The Effects of Sea Cucumber Extracts (Holothuria Scabra) on Human Placenta- Derived Mesenchymal Stem Cells

THE EFFECTS OF SEA CUCUMBER EXTRACTS (HOLOTHURIA SCABRA) ON HUMAN PLACENTA- DERIVED MESENCHYMAL STEM CELLS

MISS JUTARAT SAENGSUWAN

A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE (BIOCLINICAL SCIENCES) CHULABHORN INTERNATIONAL COLLEGE OF MEDICINE THAMMASAT UNIVERSITY ACADEMIC YEAR 2017 COPYRIGHT OF THAMMASAT UNIVERSITY

Ref. code: 25605729040302HAO THE EFFECTS OF SEA CUCUMBER EXTRACTS (HOLOTHURIA SCABRA) ON HUMAN PLACENTA- DERIVED MESENCHYMAL STEM CELLS

MISS JUTARAT SAENGSUWAN

Ref. code: 25605729040302HAO

Thesis Title The effects of sea cucumber extracts (Holothuria scabra) on human placenta mesenchymal stem cells

Author Miss Jutarat Saengsuwan

Degree Master of Science in Bioclinical Sciences

Major Field/Faculty/University Stem cell and Regenerative Medicine Chulabhorn International College of Medicine Thammasat University

Thesis Advisor Assistant Professor Napamaee Kornthong, Ph.D. Thesis Co-Advisor Associate Professor Sirikul Manochantr, Ph.D. Associate Professor Chairat Tantrawatpan, Ph.D.

Academic Years 2017

Ref. code: 25605729040302HAO (1)

ABSTRACT

Sea cucumber, Holothuria scabra, has been emphasized on their ability in the regeneration of their own body. They may provide new pathways to target the treatment of degenerating diseases in humans, due to their regeneration ability. The thesis was focused on the effects of H. scabra extracts on mesenchymal stem cells (MSCs) derived from human placenta, including MSCs proliferation and neuronal differentiation. The H. scabra crude protein extracts were prepared from the body wall (BW), viscera (VI), radial nerve cord (RN) and nerve ring (NR) by using different extraction buffers, including 0.1M phosphate buffer saline (PBS) and 0.1M acetic acid buffers. The SDS- PAGE showed protein abundance, with various molecular mass, within the BW and VI extracts using 0.1M PBS buffer. Less protein abundance was observed for all organ extracts using 0.1M acetic acid buffer (AA). The western blot analysis demonstrated that nerve growth factor (NGF) was expressed in VI-PBS at 13 kDa. On the other hand, epidermal growth factor (EGF) also showed in BW-PBS, BW-AA, VI-PBS, RN-PBS and NR-PBS at 160 kDa. The MSCs were then treated with different doses of H. scabra extracts using MTT assay for cytotoxicity and cell proliferation. We found that the treatment of 0.1 and 1 µg/ml of H. scabra extracts increased the proliferative rate of MSCs when compared with the sham. In addition, real-time PCR of epidermal growth factor (EGF) and epidermal growth factor receptor (EGFR) transcripts was performed and shown that both genes shown higher expression level than control on day10 at 1 µg/ml of BW-PBS. After neural induction, the MSCs was detected MAP2, Nestin and β-tubulin III by immunocytochemistry. MSCs expressed β tubulin III and Nestin positive signals in the cytoplasm, although MAP2 signal is very limited signal. Moreover, real-time PCR of MAP2, Nestin and β-tubulin III transcripts were carried out and shown that β-tubullin III mRNA showed very high level at RNL2-0.1 neural MSCs group, comparing to sham control medium group. MAP2 mRNA expression showed high level at BWL1-0.1, BWL1-1, BWL2-0.1, BWL2-1 and RNL2-0.1 groups. Interestingly, Nestin mRNA expressed within the similar level between the groups. In this study, it was the first report of the ability of H. scabra crude extracts on MSCs proliferation and differentiation. While the further studies are necessary in order to conclude the regulation and mechanism on the effects of sea cucumber on MSCs.

Ref. code: 25605729040302HAO (2)

Keywords: Holothuria scabra, Mesenchymal stem cells, Sea cucumber

Ref. code: 25605729040302HAO (3)

ACKNOWLEDGEMENTS

I would like to express my gratitude to all people who have contributed to improve this thesis and also develop me as a good scientist during these years. Without all peoples, this work could not be succeeded. First and foremost, I would like to express my deeply grateful acknowledgement to my major advisor, Assist. Prof. Dr. Napamanee Kornthong for supervising this project and always encourage and support during these years. I also would like to express my gratefulness to my co-advisors, Assoc. Prof. Dr. Sirikul Manochantr and Assoc. Prof. Dr. Chairat Tantrawatpan for providing scientific thinking, support and technical advice during the study. My grateful appreciation also extended Prof. Dr. Prasert Sobhon for kindness suggestion and valuable recommendations in this work. Moreover, my sincere thanks also extend to all members of the Center of excellence in stem cell research, Thammasat University (TCSR), Miss Supawadee Duangprom, Miss Supawadee Kheowkae, Miss Jutaporn Pollawat and Miss Wilailuk Ampansri, staffs from Chulabhorn International College of Medicine for guidance, suggestion, support and shared the knowledges. They didn’t not only teach and advice of techniques, procedures and methods for laboratories but also making my life more enjoyable over the past few years. Finally, I would like to thank my dearest family, my parents, my older sister, my family, my friends and others person for all their support and constant encouragement throughout the period of this thesis and the research grant from Thammasat University, Chulabhorn International College of Medicine and the Center of excellence in stem cell research, Thammasat University (TCSR).

Miss Jutarat Saengsuwan

Ref. code: 25605729040302HAO (4)

TABLE OF CONTENTS

Page ABSTRACT (1)

ACKNOWLEDGEMENTS (3)

LIST OF TABLES (8)

LIST OF FIGURES (9)

LIST OF ABBREVIATIONS (13)

CHAPTER 1 INTRODUCTION 1

1.1 Introduction 1 1.2 Objective 2 1.2.1 Overall Objective 2 1.2.2 Specific objectives 2

CHAPTER 2 REVIEW OF LITERATURE 3

2.1 Sea cucumbers 3 2.1.1 Biology of sea cucumber 3 2.1.2 Concept of regeneration of sea cucumber 3 2.1.3 Visceral regeneration of sea cucumber 7 2.2 Mesenchymal stem cells 16 2.2.1 Morphology of MSCs 16 2.2.2 Differentiation potential of MSCs 17 2.3 The effect of sea cucumber extracts condition on proliferation 17

CHAPTER 3 RESEARCH METHODOLOGY 20

Ref. code: 25605729040302HAO (5)

3.1 Sea cucumber extraction 20 3.1.1 Tissue collection 20 3.1.2 Protein preparation 20 3.1.3 Measuring concentration of protein 20 3.1.4 SDS-PAGE 21 3.1.5 Western blot analysis 21 3.2 Cell preparation 21 3.2.1 Mesenchymal stem cell derived from human placenta 21 (PL-MSCs). 3.3 Cell culture 22 3.4 Characterization of MSCs 22 3.4.1 Multi-linage cell differentiation 22 3.4.1.1 Osteogenic differentiation 22 3.4.1.2 Adipogenic differentiation 22 3.4.2 Immunophenotypical 23 3.5 Effect of H. scabra on MSCs proliferation 23 3.5.1 Cytotoxicity test 23 3.5.2 Growth kinetic curve 23 3.5.3 Proliferative gene expression analysis by qRT-PCR 24 3.6 Treat sea cucumber crude extract 26 3.6.1 Neural differentiation 26 3.6.1.1 Commercial neural differentiation medium 26 3.6.1.2 In-House neural differentiation medium 26 3.6.2 Immunofluorescence staining of neurogenic-MSCs 27 3.7 RNA extraction 27 3.8 First-strand cDNA synthesis 28 3.9 Quantitative real-time polymerase chain reaction (qRT-PCR) 28

CHAPTER 4 REVIEW OF LITERATURE 30

Ref. code: 25605729040302HAO (6)

Page

4.1 Isolation and characterization of PL-MSCs from placenta 30 4.1.1 Isolation PL-MSCs from placenta 30 4.1.2 Characterization of PL-MSCs 32 4.1.2.1 Adipogenic differentiation potential of PL-MSCs 32 4.1.2.2 Osteogenic differentiation potential of PL-MSCs 34 4.1.2.3 Immunophenotype of MSCs derived from placenta 36 4.2 Proliferative effect of H. scabra on PL-MSCs 39 4.2.1 Protein profile of H. scabra using SDS-PAGE 40 4.2.2 Protein identification of H. scabra growth factor using 41 Western blot analysis 4.2.3 Cell proliferation and cell cytotoxicity determined by MTT 44 assay 4.2.4 Cell growth determined by direct cell counting 47 4.2.5 Proliferative genes expression of PL-MSCs by qRT-PCR 50 4.3 Neural differentiation potential of MSCs derived from placenta 57 with sea cucumber extracts 4.3.1 Commercial neural differentiation medium 57 4.3.2 In-House neural differentiation medium 64 4.4 Neural genes expression by RT-PCR 68

CHAPTER 5 CONCLUSIONS AND RECOMMENDATIONS 72

REFERENCES 77

APPENDICES 80

APPENDIX A 81

APPENDIX B 86

Ref. code: 25605729040302HAO (7)

Page APPENDIX C 91

BIOGRAPHY 100

Ref. code: 25605729040302HAO (8)

LIST OF TABLES

Tables Page 3.1 The sequence of primers for proliferative genes and 25 house-keeping gene 3.2 The sequence of primers for neurogenic genes and 29 house-keeping gene 4.1 The surface marker expression profiles of MSCs from placenta 37

Ref. code: 25605729040302HAO (9)

LIST OF FIGURES

Figures Page 1.1 Regeneration of various organism 5 1.2 Principle of basic mechanism of regeneration in vertebrates and 6 invertebrates. 1.3 Schematic diagram shows the tissue layers of the holothurians 8 digestive tract 1.4 Diagram showing the nervous system of A.japonicus 9 1.5 Anatomical diagram showing organization of the regenerating 11 digestive tube in a holothurian, at different times points after evisceration 1.6 Histological sections of normal and regenerating intestine during 12 the different regeneration stages in the sea cucumber A.japonicus 1.7 Uninjured and regenerating stages of the radial nerve cord 13 (RNC) of H. glaberrima 1.8 KEGG pathway and putative transcripts in regenerative 14 A. japonicus transcriptome 1.9 Bioactive components of sea cucumber extracts and their 15 biological effects on various human cancer cells and cancer animal models 1.10 The interactions between a sulfated polysaccharide from Haishen 18 (HS) and EGF (20 ng/ml) or FGF-2 (20ng/ml) on the cell viability of rat NSPCs in vitro 1.11 The effect of Stichopus variegatus water extract (SVWE) and 19 EGF treatments on spinal astrocytes culture in vitro 4.1 Morphology of mesenchymal stromal cells 31 4.2 Adipogenic differentiation of PL-MSCs 33 4.3 Osteogenic differentiation of PL-MSCs 35

Ref. code: 25605729040302HAO (10)

LIST OF FIGURES (cont.)

Figures Page 4.4 Immunophenotypes of PL-MSCs. Placenta derived MSCs were 38 positive for typical MSC markers; (CD73, CD90 and CD105) and negative for hematopoietic markers CD34 and CD45 4.5 The SDS-PAGE which showed the bands of protein from Body 39 wall (BW), Viscera (VI), Nerve ring (NR) and Radial nerve (RN) in PBS compare with in acetic acid 4.6 Western blot analysis of NGF protein representing the positive 42 signal in VI-PBS at 13 kDa, no positive signal at BW-PBS, BW-AA,VI-AA, RN-PBS, RN-AA, NR-PBS and NR-AA 4.7 Western blot analysis of EGF protein representing the positive 43 signal in 160 kDa of BW-PBS, BW-AA, VI-PBS, RN-PBS and NR-PBS 4.8 Proliferation of PL-MSCs after treated with the body wall from 45 sea cucumber (H. scabra) extracts at days 1, 3, 5 post-treatment 4.9 Proliferation of PL-MSCs after treated with the viscera from 46 sea cucumber (H. scabra) extracts at days 1, 3, 5 post-treatment 4.10 Growth kinetic of PL-MSCs after treated with the body wall 48 from sea cucumber (H. scabra) extracts at days 1, 3, 5 post-treatment 4.11 Growth kinetic of PL-MSCs after treated with the viscera from 49 sea cucumber (H. scabra) extracts at days 1, 3, 5 post-treatment 4.12 mRNA expression of EGF gene in PL-MSCs cultured in 51 complete medium with 5%FBS (control) comparing with complete medium with 5%FBS, and supplemented with 0.1-1 µg/ml of BW-PBS and RN-PBS for 3 and 7 days

Ref. code: 25605729040302HAO (11)

LIST OF FIGURES (cont.)

Figures Page 4.13 mRNA expression of EGF gene in PL-MSCs cultured in 52 complete medium with 5%FBS (control) comparing with complete medium with 5%FBS, and supplemented with 0.1-1 µg/ml of BW-PBS and RN-PBS for 10 and 14 days 4.14 mRNA expression of EGFR gene in PL-MSCs cultured in 53 complete medium with 5%FBS (control) comparing with complete medium with 5%FBS, and supplemented with 0.1-1 µg/ml of BW-PBS and RN-PBS for 3 and 7 days 4.15 mRNA expression of EGFR gene in PL-MSCs cultured in 54 complete medium with 5%FBS (control) comparing with complete medium with 5%FBS, and supplemented with 0.1-1 µg/ml of BW-PBS and RN-PBS for 3 and 7 days 4.16 mRNA expression of EGF gene in PL-MSCs cultured in 55 complete medium with 5%FBS (control) comparing with complete medium with 5%FBS, and supplemented with 0.1-1 µg/ml of BW-PBS and RN-PBS for 3, 7, 10 and 14 days 4.17 mRNA expression of EGFR gene in PL-MSCs cultured in 56 complete medium with 5%FBS (control) comparing with complete medium with 5%FBS, and supplemented with 0.1-1 µg/ml of BW-PBS and RN-PBS for 3, 7, 10 and 14 days 4.18 Representative photomicrographs showing the expression of 58 β-tubulin III of neural diffentiation of PL-MSCs after neural induction for 72 h by various kind of mediums 4.19 Representative photomicrographs showing the expression of 60 MAP2 of neural diffentiation of PL-MSCs after neural induction for 72 h by various kind of mediums

Ref. code: 25605729040302HAO (12)

LIST OF FIGURES (cont.)

Figures Page 4.20 Representative photomicrographs showing the expression of 62 Nestin of neural diffentiation of PL-MSCs after neural induction for 72 h by various kind of mediums 4.21 Representative photomicrographs anti-β tubulin III staining of 66 neural diffentiation of PL-MSCs after cultured with body wall, viscera or radial nerve in different doses (0.1-1µg/ml) for 10 days 4.22 The number of neurons after PL-MSCs were induced with 67 in-house differentiation media adding different doses (0.1-1 µg/ml) of the extracts from body wall, viscera and radial nerve for 10 days 4.23 mRNA expression of β tubulin III gene in PL-MSCs cultured in 69 complete medium (DMEM) comparing with shame control medium group, and supplemented with 0.1-1 µg/ml of BWL1, VSL1, RNL1, BWL2 and RNL2 4.24 mRNA expression of MAP2 gene in PL-MSCs cultured in 70 complete medium (DMEM) comparing with shame control medium group, and supplemented with 0.1-1 µg/ml of BWL1, VSL1, RNL1, BWL2 and RNL2 4.25 mRNA expression of Nestin gene in PL-MSCs cultured in 71 complete medium (DMEM) comparing with shame control medium group, and supplemented with 0.1-1 µg/ml of BWL1, VSL1, RNL1, BWL2 and RNL2 5.1 Distribution of the species to the sequences, of which the 73 unigenes of A. japonicus obtained in this study were matched

Ref. code: 25605729040302HAO (13)

LIST OF ABBREVIATIONS

Symbols/Abbreviations Terms AA Acetic acid AD Alzheimer’s disease BW Body wall BSA Bovine serum albumin EDTA Ethylene diamine tetra-acetic acid FBS Fetal bovine serum Haishen Sea cucumber HLA Human leukocyte antigen HSCT Hematopoietic stem cell transplantation IBMX Isobutyl methyl xanthine MSCs Mesenchymal stem cells OR Mesenchymal stromal cells PBS Phosphate buffered saline RN Radial nerve SVZ Subventricular zone VI Viscera

Ref. code: 25605729040302HAO 1

CHAPTER 1 INTRODUCTION

1.1 Introduction

The neurodegenerative disorders, such as Alzheimer’s disease (AD), dementia, Huntington’s disease, and Parkinson’s disease, among others are affected people worldwide and the number tend to be increased. Neurodegenerative diseases was wildly affect to elderly people and the major cause is progress of deteriorated nerve cells until they death. AD is the most common type of dementias in adults’ age over 65 years old. For AD therapy, there are many researches try to improve the way to treat this disease, but it has only treatment to improve the symptoms by using the drug. Nowadays, the efficient treatment for AD has not been developed yet, especially to diminish the degenerative process of AD brain. Although, there are some reports suggesting that the adult mammal brains contained some kind of stem cells residing in the subventricular zone (SVZ), hippocampus, and spinal cord. These cells have been proven to be involved in neurogenesis process, such as neuron, astrocytes, and oligodendrocytes, and may migrate to the injury region, proliferate and promote neural regeneration in the AD. Sea cucumber, Holothuria scabra, is an economically important aquatic species, which is found in coastal area and naturally distributed in Asian countries, including China, Japan, Malaysia, Thailand, Viet Nam, Indonesia and Philippines. Sea cucumbers are commonly found along the gulf of Thailand particularly with 2 species, Holothuria scabra, and Holothuria atra. Sea cucumbers are well-known for their ability to regularly discard completely or mostly their internal organs in response to an external stimulus, or on a seasonal basis, called eviceration. Sea cucumbers contain the visceral regeneration ability. They can completely discard most of internal organs or viscera, including oral, intestine, esophagus, pharyngeal bulb, and respiratory tree, and then rapidly regrow them. Furthermore, they also can regenerate their body wall and radial nerve cord when they are injured. The knowledge of regeneration processes and the factors that drive them may provide new pathways to target the treatment of degenerating diseases mammals and humans, especially in cases where the endogenous

Ref. code: 25605729040302HAO 2 pathways in mammal may have been lost, including degenerative disorder and neurodegenerative disorder. From this modification, we suggested that sea cucumbers may have some growth factors, which affected the proliferation and neurogenic differentiation in human multipotent stem cells. Therefore, we attempt to study the effects of H. scabra on human placenta- derived mesenchymal stem cells proliferation, and to find the optimal dose of H. scabra protein extracts. Moreover, the neural differentiation also studies after the treatment of H. scabra protein extracts with MSCs. From this study, it may provide a background knowledge to develop, modify, and synthesize a better new natural product to treat degenerative diseases in the future.

1.2 Objective

1.2.1 Overall objective To study the effects of protein extraction from sea cucumbers could enhance human placenta tissue-derived MSCs proliferation and activate neural differentiation

1.2.2 Specific objectives 1. To isolate and characterize MSCs from placenta. 2. To study and identify growth factors in sea cucumber extracts by western blot analysis 3. To study the division and proliferative capacity of MSCs derived from human placenta which are cultured in sea cucumber extracts condition in comparison to normal culture condition. 4. To study the neural differentiation capacity of MSCs derived from human placenta which are cultured in sea cucumber extracts condition in comparison to in normal culture condition. 5. To study the expression of neural genes in MSCs derived from placenta cultured in sea cucumber extracts condition comparing with normal culture condit

Ref. code: 25605729040302HAO 3

CHAPTER 2 REVIEW OF LITERATURE

2.1 Sea cucumbers

2.1.1 Biology of sea cucumber Sea cucumber (Holothuria scabra) is an important aquaculture species for coastal and marine economy, they can be found in coastal area and naturally live in Asian countries, including China, Japan, Malaysia, Indonesia, Vietnam, Philippines and Thailand. The sea cucumber belongs to phylum Echinodermta, class Holothuridea, order Aspidochirotida, family Holothuriidae, genus Holothuria and species H. scabra (1). For medical and heath consideration, sea cucumbers have their long history to using for remedies and nutritional properties. Hence, the demands of sea cucumber in the Asian market will be increasing, by the reason of strong consumer complacency for this favorable sea food. In Thailand, sea cucumbers were recorded at 102 species in 8 families mainly Holothuriida. From those species, it has been reported that 9 species of Holothuriidae and 3 species of Stichopodidae are reported as food(2). The most commercially important species is H. scabra or sandfish, followed by Holothuria atra or lolly fish. Sea cucumbers have been harvested in Thailand by hand up to fishing gear operation, including picking by hand during low tide, snorkeling at deeper water up to 5-10 m(2). The most common for local fisherman is to collect sea cucumber within nearby coastal zones during low tide or extensive migration to offshore islands for fisheries.

2.1.2 Concept of regeneration of sea cucumber Regeneration is widely but non-identically represented in metazoan phylogeny, although it is not universal (Figure 1.1).The capacity of regeneration varies among animal species, and generally increases from higher to lower life form. Principle of regenerative strategies include the rearrangement of pre-existing tissue, the use of adult somatic stem cells and the dedifferentiation and/or transdifferentiation of cells

Ref. code: 25605729040302HAO 4

(Figure 2), and more than one pathway can occur indifferent tissues of the same animal. These regenerative processes result in the reestablishment of proper tissue polarity, structure and form. Thus, the important questions in regenerative process related to the evolutionary and biological reasons that are involved in the same pattern of molecular pathways and cellular pathways in the similar or different ways between regeneration and normal development. The regeneration capacity of invertebrate has long attracted biomedical research area, due to the potential of replacing old and damaged tissues with new ones. To gain more understanding of regeneration, the processes that are involved must be studied in vivo of invertebrates, because of the complex interactions that take place within and among the different cell types and pathways that are involved. Interestingly, why a particular regenerative process occurs in a model system but not in human tissues could provide new pathways to stimulating regeneration if endogenous pathways are unavailable. Our attention of regeneration study is on the sea cucumber. Some marine invertebrates can be also able to regenerate lost tissues following injury. One of the most outstanding capacity for regeneration is focused on echinoderm. In particular, sea cucumbers are capable of regenerating external parts of their body (spines, pedicellariae, tube feet and body wall) and internal organs (intestine, whole visceral mass, nervous system, respiratory tree, and gonads) that are often subjected to predation or amputation, self-induced or traumatic, allowing the complete functional regrowth of lost parts. Some sea cucumbers that are confronted to stressful situation will eviscerate a more or less significant portion of their internal organs, and will slowly regenerate all of these lost internal organs. It has been reported that the first organs to regenerate, in all species documented are associated with the digestive tract. The pattern of evisceration is different among various species of sea cucumbers. In the order Aspidochirotida, such as Holothuria glaberrima (Holothuridae) and Apostichopus japonicas (Stichopodidae), eviscerate their intestine, hemal system, and respiratory tree through the cloaca. Although, other species, such as the dendrochirote Eupentacta fraudatrix, lose their viscera (mainly intestine) through the mouth. The time needed for visceral organ to regenerate also varies in different species. While, H. scabra takes only

Ref. code: 25605729040302HAO 5 seven days for the regeneration process to complete; on the other hand Thyone briareus, A. japonicas and H. glaberrima need about 30 days.

Figure 1.1 Regeneration of various organism. A: The phylogenetic tree analysis of regeneration of in multicellular organisms, the violet background shows the taxa that contains the regeneration ability. B: Example of the organisms that have ability to regenerate and have been investigated in molecular level of regeneration. Ba shows the cnidarians, Hydra vulgaris; Bb shows the freshwater planarian Schmidtea mediterranea (a platyhelminth); Bc shows the zebrafish (Danio rerio); Bd shows the newt (Notophthalmus viridescens) (3).

Ref. code: 25605729040302HAO 6

Figure 1.2 Principle of basic mechanism of regeneration in vertebrates and invertebrates. Regenerative processes share some similarity with development process, in which the stem cells will determine the future cell type determination. The process response is various among species, e.g. Hydra undergoing remodeling, Planarians undergoing tissue remodeling and proliferation of stem cells, Vertebrates undergoing stem cell proliferation and dedifferentiation. Subsequently, cells differentiate into distinct cell types according to the determination, such as muscle or nerve cells that then proliferate to re-establish scale and proportion to recover tissue functionality (4).

Ref. code: 25605729040302HAO 7

2.1.3 Visceral regeneration of sea cucumber To understand body regeneration in sea cucumber, it is necessary to understand the normal process of evisceration and regeneration of holothurians. In sea cucumber, the viscera will eventually regenerate after the evisceration. In the natural condition, self-induced evisceration in holothuroids is assumed to be a natural response to noxious stimuli, including high temperatures, low oxygen levels, and foul water. However, in research works a variety of agents could induce evisceration when injected into the coelomic cavity. The intestinal tube of sea cucumber consists several layers like in mammals, comprising a coelomic epithelium (serosa), an outer connective tissue layer, a muscle layer, an inner connective tissue layer (submucosa), and a digestive epithelium lining the lumen (mucosa) (Fig 1.3). Each layer of intestinal tube also contains the nerve elements which include neuronal cells within the coelomic epithelium, radial nerve fibers associated with the muscle cells, and neuroendocrine- like cells within the luminal epithelium.

Ref. code: 25605729040302HAO 8

Figure 1.3 Schematic diagram shows the tissue layers of the holothurians digestive tract. The cress section of intestinal lumen was shown. Abbreviation: coelomic epithelium (CE), circular muscles (CM), inner connective tissue (ICT), luminal epithelium (LE), longitudinal muscles (LM), and outer connective tissue (OCT)(5).

Ref. code: 25605729040302HAO 9

Figure 1.4 Diagram showing the nervous system of A. japonicus. (A) Lateral view of the whole sea cucumber showing the nervous system, water vascular system and digestive tract. (B) Cross-section of the radial nerve cord. The podial nerve extends from the ectoneural part of the radial nerve cord. AP, ampulla; CL, connective tissue layer; CM, circular muscle; CN, circumoral nerve ring; CR, calcareous ring; CT, connective tissue of the body wall; DT, digestive tract; RE, ectoneural part of the radial nerve; ES, epineural sinus; RH, hyponeural part of the radial nerve; HS, hyponeural sinus; LMBW, longitudinal muscle of the body wall; PC, podial water canal; PN, podial nerve; RC, radial canal; RN, radial nerve; T, tentacle; TC, tentacular water canal; TF, tube foot; TN, tentacular nerve; WR, water ring canal(6).

Ref. code: 25605729040302HAO 10

During evisceration, rupture of the digestive tract occurs at the level of the stomach and the junction between the posterior intestine and the cloaca (Fig. 4A). In A. japonicus, the process of digestive tract regeneration in terms of morphology can be divided into the following five stages: wound healing (0–2 days post-evisceration, dpe) (Fig. 1.4B), formation of blastemal (2–5 dpe; Fig. 1.4C), lumen formation (5–14 dpe; Fig. 1.4D), intestine differentiation (14–21 dpe; Fig. 1.4E), and intestine growth (21 dpe; Fig. 1.4F). During intestine differentiation, the intestinal lumen gradually expands and provides space for the luminal epithelium development (Fig. 1.5). Histological study has been reported in A. japonicas during post evisceration. At 4 dpe, the lumen develops very fast forming the tubular outgrowths of the intestine. The digestive tract develops lumen and is ready to feed around 16 dpe (Fig. 1.5) and the radial nerve cord can re-construction within 12 dpi (Fig. 1.6). It has been strongly suggested that the regenerative process of sea cucumber may involve in multi tissue types regeneration, including nervous system, viscera and muscle regeneration.

Ref. code: 25605729040302HAO 11

Figure 1.5 Anatomical diagram showing organization of the regenerating digestive tube in a holothurian, at different times points after evisceration. Abbreviations: ar, anterior rudiment; cl, cloaca; de, digestive (luminal) epithelium; es, esophagus; me, mesothelium; mes, mesentery; phb, pharyngeal bulb; pr, posterior rudiment(7).

Ref. code: 25605729040302HAO 12

Figure 1.6 Histological sections of normal and regenerating intestine during the different regeneration stages in the sea cucumberA. japonicus. (A) Cross-section of normal intestine. From outside to inside, the intestinal wall is composed of serosa,muscle layer, submucosa, and mucosa. (B–E) Variation of intestinal tissue layers during four stages of intestinalregeneration at (B) three days post-evisceration (dpe), (C) 7 dpe, (D) 10 dpe, and (E) 14–21 dpe. ser, serosa; mus, muscle;sub, submucosa; muc, mucosa; lum, intestinal lumen(8).

Ref. code: 25605729040302HAO 13

Figure 1.7 Uninjured and regenerating stages of the radial nerve cord (RNC) of H. glaberrima. Longitudinal tissue sections of (A) uninjured and regenerating RNC at (B) 2, (C) 6, (D) 12, (E) 20 and (F) 28 days post injury (dpi) were stained with Toluidene Blue. EN,ectoneural;HN, hyponeural(9).

The transcriptome among regenerative process of A. japonicus were studied by L. Sun et al. They found the group of genes involved in 10 major intercellular signaling pathways changed during regeneration process after evisceration that are play a key role in initiating and maintaining the animal regeneration based on matches to KEGG database (10). While Ortiz-Pineda, P. A. et al and Mashanov et al were report about transcriptomic change and gene expression profile during regeneration of the central nervous system and intestine in Holothuria glaberrima. They found the 3 major groups; Development genes, ECM-associated genes and Cytoskeletal genes; which were expressed during these process This might be a significant contribution of these candidate genes and functional pathways to visceral and body wall regeneration in A. japonicus.

Ref. code: 25605729040302HAO 14

Figure 1.8 KEGG pathway and putative transcripts in regenerative A. japonicus transcriptome. Some of these genes were significantly up-regulated during regeneration, compared to the control (Fisher p value < 0.05)(10).

Ref. code: 25605729040302HAO 15

Figure 1.9 Bioactive components of sea cucumber extracts and their biological effects on various human cancer cells and cancer animal models(11).

Echinoderms have capacity of regeneration and autotomy. Holothurians, or sea cucumbers, respond to adverse stimuli by undergone evisceration and ejectedmost of its viscera, including the hemal system, the digestive tube, and the respiratory trees, will slowly regenerate all of these lost internal organs. Neuronal fibers and cell bodies are present within the viscera. The enteric nervous system has the capacity of regeneration also. The sea cucumber eviscerates through an opening torn in the body wall. The body wall will contract and expel both the associated viscera and intestine, but not the organs of the oral complex. From this modifications, we suggest that sea cucumbers have growth factors which may affect to proliferation and neurogenic differentiation of multipotent stem cells.

Ref. code: 25605729040302HAO 16

2.2 Mesenchymal stem cells

Mesenchymal stem cells or mesenchymal stromal cells (MSCs) can generate colonies of adherent fibroblast-like cells and have asymmetry. MSCs were first isolated from bone marrow (BM) by Friedenstein et al(12). It can differentiate into many cell types such as adipose tissue, bone and cartilage both in vitro and in vivo. However, other populations of MSCs have been found from various tissue including peripheral blood, adipose tissue, umbilical cord blood, umbilical cord tissue, chorion tissue and placenta tissue (13-16) The International Society for Cellular Therapy (ISCT) proposed criteria for defining multi-potent human MSCs: 1) MSCs are adherence to plastic in standard culture condition. 2) MSCs are express a specific set of cell surface markers including CD73, CD90 and CD105 together with lack of expression of the hematopoietic markers CD34, CD45, CD14 and human leukocyte antigen (HLA-DR). 3) MSCs are differentiate into multiple mesenchymal lineages including osteocytes, adipocytes and chondrocytes (17). The MSCs are interested in regenerative medicine by were pointed on the repair, regeneration and replacement of cells, tissues or organs because it was not concern about ethical and not had immune stimulant(18). The MSCs were focused as a new therapy because the cells can generated numerous number of cells within the short period time and have mechanism of cells proliferation, differentiation and self-renewal. Hematopoietic stem cell transplantation (HSCT) are relatively easy to reach and have received considerable attention. HSCT ismore ethically acceptable to use in alternative blood diseases therapy including Thailand. However, the use of hematopoietic stem cells from bone marrow has limitations of the limited amount of cell number, invasive procedure of harvesting bone marrow and also related with age (19).

2.2.1 Morphology of MSCs Former studies claimed that MSCs isolated from bone marrow is a single cell that has morphology as spindle-shape and is symmetrically.

Ref. code: 25605729040302HAO 17

2.2.2 Differentiation potential of MSCs Many evidences shown that MSCs can differentiated to vary type of mesoderm tissue such as chondrocytes, osteoblasts, adipocytes and cardiomyocytes (20- 22). In vitro adipogenic differentiation can be induced by culturing MSCs in medium compose dexamethasone, isobutyl methyl xanthine (IBMX) and indomethacin into the MSCs medium culture. The adipogenic differentiation could be assessed by Oil Red-O staining as the expression level of adipogenic genes, such as Peroxisome proliferator activated receptors ɣ (PPARɣ), lipoproteins lipase (LPL), adiponectin, glucose transporter 4 (GLUT4) and SREBP-1C. In vitro osteogenic differentiation can be induced by using the culturing medium containing of dexamethasone, β- glycerophophate and ascorbic acid for 14-28 days The osteogenic differentiation can be confirm by Alizarin Red staining of calcium in mineralized colonies to assess the calcium deposit within cells (19).

2.3 The effect of sea cucumber extracts condition on proliferation

The previous study demonstrated that sulfated polysaccharide extracted from the body wall of the sea cucumber Stichopus japonicus by enzymolysis enhance the proliferation of rat neural stem/progenitor cells (NSPCs) while did not enhance apoptosis of NSPCs and the purified sulfated polysaccharide from sea cucumber acted synergistically with fibroblast growth factor-2 (FGF-2) but not epidermal growth factor (EGF) (22).

Ref. code: 25605729040302HAO 18

Figure 1.10 The interactions between a sulfated polysaccharide from Haishen (HS) and EGF (20 ng/ml) or FGF-2 (20 ng/ml) on the cell viability of rat NSPCs in vitro. A dose of 500 ng/ml HS was added to all of the cultures in this experiment. The cells cultured in the basal medium were used as the control. Cell proliferation was assessed by MTT assay 72 h after incubation(23).

Azim Patar et al. studied the effect of water extract of sea cucumber Stichopus variegatus on rat spinal astrocytes cell lines, they found that 10µg/ml of the extract supported the spinal astrocytes proliferation over a period of 72h and at 5µg/ml of the extract the astrocytes proliferation was seen to increase only at 72 h(24).

Ref. code: 25605729040302HAO 19

Figure 1.11 The effect of Stichopus variegatus water extract (SVWE) and EGF treatments on spinal astrocytes culture in vitro. Each value is the average ± standards error of mean (S.E.M). Bars indicate S.E.M. Significance of differences, was evaluated by Student’s t-test; Panel I = treated SVWE: ,p<0.01, ,p<0.05; Panel II = treated SVWE: ,p<0.01, ,p<0.05; Panel III = treated SVWE: , p<0.01, , ,p<0.05.

However, the effects of sea cucumber extracts on human mesenchymal stem cells and neurogenic differentiation have not been reported.

Ref. code: 25605729040302HAO 20

CHAPTER 3 RESEARCH METHODOLOGY

3.1 Sea cucumber extraction

3.1.1 Tissue collection Wild-type of sea cucumbers (Holothuria scabra) 200-500g body weight were obtained from the Prachuapkirikhan Coastal Fisheries Research and Development Center, Thailand. Sea cucumbers were kept in plastic tanks, with seawater at room temperature for 24 h before sacrificed. Sea cucumbers were anesthetized on water with clove-oil for 10-15 min, after which the body wall, viscera and radial nerve were collected separately, cut into small pieces and immediately frozen in liquid nitrogen for storage at -80°C until used.

3.1.2 Protein preparation To extract total protein, the body wall, viscera, nerve ring and radial nerve cord of sea cucumber were immersed separately in 0.1M phosphate buffered saline

(PBS) (containing distill water 1 liter; 76.5g of NaCl; 9.94g of Na2HPO4; 4.08g of

KH2PO4; pH7.4) and 0.1M acetic acid and homogenized on ice by using a homogenizer. The homogenate duration used as 20 sec alternating with 5 sec stopping, and this step was repeated more than 10 times, until the tissues were homogeneous. The homogenated body wall, viscera and radial nerve cord were centrifuged at 12,000×g at 4°C for 30 min. The supernatants were carefully collected, freezed and kept at -80°C until used.

3.1.3 Measuring concentration of protein The body wall, viscera, nerve ring and radial nerve cord extracts were measured concentration of protein by Bradford assay, and the bovine serum albumin (BSA) was used as standard control. Subsequently, the H. scabraextracts were stored at -80ºC.

Ref. code: 25605729040302HAO 21

3.1.4 SDS-PAGE The protein profile of H. scabra protein extracts from viscera (VI), body wall (BW) and radial nerve cord (RN) were studied using SDS-PAGE method. The concentration of protein at 15 µg/ml of each extracts were loaded onto 15% of the SDS- PAGE gel and the gel was subsequently stained with Coomassie blue. The SDS-PAGE gel micrograph was examined and analyzed by the Gel Doc EZ System (Bio-rad, USA).

3.1.5 Western blot analysis The expression of NGF and EGF in all protein extracts were detected by Western blotting. The proteins from Body wall (BW), Viscera (VI), Nerve ring (NR) and Radial nerve cord (RN) were dissociated by 15% SDS-PAGE and then were transferred onto nitrocellulose membrane (Bio-Rad, CA, USA). The membrane was blocked by 5% non-fat milk in TBST for 1 h at room temperature and was incubated with HRP-conjugated goat antihuman antibody (Fab specific) (Santa Cruz Biotechnology, CA, USA). The level of NGF and EGF were detected and analyzed using the Gel Doc EZ System (Bio-rad, USA).

3.2 Cell preparation

3.2.1 Mesenchymal stem cell derived from human placenta (PL-MSCs). Placentas were collected from Thammasat Chalermprakiat Hospital, which have been screen for negative from any infectious diseases, then placentas were brought to our laboratory promptly and washed with 0.1M PBS for 3 times. The placentas were cut into small pieces as 1-2 mm2 and washed again with 0.1M PBS for twice. Then, the tissues were digested by using1.6 mg/ml collagenase XI (Sigma- Aldrich, USA), 200 mg/ml deoxyribonuclease I (Sigma-Aldrich, USA) in dulbecco's modified eagle's medium (DMEM). The mixed sample was incubated in shanking incubator at 37ºC. After 4 h, the tissue was washed twice with 0.1M PBS. The digested tissue was cultured in tissue culture flask 25 mm2by using complete medium. The medium was fed every 3-4 days.

Ref. code: 25605729040302HAO 22

3.3 Cell culture

PL-MSCs were cultured in completed medium (Dulbecco's modified eagle's medium (DMEM) plus 10%FBS (Gibco, USA), 1%PenStrep (Gibco, USA), 1%GlutaMAX (Gibco, USA)) until cells confluent 80%-90%. The MSCs were trypsinized with 0.25% typsin-EDTA (Gibco, USA) and kept in FBS (Gibco, USA) with 10% DMSO (Amresco, USA) and stored at -80ºC.

3.4 Characterization of MSCs

3.4.1 Multi-linage cell differentiation 3.4.1.1 Osteogenic differentiation Primary MSCs cultured (passage2-5) 4.5×104 cells were seeded in

24 well-plate and incubated at 37ºC, 5% CO2 overnight. Osteogenic differentiation was induced by addition of DMEM containing 10% FBS plus100nM dexamethasone, 10mM β-glycerolphosphate (Sigma, USA) and 50 µM ascorbic acid 2-phosphate (Sigma, USA) for 21–35 days. The medium was replaced every 2-3 days. After 3 weeks of induction, MSCs were assessed the level of osteogenic differentiation by measuring alkaline phosphatase activity that we used BCIP/NBT solution (Amresco, USA). The differentiated MSCs were observed under the microscope (Nikon TS100, Japan.) The positive cells were seen as blue –violet cells. The control cultured in complete DMEM without osteogenic differentiation stimuli was not expressed alkaline phosphatase activity even after culture for 3 weeks.

3.4.1.2 Adipogenic differentiation Primary MSCs cultured (passage2-5) 3×104 cells were cultured in

24 well-plate and incubated at 37ºC, 5% CO2 overnight. Consequently, adipogenic differentiation was triggered by using DMEM plus indomethacin (0.2mM), glucose (25mM), dexamethasone (1mM), 1µg/ml insulin) and it was changed every 3 days until 3-4 weeks. The morphology of MSCs were changed to large and had lipid droplet in cytoplasm. To estimated adipocyte, cells were stained with 0.5% Oil red O (Sigma- Aldrich) in 6% isopropanol. Cells were observed under the microscope (Nikon TS100,

Ref. code: 25605729040302HAO 23

Japan.). Control was cultured in complete DMEM none adding any adipogenic stimuli and no observed adipogenic induction.

3.4.2 Immunophenotypical characterization of cell culture To characterize MSCs by immunophenotype, primary cultures from placenta at passage 2 to 5 were incubated with 10 µl of fluorescein isothiocyanate (FITC) or phycoerythrin (PE)-conjugate antibody against CD34 (BD Bioscience, USA), CD45 (BD Bioscience, USA), CD73 (BD Bioscience, USA), CD90 (AbD Serotec, USA) or CD105 (BD Bioscience, USA). The positive cells were identified by comparison with isotype-match controls [FITC-conjugated mouse immune-globulin G1 (IgG1) and PEconjugated mouse immunoglobulin G2a (IgG2a)]. At least twenty thousand label cells were acquired and analyze using flow cytometry (FACScaliburTM, Becton Dickinson, USA) and CellQuest® software (Becton Dickinson, USA).

3.5 Effect of H. scabra on MSCs proliferation

3.5.1 Cytotoxicity test The amount of MSCs were 3×103 cells/well in 96-well plate (Costar) and treated with 3 parts of the sea cucumber protein extracts, which from viscera, body wall and radial nerve, by using concentration of each extracts at 0.01, 0.1, 0.5, 1, 5, 10, 25, 50, 100 µg/ml and incubating at day1, day3 and day5. Subsequently, the MSCs were tested cytotoxic by MTT assay. The absorbance was measured at 570 and 630 nm.

3.5.2 Growth kinetic curve The PL-MSCs were seeded on 24-well plates (Costar, Corning, USA) at a density 1×103 cells/well and separated into 4 groups, the first group was cultured in DMEM supplemented with 10% FBS, the second group was cultured with completed medium plus body wall extract (BW) along with different concentrations (0.1, 1, 10 and 25 µg/ml), the second group was cultured with completed medium plus viscera extract (VS) with the same concentration as body wall extract. The radial nerve extract(25) was also added to DMEM supplemented with 10% FBS and chosen different

Ref. code: 25605729040302HAO 24 concentration as BW. Each concentration was done in triplicates. The cells were disaggregated with 0.25% Trypsin (Gibco, USA) and counted by using counting chamber every 2 days until 10 days. The number of cells were calculated, data were showed as graph.

3.5.3 Proliferative gene expression analysis by qRT-PCR The PL-MSCs were seeded on 25cm2-Flask (Costar, Corning, USA). The experiments were separated into 8 groups: (1) DMEM supplement with 5% FBS as the control; (2) DMEM supplement with 10% FBS; (3)DMEM supplement with 5% FBS and 0.1 µg/ml of BW-PBS lot1; (4) DMEM supplement with 5% FBS and 1 µg/ml of BW-PBS lot1; (5) DMEM supplement with 5% FBS and 0.1 µg/ml of RN-PBS lot1; (6) DMEM supplement with 5% FBS and 1 µg/ml of RN-PBS lot1 and (7) DMEM supplement with 5% FBS and 1 µg/ml of BN-PBS lot2 and (8) DMEM supplement with 5% FBS and 1 µg/ml of RN-PBS lot2. All experiments were cultured with the medium as decribed and the MSCs were collected to study the proliferative genes expression at day 3, 7, 10 and 14 of culturing period.TriPure Isolation reagent (Roche, Germany) and QuantiNova Reverse Transcription Kit (Qiagen, Germany) were used to isolate total RNA and synthesize first-strand cDNA respectively for real-time PCR detection. Each real-time PCR was performed in duplicate for every sample. Gene- specific primers were used for amplification of human EGF and EGFR. The GAPDH gene was used as a normalization control(26). A list of gene specific primer used for real time PCR is illustrated in Table1. Amplifications (n = 3) were conducted on a CFX- 96 (Bio-Rad, USA) using iTaq Universal SYBR Green Supermix (Bio-Rad, USA). The cycling conditions for each reaction were: 95°C for 3 minutes followed by 39 cycles at 95°C for 30 seconds, 60°C for 30 seconds and 72 °C for 30 seconds. Bio-Rad CFX manager 3.1 automatically calculated the reaction efficiencies in the reactions. The REST 2009 (Relative Expression Soft-ware Tool; Qiagen, Germany) was used to calculate relative expression, before being subjected to analyze the variance between different stages of ovaries. A statistical significant analysis was performed with a GraphPad Prism 5, using a one-way analysis of variance (ANOVA). A probability value less than 0.05 (p < 0.05) indicated a significant difference.

Ref. code: 25605729040302HAO 25

Table 3.1 The sequence of primers for proliferative genes and house-keeping gene

Gene Forward primer Reverse primer

EGF 5′-CAGGGAAGATGACCACCACT-3′ 5′-CAGTTCCCACCACTTCAGGT-3′

EGFR 5’CAGTGGGCAACCCTGAGTAT3’ 5’GGGCCCTTAAATATGCCATT3’

GAPDH 5′- GAGTCAACGGATTTGGTCGT-3′ 5′-TTGATTTTGGAGGGATCTCG-3′

Ref. code: 25605729040302HAO 26

3.6 Effect of H. scabra on neural differentation

3.6.1 Neural differentiation 3.6.1.1 Commercial neural differentiation medium The MSCs at 2.5×103 cells/cm2 were seeded on 12mm diameter disc glasses, each disc was put into the 24well-plate per well and MSCs were incubated overnight. Then the medium was replaced with the different concentration of the protein extracts from different parts of sea cucumbers comprised with body wall, viscera and radial nerve cord. The concentration of the protein were 0.1 and1 µg/ml were mixed into Advance STEM Mesenchymal Stem Cell Basal Medium (SH30893.02, Hyclone, Australia) with Advance STEM Growth Supplement (SH30878.01, Hyclone, Australia) and cells were maintained for 72 h. by medium were changed every 48 h. Control differentiation was performed without any protein extract along with using completed DMEM as negative control.

3.6.1.2 In-House neural differentiation medium The MSCs at 2.5×103 cells/cm2 were seeded on 12mm diameter disc glasses, each disc wasput into the 24well-plate per well and MSCs were incubated overnight. Then the medium was replaced with the different concentration of the protein extracts from different parts of sea cucumbers comprised with body wall, viscera and radial nerve. The concentration of the protein were 0.1 and 1 µg/ml were mixed into neuronal differentiation medium I for first 5 days (composed of BrainPhys Neuronal Medium(Stem cell technology) with5%FBS (Gibco, USA), 1%PenStrep (Gibco, USA), 1%GlutaMAX (Gibco, USA), 2%B27 (Invitrogen, USA), 10µM Retinoic acid (Stemcell technology)). After 5 days, the medium was replaced into neuronal differentiation medium II (BrainPhys Neuronal Medium (Stem cell technology) adding5%FBS (Gibco, USA), 1%PenStrep (Gibco, USA), 1%GlutaMAX (Gibco, USA), 2%B27 (Invitrogen, USA), 10ng/ml BDNF (Peprotech, USA) and 10 ng/ml GDNF (Peprotech, USA)) and using neuronal differentiation medium I and II as control differentiationalong with using completed DMEM as negative control.

Ref. code: 25605729040302HAO 27

3.6.2 Immunofluorescence staining of neurogenic-MSCs The cellswere fixed with cool 4% paraformaldehyde and stained according to a standard immunofluorescent staining procedure. The primary antibodies used were mouse anti-MAP2 antibody diluted 1:100(Millipore, USA) in 4% bovine serum albumun (BSA) in 0.1M PBS and mouse anti-β tubulin III antibody diluted 1:100 (Millipore, USA), mouse anti-Nestin antibody diluted 1:200 (Millipore, USA). The secondary antibodies used were FIT-Cgoat anti-mouse antibodyat 1:1000(Thermo Fisher, US). Propidium iodide was used as a counter-stain for the nucleus. Samples were observed under florescence microscope (Nikon DS-RI2, USA).

3.7 RNA extraction

RNA of PL-MSCs were extracted using 1 ml of Trizol reagent (Invitrogen, USA) and the adherent cells were scraped off. Then, the homogenized sample was collected to collection tube. To allow complete dissociation of the nucleoprotein complex, the homogenized sample was incubated for 5 min at room temperature. Subsequently, 200 µl of chloroform (Sigma-Aldrich, USA) was added andthe sample were shake vigorously for 15 seconds and incubated at room temperature for 5 minutes. The sample were centrifuged at 12,000xgfor 15 minutesat 4°C and then the aqueous phase was transferred to a new collection tube. To precipitate RNA, 500 µl of 100% isopropanol was added to the aqueous phase and the sample mixed thoroughly by shaking for 30 seconds and incubated at room temperature for 10 minutes. Sample was then centrifuged at 12,000xg for 15 minutes at 4°C. Subsequently, supernatant was removed and 1 ml of 75% DEPC-ethanol was added to wash the pellet. The sample was centrifuged at 7,500xg for 5 minutes at 4°C, repeated 2 times supernatant was discarded and RNA pellet was dried for 10 minutes and resuspended in RNAse-free water. The purified total RNA was collected and stored at -80°C for further process.

Ref. code: 25605729040302HAO 28

3.8 First-strand cDNA synthesis

mRNA was reverse transcribed to cDNA using QuantiTect®Reverse Transcription Kit (QIAGEN, Germany) following the manufacturer’s instruction. Briefly, Template RNA containing 500 ng of total RNA, 2µl of 7x gDNA Wipeout Buffer, then added RNase-free water upto 14 µl. The mixture was incubated on MyCycler Thermal cycler (Bio-Rad, USA) at 42C for 2 min and placed immediately on ice. For Reverse-transcription master mix containing 1 µl of RT Primer Mix, 4 µl of 5x Quantiscript RT Buffer, 1 µl Quantiscript Reverse Transcriptase were prepared. Then, the template RNA and Reverse-transcription master mix were mixed together and the mixture was incubated on MyCycler Thermal cycler (Bio-Rad, USA) at 42C for 15 min, then incubated on 95C for 3 min to inactivate Quantiscript Reverse Transcriptase. Subsequently, cDNA synthesis reactions were stored at -20C or used for qRT-PCR immidiately.

3.9 Quantitative real-time polymerase chain reaction (qRT-PCR)

Each real-time PCR was performed in duplicate for every sample. Gene-specific primers were used for amplification of human MAP2, β-Tubulin III, and Nestin. The GAPDH gene was used as a normalization control(26). A list of gene specific primer used for real time PCR is illustrated in Table 2. Amplifications (n = 3) were conducted on a CFX-96 (Bio-Rad, USA) using iTaq Universal SYBR Green Supermix (Bio-Rad, USA). The cycling conditions for each reaction were: 95 °C for 3 minutes followed by 39 cycles at 95 °C for 30 seconds, 60 °C for 30 seconds and 72 °C for 30 seconds. Bio-Rad CFX manager 3.1 automatically calculated the reaction efficiencies in the reactions. The REST 2009 (Relative Expression Soft-ware Tool; Qiagen, Germany) was used to calculate relative expression, before being subjected to analyze the variance between different stages of ovaries. A statistical significant analysis was performed with a SPSS program (Statistical Product and Service Solutions; version 19), using a one-way analysis of variance (ANOVA). A probability value less than 0.05 (p < 0.05) indicated a significant difference.

Ref. code: 25605729040302HAO 29

Table 3.2 The sequence of primers for neurogenic genes and house-keeping gene

Gene Forward primer Reverse primer

MAP2 5’-CCAATGGATTCCCATACAGG-3’ 5’-CTGCTACAGCCTCAGCAGTG-3’

β-Tubulin III 5’-AACGAGGCCTCTTCTCACAA-3’ 5’-CCTCCGTGTAGTGACCCTTG-3’

Nestin 5’- TGGCAAAGGAGCCTACTCCAAGAA-3’ 5’-ATCGGGATTCAGCTGACTTAGCCT-3’

GAPDH 5′- GAGTCAACGGATTTGGTCGT-3′ 5′-TTGATTTTGGAGGGATCTCG-3′

Ref. code: 25605729040302HAO 30

CHAPTER 4 RESULTS AND DISCUSSION

4.1 Isolation and characterization of PL-MSCs from placenta

4.1.1 Isolation PL-MSCs from placenta The placenta tissues (10mg) were digested with enzyme (collagenase with Dnase) as described and they were cultured in DMEM supplement with 10% FBS. Every 3 days, non-adherent cells and medium were removed and replaced by newly fresh prepared medium. The cells were grown and cultured approximately 10- 14 days until the confluence increased nearly 80% of total culture flask. They were then subpassaged using 0.25% trypsin-EDTA. Along the culture period, the fibroblast-like cells were maintained at 37ºC with 5% CO2 level.

Ref. code: 25605729040302HAO 31

A B

Figure 4.1 Morphology of mesenchymal stromal cells. A: The PL-MSCs presented fibroblast-like morphology at day3 of passage 0 B: Spindle-shaped cells was homogenous population at passage4

Ref. code: 25605729040302HAO 32

4.1.2 Characterization of PL-MSCs 4.1.2.1 Adipogenic differentiation potential of PL-MSCs To confirm adipogenic differentiation potentials of PL-MSCs, the cells were cultured in adipogenic differentiation medium (Fig. 11A, C). After 28 days, the cells become larger and contained the lipid droplets in the cytoplasms. The differentiated cells were then stained with the oil red O, showing the positive red signal (Fig. 11D). On the other hand, the MSCs with DMEM medium didn’t show any positive signal of oil red O staining (Fig. 11C). We concluded that the MSCs contained the ability of adipogenic differentiation as we expected.

Ref. code: 25605729040302HAO 33

A B

C D

Figure 4.2 Adipogenic differentiation of PL-MSCs. A: Morphology of MSCs cultured in DMEM supplemented with 10% FBS for 28 days. B: Oil red O staining of MSCs cultured in DMEM supplemented with 10% FBS for 28 days showing negative signal. C: The MSCs after adipogenic induction for 28 days. D: The positive oil red O staining in MSCs after adipogenic induction for 28 days.

Ref. code: 25605729040302HAO 34

4.1.2.2 Osteogenic differentiation potential of PL-MSCs Furthremore, to assess the osteogenic differentiation potential of PL-MSCs, the PL-MSCs was cultured in osteogenic differentiation medium. After 21 days, the cells were denser and flattened. After receiving the osteogenic medium, MSCs have developed extracellular calcium which was positive for alizarin red S staining. While non-treated cells did not have any calcium deposit and was negative for alizarin red S staining.

Ref. code: 25605729040302HAO 35

A B

C D

Figure 4.3 Osteogenic differentiation of PL-MSCs. A: Morphology of MSCs cultured in DMEM supplemented with 10% FBS for 21 days. B: Alizarin red S staining of MSCs cultured in DMEM supplemented with 10% FBS for 21 days showing negative signal. C: The MSCs after osteogenic induction for 21 days. D: The positive Alizarin red S staining in MSCs after osteogenic induction for 21 days.

Ref. code: 25605729040302HAO 36

4.1.2.3 Immunophenotype of MSCs derived from placenta Immunophenotype of PL-MSCs (passage 3 – 5) was determined by flow cytometry using phycoerythrin (PE) -conjugated or fluorescein isothiocyanate (FITC) - conjugated antibodies against CD34, CD45, CD73, CD90, and CD105. They expressed high levels of MSCs markers including CD73, CD90, and CD105. In contrast, they did not express hematopoietic markers, CD34 and common leukocyte marker, CD45 (Table 4.1 and Fig. 4.4). Both of these markers were generally used to characterize the presence of contaminating hematopoietic cells in MSC culture. Figure 4.1 summarized the expression profiles of the mesenchymal and hematopoietic cell surface markers of PL-MSCs as determined by flow cytometry.

Ref. code: 25605729040302HAO 37

Table 4.1: The surface marker expression profiles of MSCs from placenta

Percentages of the positive cells MSC sources CD34 CD45 CD73 CD90 CD105 PL-MSCs 4.31±1.64 7.41±2.81 98.67±0.36 86.78±5.16 96.70±0.26

Data are presented at mean ± standard error of means (SEM) from 3 independent experiments

Ref. code: 25605729040302HAO 38

Figure 4.4 Immunophenotypes of PL-MSCs. Placenta derived MSCs were positive with the typical MSC markers; (CD73, CD90 and CD105) and negative for hematopoietic markers CD34 and CD45.

Ref. code: 25605729040302HAO 39

From our result, the cells which were extracted from placenta tissue and cultured with DMEM. They showed the ability to differentiate into adipocytes, as shown in the positive staining with Oil red O and to differentiate into osteocytes, shown in the positive staining with Alizarin red S. Moreover, the cells were further investigated the phenotype for MSC markers and shown that the cells were CD73, CD90 and CD105 postive and CD34 and CD45 negative. We suggested that the cells that we extracted is mesenchymal stem cells (MSCs) due to their abilities and can be further conducted the experiments in this thesis.

4.2 Proliferative effect of H. scabraon PL-MSCs

4.2.1 Protein profile of H. scabra using SDS-PAGE

Figure 4.5 The SDS-PAGE which showed the bands of protein from Body wall (BW), Viscera (VI), Nerve ring (NR) and Radial nerve (RN) in PBS compared with in acetic acid.

Ref. code: 25605729040302HAO 40

The result showed that coomassie blue staining of crude extract proteins of H. scabra in SDS-PAGE, including body wall (BW), viscera (VI), nerve ring (NR) and radial nerve cord (RN). The SDS-PAGE showed several H. scabra extracts with the different lysis buffer, comprising lane 1: body wall extracted by 0.1M PBS, lane2: body wall extracted by 0.1M acetic acid, lane3: viscera extracted by 0.1M PBS, lane 4: viscera extracted by 0.1M acetic acid, lane 5: radial nerve cord extracted by 0.1M PBS, lane 6: radial nerve cord extracted by 0.1M acetic acid, lane 7: nerve ring extracted by 0.1M PBS, and lane 8: nerve ring extracted by 0.1M acetic acid).Each H. scabra proteins were then loaded 15 µg/ml onto the gel. The results of the SDS-PAGE analysis of total protein extracted from H. scabra BW and VI using the different types of lysis buffers were shown in Fig. 4.5. The most striking difference when using different lysis buffers was the protein yield obtained from the same tissue. However, the use of different lysis buffers in the same tissue resulted in a similar protein profile outcome. Prominent protein bands were observed for both BW-PBS and VI-PBS extracts. Five bands with molecular mass of >170, ~120, ~45, ~39 and ~17 kDa were intense in the BW-PBS extract, whereas two bands with molecular mass of ~39 and ~17 kDa were prominent in the BW-AA extract. In the VI- PBS extract, the proteins with molecular mass of ~17 kDa and ~11 kDa were detected, although a faint smear of protein was observed. However, there was no band was observed for the VI-AA extract, except for a weak protein band with molecular mass of ~11 kDa (Fig. 4.5).

Ref. code: 25605729040302HAO 41

4.2.2 Protein identification of H. scabra growth factor using Western blot analysis Western blot has been used for identification of growth factors on the crude protein extracts. Our hypothesis is that H. scabra might contain some of the factors to promote the MSCs proliferation and differentiation. Therefore, for confirming our hypothesis, western blotting was performed. The nerve growth factor (NGF) and epidermal growth factor (EGF) were selected to identify in H. scabra extracts. These demonstrated that NGF was expressed in VI-PBS at 13 kDa molecular mass (Fig. 4.6). On the other hand, EGF also showed in BW-PBS, BW-AA, VI-PBS, RN-PBS and NR-PBS at 160 kDa (Fig. 4.7).

Ref. code: 25605729040302HAO 42

Figure 4.6 Western blot analysis of NGF protein representing the positive signal in VI- PBS at 13 kDa, no positive signal at BW-PBS, BW-AA, VI-AA, RN-PBS, RN-AA, NR-PBS and NR-AA.

Ref. code: 25605729040302HAO 43

Figure 4.7 Western blot analysis of EGF protein representing the positive signal in 160kDa of BW-PBS, BW-AA, VI-PBS, RN-PBS and NR-PBS. In the contrary, VI- AA, RN-AA and NR-AA showed the negative signal of EGF.

Ref. code: 25605729040302HAO 44

4.2.3 Cell proliferation and cell cytotoxicity determined by MTT assay

To test whether H. scabra protein extracts have any cytotoxic effect, viability of PL-MSCs was evaluated by MTT assay. The treatment of BW-PBS extract could enhance cell proliferation when the concentrations of 0.1-50 µg/ml were used (Fig. 4.9A). Their stimulatory effects were early observed at day1 when using 0.1- 50µg/ml extracts. In contrast, the use of BW-PBS at concentration of 100 µg/ml decreased the percent of cell proliferation. For BW-AA treatment, the proliferative effect could be observed when the PL-MSCs were treated with this extract with concentrations of 0.01-50 µg/mL, although the proliferation was declined when the concentration increased (Fig.4.9B). Similarly, the treatment with 100 µg/ml resulted in a decrease of cell proliferation. Interestingly, the cell proliferation was increased following the treatment duration for both BW-PBS and BW-AA treatments. Therefore, the most effective condition when using BW-PBS is the use of concentration of 1 µg/ml for 5 days (about 0.5 fold increase when compared with the sham control). For BW- AA, the proliferative effect was highest when the PL-MSCs were treated with 0.01 µg/ml for 5 days (Fig. 4.9 and 4.10). However, cell proliferation was decreased following an increase of concentrations from 1-100 µg/ml. We also found that the VI extracts could induce cell proliferation when the duration of treatment was prolonged until day 5. Collectively, we suggested that the use of very low concentration of BW extracts, as low as 0.01 µg/ml, was most effective to enhance in vitro PL-MSCs proliferation. On the other hand, the use of very high concentration decreased the percent of cell proliferation. This suggested that the high concentration (100 µg/ml) was toxic to the PL-MSCs and possibly induced cell death.

Ref. code: 25605729040302HAO 45

Figure 4.8 Proliferation of PL-MSCs after treated with the body wall from sea cucumber (H. scabra) extracts at days 1, 3, 5 post-treatment. (A) PL-MSCs treated with the body wall (BW) extract using 0.1M PBS. (B) PL-MSCs treated with the body wall (BW) extract using 0.1M acetic acid. The Y-axes show the percent of cell growth whereas the X-axes show the concentration of sea cucumber extract used for PL-MSC treatment. Each bar graph represents the mean ± S.E.M of 3 independent experiments (N=3). Statistical differences are indicated by asterisks (*, p < 0.05; **, p < 0.01; ***, p < 0.001).

Ref. code: 25605729040302HAO 46

Figure 4.9 Proliferation of PL-MSCs after treated with the viscera from sea cucumber (H. scabra) extracts at days 1, 3, 5 post-treatment. (A) PL-MSCs treated with the viscera (VI) extract using 0.1M PBS. (B) PL-MSCs treated with the viscera (VI) extract using 0.1M acetic acid. The Y-axes show the percent of cell growth whereas the X-axes show the concentration of sea cucumber extract used for PL-MSC treatment. Each bar graph represents the mean ± S.E.M of 3 independent experiments (N=3). Statistical differences are indicated by asterisks (*, p < 0.05; **, p < 0.01; ***, p < 0.001).

Ref. code: 25605729040302HAO 47

4.2.4 Cell division and proliferation determined by direct cell counting Apart from cell proliferation, we also investigated the effect of sea cucumber extracts on the cell division and proliferation of PL-MSCs. Low doses, ranging from 0.1-25 µg/mL, were used within this experiment. The cell number of PL- MSCs in each group was slowly increased from day 0 to day 6 and increased rapidly from day 8 to day 10 (Fig. 4.11-4.12). However, we found that all extracts had no effect on PL-MSCs growth during days 0-10, only exception for BW-PBS treatment at day 10 (Fig. 4.11-4.12). For the treatment of PL-MSCs with BW-PBS, the result at day 10 indicated that the use of BW-PBS at concentration of 1 µg/mL could significantly increase cell growth when compared with the sham control (Fig. 4.11A). However, the decrease of cell growth was observed when using 10 and 25 µg/mL of BW-PBS extracts. Therefore, we suggested that the sea cucumber extracts, both BW and VI, did not likely influence the growth of PL-MSCs.

Ref. code: 25605729040302HAO 48

Figure 4.10 Growth kinetic of PL-MSCs after treated with the body wall from sea cucumber (H. scabra) extracts at days 1, 3, 5 post-treatment. (A) PL-MSCs treated with the body wall (BW) extract using 0.1M PBS. (B) PL-MSCs treated with the body wall (BW) extract using 0.1M acetic acid. The Y-axes show the percent of cell growth whereas the X-axes show the concentration of sea cucumber extract used for PL-MSC treatment. Each bar graph represents the mean ± S.E.M of 3 independent experiments (N=3). Statistical differences are indicated by asterisks (*, p <0.05; **, p < 0.01; ***, p < 0.001).

Ref. code: 25605729040302HAO 49

Figure 4.11 Growth kinetic of PL-MSCs after treated with the viscera from sea cucumber (H. scabra) extracts at days 1, 3, 5 post-treatment. (A) PL-MSCs treated with the viscera (VI) extract using 0.1M PBS. (B) PL-MSCs treated with the viscera (VI) extract using 0.1M acetic acid. The Y-axes show the percent of cell growth whereas the X-axes show the concentration of sea cucumber extract used for PL-MSC treatment. Each bar graph represents the mean ± S.E.M of 3 independent experiments (N=3). Statistical differences are indicated by asterisks (*, p <0.05; **, p < 0.01; ***, p < 0.001)

Ref. code: 25605729040302HAO 50

4.2.5 Proliferative genes expression of PL-MSCs by qRT-PCR Next, to determine whether H. scabra is involved in the proliferative process of MSCs, we investigated the proliferative genes expression in PL-MSCs after treated with H. scabra. The effect of H. scabra extracts on PL-MSCs was further investigated through gene expression of proliferative markers, including epidermal growth factor (EGF) and epidermal growth factor receptor (EGFR). GAPDH was used as the house keeping gene. Cells were cultured in complete medium with low serum medium (5%FBS) as the control, complete medium with 10%FBS and complete medium with 5% FBS and supplement with 0.1-1 µg/ml of BW-PBS lot1, lot2 and RN- PBS lot1, lot2 for 3, 7, 10 and 14 days. The expression of both EGF and EGFR were increased at 3 days after treatment with BW-PBS lot1 at 1 µg/ml compared to control medium. The EGF were high expressed in RN-PBS lot1 at 0.1µg/ml at day 10 and at day 14 of BW-PBS lot1 at 0.1 µg/ml, BW-PBS lot2 and RN-PBS lot2 at 1 µg/ml. while the EGFR were expressed at day10 of BW-PBS lot1 at 1 µg/ml. The quantitative real- time showed the highest EGF and EGFR expression in BW-PBS-1 µg/ml treated MSCs at day 10, as compared to the control MSCs (medium with 5%FBS) (Fig. 4.13-4.18).

Ref. code: 25605729040302HAO 51

A) EGF Day3 8

Relative expression

5%FBS 10%FBS BWL1-1 RNL1-1 BWL2-1 RNL2-1 BWL1-0.1 RNL1-0.1

B) EGF Day7 3

Relative expression

5%FBS 10%FBS BWL1-1 RNL1-1 BWL2-1 RNL2-1 BWL1-0.1 RNL1-0.1

Figure 4.12 mRNA expression of EGF gene in PL-MSCs cultured in complete medium with 5%FBS (control) comparing with complete medium with 10%FBS, and complete medium with 5%FBS supplemented with 0.1-1 µg/ml of BW-PBS lot1, lot2 and RN- PBS lot1, lot2 for 3 and 7 days.

Ref. code: 25605729040302HAO 52

C) EGF Day10 15

Relative expression

5%FBS 10%FBS BWL1-1 RNL1-1 BWL2-1 RNL2-1 BWL1-0.1 RNL1-0.1

D) EGF Day14 10

Relative expression

5%FBS 10%FBS BWL1-1 RNL1-1 BWL2-1 RNL2-1 BWL1-0.1 RNL1-0.1

Figure 4.13 mRNA expression of EGF gene in PL-MSCs cultured in complete medium with 5%FBS (control) comparing with complete medium with 10%FBS, and complete medium with 5%FBS supplemented with 0.1-1 µg/ml of BW-PBS lot1, lot2 and RN- PBS lot1, lot2 for 10 and 14 days.

Ref. code: 25605729040302HAO 53

A) EGFR Day3 30

Relative expression

5%FBS 10%FBS BWL1-1 RNL1-1 BWL2-1 RNL2-1 BWL1-0.1 RNL1-0.1

B) EGFR Day7 2.0

1.5

1.0

0.5

Relative expression

0.0

5%FBS 10%FBS BWL1-1 RNL1-1 BWL2-1 RNL2-1 BWL1-0.1 RNL1-0.1

Figure 4.14 mRNA expression of EGFR gene in PL-MSCs cultured in complete medium with 5%FBS (control) comparing with complete medium with 10% FBS, and complete medium with 5%FBS supplemented with 0.1-1 µg/ml of BW-PBS lot1, lot2 and RN-PBS lot1, lot2 for 3 and 7 days.

Ref. code: 25605729040302HAO 54

C) EGFR Day10 50

Relative expression

5%FBS 10%FBS BWL1-1 RNL1-1 BWL2-1 RNL2-1 BWL1-0.1 RNL1-0.1

D) EGFR Day14 2.5

2.0

1.5

1.0

0.5

Relative expression

0.0

5%FBS 10%FBS BWL1-1 RNL1-1 BWL2-1 RNL2-1 BWL1-0.1 RNL1-0.1

Figure 4.15 mRNA expression of EGFR gene in PL-MSCs cultured in complete medium with 5%FBS (control) comparing with complete medium with 10%FBS, and complete medium with 5%FBS supplemented with 0.1-1 µg/ml of BW-PBS lot1, lot2 and RN-PBS lot1, lot2 for 10 and 14 days.

Ref. code: 25605729040302HAO 55

EGF

15 Day3 Day7 Day10 10 Day14

Relativeexpression

10% 10% 10% 10% 5%FBS BWL1-1 RNL1-1BWL2-1 RNL2-1 5%FBS BWL1-1 RNL1-1BWL2-1 RNL2-1 5%FBS BWL1-1 RNL1-1BWL2-1 RNL2-1 5%FBS BWL1-1 RNL1-1BWL2-1 RNL2-1 BWL1-0.1 RNL1-0.1 BWL1-0.1 RNL1-0.1 BWL1-0.1 RNL1-0.1 BWL1-0.1 RNL1-0.1

Figure 4.16 mRNA expression of EGF gene in PL-MSCs cultured in complete medium with 5%FBS (control) comparing with complete medium with 10%FBS, and complete medium with 5%FBS supplemented with 0.1-1 µg/ml of BW-PBS lot1, lot2 and RN- PBS lot1, lot2 for 3, 7, 10 and 14 days.

Ref. code: 25605729040302HAO 56

EGFR 50 Day 3 Day7 40 Day10 Day14 30

Relativeexpression 10

5%FBS10%FBS BWL1-1 RNL1-1BWL2-1 RNL2-1 5%FBS10%FBS BWL1-1 RNL1-1BWL2-1 RNL2-1 5%FBS10%FBS BWL1-1 RNL1-1BWL2-1 RNL2-1 5%FBS10%FBS BWL1-1 RNL1-1BWL2-1 RNL2-1 BWL1-0.1 RNL1-0.1 BWL1-0.1 RNL1-0.1 BWL1-0.1 RNL1-0.1 BWL1-0.1 RNL1-0.1

Figure 4.17 mRNA expression of EGFR gene in PL-MSCs cultured in complete medium with 5%FBS (control) comparing with complete medium with 10%FBS, and complete medium with 5%FBS supplemented with 0.1-1 µg/ml of BW-PBS lot1, lot2 and RN-PBS lot1, lot2 for 3, 7, 10 and 14 days.

Ref. code: 25605729040302HAO 57

4.3 Neural differentiation potential of MSCs derived from placenta with sea cucumber extracts

To explore the effect of H. scabra extracts from BW, VI and RN at different doses (0.1 µg/ml and 1 µg/ml), we examined the neural differentiation of PL-MSCs treatment in the comparison of standard medium condition.

4.3.1 Commercial neural differentiation medium MSCs were cultured in neural differentiation medium and neural differentiation medium supplement with BW, VI and RN at 0.1 µg/ml and 1 µg/ml, respectively, as described previous for 72 hr. To determine the differentiation potential, MSCs cultured in complete medium and neural differentiation medium were used as the negative control and sham control, respectively. After neural induction, all cultured MSCs were subsequently stained with the neural markers, including MAP-2, β-tubulin III and Nestin, using immunocytochemistry technique. Propidium iodide (PI) was used for nucleus staining. The expression of β-tubulin III and MAP2 marker were very limited in all group of experiment (Fig 4.19-4.20), except the neural differentiation medium group (sham control) (Fig 4.19B and 4.20B). MAP2 was localized in the cytoplasm of few cells and not well oriented in arranged bundles. Furthermore, Nestin expression was positive about 80-90% of cells in the neural differentiation medium group (sham control) (Fig 4.21B) and all supplement medium (Fig 4.21C-H). They were well-oriented in arranged bundles and showed a characteristic filamentous structure.

Ref. code: 25605729040302HAO 58

Neural differentiation staining with anti-β-tubulin III

Ref. code: 25605729040302HAO 59

Figure 4.18 Representative photomicrographs showing the expression of β tubulin III of neural diffentiation ofPL-MSCs after neural induction for 72 h by various kind of mediums. A: Anti-β tubulin III negative staining of MSCs cultured in complete DMEM medium (negative control). B: Anti-β tubulin III staining of MSCs cultured in neural induction medium (sham control). C: PL-MSCs cultured in neural differentiation medium supplemented with BW at 0.1 µg/ml. D: PL-MSCs cultured in neural differentiation medium supplemented with BW at1 µg/ml. E: PL-MSCs cultured in neural differentiation medium supplemented with VI at 0.1 µg/ml. F: PL-MSCs cultured in neural differentiation medium supplemented with VI at 1 µg/ml G: PL-MSCs cultured in neural differentiation medium supplemented with RN at 0.1 µg/ml H: PL-MSCs cultured in neural differentiation medium supplemented with RN at 1 µg/ml Scale bar = 100 µm

Ref. code: 25605729040302HAO 60

Neural differentiation staining with anti-MAP2

Ref. code: 25605729040302HAO 61

Figure 4.19 Representative photomicrographs showing the expression of MAP2 of neural diffentiation ofPL-MSCs after neural induction for 72 h by various kind of mediums. A: Anti-MAP2negative staining of MSCs cultured in complete DMEM medium (negative control). B: Anti-MAP2 staining of MSCs cultured in neural induction medium (sham control). C: PL-MSCs cultured in neural differentiation medium supplemented with BW at 0.1 µg/ml. D: PL-MSCs cultured in neural differentiation medium supplemented with BW at1 µg/ml. E: PL-MSCs cultured in neural differentiation medium supplemented with VI at 0.1 µg/ml. F: PL-MSCs cultured in neural differentiation medium supplemented with VI at 1 µg/ml. G: PL-MSCs cultured in neural differentiation medium supplemented with RN at 0.1 µg/ml. H: PL-MSCs cultured in neural differentiation medium supplemented with RN at 1 µg/ml. Scale bar = 100 µm.

Ref. code: 25605729040302HAO 62

Neural differentiation staining with anti-Nestin

Ref. code: 25605729040302HAO 63

Figure 4.20 Representative photomicrographs showing the expression of Nestin of neural diffentiation ofPL-MSCs after neural induction for 72 h by various kind of mediums. A: Anti-Nestin negative staining of MSCs cultured in complete DMEM medium (negative control). B: Anti-Nestin staining of MSCs cultured in neural induction medium (sham control). C: PL-MSCs cultured in neural differentiation medium supplemented with BW at 0.1 µg/ml. D: PL-MSCs cultured in neural differentiation medium supplemented with BW at1 µg/ml. E: PL-MSCs cultured in neural differentiation medium supplemented with VI at 0.1 µg/ml. F: PL-MSCs cultured in neural differentiation medium supplemented with VI at 1 µg/ml. G: PL-MSCs cultured in neural differentiation medium supplemented with RN at 0.1 µg/ml. H: PL-MSCs cultured in neural differentiation medium supplemented with RN at 1 µg/ml. Scale bar = 100 µm.

Ref. code: 25605729040302HAO 64

4.3.2 In-House neural differentiation medium MSCs were cultured in neural differentiation medium and neural differentiation medium supplement with BW, VI and RN at 0.1 µg/ml and 1 µg/ml as described previous for 10 days. To determine the differentiation potential, MSCs cultured in complete medium and neural differentiation medium were used as the negative control and sham control, respectively. After neural induction, all cultured MSCs were subsequently stained with β-tubulin III using immunocytochemistry technique. DAPI was used for nucleus staining. PL-MSCs were stained with anti-β tubulin III (Fig. 4.22). The positive signals of β-tubulin III were shown in the green signal and DAPI representing with the blue color. PL-MSCs with DMEM medium (negative control) and the neural differentiation medium (sham control) (Fig 4.22A-B), supplement medium at 0.1µg/ml BW and RN supplement medium 1 µg/ml (Fig. 4.22C,H) were limited to a very few cells of β-tubulin III. At the BW 1 µg/ml, VS 0.1,1 µg/ml and RN at 0.1 µg/ml conditions, neural-MSCs were expressed comparing with the other groups (Fig. 4.22D, E, F, G). The number of expressed β-tubulin III cells were counted and showing in the picture (Fig .4.23). The amount of neuron in medium condition supplement with RN 0.1 µg/ml was higher than control and others condition.

Ref. code: 25605729040302HAO 65

Neural differentiation by in-house differentiation media staining with anti-β tubulin III

Ref. code: 25605729040302HAO 66

Figure 4.21 Representative micrographs showing anti-β tubulin III staining of neural diffentiation of PL-MSCs after cultured with body wall, viscera or radial nerve in different doses (0.1-1µg/ml) for 10 days. Scale bar = 100 µm A: Anti-β tubulin III negative staining of MSCs cultured in complete DMEM medium. A: Anti-β tubulin III positive staining of MSCs cultured in neural induction medium. B: PL-MSCs cultured in neural differentiation medium with BW at 0.1 µg/ml C: PL-MSCs cultured in neural differentiation medium with BW at 1 µg/ml D: PL-MSCs cultured in neural differentiation medium with VS at0.1 µg/ml E: PL-MSCs cultured in neural differentiation medium with VS at 1 µg/ml F: PL-MSCs cultured in neural differentiation medium with RN at 0.1 µg/ml H: PL-MSCs cultured in neural differentiation medium with RN at 1 µg/ml

Ref. code: 25605729040302HAO 67

β-tubulin III 50

40 Control diff 30 BW VS 20

Cell Cell number RN 10

0 0.1 1

Protein concentration (µg/ml)

Figure 4.22 The number of neurons after PL-MSCs were induced with in house differentiation media adding different doses (0.1-1µg/ml) of the extracts from body wall, viscera and radial nerve for 10 days.

Ref. code: 25605729040302HAO 68

4.4 Neural genes expression by RT-PCR

To investigate neural gene markers expression of MSCs, the quantitative real- time PCR was conducted after MSCs neural induction. MAP2, β-tubullin III and Nestin expression were carried out with the 3 different samples (N=3). GAPDH was used as the house keeping gene. The level of β-tubullin III mRNA showed very limit at the DMEM medium (negative control group). β-tubullin III mRNA showed very high level at RNL2-0.1 µg/ml neural MSCs group, comparing to sham control medium group (Fig. 4.24). However, β-tubullin III mRNA of BW1-0.1, BWL1-1, VSL1-0.1, VSL1-1, and RNL2-1 showed similar mRNA expression level to sham control group (Fig. 4.24). Moreover, β-tubullin III mRNA of RNL1-0.1, RNL1-1, and BWL2-1 expressed lower than the sham control group (Fig. 4.24). MAP2 mRNA expression was also carried out. As compared to the sham control group, MAP2 mRNA expression showed high level at BWL1-0.1, BWL1-1, BWL2- 0.1, BWL2-1 and RNL2-0.1 groups (Fig. 4.25). Although, VSL1-0.1, VSL1-1, RNL1- 0.1, RNL1-1, RNL2-1 groups showed MAP2 mRNA expression with the low level, as compared to sham control (Fig 4.25). Interestingly, Nestin mRNA expressed within the similar level between the groups (Fig 4.26).

Ref. code: 25605729040302HAO 69

-tubulin III 1000

800

600

400

Relative expression Relative 200

DMEM VSL1-1 RNL1-1 BWL2-1 RNL2-1 BWL1-1VSL1-0.1 BWL1-0.1 RNL1-0.1 BWL2-0.1 RNL2-0.1 Control diff

Figure 4.23 mRNA expression of β tubulin III gene in PL-MSCs cultured in complete medium (DMEM) comparing with sham control medium group, and supplemented with 0.1-1 µg/ml of BWL1, VSL1, RNL1, BWL2 and RNL2.

Ref. code: 25605729040302HAO 70

MAP2 100

Relative expression Relative 20

DMEM VSL1-1 RNL1-1 BWL2-1 RNL2-1 BWL1-1VSL1-0.1 BWL1-0.1 RNL1-0.1 BWL2-0.1 RNL2-0.1 Control diff

Figure 4.24 mRNA expression of MAP2 gene in PL-MSCs cultured in complete medium (DMEM) comparing with sham control medium group, and supplemented with 0.1-1 µg/ml of BWL1, VSL1, RNL1, BWL2 and RNL2.

Ref. code: 25605729040302HAO 71

Nestin 150

100

Relative expression Relative

DMEM VSL1-1 RNL1-1 BWL2-1 RNL2-1 BWL1-1VSL1-0.1 BWL1-0.1 RNL1-0.1 BWL2-0.1 RNL2-0.1 Control diff

Figure 4.25 mRNA expression of Nestin gene in PL-MSCs cultured in complete medium (DMEM) comparing with sham control medium group, and supplemented with 0.1-1 µg/ml of BWL1, VSL1, RNL1, BWL2 and RNL2.

Ref. code: 25605729040302HAO 72

CHAPTER 5 CONCLUSIONS AND RECOMMENDATIONS

In our study, we found that SDS-PAGE analysis from BW and VI displayed a different protein profile which are not surprised as these tissues have a distinct physical structures and physiological functions. However, the protein extracts from RN-PBS and NR-PBS showed with band smearing and hard to distinguish the molecular mass. B. H. Ridzwan et al. showed SDS PAGE presented of three protein bands from body wall of H. scabra, characterized by molecular weight of ~125 kDa, ~108 kDa and ~54 kDa(27), whereas our study found five protein bands in body wall-PBS size >170, ~120, ~45, ~39 and ~17 kDa. The ~17 kDa and ~39 kDa bands showed in all PBS-crude extract protein samples. Comparatively, the crude extracts from different lysis buffers (0.1M PBS and 0.1 M acetic acid) showed that the molecular weight of protein are almost similar in size but different in amount of protein extracts. Suggesting that using in 0.1M PBS as lysis buffer are more suitable than 0.1M acetic acid for crude proteins extraction. Furthermore, the protein components within these tissues should be investigated further, especially ones with high abundance for BW and VI and low abundance for RN and NR. Our western blot result presented the preliminary report of growth factors in normal stage of H. scabra both EGF and NGF. Consequently, NGF was found in viscera extracted with PBS while EGF was found BW-PBS, BW-AA, VI-PBS, RN- PBS and NR-PBS. Our study related to the previous study in the sea urchin. Keisuke Horii found an activated EGIP gene for exogastrula-inducing peptides (EGIPs) after the onset of gastrulation of the sea urchin Anthocidaris crassispina, which are structurally related to the epidermal growth factor (EGF)(28). EGF plays an important role in proliferation and differentiation of many cell types(29, 30). Guihai Aiet al. showed that EGF promotes the proliferation of adipose stem cells (ASCs) and also maintains the differentiation potency of ASCs. While Okinawan starfish Linckia laevigata steroid glycosides mimic nerve growth factor (NGF) activity, which involved with neuronal differentiation, growth, survival, function maintenance, and prevention of aging in the central and peripheral nervous systems(31).

Ref. code: 25605729040302HAO 73

In addition, previous report found that Myc homolog involved with the pluripotency of cells found in the transcriptomic changes during regeneration of the central nervous system in the sea cucumber Holothuria glaberrima. It has been reported that In silico search of adult A. japonicus sea cucumbers genes were carried out. Unigenes were matched to the top 15 species, including Homo sapiens, Mus musculus, Rattus norvegicus, Bos taurus, Xenopus laevis and X. tropicalis etc(10).

Figure 5.1 Distribution of the species to the sequences that were matched with the unigenes of A. japonicus (10).

Pablo A Ortiz-Pineda reported the developmental genes which involved in the organogenesis processes of sea cucumber H. glaberrima, comprising unknown C-4766- 1, Centaurin and Melanotransferrin. Hox12 had previously been found in H. glaberrima regenerating intestine cDNA library. It is one of the development gene which involved in echinoderm regeneration, and increases the expression during intestinal regeneration coincides with findings in the mammalian digestive tract by

Ref. code: 25605729040302HAO 74 expressed during the process of development in embryonic state(32). The family of bone morphogenetic proteins (BMPs) has also been increasingly associated with regenerative phenomena of sea cucumber intestinal and body wall regeneration. The BMP family also have been associated with fin regeneration of zebra fish(33). Wnt homologue (Wnt-9) was overexpressed in the regenerating intestine during the first two weeks of regeneration. Wnt apparently plays a key role in the control of intestinal stem cell proliferation and differentiation in human and mice(34). In the other way, Michael C. Thorndyke et al. studied about Echinoderm, Asterias rubens, they had been reported the evidence of Hox gene homologues expression in regenerating radial nerve cords and BMP2/4 expression during arm regeneration(35). From MTT results, the protein profile of VI extracts were not prominent, their stimulatory effect on PL-MSC proliferation was promising, especially when the cells were treated with low concentrations (0.01-0.1 µg/ml) for 5 days. We also found that the VI extracts could induce cell proliferation when the duration of treatment was prolonged until day 5. This suggested that the exposure time is critical for the VI extracts. The use of acetic acid buffer for VI extraction showed a better result for cell proliferation, suggesting that the potent molecules were obtained by this lysis buffer rather than the 0.1M PBS. Comparison between different tissues, we found that the VI extracts were the most potent candidates for inducing PL-MSC proliferation, especially for the use of 0.01 µg/ml VI-AA for 5 days. In our study, we found that the sea cucumber protein extracts from the BW and VI could enhance the PL-MSCs proliferation. Therefore, the potent protein molecules within these extracts were expected. The nutritional quality and composition of sea cucumber meat has also been explored, showing a high proportion of total and essential amino acid(36, 37) It has been shown that the amino acids such as glycine, glutamic acid, and arginine, could induce lymphocyte proliferation and activity(38). Therefore, these small amino acids present in the H. scabra extracts may be important candidates that are involved in the proliferation of PL-MSCs. Generally, highly insoluble collagen fibers constitute approximately 70% of the total body wall protein(10, 39). Interestingly, the pepsin-solubilized collagen extract of Stichopus japonicus could enhance human keratinocyte cell migration and proliferation(40). However, it is likely that the H. scabra extracts used in the current study, particularly the BW, contains less amount of collagen because the tissues were

Ref. code: 25605729040302HAO 75 not treated with alkaline solution and hydrolysis enzymes during extraction, which are important steps for collagen extraction(39, 40). Moreover, we found that EGF and EGFR were highly expressed after treating with after treatment with BW-PBS at 1 µg/ml compared to control medium. Growth factors, including fibroblast growth factor (FGF), epidermal growth factor (EGF), bone morphogenetic protein (BMP), transforming growth factor beta (TGF-β), have been known to mediate proliferation in mammalian multipotential stromal cells(41, 42). These cytokine proteins are also present in the sea cucumbers and they play important role in the regeneration and development of this animal(10, 43, 44). Potentially, the sea cucumber cytokines may act as exogenous agents to stimulate the proliferation of PL-MSCs in the current study. Whether the cytokine proteins are present within the H. scabra extracts and its association with PL-MSCs proliferation are challenging and require further investigation. In addition, our result indicated that PL-MSCs expressed β-tubulin III and Nestin while MAP2 absence within the cells after neural induction with commercial neural differentiation media supplement with the protein extracts from body wall, viscera and radial nerve for 72 h. Comparing to in-house medium of neural induction, the result showed strongly the positive expression of β-tubulin III even culture with protein extracts or the sham medium when compared to normal condition. We found that the number of cells which were expressed the green fluorescent of β-tubulin III from in-house differentiation medium, radial nerve cord at 0.1 µg/ml showed the highest positive cells among all experimental groups. In our experiment, to discover that whether extract of sea cucumber, H. scabra, as one of chief source of traditional medicine(45, 46) could stimulate proliferation of mesenchymal stem cells and neural differentiation. Previous study found that sulfated polysaccharide from sea cucumber Stichopus japonicus can promoted the proliferation of neural stem/progenitor cells (NSPCs)(23) and water extract of Stichopus variegatus has potential to promote proliferation of rat spinal astrocytes at the concentration of 0.5-10 µg/ml(47). However, there has not yet been a detailed of the effects on human MSCs study, especially with regards to neural differentiation effects. In conclusion, sea cucumber possess spectacular regenerative capacity. Regeneration has been the topic of considerable research, with an emphasis on visceral (intestine) regeneration, including the histological changes (for example, tissue layer

Ref. code: 25605729040302HAO 76 changes in the intestine wall and changes in the radial nerve cord) and cellular events (cell origin, migration and proliferation) associated with such regeneration. The gene expression that drive the regeneration capacity has been reported. Thus, the knowledge of regeneration processes of and the factors in sea cucumbers that drive them may provide new pathways to target the treatment of degenerating diseases mammals and humans, especially in cases where the endogenous pathways in mammal may have been lost, including degenerative disorder and neurodegenerative disorder. The sea cucumber capabilities on MSCs stimulation are still limited. NGF and EGF have never been reported in sea cucumber before, we are currently first reporting of these growth factors in H. scabra. Although, Moreover, the unpublished data in our group has shown the presence of neurotrophin, the one of molecule regulating neuronal survival, growth and differentiation, in body wall, radial nerve cord and nerve ring of H. scabra (unpublished data). The presence of these growth factors may provide the data support in the consequence experiment with the MSCs. The growth factors in H. scabra might be the one of the factors that may increase the proliferation and differentiation effects in MSCs. We studied the effects of protein extracts from H. scabra on MSCs and indicated that H. scabra extracts could stimulate the MSCs proliferation and division. EGF and EFGR mRNA expression also showed increasing in the number of the gene after H. scabra treatments. To investigate the neural differentiation of MSCs, the MSCs can differentiated into neural cells in sham control group and various supplements of H. scabra extracts. β-tubullin III mRNA showed very high level at RNL2-0.1 neural MSCs group. MAP2 mRNA expression showed high level at BWL1-0.1, BWL1-1, BWL2-0.1, BWL2-1 and RNL2-0.1 groups. Interestingly, Nestin mRNA expressed within the similar level between the groups. This suggested an in vitro proliferative and differentiation potency of the H. scabra extracts on MSCs derived from the human placenta. Although this study was performed the experiment with the crude protein extracts from H. scabra. From our data, we suggested that H. scabra may contain some growth factors, such as EGF, NGF and Neurotrophin. They may lead to the increase of MSCs proliferative and differentiation potency. While further studies are required, this finding has firstly provided the evidence that H. scabra extracts could be potentially used to induce in vitro MSCs proliferation and differentiation.

Ref. code: 25605729040302HAO 77

REFERENCES

1. Hamel J-F, Conand C, Pawson DL, Mercier A. The sea cucumber Holothuria scabra (Holothuroidea: Echinodermata): Its biology and exploitation as Beche-de-mer. Advances in Marine Biology. Volume 41: Academic Press; 2001. p. 129-223. 2. Secretariat SAFDCT. Report on the Regional Study on Sea Cucumber Fisheries, Utilization and Trade in Southeast Asia 2007-2008: Secretariat SEAFDEC; 2009. 3. Alvarado AS, Tsonis PA. Bridging the regeneration gap: genetic insights from diverse animal models. Nat Rev Genet. 2006;7(11):873-84. 4. Franco C, Soares R, Pires E, Koci K, Almeida AM, Santos R, et al. Understanding regeneration through proteomics. PROTEOMICS. 2013;13(3-4):686- 709. 5. García-Arrarás JE, Greenberg MJ. Visceral regeneration in holothurians. Microscopy Research and Technique. 2001;55(6):438-51. 6. Gao F, Yang H. Chapter 4 - Anatomy. In: Hongsheng Yang J-FH, Annie M, editors. Developments in Aquaculture and Fisheries Science. Volume 39: Elsevier; 2015. p. 53-76. 7. Mashanov VS, García-Arrarás JE. Gut Regeneration in Holothurians: A Snapshot of Recent Developments. The Biological Bulletin. 2011;221(1):93-109. 8. Wang T, Sun L, Chen M. Chapter 11 - Aestivation and Regeneration. In: Hongsheng Yang J-FH, Annie M, editors. Developments in Aquaculture and Fisheries Science. Volume 39: Elsevier; 2015. p. 177-209. 9. San Miguel-Ruiz JE, Maldonado-Soto AR, García-Arrarás JE. Regeneration of the radial nerve cord in the sea cucumber Holothuria glaberrima. BMC developmental biology. 2009;9(1):3. 10. Sun L, Chen M, Yang H, Wang T, Liu B, Shu C, et al. Large scale gene expression profiling during intestine and body wall regeneration in the sea cucumber Apostichopus japonicus. Comparative Biochemistry and Physiology Part D: Genomics and Proteomics. 2011;6(2):195-205. 11. Janakiram NB, Mohammed A, Rao CV. Sea Cucumbers Metabolites as Potent Anti-Cancer Agents. Marine Drugs. 2015;13(5):2909-23. 12. Friedenstein AJ, Chailakhjan RK, Lalykina KS. The development of fibroblast colonies in monolayer cultures of guinea-pig bone marrow and spleen cells. Cell Tissue Kinet. 1970;3(4):393-403. 13. Cutler C, Antin JH. Peripheral Blood Stem Cells for Allogeneic Transplantation: A Review. Stem cells (Dayton, Ohio). 2001;19(2):108-17. 14. Lee OK, Kuo TK, Chen W-M, Lee K-D, Hsieh S-L, Chen T-H. Isolation of multipotent mesenchymal stem cells from umbilical cord blood. Blood. 2004;103(5):1669. 15. Meirelles LdS, Chagastelles PC, Nardi NB. Mesenchymal stem cells reside in virtually all post-natal organs and tissues. Journal of Cell Science. 2006;119(11):2204. 16. Pelekanos RA, Sardesai VS, Futrega K, Lott WB, Kuhn M, Doran MR. Isolation and Expansion of Mesenchymal Stem/Stromal Cells Derived from Human Placenta Tissue. Journal of Visualized Experiments : JoVE. 2016(112):54204. 17. Spencer ND, Gimble JM, Lopez MJ. Mesenchymal Stromal Cells: Past, Present, and Future. Veterinary Surgery. 2011;40(2):129-39.

Ref. code: 25605729040302HAO 78

18. Puissant B, Barreau C, Bourin P, Clavel C, Corre J, Bousquet C, et al. Immunomodulatory effect of human adipose tissue-derived adult stem cells: comparison with bone marrow mesenchymal stem cells. British Journal of Haematology. 2005;129(1):118-29. 19. Zhou S, Greenberger JS, Epperly MW, Goff JP, Adler C, LeBoff MS, et al. Age-Related Intrinsic Changes in Human Bone Marrow-Derived Mesenchymal Stem Cells and Their Differentiation to Osteoblasts. Aging cell. 2008;7(3):335-43. 20. Makino S, Fukuda K, Miyoshi S, Konishi F, Kodama H, Pan J, et al. Cardiomyocytes can be generated from marrow stromal cells in vitro. The Journal of Clinical Investigation. 1999;103(5):697-705. 21. Taylor SM, Jones PA. Changes in phenotypic expression in embryonic and adult cells treated with 5-azacytidine. Journal of Cellular Physiology. 1982;111(2):187- 94. 22. Koo BK, Park IY, Kim J, Kim J-H, Kwon A, Kim M, et al. Isolation and Characterization of Chorionic Mesenchymal Stromal Cells from Human Full Term Placenta. Journal of Korean Medical Science. 2012;27(8):857-63. 23. Zhang Y, Song S, Song D, Liang H, Wang W, Ji A. Proliferative effects on neural stem/progenitor cells of a sulfated polysaccharide purified from the sea cucumber Stichopus japonicus. Journal of Bioscience and Bioengineering. 2010;109(1):67-72. 24. Azim Patar SMSSJ, Hasnan Jaafar, Jafri Malin Abdullah. The effect of water extract of sea cucumber Stichopus variegatus on rat spinal astrocytes cell lines. Current Neurobiology 2012. 2012;3(1):11-6. 25. Treerattrakool S, Panyim S, Chan SM, Withyachumnarnkul B, Udomkit A. Molecular characterization of gonad-inhibiting hormone of Penaeus monodon and elucidation of its inhibitory role in vitellogenin expression by RNA interference. The FEBS journal. 2008;275(5):970-80. 26. Marupanthorn K, Tantrawatpan C, Kheolamai P, Tantikanlayaporn D, Manochantr S. Bone morphogenetic protein-2 enhances the osteogenic differentiation capacity of mesenchymal stromal cells derived from human bone marrow and umbilical cord. International Journal of Molecular Medicine. 2017;39(3):654-62. 27. B.H. RidzwanZ. FH, J.M. Daud. Protein profiles of three species of Malaysian sea cucumber; Holothuria edulis Lesson, H. scabra Jaeger and Stichopus horrens Selenka. European Journal of Scientific Research. 2012;Vol.75 No.2 (2012):255-61. 28. Horii K, Suzuki G, Suyemitsu T, Yamasu K. Characterization of the upstream region that regulates the transcription of the gene for the precursor to EGF-related peptides, exogastrula-inducing peptides, of the sea urchin Anthocidaris crassispina. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology. 2003;136(1):15-26. 29. Ai G, Shao X, Meng M, Song L, Qiu J, Wu Y, et al. Epidermal growth factor promotes proliferation and maintains multipotency of continuous cultured adipose stem cells via activating STAT signal pathway in vitro. Medicine. 2017;96(30):e7607. 30. You DH, Nam MJ. Effects of human epidermal growth factor gene-transfected mesenchymal stem cells on fibroblast migration and proliferation. Cell proliferation. 2013;46(4):408-15.

Ref. code: 25605729040302HAO 79

31. Han C, Qi J, Ojika M. Structure–activity relationships of novel neuritogenic steroid glycosides from the Okinawan starfish Linckia laevigata. Bioorganic & Medicinal Chemistry. 2006;14(13):4458-65. 32. Yasuhiro K, Tomohisa S, Masatake A, Katsumasa T, Kimi A, Ken‐ ichi Y. Region‐ specific gastrointestinal Hox code during murine embryonal gut development. Development, Growth & Differentiation. 2002;44(1):77-84. 33. Smith A, Avaron F, Guay D, Padhi BK, Akimenko MA. Inhibition of BMP signaling during zebrafish fin regeneration disrupts fin growth and scleroblast differentiation and function. Developmental Biology. 2006;299(2):438-54. 34. Yen T-H, Wright NA. The gastrointestinal tract stem cell niche. Stem Cell Reviews. 2006;2(3):203-12. 35. Thorndyke Michael C, Chen WC, Beesley Philip W, Patruno M. Molecular approach to echinoderm regeneration. Microscopy Research and Technique. 2001;55(6):474-85. 36. Jing W, Chaoqun H, Sigang F. Chemical composition and nutritional quality of sea cucumbers. Journal of the Science of Food and Agriculture. 2010;90(14):2469-74. 37. Bordbar S, Anwar F, Saari N. High-Value Components and Bioactives from Sea Cucumbers for Functional Foods—A Review. Marine Drugs. 2011;9(10). 38. Cruzat VF, Krause M, Newsholme P. Amino acid supplementation and impact on immune function in the context of exercise. Journal of the International Society of Sports Nutrition. 2014;11(1):61. 39. M. S, N. K, N. U, S. K. Collagen as the Major Edible Component of Sea Cucumber (Stichopus japonicus). Journal of Food Science. 2002;67(4):1319-22. 40. Park S-YL, H.K.; Lee, S.; Hwang, H.C.; Cho, S.K.; Cho, M. Pepsin-solubilised collagen (PSC) from Red Sea cucumber (Stichopus japonicus) regulates cell cycle and the fibronectin synthesis in HaCaT cell migration. Food Chem. 2012;132:487-92. 41. Zhao‐ Jun L, Ying Z, C. VO. Trafficking and differentiation of mesenchymal stem cells. Journal of Cellular Biochemistry. 2009;106(6):984-91. 42. Watabe TM, K. . Roles of TGF-[beta] family signaling in stem cell renewal and differentiation. Cell Research. 2009;19:103-15. 43. Mashanov VSZ, O.R.; Garcia-Arraras; J.E. . Expression of Wnt9, TCTP, and Bmp1/Tll in sea cucumber visceral regeneration. Gene Expression Patterns. 2012;12(1- 2):24-35. 44. Sun LY, H.; Chen, M.; Ma, D.; Lin, C. RNA-Seq Reveals Dynamic Changes of Gene Expression in Key Stages of Intestine Regeneration in the Sea Cucumber Apostichopus japonicas. PLoS One 2013;8:e69441. 45. Bahrami Y, Zhang W, Franco C. Discovery of Novel Saponins from the Viscera of the Sea Cucumber Holothuria lessoni. Marine Drugs. 2014;12(5):2633-67. 46. Gates KW. Marine Products for Healthcare: Functional and Bioactive Nutraceutical Compounds from the Ocean, Vazhiyil Venugopal. Journal of Aquatic Food Product Technology. 2010;19(1):48-54. 47. Azim Patar SMSSJ, Hasnan Jaafar, Jafri Malin Abdullah. The effect of water extract of sea cucumber Stichopus variegatus on rat spinal astrocytes cell lines. . Current Neurobiology 2012. 2012;3(1):11-6.

Ref. code: 25605729040302HAO 80

APPENDICES

Ref. code: 25605729040302HAO 81

APPENDIX A REAGENTS AND INSTRUMENTATIONS

Reagents

0.25% Trypsin-EDTA (Cat. No. 25200, GibcoBRL, USA) 2-Propanol (Cat. No. 109634, Merck, Germany) BCIP®/NBT Liquid substrate (Cat. No. B1911, Sigma-Aldrich, USA) β-glycerophosphate (Cat. No. G9422, Sigma-Aldrich, USA) AdvanceSTEM mesenchymal Stem (Cat. No. SH30893.02, HyClone, USA) cell Basal Medium AdvanceSTEM Growth (Cat. No. SH30878.01, Hyclone, USA) Supplement Alizarin Red S (Cat. No. A3757, Sigma-Aldrich, USA) B27 supplement (Cat. No. 12587, Invitrogen, USA) BDNF (Cat. No. 450-02, Peprotech, USA) Bovine serum albumin (BSA) (Cat. No. A7888, Sigma-Aldrich, USA) Bradford reagent (Cat. No. 5000006, Bio-Rad, USA) BrainPhys Neuronal Medium (Cat. No.05790, StemCell Technology, Canada) Collagenase from Clostridium (Cat. No. C2674, Sigma-Aldrich, USA) D-glucose anhydrous (Cat. No. 783, Ajax Finechem, Australia) Deoxyribonuclease I (Cat. No. D5025, Sigma-Aldrich, USA) Dexamethasone (Cat. No. D4902, Sigma-Aldrich, USA) Dimethyl sulfoxide (DMSO) (Cat. No. 0231, Sigma-Aldrich, USA) Dulbecco’s Modified Eagle’s (Cat. No. 31600034, GibcoBRL, USA) Medium (DMEM) Fetal bovine serum (Cat. No. 26140, GibcoBRL, USA) GDNF (Cat. No. 450-10, Peprotech, USA)

Ref. code: 25605729040302HAO 82

GlutaMAXTM (Cat. No. 35050, GibcoBRL, USA) Indomethacin (Cat. No. I7378, Sigma-Aldrich, USA) IsoPrep (Robbins Scientific Corporation, USA) Insulin from bovine pancreas (Cat. No. I6634, Sigma-Aldrich, USA) Isobutylxanthine (Cat. No. I7018, Sigma-Aldrich, USA) L-ascorbic acid (Cat. No. A4403, Sigma-Aldrich, USA) Oil red O (Cat. No. O0625, Sigma-Aldrich, USA) Penicilin/Streptromycin (Cat. No. 15140, GibcoBRL, USA) Retinoic acid (Cat. No. 72262, StemCell Technology, Canada) Trizol® reagent (Cat. No. 15596026, Invitrogen, USA) Vectashield with propidium iodide (Cat. No. H-1300, Vector laboratories, Canada)

Ref. code: 25605729040302HAO 83

Antibodies

Alexa Fluor 488 goat anti-mouse IgG (Cat. No. A11001, Invitrogen, USA) FITC anti-human CD45 (Cat. No. 304006, BioLegend, USA) FITC anti-human CD90 (Cat. No. 328108, BioLegend, USA) Mouse anti-human β-tubulin III (Cat. No. MAB1637, Merck, USA) Mouse anti-human β-tubulin III (Cat. No. T5076, Sigma LifeScience, USA) Mouse anti-human MAP2 (Cat. No. 05-346, Merck, USA) Mouse anti-human Nestin (Cat. No. MAB5326, Merck, USA) PE anti-human CD34 (Cat. No. 343506, BioLegend, USA) PE anti-human CD73 (Cat. No. 344004, BioLegend, USA) PE Mouse anti-human CD105 (Cat. No. 560839, BD Bioscience, USA)

Ref. code: 25605729040302HAO 84

Instrumentations

BD FACScalibur™ (Becton Dickinson, USA) Class II biological safety cabinets (LABCONCO, USA) Centrifugation Machine (Hettich, Universal 320K, USA)

CO2 incubator (NUAIRE TM, USA) Fluorescent microscopy (Nikon eclipse Ts2R, Japan) Freezer(-20 °C Templow) (J.P. SELECTA, Japan) Freezer (-80°C) (Sunyo, Japan) Inverted microscopy (TS100) (Nikon, Japan) Microplate reader (BioTex, USA) Sunyo Biomedical Freezer (Sunyo, Japan) Step one plus™ Real-Time PCR (Applied Biosystems; ABI, USA) machine Water bath (Julabo, USA)

Ref. code: 25605729040302HAO 85

Plasticwares and miscellaneous

0.40 µm Sterile Syringe Filter (Corning Intercorporated, USA) 6-well plate (Corning Intercorporated, USA) 24-well plate (Corning Intercorporated, USA) 96-well plate (Corning Intercorporated, USA) 12 mm cover glasses #1 (Thermo scientific, USA) 35 mm dish (Corning Intercorporated, USA) 15 ml falcon tube (Corning Intercorporated, USA) 50 ml falcon tube (Corning Intercorporated, USA) Universal fit pipet tips 0.1-10 µl (Corning Intercorporated, USA) Universal fit pipet tips 1-200 µl (Corning Intercorporated, USA) Serological pipettes 2 ml (Corning Intercorporated, USA) Serological pipettes 5 ml (Corning Intercorporated, USA) Serological pipettes 10 ml (Corning Intercorporated, USA) Serological pipettes 25 ml (Corning Intercorporated, USA) T25 Cell Culture Flask (Corning Intercorporated, USA) T75 Cell Culture Flask (Corning Intercorporated, USA)

Ref. code: 25605729040302HAO 86

APPENDIX B REAGENT PREPARATION

10X Phosphate buffered saline (PBS) NaCl 76.5 g Na2HPO4 9.9 g KH2PO4 4.0 g Distilled water to 1 L The stock buffer was prepared by dissolving all of above reagents in distilled water, mixed until complete dissolving, adjust pH 7.4, added distilled water to final volume of 1 L and autoclaved. The solution was steriled by autoclaving for 15 min at 121°C, 151b/square inches and store at 4°C.

1X Phosphate buffered saline (PBS) 10X PBS 50 ml Distilled water 450 ml The buffer was prepared by mixed 50 ml 10X PBS with 450 ml steriled distilled water. The solution was stored at 4°C.

16% Paraformaldehyde Paraformaldehyde 80 g Distilled water 450 ml 10 N NaOH 500 µl The stock solution was prepared by dissolving all above reagents in distilled water, heat the solution while stirring until the solution was clears, equilibrated to pH7.4 and added volume to 500 ml. The solution was filtered and stored at 4°C.

4% Paraformaldehyde 16% Paraformaldehyde 2.5 ml 1X PBS 7.5 ml

Ref. code: 25605729040302HAO 87

The solution was prepared by mixed 2.5 ml 16% paraformaldehyde with 7.5 ml 1X PBS and used immediately.

DMEM stock solution DMEM 1 pack NaHCO3 3.7 g Distilled water to 1 L The stock solution was prepared by dissolving all above reagents in distilled water, stirred until the solution was clear, equilibrated to pH 7.4 and added volume to 1 L. The solution was filtered and stored at 4°C.

DMEM + 10%FBS DMEM solution 44 ml FBS 5 ml 1X Penicillin/streptomycin 500 µl L-glutamine 500 µl The solution was prepared by mixed all above reagents, stored at 4°C.

2.5 M D-glucose (25 ml) D-glucose 11.26 g Distilled water to 25 ml The solution was prepared by dissolved D-glucose in 25 ml distilled water, filtered with 0.40 µm sterile syringe filter and stored at -20°C

0.5% (w/v) Oil red O in isopropanol Oil red O 0.5 g 2-Propanol (Isopropanol) 100 ml The stock solution was prepared by dissolved oil red O in isopropanol and stored at 4°C

Oil red O working solution 0.5% (w/v) Oil red O in isopropanol 6 ml

Ref. code: 25605729040302HAO 88

Distilled water 4 ml The solution was prepared by dissolving stock Oil red O in distilled water, filtered with Whatman #1 filter paper and used immediately.

Adipogenic differentiation medium Complete DMEM 48.4 ml Isobutylxanthine 5.75 mg 20 mM indomethacin 500 µl 2.5 M glucose 500 µl 1 mM Dexamethasone 50 µl 1 mg/ml insulin 50 µl The solution was prepared by added all above reagents in complete DMEM, filtered with 0.40 µm sterile syringe filter and stored at 4°C.

Osteogenic differentiation medium I Stock DMEM 44.05 ml FBS 4.95 ml 1X Penicillin/Streptomycin 500 µl 0.1µM Dexamethasone 500 µl 60 mM Ascorbic acid 500 µl The solution was prepared by added all reagent above without ascorbic acid in stock DMEM, filtered with 0.40 µm sterile syringe filter and stored at 4°C. Added ascorbic acid freshly before used.

Osteogenic differentiation medium II Stock DMEM 39.60 ml FBS 4.45 ml 1X Penicillin/Streptomycin 450 µl 0.1µM Dexamethasone 500 µl 10 mM β-glycerophosphate 5 ml 60 mM Ascorbic acid 500 µl

Ref. code: 25605729040302HAO 89

The solution was prepared by added all above reagents without ascorbic acid instock DMEM, filtered with 0.40 µm sterile syringe filter and stored at 4°C. Added ascorbic acid freshly before used.

Neural differentiation medium (Commercial medium) AdvanceSTEM Mesenchymal Stem Cell Basal Medium 45 ml AdvanceSTEM Growth Supplement 5 ml The solution was prepared by added all above reagents stored at 4°C.

Neural differentiation medium I (In-house medium) BrainPhys basal medium 9.786 ml 2mM GlutaMAX 1X Penicillin/Streptomycin 100 µl 10 uM Retinoic acid 2% B27 supplement FBS 500 µl The solution was prepared by added all above reagents BrainPhys basal medium, filtered with 0.2 µm sterile syringe filter and stored at 4°C.

Neural differentiation medium II (In-house medium) BrainPhys basal medium 8.896 ml 2mM GlutaMAX 1X Penicillin/Streptomycin 100 µl 20 ng/ml BDNF 20 ng/ml GDNF 2% B27 supplement FBS 500 µl The solution was prepared by added all above reagents BrainPhys basal medium, filtered with 0.2 µm sterile syringe filter and stored at 4°C.

40mM Alizarin Red S Alizarin Red S 0.274 g

Ref. code: 25605729040302HAO 90

Distilled water 50 ml The stock solution was prepared by dissolved Alizarin Red S in distilled water,stirred to mix until homogeneous, adjusted pH to 4.1 with 10% (v/v) ammonium hydroxide and stored at room temperature. Keep working ARS dye solution in dark container (cover with foil).

0.3% Trixton X 1X PBS 49.70 ml Trixton X 300 µl The 0.3% Trixton X prepared by mixed 300 µl Trixton X with 49.70 ml steriled 1X PBS. The solution was stored at 4°C.

0.1% Tween 20 1X PBS 49.90 ml Trixton X 100 µl The 0.1% Trixton X prepared by mixed 100 µl Trixton X with 49.90 ml steriled 1X PBS. The solution was stored at 4°C.

Ref. code: 25605729040302HAO 91

APPENDIX C EXPERIMENT PROCIDURE

Isolation and culturation of MSCs from postnatal tissues Reagents: DMEM + 10% FBS (v/v) + 2 mM L-glutamine + 100 U/ml penicillin + 100 µg/ml streptomycin 1X Phosphate buffered saline+100 U/ml penicillin+100 µg/ml streptomycin 1.6 mg/ml Collagenase type I-A 200 mg/ml Deoxyribonuclease I 0.25 % Trypsin EDTA

Materials and instruments: 50 ml Falcon tube Centrifugation machine Serological pipettes 10 ml T25 cell culture flask

Procedure 1. Dissect placenta tissues placental tissue size 3 x 3 cm2 2. Rinse with 1X PBS +100 U/ml penicillin + 100 µg/ml streptomycin and mince into small pieces (1-2 mm2 in size). 3. Wash the tissues with 1X PBS + 100 U/ml penicillin + 100 µg/ml streptomycin. 4. Centrifuge at 2,000 x g for 5 min 5. Collect the pellets and digested with 5 ml of 1.6 mg/ml collagenase type IX (Sigma-Aldrich, USA.) and 200 mg/ml deoxyribonuclease I (SigmaAldrich, USA.) for 4 hours at 37ºC with shaking. 6. Wash twice with 1X PBS + 100 U/ml penicillin + 100 µg/ml streptomycin, then centrifuge at 2,000 x g for 5 min.

Ref. code: 25605729040302HAO 92

7. Culture cells and all pellet in DMEM supplemented with 10% FBS + 2mM L-glutamine + 100 U/ml penicillin + 100 µg/ml streptomycin in 25 cm2tissue culture flasks.

8. Maintain the cultures at 37ºC in a humidifiled atmosphere containing 5%CO2 9. Change culture medium every 3 - 4 days. 10.Remove fibroblastoid cells at day 7 (80% confluence) after initiatedplating using 0.25% trypsin/ 2 mM EDTA (GibcoBRL, USA).Replate the cells at a density of 1 x 104 cells/cm2.

Immunophenotypical characterization of culture cells Reagents: FITC-conjugated anti-human CD45 antibody FITC-conjugated anti- human CD90 antibody FITC-conjugated anti- human CD105antibody PE-conjugated anti- human CD34 antibody PE-conjugated anti- human CD73 antibody 1X Phosphate buffered saline (1X PBS) 0.25% Trypsin EDTA 1% Paraformaldehyde in 1X PBS

Materials and instruments: 10 ml Serological pipettes 15 ml Falcon tube Centrifugation machine

Procedure 1. Wash the primary cells (passage 3 - 5) with 1X PBS 2. Add 1 ml of 0.25% trypsin-EDTA into T25-flask and incubate for min at 37ºC. 3. Add 1 ml of FBS to stop the reaction. 4. Centrifuge at 2,000 x g for 5 min 5. Collect the cell pellet and wash twice with 1X PBS

Ref. code: 25605729040302HAO 93

6. Stain cells (4 x 105 cells in 50 µl 1X PBS) with 5 µl of fluoresceinisothiocyanate (FITC) or phycoerythrin (PE)-conjugated antibodies for 30min at 4ºC in the dark. 7. Wash twice with 1X PBS and fix with 1% paraformadehyde in 1X PBSfor 15 min. 8. Acquire and analyze the label cells using flow cytometer (FACS caliber, Becton Dickinson) and Cell Quest software.

Adipogenic differentiation assay of culture cells Reagents: 0.5% (v/v) Oil Red O 1X Phosphate buffered saline 40% Formalin Adipogenic differentiation medium Distilled water

Materials and instruments: 5 ml Serological pipettes 15 ml Falcon tube 35-mm-culture dish Centrifugation machine

Procedure 1. Seed PL-MSCs (7.5 x 104 cells) at passage 4 in 35-mm2 dish and allow to adhere to the dish overnight. 2. Wash with 1X PBS and change the medium to adipogenic differentiation medium.

3. Culture at 37 °C in humidified atmosphere containing 5% CO2 4. Replace the adipogenic differentiation medium every 3 days. 5. After 4 weeks of culture, wash the cell with 1X PBS and fix with 40%formalin vapor for 10 min at room temperature.

Ref. code: 25605729040302HAO 94

6. Wash twice with distilled water and stain with 0.10% (v/v) oil Red O in60% isopropanol for 20 min at room temperature. 7. Wash twice with distilled water. 8. Observe the cells under inverted microscope (Nikon TS100, Japan).

Osteogenic differentiation assay of culture cells Reagents: 1X Phosphate buffered saline 40 mM Alizarin red S 4% Paraformaldehyde Distilled water Osteogenic differentiation medium

Materials and instruments: 5 ml Serological pipettes 15 ml Falcon tube 35-mm culture dish Centrifugation machine

Procedure 1. Seed PL-MSCs (passage 4) at a density of 4.5 x 104 cells in 35-mm2 dishes and allow to adhere to the dish overnight. 2. Wash with 1X PBS and change the medium to osteogenic differentiation medium.

3. Culture at 37°C in humidified atmosphere containing 5% CO2. 4. Replace the osteogenic differentiation medium every 3 days. 5. After 4 weeks of culture, wash the cells with 1X PBS and fix with 4%paraformaldehyde for 5 min at 4ºC. 6. Stain with Alizarin red S (ARS) for 30 min at room temperature to visualize osteogenic differentiation. 7. Wash twice with distilled water. 8. Observe the cells under inverted microscope (Nikon TS100, Japan).

Ref. code: 25605729040302HAO 95

Proliferation assay Reagents: DMEM + 10% (v/v) FBS + 2 mM L-glutamine + 100 U/ml penicillin + 100 µg/ml streptomycin 1X Phosphate buffered saline + 100 U/ml penicillin + 100 µg/ml Streptomycin 0.25% Trypsin-EDTA

Materials and instruments: 24-well culture plate 5 ml Serological pipettes Centrifugation machine Hemocytometer

Procedure 1. Seed MSCs (1 x 103 cells) at passage 2 - 4 into 24-well plate containing 500 µl of complete medium in triplicate. 2. Incubate the cells at 37°C in a humidified tissue culture incubator with

5% CO2. 3. Harvest the cells using 0.25% trypsin-EDTA and count the total cells using hematocytometer. 4. The mean numbers of cells and plot against culture time to generate a growth curve.

Neural differentiation assay culture cells (Commercial medium) Reagents: 1X Phosphate buffered saline 0.1% Tween 20 in 1X PBS 0.3% TrixtonX 100 in 1X PBS Mouse anti-β tubulin III Mouse anti-MAP2

Ref. code: 25605729040302HAO 96

Mouse anti-Nestin Alexa Fluor 488 Goat anti-mouse VectaShield with PI AdvanceSTEM Mesenchymal Stem Cell Basal Medium AsvanceSTEM Growth supplement

Materials and instruments: 5 ml Serological pipettes 15 ml Falcon tube 24-well plate 12 mm cover glasses Centrifugation machine

Procedure 1. Seed PL-MSCs (passage 4-5) at a density of 5 x 103 cells in 24-well plate and allow to adhere to the 12 mm cover glasses overnight. 2. Wash with 1X PBS and change the medium to neural differentiation medium.

3. Culture at 37°C in humidified atmosphere containing 5% CO2. 4. Replace the neural differentiation medium every 2 days. 5. After 72 h of culture, wash the cells with 0.1% Tween20 and fix with 4%paraformaldehyde for 30 min at 4ºC. 6. Incubate with 0.3%TrixtonX 100 for 30 minutes at room temperature. 7. Wash with 1X PBS cold 3 times, then incubate with 4%BSA as blocking solution. 8. Stain with mouse anti-β tubulin III, MAP2 and Nestin for 2-4 h at room temperature. 9. Wash with 0.1% Tween20 in 1X PBS and stain with Alexa 488 goat anti- mouse. 10. Wash once with0.1% Tween20 in 1X PBS and twice with distilled water 11. Stain nucleus and add anti-fade with Vectashield. 11. Observe the cells under inverted microscope (Nikon eclipse Ts2R, Japan).

Ref. code: 25605729040302HAO 97

Neural differentiation assay culture cells (In-house medium I) Reagents: 1X Phosphate buffered saline 0.1% Tween 20 in 1X PBS 0.3% TrixtonX 100 in 1X PBS Mouse anti-β tubulin III Mouse anti-MAP2 Mouse anti-Nestin Alexa Fluor 488 Goat anti-mouse VectaShield with PI BrainPhys basal medium GlutaMAX Penicillin/Streptomycin Retinoic acid B27 supplement

Materials and instruments: 5 ml Serological pipettes 15 ml Falcon tube 24-well plate 12 mm cover glasses Centrifugation machine

Ref. code: 25605729040302HAO 98

6. Incubate with 0.3%TrixtonX 100 for 30 minutes at room temperature. 7. Wash with 1X PBS cold 3 times, then incubate with 4%BSA as blocking solution. 8. Stain with mouse anti-β tubulin III, MAP2 and Nestin for 2-4 h at room temperature. 9. Wash with 0.1% Tween20 in 1X PBS and stain with Alexa 488 goat anti- mouse. 10. Wash once with0.1% Tween20 in 1X PBS and twice with distilled water 11. Stain nucleus and add anti-fade with vectashield. 11. Observe the cells under inverted microscope (Nikon eclipse Ts2R, Japan).

Neural differentiation assay culture cells (In-house medium I and II) Reagents: 1X Phosphate buffered saline 0.1% Tween 20 in 1X PBS 0.3% TrixtonX 100 in 1X PBS 20 ng/ml BDNF 20 ng/ml GDNF Mouse anti-β tubulin III Mouse anti-MAP2 Mouse anti-Nestin Alexa Fluor 488 Goat anti-mouse VectaShield with PI BrainPhys basal medium GlutaMAX Penicillin/Streptomycin Retinoic acid B27 supplement

Materials and instruments: 5 ml Serological pipettes 15 ml Falcon tube

Ref. code: 25605729040302HAO 99

24-well plate 12 mm cover glasses 0.2 µm syringe filter Centrifugation machine

3. Culture at 37°C in humidified atmosphere containing 5% CO2 for 5 days. 4. Replace the neural differentiation medium I every 2 days. 5. Change medium to neural differentiation medium II.

6. Culture at 37°C in humidified atmosphere containing 5% CO2 for 5 days by replace the neural differentiation medium II every 2 days. 7. After 10 days of culture period, wash the cells with 0.1% Tween20 in 1X PBS and fix with 4%paraformaldehyde for 30 min at 4ºC. 8. Incubate with 0.3%TrixtonX 100 for 30 minutes at room temperature. 9. Wash with 1X PBS cold 3 times, then incubate with 4%BSA as blocking solution. 10. Stain with mouse anti-β tubulin III, MAP2 and Nestin for 2-4 h at room temperature. 11. Wash with 0.1% Tween20 in 1X PBS and stain with Alexa 488 goat anti- mouse. 12. Wash once with0.1% Tween20 in 1X PBS and twice with distilled water 13. Stain nucleus and add anti-fade with vectashield. 14. Observe the cells under inverted microscope (Nikon eclipse Ts2R, Japan)

Ref. code: 25605729040302HAO 100

BIOGRAPHY

Name Miss Jutarat Saengsuwan Date of birth July 27, 1992 Educational attainment Academic Year 2013: Bachelor Degree of Science (Medical Technology) Faculty of Medical Technology, Thammasat University, Thailand

Work position Medical technologist at Thammasat chalermprakiat hospital

Scholarship Teacher assistant Scholarship, Thammasat university

Work experiences 2016-2018: Medical technologist, Thammasat Chalermprakiat hospital, Pathum Thani, Thailand 2015-2016: Medical technologist, Nonthavej Hospital, Nonthaburi, Thailand 2014: Medical technologist, Loei hospital, Loei, Thailand

Award 3rd Best Poster Presentation Award from International Conference of Pharmaceutical Sciences and Medicines at Faculty of Pharmaceutical Sciences, Burapha University, Chonburi, Thailand. On 16 June 2017

Ref. code: 25605729040302HAO