing the distribution of the spintrons, it is noted that the ITS1 spintron is absent more instances than the ITS2 spintron (Table 1). This suggests that the ITS1 spintrons may not be as tightly retained as ITS2 spintrons. When observing the sequences, the conservation of
DNA, as presented by the frequency of identical and similar pieces of DNA, between all ITS1 spintron sequences is lower than the conservation seen between all ITS2 spintron sequences
(supplemental material), which implies that ITS1 spintrons have a higher nucleotide mutation rate than ITS2 spintrons, and is supported by data in this study (Figure 2). The combination of a greater mutation rate and higher occurrence of an absence of an ITS1 spintron could suggest that sequence conservation is not as critical for ITS1 spintrons as for ITS2 spintrons. Past studies of sharks were done to develop a method of identifying shark species from ambiguous shark tissue by composing primers to amplify various sections of rDNA. A pair of primers was made to 12
amplify the ITS2 region, which also encompassed the spintron, and the result was a viable method of identifying different shark species from ambiguous tissue for shark conservation purposes (Shivji, M. et al.2003). The results from the aforementioned study and the spintron sequence data from this study show that ITS2 spintron sequences are highly conserved, but are still variable across species to be utilized as a tool for identification and for an evolutionary investigation.
The phylogram in this study (Figure 2) depicts that ITS1 spintrons and ITS2 spintrons are diverged, and therefore, it is unclear of when they initially inserted in the Neoselachii and
Batoidea, but it can be hypothesized that they inserted into an ancestor prior to the divergence of skates and rays from Elasmobranchii (Douady, C. et al 2003, Winchell, C. 2004). The longest external branch distance belongs to the ITS2 of N. kuhlii signifying that this spintron sequence has accumulated the most nucleotide mutations compared to the rest of the spintrons observed, and it can be inferred that N. kuhlii is older than Neoselachii, which is strengthened by the study conducted that refutes the previous hypothesis that Batoidea are derived sharks (Douady, C. et al.
2003, Winchell, C. 2004). In general, the internal branches of the phylogram are longer for ITS1 spintrons than ITS2 spintrons, which indicates more nucleotide mutations have occurred in the most recent ancestors of the taxa for ITS1 spintrons than ITS2 spintrons. This likely suggests that
ITS1 spintrons have a greater evolution rate than ITS2 spintrons.
While sequence conservation in ITS1 spintrons are low, it is observed that spintron structures for the ITS1 spintron and ITS2 spintron are highly conserved, and suggests that spintron structure is crucial for both spintrons in species that contain them (Figures 4 and 5).
This points to the likelihood that any mistakes in the folding of either spintron could affect ITS processing, via improper splicing, and significantly reduce or inactivate the production of 13
ribozymes (van der Sande, C. et al. 1992; van Nues, R. et al. 1994; Shinohara, M.L. et al. 1999).
The domains where variations in lengths are observed are located in the scaffold domains and not in the catalytic core of the spintron structure supporting the notion that structure of the catalytic core is more necessary than the scaffold domain for proper splicing (Cech, T.R. 1988).
This study investigated the probability that the first appearance of these spintrons were in an ancestor to Neoselachii and Batoidea. The phylogram (Figure 2) presents N. kuhlii as the oldest species and supports the hypothesis that these ITS spintrons were likely inserted in an ancestor to both Neoselachii and Batoidea.
The mutation rate of the spintrons was also investigated in this study. Sequence data alignments and a phylogenetic analysis were executed to observe sequence conservation and sequence mutation changes. It was found that ITS1 spintrons have less sequence conservation and generally more mutation changes of the spintron in a close ancestor, and consequently, ITS1 spintrons have a higher mutation rate than ITS2 spintrons. Assuming that the time span presented by the phylogram is constant for both ITS spintrons and N. kuhlii is treated as an outgroup, the data supports the hypothesis that these spintrons evolved independently, as ITS1 spintrons experience more nucleotide mutations than ITS2 spintrons.
The other important facet explored from this study was the notion that this spintron primarily inserted into ITS1, then a copy inserted into ITS2 in an early Elasmobranch ancestor.
Considering the ITS1 spintrons and ITS2 spintrons are diverged early in the phylogram, there is insufficient data to support this hypothesis. To expand this study and address the hypothesis, more DNA and secondary RNA structure analyses, spintron alignments, and phylogenetic tests would have to be made in Batoidea and Neoselachii. 14
REFERENCES
Beagley, C.T., Okada, N.A., & Wolstenholme, D.R. (1996) Two mitochondrial group I introns
in a metazoan, the sea anemone Metridium senile: One intron contains genes for subunits
1 and 3 of NADH dehydrogenase. Proceedings of the National Academy of Sciences.
USA 73: 5619-5623.
Capetta, H. (1987) Chondrichthyes II. Mesozoic and Cenozoic Elasmobrachii, vol. 3B Handbook
Paleoichthyology, Gustav Fischer Verlag, Stuttgart.
Cech, T.R. & Bass, B.L. (1986) Biological catalysis by RNA. Annual Review of Biochemistry.
55: 599-629.
Cech, T.R. (1988). Conserved sequences and structures of group I introns: building an active site
for RNA catalysis-a review. Gene 73: 259-271.
Cech, T.R., Damberger, S.H. & Gutell, R.R. (1994) Representation of the secondary and tertiary
structure of group I introns. Nature Structural and Molecular Biology. 1: 273-280.
Cech, T.R., & Herschlag, D. (1997) In Eckstein, F. & Lilley, D.M.J. (Eds) Catalytic RNA.
Nucleic Acids and Molecular Biology. vol 10, Springer Verlag, New York, p. 1-17.
Douady, C., Dosay, M., Shivji, M., Stanhope, M. (2003) Molecular phylogenetic evidence
refuting the hypothesis of Batoidea (rays and skates) as derived sharks. Evolution 26:
215-221.
Felenstein J. (1985) Confidence limits on phylogenies: An approach using the bootstrap.
Evolution 39: 783-791.
Gargas, A., DePriest, P.T. & Taylor, J.W. (1995) Positions of multiple insertions in SSU rDNA
of lichen-forming fungi. Molecular Biology and Evolution. 12: 208-218. 15
Jaeger, J. A., Turner, D. H. & Zuker, M. (1989b) Improved predictions of secondary structures
for RNA. Proceedings of the National Academy of Sciences. USA 86: 7706-7710.
Jaeger, J. A., Turner, D. H. & Zuker, M. (1990) Predicting optimal and suboptimal secondary
structure for RNA. Methods in Enzymology 183: 281-306.
Jaeger, L., Michel, F. & Westof, E. (1997) In Eckstein, F. & Lilley, D.M.J. (Eds) Catalytic RNA.
Nucleic Acids and Molecular Biology. vol 10, Springer Verlag, New York, p. 33-51.
Kumar S., Stecher G., and Tamura K. (2015). MEGA7: Molecular Evolutionary Genetics
Analysis version 7.0 for bigger datasets. Molecular Biology and Evolution (submitted).
Lambowitz, A.M. & Belfort, M. (1993) Introns as mobile genetic elements. Annual Review of
Biochemistry. 62: 587-622.
Long, J.A. (1995) The Rise of Fishes: 500 Million Years of Evolution, The Johns Hopkins
University Press, Baltimore, MD.
Martin, A. P. (1995) Metabolic Rate and Directional Nucleotide Substitution in Animal
Mitochondrial DNA. Molecular Biology and Evolution. 12: 1114-1123.
Michel, F. & Westof, E. (1990) Modelling of the three-dimensional architecture of group I
catalytic introns based on comparative sequence analysis. Journal of Molecular Biology.
216: 585-610.
Michel, F. & Westof, E. (1996) Visualizing the logic behind RNA self-assembly. Science 273:
1676-1677.
Pank, Melissa, Michael Stanhope, Lisa Natanson, Nancy Kohler, and Mahmood Shivji. 2001.
Rapid and simultaneous identification of body parts from the morphologically similar
sharks Carcharihinus obscurus and Carcharhinus plumbeus (Carcharhinidae) using
multiplex PCR. Marine Biotechnology 3: 231-240. 16
Rogers, S.O., and A.J. Bendich. (1985) Extraction of DNA from milligram amounts of fresh,
herbarium and mummified plant tissues. Plant Molecular Biology. 2: 69-76.
Rogers, S.O., and A.J. Bendich. (1994) Extraction of total cellular DNA from plants, algae and
fungi. In: Gelvin, S.B., and Schilperoort, R.A., eds. Plant Molecular Biology Manual. 3rd
ed. Dordrecht, the Netherlands: Kluwer Academic Press. P D1:1-8.
Rogers, S. O., Yan, Z. H., Shinohara, M., LoBuglio, K.F. & Wang, C. J. K. (1993) Messenger
RNA intron in the nuclear 18s ribosomal RNA gene of deuteromycetes. Current
Genetics. 23: 338-342.
Saitou N. and Nei M. (1987). The neighbor-joining method: A new method for reconstructing
phylogenetic trees. Molecular Biology and Evolution 4: 406-425.
Shinohara, M.L., LoBuglio K.F. & Rogers, S.O. (1999). Comparison of ribosomal DNA ITS
regions among geographic isolates of Cenococcum geophilum. Current Genetics. 35:
527-353.
Shivji, M., C. Tagliaro, L. Natanson, N. Kohler, S.O. Rogers and M. Stanhope. 1996. Utility of
ribosomal DNA ITS2 for deriving shark species-diagnostic identification markers.
Aquaculture Biotechnology Symposium Proceedings, Physiological Section, American
Fisheries Society, pp. 87-93.
Shivji, Mahmood, Shelley Clarke, Melissa Pank, Lisa Natanson, Nancy Kohler, and Michael
Stanhope. 2001. Genetic identification of pelagic shark body parts for conservation and
trade monitoring. Conservation Biology 16: 1036-1047.
Shivji, M., S.O. Rogers and M. Stanhope. 1996. Molecular studies on sharks. Shark Tagger 1995
Summary, NOAA. p.15. 17
Tamura K., Nei M., and Kumar S. (2004). Prospects for inferring very large phylogenies by
using the neighbor-joining method. Proceedings of the National Academy of Sciences
(USA) 101:11030-11035. van Nues, R. W., Rientjes, J. M. J., van der Sande, C. A. F. M., Zerp, S. F., Sluiter, C., Venema,
J., Planta, R.J. & Raue, H. A. (1994) Separate structural elements within internal
transcribed spacer 1 of Saccharomyces cerevisiae precursor ribosomal RNA direct the
formation of 17S and 26S rRNA. Nucleic Acids Res. 22: 912-919. van der Sande, C. A. F. M., Kwa, M., van Nus, R. W., van Heerkhuizen, H., Raue, H. A. &
Planta, R. J. (1992) Functional Analysis of Internal Transcribed Spacer 2 of
Saccharomyces cerevisiae Ribosomal DNA. Journal of Molecular Biology. 223: 899-
910.
Winchell, Christopher J., Andrew Martin, and Jon Mallat. (2004) Phylogeny of elasmobranchs
based on LSU and SSU ribosomal RNA genes. Molecular Phylogenetics and Evolution.
31: 214-224. 18
APPENDIX A. FIGURES
l1
Figure 1. Location of the spintrons within the ITS1 and ITS2 region. Lengths (in nucleotides) of the sequences are as follows: C. leucas, l1= 337, l2=516; C. brevipinna, l1= 0, l2= 516; C. falciformis, l1= 0, l2= 538;C. plumbeus, l1= 0, l2= 526; P. glauca, l1= 0, l2= 492; C. obscurus, l1= 0, l2= 526; R. typus, l1 = 0, l2 = 488; C. carcharias, l1 = 0, l2 = 475; P. nudipinnis, l1 = 0, l2
= 364; C. limbatus, l1 = 0, l2 = 534; C. ventriosum, l1 = 0, l2 = 426; C. acronotus, l1 = 0, l2 =
526; I. oxyrinchus, l1 = 511, l2 = 491; H. griseus, l1= 578, l2 = 303; G. cirratum, l1= 472, l2 =
545; H. francisci, l1 = 737, l2 = 457; C. plagiosum, l1 = 488, l2 = 0; L. nasus, l1 = 644, l2 = 503;
N. cepedianus, l1 = 592, l2 = 333; P. japonicus, l1 = 624, l2 = 363; S. acanthias, l1 = 653, l2 =
377; S. californica, l1 = 610, l2 = 374; S. lewini, l1= 491, l2 = 0 N. kuhlii, l2 = 64 (Scott Rogers). 19
Figure 2. Neighbor-joining phylogram based on aligned ITS1 and ITS2 spintrons, bootstrap value on nodes (1000 replications). Bootstrap values below 50 are not shown. The right of the diagram contains the Orders of the species in the phylogram. To the right of the Orders, the location of the spintrons is noted. 20
vii
vi v
Figure 3. Line representation of the C. leucas ITS2 intron highlighting the functional regions (as in Cech et al. 1994, Jaeger etal. 1997). Shaded boxed in regions i, ii, iii, iv, v, vi, and vii correspond to differences in length between ITS2 and ITS1 spintrons corresponding to Figures 4 and 5. Arrows indicate splicing sites (Scott Rogers). 21
Notorynchus cepedianus Pristiophorus japonicus Squatina acanthus Squatina californica
Lamna nasus Isurus oxyrhinchus Heterodontus franscii
Ginglymostoma cirratum Hexanchus griseus Chiloscyllium plagiosum
Carcharhinus leucas Sphyrna lewini
Figure 4. ITS1 spintron structures. Red lines represent ITS1 flanking sites. Shark species are shown below the structure model (Scott Rogers). 22
Carcharhinus acronutus Prionace glauca Carcharhinus brevipinna Carcharhinus falciformis Carcharhinus leucas Carcharhinus obscurus Carcharhinus limbatus Carcharhinus plumbeus
Carcharodon carcharias Cephaloscyllium ventriosum Isurus oxyrhinchus Heterodontus franscii Lamna nasus
Hexanchus griseus Pristiophorus japonica Notorynchus cepedianus Pristiophorus nudipinnis Ginglymostoma cirratum Neotrygon kuhlii Squatina acanthus Rhincodon typus Squatina californica
Figure 5. ITS2 spintron structures. Red lines represent ITS2 flanking sites. Shark and ray species are shown below the structure model (Scott Rogers).
23
APPENDIX B. TABLE OF SPECIES AND ACCESSION NUMBERS FOR THE
SPINTRONS STUDIED
Species ITS1 Accession number ITS2 Accession number Squatina californica JF906176 JN003443 Squalus acanthias MH843529 JN003445 Pristiophorus japonicus JN003430 JN003448 Pristiophorus nudipinnis No intron JN003449 Carcharodon carcharias No intron AY198335 Lamna nasus JN003431 JN003440 Isurus oxyrinchus JN003432 JN003441 Hexanchus griseus JN003428 JN003446 Notorynchus cepedianus JN003429 JN003447 Chiloscyllium plagiosum JN003434 No intron Rhincodon typus No intron JN003442 Heterodontus francisci JN003427 JN003444 Carcharhinus leucas JN003436 JN039366 Carcharhinus limbatus No intron JN003438 Carcharhinus brevipinna No intron JN039365 Carcharhinus acronotus No intron GU385345 Carcharhinus plumbeus No intron AY033820 Carcharhinus falciformes No intron AF513986 Carcharhinus obscurus No intron AY033819 Prionace glauca No intron JN003439 Sphyrna lewini JN003435 No intron Cephaloscyllium ventriosum No intron JN039367 Ginglymostoma cirratum JN003433 JN243354 Neotrygon kuhlii Not determined KC204929