Helicobacter Pylori Adhesion and Patho-Adaptation the Role of Baba and Saba Adhesins in Persistent Infection and Chronic Inflammation

UMEÅ UNIVERSITY MEDICAL DISSERTATIONS Abstract No. 83, ISSN 0345-7532, ISBN 91-7305-548-4

From the Department of Odontology, Division of Oral Microbiology, Faculty of Medicine, Umeå University, Umeå, Sweden

Helicobacter pylori Adhesion and Patho-adaptation The role of BabA and SabA adhesins in persistent infection and chronic inflammation

Jafar Mahdavi

Umeå, 2004

Print & Media

To my lovely family;

Vina, Melissa and Mona

Print & Media

Vision without action is a daydream, Action without vision is a nightmare.

Derived from The Analects of Confucius

Print & Media

Contents

Page Preface 5

Abbreviations 6

Abstract 8

Introduction 9

1. A brief history of H. pylori infection 9

2. Microbiology of Helicobacter 9

3. Epidemiology 10

4. The Lewis and ABO blood group systems and H. pylori infection 11

5. Biodiversity 13

5.1 Habitat diversity 13

5.2 Genetic diversity 13

5.3 Tropism and patho-adaptation 16

5.4 Biofilm formation 17

6. Virulence factors and persistence of infection 17

6.1 Adhesins 19

6.1.1 Consequences of bacterial adhesion 19

6.1.1.1 Effect on the bacterial cells 20

6.1.1.2 Effect on the host cells 21

6.2 Invasion of host cells 22

6.3 H. pylori enzymes 23

6.4 VacA and CagA 23

6.5 H. pylori LPS 24

Print & Media 7. Diseases associated with H. pylori infection 25

7.1 Gastritis 25

7.2 Peptic ulcer disease 27

7.3 Gastric adenocarcinoma 27

7.4 Barrett’s esophagus 28

Aims 29

Results and Discussion 30

8. The role of MUC5AC in H. pylori adherence 30

9. Gastric mucosa sialylation and inflammation 30

10. Identification of inflammation associated H. pylori adhesive activities 32

11. The role of BabA and SabA in persistent infection and 32

chronic inflammation

11.1 phase variation and biofilm formation 33

11.2 SabA and BabA in relation to patho-adaptation 34

12. The role of LPS in H. pylori adherence 35

Specific conclusions 37

Future perspectives 38

Acknowledgements 40

References 41

Appendix I-IV 53

Print & Media Preface

This thesis is based on the following papers, which are referred to in the text by their Roman numerals:

I. Van de Bovenkamp J.H., Mahdavi J., Korteland-Van Male A., Büller H., Einerhand A., Borén T., and Dekker J. The MUC5AC glycoprotein is the primary receptor for Helicobacter pylori in the human stomach. Helicobacter 2003, 8, 521-532.

II. Mahdavi J., Sondén B., Hurtig M., Olfat O.F., Forsberg L., Roche N., Ångström J., Larsson T., Teneberg S., Karlsson K.A., Altraja S., Wadström T., Kersulyte D., Berg E.D., Dubois A., Petersson C., Magnusson K.M., Norberg T., Lindh F., Lundskog B.B., Arnqvist A., Hammarström L., and Borén T. Helicobacter pylori SabA adhesin in persistent infection and chronic inflammation. Science 2002, 297, 573-578.

III. Lindén S., Mahdavi J., Olsen C., Borén T., Carlstedt I., and Dubois A. Effects of Helicobacter pylori inoculation on host glycosylation and H. pylori adhesion sites in rhesus monkey. Submitted.

IV. Mahdavi J., Borén T., Vandenbroucke-Grauls C., and Appelmelk B.J. Limited role of lipopolysaccharide Lewis antigens in adherence of Helicobacter pylori to the human gastric epithelium. Infection & Immunity 2003, 71, 2876-2880.

Print & Media Abbreviations ALeb: blood group A derivative of Lewis b. BLeb: blood group B derivative of Lewis b. BabA: blood group antigen binding adhesin. cagA: cytotoxin-associated gene A. cag-PAI: cag-pathogenicity island. FimH: adhesive subunit of type I fimbriae. GERD: gastro-esophageal reflux disease. GI: gastrointestinal. IARC: International Agency for Research on Cancer. ICAM: intercellular adhesion molecule. IL-8: interleukin-8. IVEC: in vitro explant culture. LPS: lipopolysaccharide. Le a, b, x and y: Lewis blood group antigen a, b, x and y. MALT: mucosa-associated lymphoid tissue. MAP: mitogen-activated protein kinase. NADH: nicotinamide adenine dinucleotide (co-enzyme). NAP: neutrophil activating protein. NF-B: nuclear factor-B. NMR: nuclear magnetic resonance. NIH: National Institutes of Health. OMP: outer membrane protein. P-(pap)-fimbriae: pyelonephritis-associated pilus. PMN: polymorphonuclear leukocyte. RBC: red blood cell. ROS: reactive oxygen species. SabA: sialic acid binding adhesin. sLex: sialyl-Lewis x antigen. sLea: sialyl-Lewis a antigen. sdiLex: sialyl-dimeric Lewis x antigen. TLR: toll-like receptor. TNF: tumor necrosis factor alpha.

Print & Media UTI: urinary tract infection. VacA: vacuolating cytotoxin A.

Print & Media Helicobacter pylori Adhesion and Patho-adaptation The role of BabA and SabA adhesins in persistent infection and chronic inflammation Helicobacter pylori (H. pylori) is a human-specific gastric pathogen which is responsible for a spectrum of diseases ranging from superficial gastritis to gastric and duodenal ulceration, and which is also highly associated with gastric cancer. The pathogenesis of severe gastric disorders caused by H. pylori is multifactorial and involves complex interactions between the microbe and the gastric mucosa. H. pylori expresses several adhesion proteins. These molecules have important roles in the establishment of persistent infection and chronic inflammation, which cause tissue damage. The aim of this thesis was to study the attachment of this bacterium to human gastric epithelium, mediated by blood group antigens in both health and disease. One of the best-characterized H. pylori adhesins is the histo-blood group antigen binding adhesin (BabA), which binds specifically to the Lewis b antigen (Leb) in the gastric mucosa. A protective mucus layer lines the stomach. The mucosal glycosylation patterns (GPs) vary between different cell lineages, different locations along the gastrointestinal (GI) tract and different developmental stages. In addition, GPs undergo changes during malignant transformation. MUC5AC is a mucin molecule produced by the surface epithelium. Three distinctly different types of human gastrointestinal tissue were studied by bacterial adherence analysis in situ. MUC5AC is the most important carrier of Leb and the new results demonstrate that it forms major receptors for H. pylori adherence. By analysing an H. pylori babA-deletion mutant, a novel adhesin-receptor binding mode was found. Surprisingly, the mutant bound efficiently to both human gastric mucosa and to gastric mucosa of Leb transgenic mice. The sialylated and fucosylated blood group antigen, sialyl-dimeric-Lewis x (sdiLex), was structurally identified as the new receptor. A positive correlation was found between adherence of H. pylori to sialyl- Lewis x (sLex) and elevated levels of inflammation response in the human gastric mucosa. These results were supported by detailed analysis of sialylated and fucosylated blood group antigen glycosylation patterns and, in addition, in situ bacterial adherence to gastric mucosa of experimentally challenged Rhesus monkey. The cognate sialic acid- binding adhesin (SabA) was purified by the retagging technique, and the corresponding sabA-gene was identified. H. pylori lipopolysaccharide (LPS) contains various Lewis blood group antigens such as Lewis x (Lex) and Lewis y (Ley). Additional bacterial adherence modes, which are independent of the BabA and/or SabA adhesins, could possibly be mediated by Lex interactions. Adherence of a clinical isolate and its corresponding Lex mutant to human gastric mucosa with various gastric pathologies was studied in situ. The results suggest that H. pylori LPS plays a distinct but minor role in promotion of bacterial adhesion. Taken together, the results suggest mechanisms for continuous selection of H. pylori strains, involving capacity to adapt to changes in the local environment such as shifts in cell differentiation and associated glycosylation patterns. Adherence of H. pylori is dependent on both the BabA and the SabA adhesin. Multi-step dependent attachment mechanisms may direct the microbes to distinct ecological niches during persistent infections, driving the chronic inflammation processes further toward the development of peptic ulcer disease and/or malignant transformation.

Key words: H. pylori, BabA, adhesin, Lewis b, MUC5AC, sialyl-dimeric-Lewis x, chronic inflammation, SabA, Lewis x, LPS.

Print & Media Introduction

1. A brief history of H. pylori Infection In 1982, Barry Marshall and Robin Warren managed to culture Helicobacter pylori from stomach biopsies. The material came from patients with gastritis, but their initial reports suggested that gastric inflammation and peptic ulcers might be the consequences of bacterial infections were initially met with considerable skepticism by the medical community (Marshall & Warren, 1984). Isolation of H. pylori (or Campylobacter pylori as it was first named) was a significant scientific result, but still did not establish whether the bacteria were the cause of the inflammation with which they were associated, or whether they occurred as a result of it. However, the scientific field has rapidly moved forward during the last two decades of H. pylori research, and today we know that merely 10% of infected people develop serious illness such as gastritis, peptic ulcer disease and gastric cancer, i.e. the majority (90%) of people infected with H. pylori suffer no symptoms related to their infection In 1994, the National Institutes of Health (NIH) concluded that there is a strong association between H. pylori and peptic ulcer disease and the International Agency for Research on Cancer (IARC), part of the World Health Organization (WHO), classified H. pylori as a class I carcinogen. The pathophysiology of this infection can be understood better by considering five central concepts; heterogeneity of strains, persistence of infection, immunological downregulation, physiological consequences and variability in outcome. Microbial, host and environmental factors probably all contribute to the variation in outcome (reviewed by Blaser et al., 1996).

2. Microbiology of Helicobacter Campylobacter, Helicobacter, Wolinella, Arcobacter and Flexispira belong to a single phylogenetic group which is distinct from other Gram-negative bacteria. This classification is based on 16S rRNA sequencing, DNA hybridization, genus-specific probes, cell wall protein and lipid characterization, and also serological and biochemical analysis (Romaniuk et al., 1987). More than 100 Helicobacter species have now been identified, the majority being gastric organisms. H. pylori is Gram- negative, microaerophilic, motile and has a helical (spiral or curved) cell body with 4- 6 sheathed flagellae (Solnick et al., 2001).

Print & Media In 1997, the first complete genome sequences of H. pylori (laboratory strain H. pylori 26695) was released by the TIGR Institute and the second genome based on the clinical isolate H. pylori J99 was released 2 years later (Tomb et al., 1997; Alm et al., 1999). Together, these two genomes have provided considerable insight into H. pylori biology. Among the 1590 predicted ORFs in the strain 26695 genome, 594 lack homology to E. coli or H. influenzae genes (Le Bouder-Langevin et al., 2002), and 499 of the ORFs even lack obvious homology to any of the sequences in the public genome databases. In addition, the strain-specific genes may play distinct roles in the pathophysiology of H. pylori infections. Both the variable gene content in the plasticity zone and strain- specific genes outside the plasticity zone in other H. pylori strains (Aras et al., 2003) may have an important role in this regard. In support of this, H. pylori has a very plastic genome, reflecting its high rate of recombination and point mutation. This plasticity promotes divergence of the population by the development of sub-clones and presumably enhances adaptation to host niches (Blaser et al., 2004).

3. Epidemiology H. pylori infection is highly prevalent in many developing countries, including those of Eastern Europe (up to 100% in some age groups). Acquisition of the organisms during one’s lifetime is characteristic of groups living under poor hygienic conditions, and it appears to be dependent of geographic area, age, race, and ethnicity; e.g. in higher socioeconomic groups, the rate of colonization is lower and the prevalence increases with age to eventually reach 40% or more. In addition, the low frequency of H. pylori infection in Western countries compared to developing countries may be partly explained by high consumption of antibiotics against e.g. nasopharyngeal infection during childhood (Brown, 2000). The means of transmission of H. pylori infection are not well known yet. No established reservoir of the microorganism has been identified outside the human stomach, except in non-human primates. Nevertheless, H. pylori is just one of an increasing number of Helicobacter species being isolated from a broad range of animals as diverse as the shrew, cheetah, tern and dolphin (Solnick et al., 2001). It has been suggested that H. pylori is mainly transmitted directly from one human to

Print & Media another (Graham, 1991). Three likely routes of transmission have been put forward: 1) fecal-oral transmission is the most important route in developing countries; 2) person to person transmission via aspiration of H. pylori from vomit is also a possibility, but has not been well documented (1 and 2 have been reviewed by Brown et al., 2000); 3) H. pylori infection appears to be preferentially intrafamilial in industrialized countries (Drumm et al., 1990; Roma-Giannikou et al., 2003). Recent observations indicate that dental plaque or saliva is a reservoir of H. pylori and that the bacterium can be transmitted in this way by person-to-person contact (Brown et al., 2000; Ndip et al., 2003).

4. The Lewis and ABO blood group systems, and H. pylori infection Carbohydrate antigens are not primary gene products, but are instead the enzymatic reaction products of glycosyltransferase enzymes. The ABO blood group antigens are complex carbohydrate structures on glycoproteins and glycolipids expressed at the surface of red blood cells (RBCs or erythrocytes) and in the entire gastrointestinal epithelium (reviewed by Clausen et al., 1989). In addition, they are present in secretions, as mucin glycans. In a review, Marionneau and co-workers concluded that the highly polymorphic genes of each family provide intraspecies diversity that allows coping with diverse and rapidly evolving pathogens (Marionneau et al., 2001). Immunodominant structures of blood group A and B antigens, GalNAc1.3(Fuc 1.2)Gal- and Gal1.3(Fuc1.2)Gal-, respectively, are synthesized by a series of reactions. The A and B transferases encoded by functional alleles catalyze the last step of the synthesis, while the O allele is non-functional. Thus, the acceptor substrate, (H antigen: Fuc1.2Gal-) remains without further modification (Larsen et al., 1990; reviewed by Clausen et al., 1989). FUT III (the “Lewis type” enzyme) has the broadest 3FUT substrate specificity since it can incorporate fucose in either 1.3- linkage to Gal(1.4)GlcNAc (to make Lewis x (Lex) or 1.4- linkage to Gal(1.3)GlcNAc to make Lewis a (Lea). The Lewis y (Ley) and Lewis b (Leb) antigens constitute the di-fucosylated equivalents (Kukowska-Latallo et al., 1990; Henry et al., 1995; Clausen et al., 1989). The Lewis blood groups share some genetic links with ABO i.e. H antigen can be modified by ABO and Lewis transferases. The secretor gene (FUTII) transferase controls the expression of the H antigen in the secretory compartments (Kelly et al.,

Print & Media 1995). This gene is active in 80% of the European population and will confer expression of ABH antigens in secretions such as saliva, sweat, tears, semen and serum (Henry et al., 1995). There is also the Le a+b+ phenotype in Asian (Broadberry et al., 1991) and Polynesian populations (Henry et al., 1993). This phenotype relates to poor expression of salivary ABH secretions and is known as weak or partial-secretor phenotype (Henry et al., 1993; Henry et al., 1996). In several studies, individuals of blood group O (Rotter, 1983) and non-secretor (Sipponen et al., 1989) phenotypes are more prone to peptic ulcer disease. Sialyl Lewis x, a sialylated (charged) blood group antigen, is of major importance. Cancer cells are usually heavily sialylated (Reglero et al., 1993; Kageshita et al., 1995). Among enteropathogenic bacteria, H. pylori is recognized to bind the H1 and Leb antigen (Borén et al., 1993) in both healthy and inflamed gastric tissues (Paper II). An adhesin from a strain of Staphylococcus aureus that binds to Lea has been described (Saadi et al., 1994). Since Lea is present in large amounts on epithelial cells from non-secretors, but in more limited amounts on those from secretors, the former individuals are expected to be more sensitive to this strain of bacteria than the secretor. Stapleton and colleagues reported that uropathogenic E. coli recur two to three times more often in non-secretor women than secretors (Stapleton et al., 1992). Similarly, the prevalence of dental caries is higher among non-secretors than secretors (Arneberg et al., 1976). Later, Holbrook et al. (1989) confirmed the high prevalence of dental caries in Icelanders, who have one of the highest proportions of non-secretors recorded in European countries. This may be related to the lack of ABH blood-group substances in saliva, which are suggested to interfere with adherence of Streptococcus mutans to the dental surface (Holbrook et al., 1989). Conversely, pathogens that bind to H-antigens present on epithelial cells are expected to preferentially infect secretor individuals. Indeed, Campylobacter jejuni strains have been shown to attach to H type 2 (i.e., the H antigen, which is the monofucosylated carbohydrate structure of the blood group O phenotype in the ABO system, based on the lacto series type-2 core chains (Gal1.4GlcNAc). This attachment could be inhibited by human milk oligosaccharides such as fucosyl- lactose (Newburg, 2000). It should be most useful for a population to present a diversity of blood group antigens so that a single virulent microorganism cannot infect all individuals within the population. This would be favorable for the population in the long run, although it

Print & Media might be harmful for a fraction of individuals facing one given type of infectious agent.

5. Biodiversity Here are three general kinds of biodiversity discussed: habitat diversity, genetic diversity, and species diversity. The survival of each is linked to the safety of the other two, and together they comprise the resources of bacterial ecosystems.

5.1 Habitat diversity Here, habitat diversity refers to the variety of organs and/or pathological alterations caused by bacterial infection; i.e. Helicobacter species exist in the stomach for H. pylori (Marshall & Warren, 1984), the intestinal tract for H. canadensis (Fox et al., 2000), the liver for. H. hepaticus (Nilsson et al., 2001), and the gall bladder for H. bilis (Chen et al., 2003). The natural habitat of H. pylori appears to be the gastric mucus and the mucus- producing epithelium (Shimizu et al., 1996). In the duodenum of H. pylori infected patients, the bacterium is always found closely associated with gastric metaplastic cells (Wyatt et al., 1990; Gisbert et al., 2000), which is a precancerous condition and relatively common in the upper GI tract. The formation of gastric-type epithelium in the duodenum seems to be related to increased gastric acid output (Harris et al., 1996). This new habitat could be essential for colonization of H. pylori when gastric changes such as chronic active atrophic gastritis or cancer induced by bacteria take place in the natural habitat.

5.2 Genetic diversity and species diversity The genetic diversity within a species is mainly the variety of populations that comprise it. The more variation within an H. pylori population in an infected individual, the better the chance that some of the phenotypes will have an allelic variant that is suited to the changing environment in the stomach, and that it will produce offspring with variants that will in turn reproduce and continue the population into subsequent generations (illustrated in Figure 1). Compared to most other organisms in the human biosphere (Suerbaum et al., 1998), H. pylori is highly diverse. The identification of genetically divergent sub-clones

Print & Media within individual hosts indicates that H. pylori diversification continues during its decades-long colonization of the host (Israel et al., 2001). This genetic diversity is generated through multiple mechanisms, including spontaneous point mutations, recombination with other bacterial cells, and intragenomic rearrangements involving mobile genetic elements (Woolhouse et al., 2001) or repetitive DNA sequences (Aras et al., 2001). The babA and babB genes code for a family of H. pylori outer membrane proteins (OMPs), which have appreciable N and C-terminal identity. Recently, Pride et al., (2002) analyzed the nucleotide sequences of babA and babB and showed that geographic origin was the major determinant of phylogenetic relationships (Pride et al., 2002). Simultaneous colonization of the human stomach with more than one strain of H. pylori can be detected in about 5-10% of patients in the United States (Fujimoto et al., 1994), and this may occur more commonly in other populations (Jorgensen et al., 1996). Such mixed infections, even if transient, provide an opportunity for genetic exchange between strains. Kersulyte et al. (1999) could show different genetic exchanges between single cell clones from a patient who was naturally infected with two different H. pylori strains. One exchange resulted in deletion of the cag-PAI, while other recombination involved a region encoding outer membrane proteins that could be involved in adherence activities. Genetic exchange may play an important role in the biology of H. pylori by generating new genotypes much more rapidly than is possible by mutation alone, thereby allowing genera of pathogenic bacteria to adapt to other organs (Cover et al., 2001).

Print & Media Figure 1. Schematic drawing of stages hypothetically involved in biofilm formation by H. pylori. A protective and continuous mucus layer lines the stomach. Mucins are a family of large, heavily glycosylated proteins. Bicarbonate is secreted from the epithelium into the mucus layer, where it neutralizes acid that is back-diffused from the lumen of the stomach and forms a pH gradient, with a higher pH at the epithelial cell surface (Ross et al., 1981; Schade et al., 1994). In the healthy stomach, MUC5AC is produced in the foveolar epithelium and MUC6 in the glands. The biofilm is colonized by a mixture of H. pylori bacterial cells with different adhesion capabilities, although one phenotype may predominate. Here, planktonic H. pylori cells adhere to the MUC5AC mediated by Leb. Further growth, cell replication and phase/antigenic variations lead to occurrence of different phenotypes with different adhesion properties, which contributes to establishment of the biofilm.

Print & Media 5.3 Tropism and patho-adaptation It has long been recognized that a particular bacterial species will tend to adhere to colonize, and possibly induce pathology in only one preferred type of tissue. This phenomenon is referred to as tissue tropism. This kind of tropism in associated with the ability of the bacterium to rupture mucosal barriers and invade the host, and distinguishes pathogens from commensals. Two major selective factors, adhesion and environment, are essential for colonization of a particular type of tissue. Bacteria use a large number of surface components such as lipopolysaccharide (LPS), lipoteichoic acid, outer membrane proteins and adhesive structures such as fibrils, pili and fimbriae for interaction with specific receptors on the host cell surface (Hultgren et al., 1993; Sauer et al., 2000). The pathogenic microorganisms affect the host cells, which results in alteration in cell morphology, glycosylation pattern and cytokine production, i.e. environmental changes to counteract the colonization of the pathogenic organism. In response to these environmental changes, pathogenic organisms might adapt functionally by elimination of some genes or activation of silent genes. One of the mechanisms in bacterial evolution towards virulence is the allelic micro-variation of existing genes, which has been called patho-adaptation (Sokurenko et al., 1999). As a case in point, H. pylori is able to attach to the regularly fucosylated Lewis antigens (i.e. Leb, ALeb, BLeb) during health, and to the sialylated Lewis antigens (i.e. sLex and sLea) during the course of infection. Such differences display the responsive adjustment of H. pylori to the environment. Furthermore, distribution of ABO blood groups varies between different populations. Recently, BabA adhesin molecules from H. pylori strains isolated from different parts of the world were found to bind the A, B, and O blood group antigens, with the exception of H. pylori strain from the South American Amerindian population. Here H. pylori strains bind preferentially the blood group O antigens, which is of particular interest since this population is of blood group O phenotype only (Aspholm-Hurtig et al. submitted). The BabA adhesin produced by most H. pylori strains is a rather conserved protein. Lack of substantial variation could possible relate to the invariant histo-blood group antigen receptors recognized by H. pylori. However, minor aminoacid changes have been described to result in drastic shifts in adhesive properties such as binding of E. coli mediated by FimH to 3-mannose in the large

Print & Media intestine as primary niche, and to mono-mannose in the urinary bladder as secondary niche. Such changes in tissue tropism could be correlated with decreased or increased affinity for binding to sugars (Sokurenko, et al., 1994). This can drive the adaptive evolution of pathogenic organisms during their spread and growth in diverse host environments.

5.4 Biofilm formation Does H. pylori exist as isolated, single cells that are independent of their neighbors – or as a community of cells living together in an ordered structure known as a biofilm? In general, three stages can be recognized in biofilm formation on a water-insoluble surface: adhesion, colonization and growth. The first phase involves adhesion of planktonic bacteria to the surface. If an adequate supply of nutrients is available and environmental factors are favorable, adherent bacteria may then colonize. The community grows and develops a characteristic structure, the nature of which will depend on many factors including the species involved, the availability of nutrients, pH, and the hydrodynamic and mechanical shear forces present (Figure 1). It has been established that by adaptive mechanisms, H. pylori changes its gene expression in response to acid exposure (Wen et al., 2003). In addition, H. pylori cells differ in length, shape, and the stage at which they convert from common shape to spherical (with different adhesion capacity and phenotypes), which may affect the bacterial survival in the gastric mucus (Enroth et al., 1999). Consequently, the use of a thick protective and stabilizing biofilm by H. pylori may be important in enhancing resistance to host defense factors and antibiotics, and in maintaining micro- environmental pH homeostasis, both of which facilitate its growth and survival in vivo (Stark et al., 1999).

6. Virulence factors and persistence of infection Our recent results on the interactions between gastric epithelial cells and H. pylori have highlighted the complex cell-to-cell communication which underlies the pathology produced by this microorganism (paper II). Bacteria-host interactions are clearly two-way processes, with factors from eukaryotic cells being able to interact and modulate the activity of bacteria and vice versa. Detailed information about how bacteria redirect and manipulate the cytokine

Print & Media networks that result in tissue pathology is essential for a better understanding of the development of infectious disease (Figure 2).

Figure 2. This figure shows one proposed mechanism involving chemokines (e.g. IL- 8) for chemo-attracting PMNs to the lumen of the H. pylori infected stomach. It shows also the adherence of H. pylori mediated by binding to Leb and sLex which are expressed in the surface of gastric epithelial cells by the BabA and SabA adhesins (i.e. signaling between H. pylori, mucosal epithelial cells and underlying immune systems) in conditions of both health and inflammation. Attachment of H. pylori to gastric epithelial cells activates the type IV secretion system, which results in the injection of effector proteins into host cells. The effectors are thought to upregulate the activity of Nuclear Factor NF-B, which, together with AP-I, leads to induction of IL-8 expression. This triggers transduction pathways and pedestal formation as a result of cytoskeletal rearrangements. The leukocytes are programmed to reveal the healing process, but they can also enhance inflammation, which can proceed to tissue damage. The rolling and attaching phase in the capillaries is mediated by the selectin family, the E- and L-selectins, and their sialylated Lewis type of ligands. H. pylori adhesion stimulates the release of the IL-8 and induces expression of the intercellular adhesion molecule ICAM-1, which facilitates the migration of PMN cross the gastric epithelium.

Print & Media 6.1 Adhesins A wide variety of molecules present on adherent structures of bacteria can function as adhesins. In bacterial-eukaryotic interfaces, there are apparently general systems for recognition of certain microbial cell surface carbohydrate characteristics (Wilson et al., 2002; chapter 7). The normal habitat of E. coli is the gastrointestinal tract, but some uropathogenic strains are capable of causing UTIs (urinary tract infections). A large number of potential adhesins have been identified in E. coli, such as different classes of P- fimbriae, which bind to the Gal(1.4)-Gal residues present in glycolipids in kidney tissue (Strömberg et al., 1991). Like other microorganisms, H. pylori requires adhesive molecules for colonization and persistence. H. pylori has a wide range of adhesion properties and has been suggested to bind to many different carbohydrates, (Karlsson 1998; reviewed by Evans, 2000) mediated by various bacterial components. The Leb and sLex antigens binding adhesins, BabA and SabA, respectively, are the best described (Ilver et al., 1998 and paper II). Hemagglutination of RBCs by bacteria has been used to study bacterial binding specificities and to identify the cognate bacterial adhesins. The H. pylori sialic acid- dependent hemagglutination was a subject for researchers for more than a decade but recently, this sialic acid-dependent binding activity has been shown to be mediated by SabA, since the corresponding sabA deletion mutant lacks all hemagglutination properties (Olfat et al., manuscript).

6.1.1 Consequences of bacterial adhesion It is becoming increasingly obvious that the act of adhering to the host cells induces intense changes in the adherent organism, regardless of the origin of the host cells. It is also known that adhesion of an organism to a host receptor greatly affects its rate of growth, carbohydrate utilization, protein synthesis and energy generation, as well as its cell wall composition and production of adhesive molecules. The host cell and its adherent bacterium exchange signals (i.e. they engage in molecular “crosstalk”), which brings about changes in both cell types (Diagram 1) (Soto et al., 1999; Tesh, 1998).

Print & Media Diagram 1. Adhesion of Helicobacter pylori to gastric epithelial cells induces a multitude of changes to the host cell, the most common of which are shown in the diagram.

6.1.1.1 Effect on the bacterial cells There are a number of reasons why the bacterial cell has to adjust its phenotype once it has adhered to a cell surface. Prior to any interaction with its host, H. pylori is probably exposed to different environmental conditions (e.g. different pH, high turnover, shear force, osmolality, nutrient concentration). Then, adherence is required for microbial survival in this hostile environment. Attachment of H. pylori to the gastric mucosa (e.g. mediated by Leb) activates the type IV secretion system which results in the translocation of CagA protein into the host cells (Odenbreit et al., 2000) and triggers inflammation. Having reached an inflamed epithelial surface with the new carbohydrate structure as a ligand (which may not necessarily be its

Print & Media ultimate destination), H. pylori will then have to adapt to this new environment and this will require the upregulation or suppression of various genes such as SabA. Such changes will certainly be induced in response to alterations in a number of environmental factors, but some are recognized to be triggered by the adhesion process itself. Recently, changes in H. pylori gene expression induced by bacterial adhesion to AGS (cultured gastric adenocarcinoma) cells were reported. Several genes, and those for two outer membrane proteins in particular, were upregulated (Kim et al., 2004). Attachment to the host cell may be only the first step in a sequence of events that could involve invasion of the cell. Adhesion of H. pylori mediated by SabA may be used as a signal for the microbe to begin synthesis of those molecules essential to initiate invasion of the host cell. There have been many reports suggesting that bacteria do respond in this way to contact with the host cell. As an example of this, similar crosstalk has been described for Porphyromonas gingivalis adherence to epithelial cells, which induces the secretion of a multitude of proteins and downregulation of the production of extracellular proteases (Park et al., 1998).

6.1.1.2 Effect on the host cells A number of bacterial species capable of inducing pathology in humans also adhere to epithelial cells without actually inducing any apparent changes in these cells. However, although the adhesion process itself may not affect the structure or function of the host cell, microorganisms also produce toxins – enzymes that may ultimately damage host cells. H. pylori induces the morphological alterations in gastric epithelial cells (Segal et al., 1999), (Figure 2). H. pylori-related chronic inflammation in gastric tissue has also been reported to modulate the glycosylation patterns of epithelial cells. Ota et al., (1998), have shown increased levels of sLea antigen in response to H. pylori infection and recently, we have shown that sLex was upregulated in gastric epithelial cells due to H. pylori infection (paper II). In contrast, normal human gastric epithelial cells are essentially devoid of such sialylated glycoconjugates (Filipe, 1979; Madrid et al., 1990). In addition, recent studies have indicated that adherence of H. pylori induces cell proliferation and apoptosis during the early phase of chronic inflammation of the gastric mucosa (Ebert et al., 2002).

Print & Media A characteristic feature of any bacterial infection is the migration of PMNs towards the site colonized by the infecting organism. Binding of H. pylori to the gastric epithelial cells induces the expression and secretion of IL-8 (Crabtree, 1996). In response to a chemotactic gradient from the site of infection, PMNs first adhere to, and then traverse, the vascular endothelium (McCormick et al., 1998; Bevilacqua et al., 1991). This process involves the interaction between E-selectin, intercellular adhesion molecule (ICAM) 1 and 2 on the surface of the endothelium cell, and sLex

and 2-integrins on the PMN surface (Slattery et al., 2003) (Figure 2). PMNs are rich in various sialylated glycoconjugates, which H. pylori can bind to. An important consequence would be the bacterial interaction with, and activation of PMNs (Rautelin et al., 1993). Very recently, Petersson et al. (in manuscript) have demonstrated that SabA is essential for attachment and activation of human PMNs. Nutrients released by the inflamed and damaged cells might be used by H. pylori as an energy source (Blaser, 1992; 1996). See Diagram 1 for how H. pylori adhesion affects the host cells.

6.2 Invasion of host cells A characteristic feature of H. pylori-induced inflammation is massive attraction of phagocytes (particularly PMNs) to the site of infection. This can be achieved by the production of H. pylori neutrophil-activating protein (HP-NAP). The latter was found to promote the adhesion of PMNs to endothelial cells by upregulating adhesion receptors of the 2-integrin family (Satin et al., 2000). Satin and colleagues showed that HP-NAP stimulates (NADPH) oxidase assembly and production of reactive oxygen species (ROS). Also, as PMNs consistently outnumber macrophages in H. pylori infected stomach, it induces a state of chronic acute inflammation. Previous reports (Björkholm et al., 2000; Amieva et al., 2002; Kwok et al., 2002) have suggested that H. pylori is capable of invading epithelial cells in the gastric mucosa; however, the role of invasion in H. pylori pathogenesis remains unclear.

The following mechanisms have been postulated to explain how H. pylori evades phagoctosis:

Print & Media 1- Strong binding between H. pylori and phagocytes correlates with a rise in the level of urease on the surface of H. pylori, thus retarding phagocytosis and strong respiratory burst in the phagocytes (Telford, 1997). 2- Catalase, alkyl hydroperoxide reductase, and factors (cag pathogenicity island type IV secretion apparatus) that are unique to type I strains allow bacteria to resist phagocytic killing (Allen, 2001). 3- Delayed phagocytosis is linked to intracellular survival, since type I H. pylori persists inside macrophages within a novel vacuole called the megasome (Allen et al., 2000).

6.3 H. pylori enzymes H. pylori produces catalase and urease enzymes. Urease (which converts urea to ammonia) is an abundantly produced enzyme. H. pylori has developed a unique mechanism to control urease-dependent pH buffering. The urea channels (UreI) present in the inner membrane are opened at pH below 6.5, to allow for delivery of urea to intracellular urease. The NH3 produced can then buffer the periplasm (Weeks et al., 2000; Bury-Mone et al., 2001). Urease activity is therefore essential for maintenance of cytosolic pH levels compatible with efficient metabolism and survival of H. pylori in the acidic environment of the stomach.

6.4 CagA and VacA Although most strains possess the vacA gene, some strains also exhibit another virulence marker called cagA (cytotoxin-associated gene) and are defined as Type I strains (Xiang et al., 1995). Those that are vacA positive but cagA negative are considered low-virulence strains (Type II strains). Fifty to sixty per cent of isolates carry the cagA locus, which acts as a marker for the cag pathogenicity island (an assembly of some 40 genes that are linked to virulence of the organism, coding to a large degree for a type IV bacterial secretion system) which is involved in the stimulation of pro-inflammatory cytokines from the gastric epithelium. A number of the proteins encoded by the cagpai type IV secretion system are similar to those used by Bordetella pertussis to secrete pertussis toxin (Farizo et al., 2000). The type IV system and the phosphorylated effector molecule CagA confer cytoskeletal rearrangments and pronounced inflammatory responses through the

Print & Media induction of IL-8 expression and, in some cases, cancer (Stein et al., 2000; Censini et al., 2001; Nilsson et al., 2003). Since cagA (-) cells are relatively unimpaired in IL- 8 induction (Nilsson et al., 2003), other cagpai-encoded effectors may also be translocated by the type IV secretion system (Odenbreit et al., 2000). CagA has been shown to activate mitogen-activated protein (MAP) kinase cascades, leading to the induction of expression of c-fos and phophorylation of c-Jun, which together comprise the transcription factor AP-I (Stein et al., 2000) (Figure 2). Unlike the cag pathogenicity island, all H. pylori strains possess the vacA gene and approximately 50% of strains express the VacA protein, which causes structural and functional alterations in epithelial cells (Leunk et al., 1988; Telford et al., 1994). VacA binds to multiple epithelial cell-surface receptors, and partly remains associated to the bacterial outer membrane (reviewed in Papini et al., 2001). Upon bacterial contact with host cells, toxin clusters are transferred directly from the bacterial surface to the host cell surface at the bacteria-cell interface, followed by uptake and intoxication (Ilver et al., 2004). VacA is considered to be an important virulence factor that induces vacuole formation in host cells, stimulates epithelial-cell apoptosis and also plays a role in the pathogenesis of peptic ulcer disease (Boquet et al., 2003).

6.5 H. pylori LPS The LPSs of Gram-negative bacteria are among the dominant surface features in terms of their abilities to induce a host response, which stimulates macrophages to produce and release tumor necrosis factor (TNF-), (Holler, 2002). However, the LPS of H. pylori have far lower biological activity than those of E. coli or Salmonella (Muotiala et al., 1992). One characteristic peculiar to H. pylori is that almost all strains express Lewis blood group antigens (Lea, Leb, Lex, sialyl Lex, Ley, H-type I, i-antigen and blood group A antigens) in their surface-expressed LPS O-antigen (reviewed by Monteiro et al., 2001). H. pylori has been suggested to induce gastric autoimmune responses by inducing anti-Lex antibodies that bind to gastric epithelium (Appelmelk et al., 1996). H. pylori LPS has also been shown to mediate adherence of the bacterium to laminin in the basement membrane, with sialic acid binding specificity (Valkonen et al., 1994; Valkonen, 1997), and to gastric epithelium (Edwards et al., 2000). However, deletion of glycosyltransferase genes, required for

Print & Media LPS biosynthesis, yields Lewis antigen-negative mutants that colonize well in experimental infections. Galustian and colleagues have suggested that H. pylori LPSs contribute to the chronic inflammation through interactions with leukocyte-endothelial adhesion molecules of the host (i.e. E- and P-selectins). They have also suggested that H. pylori isolates from patients with chronic gastritis, duodenal ulcer and gastric cancer interact with E- and L-selectins (Galustian et al., 2003).

7. Diseases associated with H. pylori infection The healthy state is the normal condition in an organ, but sometimes the organ becomes diseased, either due to physiology dysfunction or to infections. In classical histopathology, diagnosis is mostly based on morphological and structural features of cells and tissues, and to a lesser extent on the biochemistry of the cell (Rosai et al., 1989). The histology of upper gastrointestinal tract is illustrated in Figure 3.

7.1 Gastritis or gastric inflammation Gastritis means inflammation of the stomach. It means that white blood cells move into the wall of the stomach as a response to injury. Gastritis does not mean that there is an ulcer or cancer. It is simply inflammation, either acute or chronic. The mucosal surfaces of the body are programmed to signal to the immune system to induce the chemo-attraction of leukocytes. This has been termed the “the watch- dog” function of the mucosal epithelium. It has been shown that direct contact of H. pylori with the epithelial cell is necessary for optimal IL-8 production (Rieder et al., 1997). Recently, Olfat et al. (2002) have developed an in vivo model system, IVEC (in vitro explant culture), which closely mimics the natural environment of human stomach, and they could show that adhesion of H. pylori mediated by Leb to the gastric explants increases IL-8 production. Here, the microbial components activate Toll-like receptors (TLRs), thereby leading to NF-B-dependent transcription and resulting in production of proinflammatory cytokines such as IL-8 (Su et al., 2003) (illustrated in Figure 2).

Print & Media Figure 3. The anatomy/histology of the upper gastrointestinal tract. Cell differentiation is diagramed in the mucous pit-gland unit of the pyloric antrum and corpus. Esophagus: It is covered by non-keratinized stratified squamous epithelium. In the sub-mucosa there are groups of small mucus-secreting glands, the esophageal glands. In the lamina propria of the region near the stomach there are groups of glands, the esophageal cardiac glands, that also secrete mucus. Ventricle: The stomach is anatomically divided into four regions; fundus, cardia, corpus (or body), and pyloric antrum. In general, the gastric mucosa consists of a surface epithelium that invaginates to varying extents into the lamina propria, forming gastric pits. The gastric pits are branched, tubular glands that are characteristic of each region of the stomach, and composed of isthmus, neck and base regions. The pluripotential stem cells are anchored in the isthmus region and give rise to several committed precursors, which undergo migration-associated differentiation to replace the degenerating mucous, parietal (secreting hydrochloric acid), zymogenic (secreting pepsinogen), neuroendocrine cells such as histamine releasing enterochromaffin-like (ECL) cells and D-cells which secrete somatostatin. In these epithelia, over 90% of human cancers occur via a multi-step process which starts by alteration in the proliferation/differentiation program of the stem cells (Karam, 1999). The pre-pit cell precursor (P1), pre-parietal cell precursor (P2) and pre-neck cell precursor (P3) evolve into corpus pit, parietal and zymogenic cell lineages, respectively (Karam, 1999). The antrum-type mucosa is characterized by more branched, predominantly mucus glycoprotein secreting glands with neuroendocrine G-cells secreting gastrin and D-cells secreting somatostatin. Duodenum: The epithelium of the villi is continuous with that of the glands. In the intestinal glands, different types of cells such as stem cells, some absorptive cells, and goblet cells are found.

Print & Media 7.2 Gastric and duodenal ulcers H. pylori has been found to be present in 85-100% of patients with duodenal ulcers and in 70-90% of patients with gastric ulcers (Staat et al., 1996; Drumm, 1990). This has strongly suggested that H. pylori plays a significant role in the development of duodenal and gastric ulcer disease. The parietal cell mass of the host (Testino et al., 1999), and the effect of the inflammatory response on acid secretion by damaging the stomach cells (Kersulyte et al., 1999), play an important role in the outcome of disease. Studies of pathological tissues have shown abnormalities in the thickness of the mucus layer among people with H. pylori infection (Morgenstern et al., 2001). Gastric ulcers usually lead to pan-gastritis and low acid secretion, in which H. pylori colonizes the corpus (Björkholm et al., 2003) and may result in atrophy of parietal cells. When the patient’s immune response succeeds in suppressing the bacteria, acid secretion returns to normal and acid digests the damaged cells, leading to chronic gastritis and ulcer. Duodenal ulcer is more common than gastric ulcer. The rate of acid secretion is higher among patients with duodenal ulcer than in healthy people. The duodenum is not protected as well as the stomach against acid and the local stress can cause cells in the duodenum to undergo morphological changes named gastric metaplasia. The mechanisms of targeted tissue tropism for H. pylori (as described above) will promote transfer of the H. pylori infection from its natural niche in the antrum to the islands of gastric metaplasia, and promote a much higher risk of peptic ulcer disease.

7.3 Gastric adenocarcinoma, a silent killer Gastric cancer is cancer of the stomach. The most common type of stomach cancer is “gastric adenocarcinoma”, or cancer of the glandular tissue of the stomach. During the last century, the incidence of gastric cancer has decreased in Western countries, in contrast to the developing countries (Parkin, 1988). Gastric carcinogenesis is a multistep and multifactorial process (Correa, 1992), but bacterial infection is one of the most important risk factors for development of cancer (Correa, 2003). Based on the WHO’s conclusion, H. pylori is a definite carcinogen leading to adenocarcinoma of the stomach (Logan et al., 1994). Interestingly, the high rate of atrophic gastritis and gastric cancer is accompanied with a low rate of duodenal ulcer (Blaser et al.,

Print & Media 1995), presumably because of the impaired ability to secrete gastric acid after the development of atrophy. In contrast, there appear to be factors associated with duodenal ulcer disease that protect against gastric cancer (Hansson et al., 1996). Host genetic factors also appear to influence the chances of developing gastric cancer following infection with H. pylori. Pro-inflammatory polymorphisms within the interleukin IL-1, IL-10 and TNF- genes are associated with a higher risk of gastric carcinoma in H. pylori-infected individuals (El-Omar et al., 2000; Machado et al., 2003).

7.4 Barrett’s esophagus Barrett’s esophagus (BE) is the condition in which columnar epithelium replaces the squamous epithelium. The condition develops when gastroesophageal reflux disease damages the squamous esophageal mucosa, through a metaplastic process in which columnar cells replace squamous epithelium. The abnormal columnar epithelium that characterizes Barrett’s esophagus is an incomplete form of intestinal metaplasia (called specialized intestinal metaplasia) that predisposes patients to adenocarcinoma (Spechler et al., 2002). Inflammation of gastric cardiac mucosa decreases in prevalence from controls to patients with GERD (Wieczorek et al., 2003), and H. pylori and cagA-positive strains have been suggested to protect against the development of Barrett's esophagus (Ackermark et al., 2003). It is important to distinguish BE from intestinal metaplasia related to carditis, because these conditions have a different natural history, risk of malignancy, and treatment. Glickman et al. (2003) have reported recently that MUC1 and MUC6 expression in BE is distinct from that of the cardia and antrum with intestinal metaplasia. In addition, Barrett´s esophagus is the most important risk factor for the development of esophageal adenocarcinoma. The risk of developing esophageal adenocarcinoma from BE is estimated to be 0.5% per patient year.

Print & Media Aims The main goal of my thesis has been to study H. pylori adhesion to host cells and in particular how bacterial-ligand interactions influence the development of disease:

- To investigate the role of MUC5AC as a receptor for H. pylori in different types of tissues in conditions of both health and disease from the gastrointestinal tract.

- To study the H. pylori adhesion properties that are independent of BabA.

- To characterize the relationship between sLex expression in the gastric surface epithelium and persistent infection by H. pylori in molecular terms.

- To identify and characterize the novel adhesion molecule sialic acid-binding adhesin (SabA) from H. pylori and its corresponding receptor (sdiLex).

- To investigate the molecular impact of H. pylori infection on the glycosylation patterns in Rhesus monkey gastric mucosa, which is a primate model with the most similar expression pattern of blood group antigens to that of humans. In particular, we aimed to study the shifts in glycosylation pattern due to H. pylori infection in a time-dependent manner.

- To examine the role of H. pylori LPS Lex structure with regard to adhesion properties in various gastric tissues, and with respect to pathological background.

Print & Media Results and Discussion 8. The role of MUC5AC in H. pylori adherence In paper I, we tested the hypothesis that Leb antigen presented on MUC5AC molecules functions as a H. pylori receptor. Generally, MUC5AC is expressed in the gastric antrum, but it is produced by the metaplastic cells of gastric type in both duodenum and Barrett’s esophagus, which indicates distinct and specific function of this mucin. Previously, Van der Brink and co-workers demonstrated, that H. pylori in the antrum of infected patients co-localizes specifically with MUC5AC and MUC5AC- producing cells (Van den Brink et al., 2000). Here, a series of H. pylori strains were overlaid on tissue sections of Barrett’s esophagus, normal stomach and duodenum with gastric metaplasia. We could demonstrate that H. pylori co-localized very well with both MUC5AC and Leb antigen. Thus, the results suggest that MUC5AC mediates H. pylori adhesion and that MUC5AC is an important site for bacterial infection and/or colonization. More than 99% of H pylori positive bacterial cells were associated with either secreted MUC5AC or the apical domain of MUC5AC producing cells (Van den Brink et al., 2000). Binding to secreted MUC5AC occurs both at neutral and acidic pH. BabA-dependent binding at neutral pH and the charge-dependent binding at acidic pH allows these microbes to bind mucins over a broad pH range (Lindén et al., submitted). It seems likely that the adherence of H. pylori to the host Leb structures mediated by BabA-adhesin effectively facilitates infection, but is not an absolute necessity for colonization. Thus, the composition of diverse carbohydrate structures in MUC5AC serves as receptors for different H. pylori phenotypes at different pH, which probably makes it a suitable location for H. pylori to form the biofilm. Therefore, H. pylori with different adhesive properties may only be able to survive in biofilm (Figure 1). This is probably one of the reasons why successful eradication of H. pylori necessitates consumption of a combination consisting of different antibiotics together with acid suppressing drugs, where the pH gradient in the biofilm will be broken and make the microbe more susceptible to antibiotics.

9. Gastric mucosa sialylation and inflammation In paper II, there is evidence for the participation of sialylated structures in the recognition and adherence of H. pylori to the epithelial cells in an inflamed gastric

Print & Media tissue. In addition, we found positive correlations for H. pylori binding, inflammatory cell infiltrations and expression of sLex antigen levels in the gastric mucosa. Biological molecules containing sialic acid in the peripheral position of their oligosaccharide chain are glycolipids and glycoproteins, as well as mucin molecules. They have a structural function and the components are linked to cell surface receptors (e.g. integrins) (Pochec et al., 2003). They also affect a number of cellular activities including migration, proliferation and differentiation (Rosner 1982; Ertl et al., 1992). Certain bacteria have evolved to take advantage of the host cell’s requirement for such receptors and have produced adhesions that can bind to these receptors, thereby usurping their natural function. Chronic infection of the gastric mucosa by H. pylori results in an intense inflammatory response. One associated host response is a chronic hyper- proliferative state, in which there is increased cell turnover and also increased apoptosis of the gastric epithelial cells (Chiou et al., 2001). Shirin and colleagues explained the effects of H. pylori infection on cell cycle progression (Shirin et al. 2001) and the expression of cell cycle regulatory proteins. They concluded that overexpression of the tumor suppressor gene 16 in gastric epithelial cells of H. pylori infected patients was associated with an increase in apoptosis (Shirin et al., 2003). It has been shown that sLex has an important role in inflammation processes, and there also appears to be a correlation between cancer and degree of cell sialylation (Renkonen et al., 1997; Alper, 2001). Overexpression of sLea and sLex may correspond to 1) increased expression of a 2.3-sialyl-transferases, competing with the fucosyltransferases for the same substrate, the terminal Gal1.3GlcNAc and Gal1.4GlcNAc chains (type 1 and 2 chains), and 2) increased expression of 1.3- and 1.4-fucosyltransferase activity. Several histopathological features such as hyperproliferation of epithelial stem cells, loss of parietal and zymogenic cells common in the stomach of patients suffering from chronic atrophic gastritis are associated with elevated production of sialylated glycans (Lipkin et al., 1985). Such alterations in the cell differentiation program is very similar to that in transgenic mice lacking parietal cells, recently described by Syder et al., (1999). Interestingly, expression of sialylated glycoconjugates in the parietal cell ablated mice does not require the microflora, i.e. no H. pylori

Print & Media infection/colonization, but is rather the result of cell differentiation in the parietal cell ablated animal model (Syder et al., 1999).

10. Identification of inflammation-associated H. pylori adhesiv activities We also demonstrated in adherence experiments in situ (paper II) that a babA- mutant devoid of Lewis b antigen binding properties activated an additional complementary adhesin-receptor interaction in human gastric mucosa. A novel sialylated and fucosylated carbohydrate receptor, the sialyl dimeric Lewis x glycosphingolipid (sdiLex), and the corresponding sialic acid binding adhesin (SabA) were identified. In addition, a correlation between SabA-mediated bacterial binding and the level of gastric inflammation was found. A panel of European clinical isolates was analyzed for sLex binding (paper II, online material). Close to 43% of cagA- positive clinical isolates (33 of the 77) bound to sLex, while only 11% of cagA- negative strains (2 out of 18) were positive for sLex. These results were supported by analyses of bacterial adherence in situ to gastric mucosa of experimentally challenged Rhesus monkeys (paper III). Here, H. pylori infection triggers chronic mucosal inflammation, which leads to expression of sLex antigen in the gastric cells. The increased expression of sLea and sLex is most prominent during the first 2 months after inoculation. Changes in levels of sLea before and after eradication have been reported, but these modifications may differ according to the early or late phase of chronic inflammatory response or the stage of the disease, as explained by the change being time-dependent. Notably, in situ H. pylori density and in vitro adherence of the babA mutant was significantly correlated with sLex/a expression in the antrum, supporting the idea that these antigens function as receptors for the SabA adhesin.

11. The role of BabA and SabA for induction of inflammation Expression of BabA and SabA must be under tight control (necessitating that the organism have a detailed “knowledge” of its environment), so BabA and SabA are produced only at the appropriate point during the journey of the organism from its initial site of colonization to its ultimate target receptors. When the pathological events have occurred because of the BabA-Leb binding activity, the SabA-sLex interaction mediates the next level of attachment. Such stepwise attachment

Print & Media mechanisms could direct the microbes to distinct ecological niches during the chronic inflammation process, driving the inflammation process further to development of peptic ulcer disease and/or malignant transformation. There could be a continuous selection for H. pylori strains with the capacity to adapt to changes in the environment such as local shifts in cell-differentiation and glycosylation patterns. As discussed above, leukocytes that are targeted to enter inflamed tissues require an initial cellular interaction with the endothelial lining mediated by selectin cell adhesion molecules and their cognate sLex and sLea ligands. Since H. pylori strains express SabA adhesins on their surface in order to adhere to inflamed gastric mucosa, this renders them vulnerable to such host defense mechanisms. The sLex binding activity of SabA can be regarded as a mechanism of selectin mimicry. So, how then can H. pylori differentiate between sLex presented on the surface of leukocytes versus inflamed gastric epithelium? Below, I will discuss two different approaches to this contradiction: I. Phase variation and biofim formation. II. Change of function with respect to patho- adaptation.

11.1 Phase variation and biofilm formation Surface components such as pili, OMPs, S layer proteins, flagellae, lipopolysaccharides (LPSs) and capsules are involved in a number of host-bacteria interactions including adhesion and resistance to phagocytosis, and many contribute towards the pathogenic effects of the bacterium. Many of these components that are antigenic and exposed to the mucosal immune system have the means to switch expression on or off by mechanisms of phase variation. Similarly, switching on and off adhesins such as SabA alters the binding properties. Screening of all SabA and BabA-positive H. pylori strains examined indicated that 1% of colonies spontaneously lost their ability to bind sLex, in contrast to the almost constitutive Leb antigen binding properties. The observation suggested instability in sLex-binding activity. By switching off expression of SabA, bacteria may be able to “de-camp” from a particular site and retreat into areas of non-inflamed gastric environment. Such mechanisms of phase variation could provide the infection with means of avoiding immune defenses.

Print & Media An alternative explanation of phase variation would be to promote flexible survival within the biofilm of organisms with a diverse set of nutrient and physicochemical requirements (Figure 1). If the biofilm consists of only a single species, the different microhabitats (pH, nutrition, availability of functional receptor) will enable changes to gene expression patterns. In addition, H. pylori populations infecting one individual can undergo significant divergence, creating stable sub-clones with substantial genotypic and phenotypic differences (Björkholm et al., 2001). Those events have been illustrated in a schematically drawn picture in Figure 1.

11.2 SabA and BabA in relation to patho-adaptation Expression of BabA and SabA by H. pylori results from adaptation to different microniches and environments. The change of gene functions and programmed expression patterns of genes during infection is termed patho-adaptation. A variety of individual host conditions are critical to the susceptibility of an individual to H. pylori infectious diseases. Virulent strains often share their primary habitat with commensals and rarely spread into tissues where their growth will induce symptomatic disease. The phenotypic properties acquired during the evolution of pathogenic bacteria are traits that provide strategies for: 1) tropism for tissues of a virulence niche, 2) mechanisms to consume available nutrients, and/or 3) mechanisms to evade or overcome antibacterial defenses. Recently, genomic changes were shown in H. pylori infected Rhesus monkeys. In some cases, the babA gene was replaced by babB, which is a functionally uncharacterized OMP but closely related to babA. Bacteria which lack the babA gene could not bind to Leb antigen (Solnick et al., 2004). Similarly, by these mechanisms SabA can change and/or expand the binding properties and overcome the PMNs in an inflamed niche, and adapt to the new environment during the course of infection. In contrast, activation of PMNs (ROS-activities) by adherent bacteria and invasion of both epithelial cells and PMNs might be the strategy to escape and simultaneously employ the host immune defense to capture the other bacterial phenotypes and be the primary pathogen. This evolutionary pathway is expected to be important for

Print & Media microorganisms that are considered to be primary pathogens for their long-term persistence in nature.

12. The role of LPS in H. pylori adherence In paper IV, we studied the adhesive properties of H. pylori strains with Lex antigens in their LPS, and their corresponding mutants, in situ, to gastric tissues of different pathology. The results suggested that LPS did indeed demonstrate adhesive properties, but only for a subset of the patient material studied. However, the results imply a wide range of possible interactions, such as carbohydrate-carbohydrate, protein-protein or protein-carbohydrate. Previously, Lex- Lex interactions have been described to provide good affinity (Hakomori, 1994). When comparing carbohydrate-carbohydrate interactions with protein-protein or protein-carbohydrate ones, the first type of interaction is certainly generally considered weak. One more characteristic feature of the carbohydrate-carbohydrate interaction is its dependence on bivalent ions (calcium magnesium and manganese) (Eggens et al., 1989). The carbohydrate-binding protein (lectin) mediates targeting mainly by hydrogen and/or electrostatic interactions in conserved hydrophilic residues. Though each hydrogen bond forms a relatively weak interaction, a group of interactions can make a force strong enough for a tight and specific binding. In particular, water molecules often bridge hydrogen bonds. The carbohydrates are as a whole hydrophilic, and they also have significant hydrophobicity. This could also possibly make a second class of interactions between lectins and carbohydrates, such as protein-protein interactions between bacteria and eukaryotic cells mediated by bacterial LPS. Thus, a model for interaction between an unknown H. pylori lectin “B face” and unknown human lectin “A face” mediated by multimeric and multivalent Lex antigens must be considered. We studied a series of trypsin-treated gastric tissues and bacterial strains and the results more likely indicate a protein-protein interaction, results which might argue for a protein-protein interaction mediated by bacterial LPS side chains. Molecular interactions mediated by protein-LPS-protein interaction are illustrated in Figure 4. In addition, it could be speculated that the initial recognition and binding of H. pylori may occur through LPS and that subsequently a more specific interaction with a lectin-like adhesin on the bacterial surface occurs.

Print & Media Figure 4. A representative model showing protein-protein interaction between H. pylori lectins and host outer membrane proteins (A and B faces) and a ligand molecule (here, trimeric Lewis x, galactose and fucose residues). Two kinds of interaction dominate the binding; i.e. hydrogen bonding and van der Waals contact. Hydrogen bonds could be formed between hydroxyl groups of a ligand saccharide and the side chains of hydrophilic residues, but might also involve backbone carbonyl or amide groups. Note that in this case the "A face" is relatively hydrophilic while on the other hand the "B face" is relatively hydrophobic, to which an appropriate aromatic residue (most frequently tryptophan) may make efficient contact.

Print & Media Specific conclusions

• The H. pylori BabA adhesin binds to MUC5AC mucin structures, which carry Le b antigen in different tissues and pathologies in the gastrointestinal tract.

• As a consequence of inflammation, sLex/a antigens are expressed in gastric epithelium. Correlations between sLex expression, chronic inflammation and H. pylori binding were found.

• The complementary H. pylori sialic acid-binding adhesin (SabA) that mediates binding to sLex/a antigens was identified.

• Alterations in glycosylation patterns (Leb versus sLex/a) in gastric mucosa challenged by H. pylori infection modulate and re-program H. pylori adhesion over time in Rhesus monkey. The H. pylori BabA and SabA adhesins together constitute a balanced selection where adapted phenotypes are functionally selected for in different microenvironments.

• The adherence mode mediated by H. pylori LPS has a limited role in adhesion processes. The data presented here were obtained from in vitro adhesion experiments, and the functional impact of the H. pylori Lewis antigens for in vivo colonization remains to be elucidated.

• Our new results on the functional prerequisites for H. pylori adherence have contributed to elucidation of the molecular mechanisms by which H. pylori infection causes disease. The new results have implications both for design of novel therapies and for clinical strategies to identify individuals at risk.

Print & Media Future perspectives A vaccine, which would make prevention of this disease a feasible public health goal, could prevent infection in millions of children and greatly reduce the worldwide incidence of gastritis, ulcers, and stomach cancer. Today, antibiotic therapy is the only efficient treatment to eradicate H. pylori infections. However, antibiotic therapy results in the generation and selection of antibiotic resistant bacteria throughout the body. In addition, complex drugs such as antibiotics are not readily available in the developing parts of the world. Identification of molecular targets is the first but essential step in the development of novel antibacterial strategies. Blocking the primary stages of infection, namely bacterial attachment to host cell receptors and colonization of the mucosal surface, may be the most effective strategy for prevention of bacterial infections. Different strategies could be exploited for inhibiting adhesion of H. pylori to gastric mucosa (i.e. BabA and SabA), such as antibodies against adhesion, receptor analogs and adhesin analogs. One or more of these could form the basis of new approaches for preventing and/or treating H. pylori infection. The second approach is to tailor-design oligosaccharides that mimic host receptors to antagonize bacterial adhesion. One of the most promising animal (primate) models for detailed analyzes of H. pylori infection is the Rhesus monkey, since the Rhesus monkey closely mimics both human immune responses and glycosylation patterns. Also, simple oliogosaccharides, such as sialyl-lactose, were recently shown to have the potential to clear H. pylori infections in two of six animals, when given orally to Rhesus monkeys persistently colonized by H. pylori (Mysore et al., 1999). Recently, Roche et al, (2004) investigated the binding of SabA positive H. pylori strains and corresponding mutants to gangliosides and concluded that the factors affecting binding affinity were: (i) the length of the N-acetyl-lactosamine carbohydrate chain, (ii) the branches of the carbohydrate chain, and (iii) fucose substitution of the N-acetyl -lactosamine core chain. Thus, it is of importance to consider the length, density and multivalancy of synthetic oligosaccharides for efficient inhibition. There is growing evidence that whole grain cereals, especially when bioprocessed, play important roles in the prevention of chronic diseases, including bacterial infections (Kushi et al., 1999; Björck et al., 2000). In a parallel project, we found that fermented rye-bran (FRB) demonstrated anti-microbial activities. These novel

Print & Media properties of FRB could interfere with Lewis b antigen mediated adherence of H. pylori both in radioimmunoanalysis and to the stomach epithelium in situ (to histological tissue sections). Finally, to corroborate the in vitro results, volunteer individuals with H. pylori infections were treated with FRB. The results were promising and showed that the biological activity of the H. pylori infection decreased during therapy, as evidenced by a steep reduction in infectious load. The combined results also suggest that FRBs contain specific receptor inhibitors for binding mediated by Leb, which could be used for treatment of infections caused by the virulent H. pylori strains, and for establishment of a protective gastric microflora. We will next identify the anti-adhesive compounds in FRB and study their activities towards SabA. The findings may thus help to develop new intragastric therapeutics against H. pylori to suppress chronic inflammation and possibly other perturbations in the gastric mucosa that lead to ulceration and malignancy (Mahdavi et al.,in preparation).

Print & Media Acknowledgements

I would like to acknowledge the contributions of a number of people who directed the construction of this book. I deeply appreciate their valuable contribution. I am particularly grateful to my supervisor Thomas Borén for providing innovative research during a journey of continuous change and personal challenge. Thank you to Ben Appelmelk, Sven Bergström, Göran Hal lmans and Hanna Marklund for criticism of my book and for the time you invested in helping me put my best foot forward. I also thank my special friend and colleague, Anders Johansson, for meeting the challenge presented when parts of my project didn’t function the way they usually did. I needed to find new ways of doing things, and although some have been of little help, others have changed my life. He also gave me a view of where I have been, and should serve as a guide on how I should plan my future. Finally, special thanks to my family who provided me with strength and encouragement – giving me strength by understanding the specifics of the challenges I might need to face. Encouragement from knowing that although researching requires many moments of absence, the spirit remains firmly surrounded by the love of families and those who care.

Print & Media References

Ackermark P, Kuipers EJ, Wolf C, Breumelhof R, Seldenrijk CA, Timmer R, Segeren KC, Kusters JG, Smout AJ. (2003). Colonization with cagA-positive Helicobacter pylori strains in intestinal metaplasia of the esophagus and the esophagogastric junction. Am. J. Gastroenterol. 98:1719-1724.

Allen LA. (2001). The role of the neutrophil and phagocytosis in infection caused by Helicobacter pylori. Curr Opin Infect Dis. 14: 273-277.

Allen LA, Schlesinger LS, Kang B. (2000). Virulent strains of Helicobacter pylori demonstrate delayed phagocytosis and stimulate homotypic phagosome fusion in macrophages. J Exp Med. 191:115-128.

Alm RA, Ling LS, Moir DT, King BL, Brown ED, Doig PC, Smith DR, Noonan B, Guild BC, deJonge BL, Carmel G, Tummino PJ, Caruso A, Uria-Nickelsen M, Mills DM, Ives C, Gibson R, Merberg D, Mills SD, Jiang Q, Taylor DE, Vovis GF, Trust TJ. (1999). Genomic-sequence comparison of two unrelated isolates of the human gastric pathogen Helicobacter pylori. Nature. 397:176-180.

Alper J. (2001). Searching for medicine's sweet spot. Science. 2001 291:2338- 2343.

Amieva MR, Salama NR, Tompkins LS, Falkow S. (2002). Helicobacter pylori enter and survive within multivesicular vacuoles of epithelial cells. Cell Microbiol. 4:677–690.

Appelmelk BJ, Simoons-Smit I, Negrini R, Moran AP, Aspinall GO, Forte JG, De Vries T, Quan H, Verboom T, Maaskant JJ, Ghiara P, Kuipers EJ, Bloemena E, Tadema TM, Townsend RR, Tyagarajan K, Crothers JM Jr, Monteiro MA, Savio A, De Graaff J. (1996). Potential role of molecular mimicry between Helicobacter pylori lipopolysaccharide and host Lewis blood group antigens in autoimmunity. Infect. Immun. 64:2031-2040.

Aras RA, Takata T, Ando T, van der Ende A, Blaser MJ. (2001). Regulation of the HpyII restriction-modification system of Helicobacter pylori by gene deletion and horizontal reconstitution. Mol Microbiol. 42:369–382.

Aras RA, Kang J, Tschumi AI, Harasaki Y, Blaser MJ. (2003). Extensive repetitive DNA facilitates prokaryotic genome plasticity. Proc. Natl. Acad. Sci. USA. 100:13579-81354.

Arneberg P, Kornstad L, Nordbo H, Gjermo P. (1976). Less dental caries among secretors than among non-secretors of blood group substance. Scand J Dent Res. 84:362-366.

Print & Media Aspholm-Hurtig M, Dailide G, Lahmann M, Kalia A, Ilver D, Roche N, Vikström S, Sjöström R, Lindén S, Bäckström A, Arnqvist A, Mahdavi J, Nilsson UJ, Velapatiño B, Gilman RH, Gerhard M, Alarcon T, López-Brea M, Nakazawa T, Fox JG, Correa P, Dominguez-Bello MG, Perez-Perez GI, Blaser MJ, Normark S, Carlstedt I, Oscarson S, Teneberg S, Berg DE, Borén T. Functional Adaptation of BabA, the Helicobacter pylori ABO Blood-Group Antigen Binding Adhesin. (submitted).

Bevilacqua MP, Nelson RM, Mannori G, Cecconi O. (1994). Endothelial- leukocyte adhesion molecules in human disease. Annu. Rev. Med. 45:361–378.

Björck S, Bosaeus I, Ek E, Jennische E, Lonnroth I, Johansson E, Lange S. (2000). Food induced stimulation of the antisecretory factor can improve symptoms in human inflammatory bowel disease: a study of a concept. Gut. 46:824-829.

Björkholm B, Zhukhovitsky V, Lofman C, Hulten K, Enroth H, Block M, Rigo R, Falk P, Engstrand L. (2000). Helicobacter pylori entry into human gastric epithelial cells: a potential determinant of virulence, persistence, and treatment failures. Helicobacter. 5:148–155.

Björkholm B, Lundin A, Sillen A, Guillemin K, Salama N, Rubio C, Gordon JI, Falk P, Engstrand L. (2001). Comparison of genetic divergence and fitness between two subclones of Helicobacter pylori. Infect. Immun. 69:7832-7838.

Björkholm B, Falk P, Engstrand L, Nyren O. (2003). Helicobacter pylori: resurrection of the cancer link. J Intern Med. 253:102-119.

Blaser MJ. (1992). Hypotheses on the pathogenesis and natural history of Helicobacter pylori-induced inflammation. Gastroenterology. 102:720-727.

Blaser MJ, Chyou PH, Nomura A. (1995). Age at establishment of Helicobacter pylori infection and gastric carcinoma, gastric ulcer, and duodenal ulcer risk. Cancer Res. 55:562–565.

Blaser MJ. (1996). The bacteria behind ulcers. Sci. Am. 274:104-107.

Blaser MJ, Atherton JC. (2004). Helicobacter pylori persistence: biology and disease. J. Clin. Invest. 113:321-333.

Borén T, Falk P, Roth KA, Larson G, Normark S. (1993). Attachment of Helicobacter pylori to human gastric epithelium mediated by blood group antigens. Science 262:1892-1895.

Boquet P, Ricci V, Galmiche A, Gauthier NC. (2003). Gastric cell apoptosis and H. pylori: has the main function of VacA finally been identified? Trends Microbiol. 11:410-413.

Broadberry RE, Lin-Chu M. (1991). The Lewis blood group system among Chinese in Taiwan. Hum. Hered. 41:290-294.

Print & Media Brown LM. (2000). Helicobacter pylori: epidemiology and routes of transmission. Epidemiol. Rev. 22:283-297.

Bury-Mone S, Skouloubris S, Labigne A, De Reuse H. (2001). The Helicobacter pylori UreI protein: role in adaptation to acidity and identification of residues essential for its activity and for acid activation. Mol. Microbiol. 42:1021-1034.

Censini S, Stein M, Covacci A. (2001). Cellular responses induced after contact with Helicobacter pylori. Curr. Opin. Microbiol. 4:41-46.

Chen W, Li D, Cannan RJ, Stubbs RS. (2003). Common presence of Helicobacter DNA in the gallbladder of patients with gallstone diseases and controls. Dig Liver Dis. 35:237-243.

Chiou CC, Chan CC, Sheu DL, Chen KT, Li YS, Chan EC. (2001). Helicobacter pylori infection induced alteration of gene expression in human gastric cells. Gut. 48:598-604.

Clausen H, Hakomori S.i. (1989). ABH and related histo-blood group antigens; immunochemical differences in carrier isotypes and their distribution. Vox Sang. 56:1-20.

Correa P. (1992). Human gastric carcinogenesis: a multistep and multifactorial process. First American Cancer Society Award Lecture on Cancer Epidemiology and Prevention. Cancer Res. 52:6735-6740.

Correa P. (2003). Bacterial infections as a cause of cancer. J. Natl. Cancer Inst. 95:E3.

Crabtree JE. (1996). Gastric mucosal inflammatory responses to Helicobacter pylori. Aliment Pharmacol Ther. Suppl 1:29-37.

Cover TL, Berg DE, Blaser MJ, Mobley HL. (2001). Principles of Bacterial Pathogenesis, chapter 11; H. pylori pathogenesis. pp:509-558.

Drumm B, Perez-Perez GI, Blaser MJ, Sherman PM. (1990). Intrafamilial clustering of Helicobacter pylori infection. N. Engl. J. Med. 322:359-363.

Ebert MP, Schandl L, Malfertheiner P. (2002). Helicobacter pylori infection and molecular changes in gastric carcinogenesis. J. Gastroenterol. Suppl 13: 45-49.

Edwards NJ, Monteiro MA, Faller G, Walsh EJ, Moran AP, Roberts IS, High NJ. (2000). Lewis X structures in the O-antigen side-chain promote adhesion of Helicobacter pylori to the gastric epithelium. Mol. Microbiol. 35: 1530-1539.

Eggens I, Fenderson BA, Toyokuni T, Hakomori S. (1989). A role of carbohydrate-carbohydrate interaction in the process of specific cell recognition during embryogenesis and organogenesis: a preliminary note. Biochem. Biophys. Res. Commun. 158:913-920.

Print & Media El-Omar EM, Carrington M, Chow WH, McColl KE, Bream JH, Young HA, Herrera J, Lissowska J, Yuan CC, Rothman N, Lanyon G, Martin M, Fraumeni JF Jr, Rabkin CS. (2000). Interleukin-1 polymorphism associated with increase risk of gastric cancer. Nature. 404:398–402.

Enroth H, Wreiber K, Rigo R, Risberg D, Uribe A, Engstrand L. (1999). In vitro aging of Helicobacter pylori: changes in morphology, intracellular composition and surface properties. Helicobacter. 4:7-16.

Ertl C, Wrobel KH. (1992). Distribution of sugar residues in the bovine testis during postnatal ontogenesis demonstrated with lectin-horseradish peroxidase conjugates. Histochemistry. 97:161-171.

Evans D. (2000). Helicobacter pylori adhesins. Rev Perspect Helicobacter 5:183–195.

Farizo KM, Huang T, Burns DL. (2000). Importance of holotoxin assembly in Ptl- mediated secretion of pertussis toxin from Bordetella pertussis. Infect. Immun. 68: 4049–4054.

Filipe MI. (1979). Mucins in the human gastrointestinal epithelium: a review. Invest. Cell Pathol. 2:195-216.

Fox JG, Chien CC, Dewhirst FE, Paster BJ, Shen Z, Melito PL, Woodward DL, Rodgers FG. (2000). Helicobacter canadensis sp. nov. isolated from humans with diarrhea as an example of an emerging pathogen. J. Clin. Microbiol. 38:2546-2549.

Fujimoto S, Marshall B, Blaser MJ. (1994). PCR-based restriction fragment length polymorphism typing of Helicobacter pylori. J. Clin. Microbiol. 3:331-334.

Galustian C, Elviss N, Chart H, Owen R, Feizi T. (2003). Interactions of the gastrotropic bacterium Helicobacter pylori with the leukocyte-endothelium adhesion molecules, the selectins--a preliminary report. FEMS Immunol Med Microbiol. 36:127-134.

Gisbert JP, Blanco M, Cruzado AI, Pajares JM. (2000). Helicobacter pylori infection, gastric metaplasia in the duodenum and the relationship with ulcer recurrence. Eur. J. Gastroenterol. Hepatol. 12:1295-1298.

Glickman JN, Shahsafaei A, Odze RD. (2003). Mucin Core Peptide Expression Can Help Differentiate Barrett's Esophagus From Intestinal Metaplasia of the Stomach. Am. J. Surg. Pathol. 27:1357-1365.

Graham DY. (1991). Helicobacter pylori: its epidemiology and its role in duodenal ulcer disease. J. Gastroenterol. Hepatol. 6:105-113.

Hakomori S.i. (1994). Role of carbohydrates in cell adhesion and recognition. In Complex Carbohydrates in Drug Research (Bock K, Clausen H eds) pp 337-349, Copenhagen:Munksgaard.

Print & Media Hansson LE, Nyren O, Hsing AW, Bergstrom R, Josefsson S, Chow WH, Fraumeni JF Jr, Adami HO. (1996). The risk of stomach cancer in patients with gastric or duodenal ulcer disease. N. Engl. J. Med. 335:242-249.

Harris AW, Gummett PA, Walker MM, Misiewicz JJ, Baron JH. (1996). Relation between gastric acid output, Helicobacter pylori, and gastric metaplasia in the duodenal bulb. Gut. 39:513-520.

Henry S, Mollicone R, Fernandez P, Samuelsson B, Oriol R, Larson G. (1996). Molecular basis for erythrocyte Le(a+ b+) and salivary ABH partial-secretor phenotypes: expression of a FUT2 secretor allele with an A T mutation at nucleotide 385 correlates with reduced alpha(1,2) fucosyltransferase activity. Glycoconj. J. 13:985-993.

Henry S, Oriol R, Samuelsson B. (1995). Lewis histo-blood group system and associated secretory phenotypes. Vox. Sang. 69:166-182.

Henry S, Woodfield DG, Samuelsson BE, Oriol R. (1993). Plasma and red-cell glycolipid patterns of Le(a+b+) and Le(a+b-) Polynesians as further evidence of the weak secretor gene Se(w). Vox. Sang. 65:62-69.

Holbrook WP. (1989). Secretor status and dental caries in Iceland. FEMS Microbiol. Immunol. 1:397-399.

Holler E. (2002). Cytokines, viruses, and graft-versus-host disease. Curr. Opin. Hematol. 9:479-484.

Hultgren SJ, Abraham S, Caparon M, Falk P, St. Geme III JW and Normark S. (1993). Pilus and non-pilus bacterial adhesins: assembly and function in cell recognition. Cell 73: 887-901.

Ilver D, Arnqvist A, Ogren J, Frick IM, Kersulyte D, Incecik ET, Berg DE, Covacci A, Engstrand L, Boren T. (1998). Helicobacter pylori adhesin binding fucosylated histo-blood group antigens revealed by retagging. Science. 279:373- 377.

Ilver D, Barone S, Mercati D, Lupetti P, Telford JL. (2004). Helicobacter pylori toxin VacA is transferred to host cells via a novel contact-dependent mechanism. Cell Microbiol. 6:167-174.

Israel DA, Salama N, Krishna U, Rieger UM, Atherton JC, Falkow S, Peek RM Jr. (2001). Helicobacter pylori genetic diversity within the gastric niche of a single human host. Proc. Natl. Acad. Sci. USA. 98:14625–14630.

Jorgensen M, Daskalopoulos G, Warburton V, Mitchell HM, Hazell SL. (1996). Multiple strain colonization and metronidazole resistance in Helicobacter pylori- infected patients: identification from sequential and multiple biopsy specimens. Infect. Dis. 174:631-635.

Print & Media Kageshita T, Hirai S, Kimura T, Hanai N, Ohta S, Ono T. (1995). Association between sialyl Lewis(a) expression and tumor progression in melanoma. Cancer Res. 55:1748-1751.

Karlsson KA. (1998). Meaning and therapeutic potential of microbial recognition of host glycoconjugates. Mol. Microbiol. 29:1-11.

Karam SM. (1999) Lineage commitment and maturation of epithelial cells in the gut. Frontiers in Bioscinces. 4:D286- 298.

Kukowska-Latallo JF, Larsen RD, Nair RP, Lowe JB. (1990). A cloned human cDNA determines expression of a mouse stage-specific embryonic antigen and the Lewis blood group alpha(1,3/1,4)fucosyltransferase. Genes Dev. 4:1288-1303.

Kelly RJ, Rouquier S, Giorgi D, Lennon GG, Lowe JB. (1995). Sequence and expression of a candidate for the human Secretor blood group alpha(1,2)fucosyltransferase gene (FUT2). Homozygosity for an enzyme-inactivating nonsense mutation commonly correlates with the non-secretor phenotype. J. Biol. Chem. 270:4640-4649.

Kersulyte D, Chalkauskas H, Berg DE. (1999). Emergence of recombinant strains of Helicobacter pylori during human infection. Mol. Microbiol. 31:31-43.

Kim N, Marcus EA, Wen Y, Weeks DL, Scott DR, Jung HC, Song IS, Sachs G. (2004). Genes of Helicobacter pylori Regulated by Attachment to AGS Cells. Infect. Immun. 72:2358-2368.

Kushi LH, Meyer KA, Jacobs DR. (1999). Cereals, Legumes, and chronic disease risk reduction: evidence from epidemiologic studies. Am. J. Clin. Nutr. 70(suppl), 451s-8s

Kwok T, Backert S, Schwarz H, Berger J, Meyer TF. (2002). Specific entry of Helicobacter pylori into cultured gastric epithelial cells via a zipper-like mechanism. Infect. Immun. 70:2108-2120.

Larsen RD, Ernst LK, Nair RP, Lowe JB. (1990). Molecular cloning, sequence, and expression of a human GDP-L-fucose:beta-D-galactoside 2-alpha-L- fucosyltransferase cDNA that can form the H blood group antigen. Proc. Natl. Acad. Sci USA. 87:6674-6678.

Leunk RD, Johnson PT, David BC, Kraft WG, Morgan DR. (1988). Cytotoxic activity in broth-culture filtrates of Campylobacter pylori. J. Med. Microbiol. 26:93-99.

Le Bouder-Langevin S, Capron-Montaland I, De Rosa R, Labedan B. (2002). A strategy to retrieve the whole set of protein modules in microbial proteomes. Genome Res. 12:1961-1973.

Lindén S, Mahdavi J, Hedenbro J, Boren T, Carlstedt I. (2004). Effects of pH on Helicobacter pylori binding to human gastric mucins – identification of binding to non- MUC5AC mucins. (submitted).

Print & Media Lipkin M, Correa P, Mikol YB, Higgins PJ, Cuello C, Zarama G, Fontham E, Zavala D. (1985). Proliferative and antigenic modifications in human epithelial cells in chronic atrophic gastritis. J. Natl. Cancer Inst. 75:613-619.

Logan SM. (1994). IARC Working Group on the Evaluation of Carcinogenic Risks to Humans. Lancet. 344:1078.

Machado JC, Figueiredo C, Canedo P, Pharoah P, Carvalho R, Nabais S, Castro Alves C, Campos ML, Van Doorn LJ, Caldas C, Seruca R, Carneiro F, Sobrinho- Simoes M. (2003). A proinflammatory genetic profile increases the risk for chronic atrophic gastritis and gastric carcinoma. Gastroenterology. 125:364-371.

McCormick BA, Parkos CA, Colgan SP, Carnes DK, Madara JL. (1998). Apical secretion of a pathogen-elicited epithelial chemoattractant activity in response to surface colonization of intestinal epithelia by Salmonella typhimurium. J. Immunol. 160:455-466.

Madrid JF, Ballesta J, Castells MT, Hernandez F. (1990). Glycoconjugate distribution in the human fundic mucosa revealed by lectin- and glycoprotein-gold cytochemistry. Histochemistry. 95:179-187.

Mahdavi J, Johansson A, Olfat FO, Danielsson Å, Kamal-Eldin A, Andersson R, Åman P, Hallmans G, Borén T. Adherence of Helicobacter pylori to Gastric Mucosa Prevented by Fermented Rye-Bran – A Novel Therapeutic Approach. (manuscript).

Marionneau S, Cailleau-Thomas A, Rocher J, Le Moullac-Vaidye B, Ruvoen N, Clement M, Le Pendu J. (2001). ABH and Lewis histo-blood group antigens, a model for the meaning of oligosaccharide diversity in the face of a changing world. Biochimie. 83:565-573.

Marshall BJ, Warren JR. (1984). Unidentified curved bacilli in the stomach of patients with gastritis and peptic ulceration. Lancet. 1:1311-1315.

Monteiro MA. (2001). Helicobacter pylori: a wolf in sheep’s clothing: the glycotype families of Helicobacter pylori lipopolysaccharides expressing histoblood groups: structure, biosynthesis, and role in pathogenesis. Adv. Carbohydr. Chem. Biochem. 57:99-158.

Morgenstern S, Koren R, Moss SF, Fraser G, Okon E, Niv Y. (2001). Does Helicobacter pylori affect gastric mucin expression? Relationship between gastric antral mucin expression and H. pylori colonization. Eur. J, Gastroenterol. Hepatol. 13:19-23.

Muotiala A, Helander IM, Pyhala L, Kosunen TU, Moran AP. (1992). Low biological activity of Helicobacter pylori lipopolysaccharide. Infect. Immun. 60:1714- 1716.

Mysore JV, Wigginton T, Simon PM, Zopf D, Heman-Ackah LM, Dubois (1999). A.Treatment of Helicobacter pylori infection in rhesus monkeys using a novel antiadhesion compound. Gastroenterology. 117:1316-1325.

Print & Media Ndip RN, MacKay WG, Farthing MJ, Weaver LT. (2003). Culturing Helicobacter pylori from clinical specimens: review of microbiologic methods. J. Pediatr. Gastroenterol. Nutr. 36:616-622.

Newburg DS. (2000). Oligosaccharides in human milk and bacterial colonization, Pediatr. Gastroenterol. Nutr. 30:S8–S17.

Nilsson C, Sillen A, Eriksson L, Strand ML, Enroth H, Normark S, Falk P, Engstrand L. (2003). Correlation between cag pathogenicity island composition and Helicobacter pylori-associated gastroduodenal disease. Infect. Immun. 71: 6573- 6581.

Nilsson HO, Mulchandani R, Tranberg KG, Stenram U, Wadstrom T. (2001). Helicobacter species identified in liver from patients with cholangiocarcinoma and hepatocellular carcinoma. Gastroenterology. 120:323-324.

Odenbreit S, Puls J, Sedlmaier B, Gerland E, Fischer W, Haas R. (2000). Translocation of Helicobacter pylori CagA into gastric epithelial cells by type IV secretion. Science. 287:1497-1500.

Olfat FO, Naslund E, Freedman J, Boren T, Engstrand L. (2002). Cultured human gastric explants: a model for studies of bacteria-host interaction during conditions of experimental Helicobacter pylori infection. J. Infect. Dis. 186:423-427.

Olfat FO, Aspholm M, Sondén B, Engstrand L, Teneberg S, Borén T. The Neuraminyllactose-Binding Hemagglutinin of Helicobacter pylori is Identical to the Sialic Acid Binding Adhesin, SabA. (manuscript).

Ota H, Nakayama J, Momose M, Hayama M, Akamatsu T, Katsuyama T, Graham DY, Genta RM. (1998). Helicobacter pylori infection produces reversible glycosylation changes to gastric mucins. Virchows Arch. 433:419-426.

Papini E, Zoratti M, Cover TL. (2001) In search of the Helicobacter pylori VacA mechanism of action. Toxicon. 39:1757-1767.

Parkin M D, Stjhernsward J, Muir C. (1988). Estimates of the worldwide frequency of twelve major cancers. Int. J. Cancer. 41:184-197.

Park Y, Lamont RJ. (1998). Contact-dependent protein secretion in Porphyromonas gingivalis. Infect. Immun. 66:4777-4782.

Pride DT, Blaser MJ. (2002). Concerted evolution between duplicated genetic elements in Helicobacter pylori. J Mol Biol. 316:629-642.

Petersson C, Forsberg M, Aspholm M, Olfat FO, Forslund T, Borén T, Magnusson KE. Helicobacter pylori evokes a strong inflammatory response in human neutrophils by SabA-adhesin mediated selectin-mimicry. (manuscript).

Print & Media Pochec E, Litynska A, Amoresano A, Casbarra A. (2003). Glycosylation profile of integrin alpha 3 beta 1 changes with melanoma progression. Biochim. Biophys. Acta. 1643:113-123.

Rautelin H, Blomberg B, Fredlund H, Jarnerot G, Danielsson D. (1993). Incidence of Helicobacter pylori strains activating neutrophils in patients with peptic ulcer disease. Gut. 34:599-603.

Reglero A, Rodriguez-Aparicio LB, Luengo JM. (1993). Polysialic acids. Int J Biochem. 25:1517-1527.

Renkonen R, Mattila P, Majuri ML, Rabina J, Toppila S, Renkonen J, Hirvas L, Niittymaki J, Turunen JP, Renkonen O, Paavonen T. (1997). In vitro experimental studies of sialyl Lewis x and sialyl Lewis a on endothelial and carcinoma cells: crucial glycans on selectin ligands. Glycoconj. J. 14:593-600.

Rieder G, Hatz RA, Moran AP, Walz A, Stolte M, Enders G. (1997). Role of adherence in interleukin-8 induction in Helicobacter pylori-associated gastritis. Infect. Immun. 65: 3622-3630.

Roche N, Angstrom J, Hurtig M, Larsson T, Boren T, Teneberg S. (2004). Helicobacter pylori and complex gangliosides. Infect. Immun. 72:1519-1529.

Roma-Giannikou E, Karameris A, Balatsos B, Panayiotou J, Manika Z, Van-Vliet C, Rokkas T, Skandalis N, Kattamis C. (2003). Intrafamilial spread of Helicobacter pylori: a genetic analysis. Helicobacter. 8:15-20.

Romaniuk PJ, Zoltowska B, Trust TJ, Lane DJ, Olsen GJ, Pace NR, Stahl DA. (1987). Campylobacter pylori, the spiral bacterium associated with human gastritis, is not a true Campylobacter sp. J. Bacteriol. 169:2137-2141.

Rosner H. (1982). Ganglioside changes in the chicken optic lobes as biochemical indicators of brain development and maturation. Brain Res. 236:49-61.

Rosai J. (1989). Basal cell carcinoma with follicular differentiation. Am. J. Dermatopathol. 11:479-497.

Ross IN, Bahari HM, Turnberg LA. (1981). The pH gradient across mucus adherent to rat fundic mucosa in vivo and the effect of potential damaging agents. Gastroenterology. 81:713-718.

Rotter JI. (1983). Peptic ulcer. In: The principles and practice of Medical Genetics. Emery AEH, Rimoin DL, eds. New York: Churchill Livingstone. 863-878.

Saadi AT, Weir DM, Poxton IR, Stewart J, Essery SD, Blackwell CC, Raza MW, Busuttil A. (1994). Isolation of an adhesin from Staphylococcus aureus that binds Lewis a blood group antigen and its relevance to sudden infant death syndrome, FEMS Immunol. Med. Microbiol. 8:315–320.

Print & Media Satin B, Del Giudice G, Della Bianca V, Dusi S, Laudanna C, Tonello F, Kelleher D, Rappuoli R, Montecucco C, Rossi F. (2000). The neutrophil-activating protein (HP-NAP) of Helicobacter pylori is a protective antigen and a major virulence factor. J. Exp. Med. 191:1467-1476.

Sauer FG, Barnhart M, Choudhury D, Knight SD, Waksman G, Hultgren SJ. (2000). Chaperone-assisted pilus assembly and bacterial attachment. Curr. Opin. Struct Biol. 10:548-556.

Schade C, Flemstrom G, Holm L. (1994). Hydrogen ion concentration in the mucus layer on top of acid-stimulated and -inhibited rat gastric mucosa. Gastroenterology. 107:180-188.

Segal ED, Cha J, Lo J, Falkow S, Tompkins LS. (1999). Altered states: involvement of phosphorylated CagA in the induction of host cellular growth changes by Helicobacter pylori. Proc. Natl. Acad. Sci. USA. 96:14559-14564.

Shirin H, Weinstein IB, Moss SF. (2001). Effects of H. pylori infection of gastric epithelial cells on cell cycle control. Front. Biosci. 6:E104-18.

Shirin H, Hibshoosh H, Kawabata Y, Weinstein IB, Moss SF. (2003). p16Ink4a is overexpressed in H. pylori-associated gastritis and is correlated with increased epithelial apoptosis. Helicobacter. 8:66-71.

Shimizu T, Akamatsu T, Ota H, Katsuyama T. (1996). Immunohistochemical detection of Helicobacter pylori in the surface mucous gel layer and its clinicopathological significance. Helicobacter. 1:197-206.

Sipponen P, Aarynen M, Kaariainen I, Kettunen P, Helske T, Seppala K. (1989). Chronic antral gastritis, Lewis(a+) phenotype, and male sex as factors in predicting coexisting duodenal ulcer. Scand. J. Gastroenterol. 5:581-588.

Slattery MJ, Dong C. (2003). Neutrophils influence melanoma adhesion and migration under flow conditions. Int. J. Cancer. 106:713-722.

Sokurenko EV, Hasty DL, Dykhuizen DE. (1999). Pathoadaptive mutations: gene loss and variation in bacterial pathogens. Trends Microbiol. 7:191-195.

Sokurenko EV, Courtney HS, Ohman DE, Klemm P, Hasty DL. (1994). FimH family of type 1 fimbrial adhesins: functional heterogeneity due to minor sequence variations among fimH genes. J. Bacteriol. 176:748-755.

Solnick JV, Schauer DB. (2001). Emergence of diverse Helicobacter species in the pathogenesis of gastric and enterohepatic diseases. Clin. Microbiol. Rev. 14:59-97.

Solnick JV, Hansen LM, Salama NR, Boonjakuakul JK, Syvanen M. (2004). Modification of Helicobacter pylori outer membrane protein expression during experimental infection of rhesus macaques. Proc. Natl. Acad. Sci. USA. 101:1206- 1211.

Print & Media Soto GE, Hultgren SJ. (1999). Bacterial adhesins: common themes and variations in architecture and assembly. J. Bacteriol. 181:1059-1071.

Spechler SJ. (2002). Barrett's esophagus and esophageal adenocarcinoma: pathogenesis, diagnosis, and therapy. Med. Clin. North. Am. 86:1423-1445.

Stapleton A, Nudelman E, Clausen H, Hakomori S, Stamm WE. (1992). Binding of uropathogenic Escherichia coli R45 to glycolipids extracted from vaginal epithelial cells is dependent on histo-blood group secretor status. J. Clin. Invest. 90:965-972.

Staat MA, Kruszon-Moran D, McQuillan GM, Kaslow RA. (1996). A population- based serologic survey of Helicobacter pylori infection in children and adolescents in the United States. J. Infect. Dis. 174:1120-1123.

Stark RM. (1999). Biofilm formation by Helicobacter pylori. Lett. Appl. Microbiol. 28:121-126.

Stein M, Rappuoli R, Covacci A. (2000). Tyrosine phosphorylation of the Helicobacter pylori CagA antigen after cag-driven host cell translocation. Proc. Natl. Acad. Sci. USA. 97:1263-1268.

Strömberg N, Nyholm PG, Pascher I, Normark S. (1991). Saccharide orientation at the cell surface affects glycolipid receptor function. Proc. Natl. Acad. Sci. USA. 88:9340-9344.

Suerbaum S, Smith JM, Bapumia K, Morelli G, Smith NH, Kunstmann E, Dyrek I, Achtman M. (1998). Free recombination within Helicobacter pylori. Proc. Natl. Acad. Sci. USA. 95:12619-12624.

Su B, Ceponis PJ, Lebel S, Huynh H, Sherman PM. (2003). Helicobacter pylori activates Toll-like receptor 4 expression in gastrointestinal epithelial cells. Infect. Immun. 71:3496-3502.

Syder AJ, Guruge JL, Li Q, Hu Y, Oleksiewicz CM, Lorenz RG, Karam SM, Falk PG, Gordon JI. (1999). Helicobacter pylori attaches to NeuAc alpha 2,3Gal beta 1,4 glycoconjugates produced in the stomach of transgenic mice lacking parietal cells. Mol. Cell. 3:263-274.

Tesh VL. (1998). Virulence of enterohemorrhagic Escherichia coli: role of molecular crosstalk. Trends Microbiol. 6:228-233.

Telford JL, Covacci A, Rappuoli R, Chiara P. (1997). Immunobiology of Helicobacter pylori infection. Curr. Opin. Immunol. 9:498-503.

Telford JL, Ghiara P, Dell'Orco M, Comanducci M, Burroni D, Bugnoli M, Tecce MF, Censini S, Covacci A, Xiang Z, et al. (1994). Gene structure of the Helicobacter pylori cytotoxin and evidence of its key role in gastric disease. J. Exp. Med. 179:1653-1658.

Print & Media Testino G, Cornaggia M, Valentini M. (1999). Gastric cyto-secretory correlations in peptic ulcer. Hepatogastroenterology. 46:2710-2712.

Tomb JF, White O, Kerlavage AR, et al. (1997). The complete genome sequence of the gastric pathogen Helicobacter pylori . Nature 388:539-547.

Valkonen KH, Wadstrom T, Moran AP. (1994). Interaction of lipopolysaccharides of Helicobacter pylori with basement membrane protein laminin. Infect. Immun. 62:3640-3648.

Valkonen KH, Wadstrom T, Moran AP. (1997). Identification of the N- acetylneuraminyllactose-specific laminin-binding protein of Helicobacter pylori. Infect. Immun. 65:916-923.

Van den Brink GR, Tytgat KM, Van der Hulst RW, Van der Loos CM, Einerhand AW, Buller HA, Dekker J. (2000). H pylori colocalises with MUC5AC in the human stomach. Gut. 46:601-607.

Wyatt JI, Rathbone BJ, Sobala GM, Shallcross T, Heatley RV, Axon AT, Dixon MF. (1990). Gastric epithelium in the duodenum: its association with Helicobacter pylori and inflammation. J. Clin. Pathol. 43:981-986.

Wen Y, Marcus EA, Matrubutham U, Gleeson MA, Scott DR, Sachs G. (2003). Acid-adaptive genes of Helicobacter pylori. Infect. Immun. 71:5921-5939.

Weeks DL, Eskandari S, Scott DR, Sachs G. (2000). A H+-gated urea channel: the link between Helicobacter pylori urease and gastric colonization. Science. 287:482–485.

Wilson M, McNab R, Henderson B. (2002). Bacterial Disease Mechanisms; An introduction to cellular microbiology;. Cambridge University press, (www.cambridge.org). chapter 7.

Wieczorek TJ, Wang HH, Antonioli DA, Glickman JN, Odze RD. (2003). Pathologic features of reflux and Helicobacter pylori-associated carditis: a comparative study. Am. J. Surg. Pathol. 27:960-968.

Woolhouse ME, Taylor LH, Hayden DT. (2001). Population biology of multihost pathogens. Science. 292:1109–1112.

Xiang Z, Censini S, Bayeli PF, Telford JL, Figura N, Rappuoli R, Covacci A. (1995). Analysis of expression of CagA and VacA virulence factors in 43 strains of Helicobacter pylori reveals that clinical isolates can be divided into two major types and that CagA is not necessary for expression of the vacuolating cytotoxin. Infect. Immun. 63:94-98.

Print & Media I Print & Media Volume 8 • Number 5 • 2003 HELICOBACTER

TheBlackwell Publishing Ltd. MUC5AC Glycoprotein is the Primary Receptor for Helicobacter pylori in the Human Stomach

Jeroen H. B. Van de Bovenkamp,* Jafar Mahdavi,† Anita M. Korteland-Van Male,* Hans A. Büller,* Alexandra W. C. Einerhand,* Thomas Borén† and Jan Dekker* *Laboratory of Pediatrics, Erasmus MC/Sophia Children’s Hospital, Rotterdam, the Netherlands; †Department of Odontology/ Oral Microbiology, Umeå University, Umeå, Sweden

ABSTRACT

Background and objectives. Helicobacter pylori Results. The binding patterns for the two LeB- shows a characteristic tropism for the mucus- binding strains to all tissues were similar, whereas producing gastric epithelium. In infected patients, the strain unable to bind to LeB did not bind to any H. pylori colocalizes in situ with the gastric secretory of the tissues. In normal gastric tissue, the LeB- mucin MUC5AC. The carbohydrate blood-group binding strains always bound to MUC5AC- and LeB- antigen Lewis B (LeB) was deemed responsible for positive epithelial cells. In four nonsecretor patients, the adherence of H. pylori to the gastric surface colocalization of the LeB-binding strains was found epithelium. We sought to determine if MUC5AC is to MUC5AC-positive gastric epithelial cells. In BE, the carrier of LeB, and thus if MUC5AC is the the LeB-binding H. pylori strains colocalized very underlying gene product functioning as the main speciﬁcally to MUC5AC-positive cells. MUC5AC- receptor for H. pylori in the stomach. producing cells in GMD contained LeB. Yet, LeB- Methods. We studied three types of human tissue binding H. pylori not only colocalized to MUC5AC producing MUC5AC: Barrett’s esophagus (BE), or LeB present in GMD, but also bound to the LeB- normal gastric tissue, and gastric metaplasia of the positive brush border of normal duodenal epithelium. duodenum (GMD). Tissue sections were immuno- Conclusions. Mucin MUC5AC is the most important ﬂuorescently stained for MUC5AC or LeB, and carrier of the LeB carbohydrate structure in normal subsequently incubated with one of three strains of gastric tissue and forms the major receptor for H. pylori. Texas red-labeled H. pylori, one of which was unable Keywords. Adhesion, Helicobacter pylori, mucin, to bind to LeB. We determined the colocalization of MUC5AC, Barrett’s esophagus, gastric metaplasia, MUC5AC or LeB with adherent H. pylori. Lewis B blood group antigen.

ince the discovery of Helicobacter pylori [1,2], The gene encoding MUC5AC has been cloned Schronic infection with this bacterium has [6–8], and is expressed by the surface mucous cells been identiﬁed as the major etiological factor in of the gastric glands [9]. In addition to MUC5AC, gastritis, gastric ulcers, gastric atrophy, and gas- the normal antral mucosa of the stomach expresses tric carcinoma [3,4]. As a result, in 1994, the the secretory mucin MUC6, and these two mucins International Agency for Research on Cancer have distinct expression patterns, being expressed (IARC, Lyon, France), classiﬁed H. pylori infec- by different subsets of cells within the antral tion as a carcinogenic agent class I. glands. MUC6 is mainly expressed in the deeper Within the human body, H. pylori resides antrum gland epithelium, whereas MUC5AC is primarily in the gastric mucus layer. This mucus expressed by the surface epithelium [10]. layer consists mainly of the gel-forming mucin Different blood-group antigens, especially Lewis MUC5AC, which is, like all gel-forming mucins, (Le) antigens, are correlated with the distribution a large, heavily O-glycosylated glycoprotein [5]. of normal gastric mucin expression. Le blood- group antigens are carbohydrate structures carried Reprint requests to: Jan Dekker, Laboratory of Pediatrics, on both glycoproteins and glycolipids. They are Erasmus MC, Rm EE-15-71A, Dr Molewaterplein 50, 3015 widely distributed in the body, and found not GE Rotterdam, the Netherlands. only on erythrocytes, but also in secretions and

Print & Media 522 Van de Bovenkamp et al.

particularly on epithelial cells. The antigenic spe- fluorescently labeled H. pylori on sections of cificity is determined by relatively small differ- each of these tissues. We used three strains of ences in the sugar composition and interresidue H. pylori with well-defined LeB-binding char- linkage of the oligosaccharide moieties [11]. acteristics: (1) CCUG17875, which avidly binds These antigenic structures are carried by two LeB [16]; (2) P466, strongly binding LeB [15]; types of O-glycan backbone structures, named (3) H. pylori TIGR26695, which is unable to bind type 1 [containing Gal(β1-3)GlcNAc] and type to LeB [16]. 2 [containing Gal(β1-4)GlcNAc]. Fucosylation With the data described, we will show that the of the type 1 backbone structure leads to the MUC5AC and LeB antigens usually strongly expression of the blood group antigens Lewis A colocalize in the epithelia of the human upper (LeA), Lewis B (LeB), and H-1, whereas fuco- gastrointestinal tract. The two LeB-binding sylation of type 2 chain leads to the expression H. pylori strains applied to the tissue sections of the blood group antigens Lewis X (LeX), colocalized to both MUC5AC and LeB, whereas Lewis Y (LeY), and H-2 [12]. In the human the non-LeB-binding strain did not bind. Thus, stomach, the expression of MUC5AC is associ- it is probable that MUC5AC, as the main carrier ated with the type 1 blood group structures LeA of LeB in the gastric epithelium, is the main and LeB, and MUC6 expression is tightly asso- receptor for H. pylori in the human stomach. ciated with type 2 antigens LeX and LeY [13]. A number of molecules have been implicated as receptors for H. pylori adhesins (reviewed in Materials and Methods Evans et al. [14]). The LeB structure was shown Patients and Tissue to mediate the attachment of H. pylori to human gastric epithelium, when assayed on tissue sections Biopsy specimens of normal (i.e. non-H. pylori- [15]. The H. pylori adhesin, which interacts with infected, noninflamed) antrum (n = 20) were LeB, has been cloned and designated ‘blood group collected per endoscopy, as part of routine diag- antigen-binding adhesin’ (BabA). It belongs to a nostic endoscopy for upper gastrointestinal gene family with approximately 30 members within complaints. Biopsy specimens from the duo- the H. pylori genome [16,17]. Separate studies denal bulb (n = 12) were retrieved from archive, with transgenic mice expressing the human LeB and were selected for the presence of gastric structure in their gastric epithelial cells indicated metaplasia, as determined previously [19]. The that LeB can function as a receptor for H. pylori biopsy specimens were collected in the Aca- adhesins and mediates attachment of H. pylori to demic Medical Center in Amsterdam, with gastric pit cells and surface mucous cells [18]. permission of the Medical Ethics Committee. We previously demonstrated that H. pylori in Two biopsy specimens were available from the the antrum of infected patients colocalizes in situ antrum and duodenal bulb per patient, and were with extracellular MUC5AC as well as with the immediately fixed in phosphate-buffered saline apical domain of MUC5AC-producing cells of (PBS)/4% (w/v) paraformaldehyde solution for the superficial epithelium [10]. As the expression 4 hours, and then processed in paraffin blocks of MUC5AC is tightly associated with the pres- according to standard procedures. Tissue samples ence of the LeB antigen in the human stomach, of normal esophagus and Barrett’s esophagus we suggest that MUC5AC, as the main carrier (BE, n = 14) were retrieved from the archive of of LeB, constitutes the primary receptor for the Gastrointestinal Pathology Unit, Catholic H. pylori attachment in the human stomach. To University Leuven, Belgium. Per patient, four to test this experimentally, we determined the colo- nine endoscopic biopsy specimens were avail- calization of LeB and MUC5AC in different able, fixed in Carnoy’s fixative, and paraffin- tissues of the upper gastrointestinal tract: nor- embedded. H. pylori infection was assessed on mal stomach, esophagus and duodenum. We also antrum biopsy specimens for all patients, and the examined metaplastic tissue of the esophagus bacterium was detected using both standard his- (Barrett’s esophagus, BE) and of the duodenum tologic staining and microbiology. (gastric metaplasia of the duodenum, GMD), which were both demonstrated to express H. pylori Strains MUC5AC within specific cells [19,20]. Adherence of H. pylori to MUC5AC or LeB The following H. pylori strains were used was studied by an in vitro binding assay with (Table 1): 1, strain CCUG17875 from the

Print & Media

Adhesion of H. pylori to Human Gastric Mucin MUC5AC 523

Table 1 Characteristics of H. pylori strains used in this study and 0.1 mol/l of sodium carbonate, pH 9.0, by Type I gently pipetting. Ten microliters of a 20 mg/ml H. pylori strain (CagA/VacA) BabA References solution of Texas Red (TR; Sigma), freshly pre- CCUG17875 + + [16,50] pared in acetonitrile, was added to 1 ml of bacte- P466 + + [16,51] rial cells (OD600 = 1.0), which was followed by TIGR26695 + – [16,17] incubation for 10 minutes at room temperature Each of the three H. pylori strains is a type I strain, and carries the CagA in the dark. The bacteria were recovered by pathogenicity islet as well as the VacA toxin gene (indicated by +). The centrifugation at 3000 × g for 5 minutes, resus- presence of a functional BabA protein is also indicated (+, present; –, absent), which constitutes the structural gene for the BabA adhesin pended in 1 ml PBS/0.2% (v/v) Tween 20, and protein, the babA1 gene being a nonfunctional pseudo-gene [16]. pelleted by centrifugation as above. The washing cycle was repeated three times. After the last washing cycle, the bacteria were resuspended Culture Collection at the University of Göteborg in PBS/1% (w/v) BSA, and were diluted to (which binds strongly to LeB); 2, strain P466 1.00 OD600. The intensity of TR labeling of all (which binds strongly to LeB) [21]; 3, strain bacterial strains in each preparation was similar, TIGR26695 from The Institute for Genomic as determined by inspection of comparable numbers Research (which is unable to bind to LeB), the of organisms by fluorescence microscopy. genome of which has been fully sequenced [17]. Immunohistochemistry and H. pylori Binding to H. pylori strains were grown at 37°C on Bru- Tissue Sections cella agar supplemented with 10% (v/v) bovine blood and 1% (v/v) IsoVitalex (Becton Dickin- Tissue sections were deparaffinized through son, Franklin Lakes, NJ) under microaerophilic three changes of xylene and then rehydrated conditions (5% O2/10% CO2/85% N2) and through a series of decreasing concentrations 98% humidity. Two days after inoculation, the of ethanol solution to distilled water. Antigen bacteria were harvested from a plate and gently retrieval was performed by heating the sections resuspended in 500 µl PBS/0.2% (v/v) Tween 20 for 10 minutes at 100°C in 10 mmol/l citrate (Sigma, St. Louis, MO), and subsequently used buffer, pH 6.0, and then they were left to cool to in the fluorescent labeling procedure. room temperature for 20 minutes. Sections were washed three times for 5 minutes in PBS and incubated with blocking buffer [10 mmol/l Tris, Binding of 125I-labeled LeB Glycoconjugate H. pylori 5 mmol/l EDTA, 150 mmol/l NaCl, 0.25% (w/ Strains v) gelatin and 0.05% (v/v) Tween 20], pH 8.0, for The binding assay was performed as previously 30 minutes, followed by washing three times for described by Ilver et al. [16]. In short, LeB antigen 5 minutes in PBS/0.2% (v/v) Tween 20. Primary glycoconjugate was prepared by the conjugation monoclonal antibody diluted in PBS was of purified fucosylated oligosaccharide to human added, either anti-MUC5AC (45M1, Novocastra, serum albumin (IsoSep AB, Tullinge, Sweden). Newcastle, UK; diluted 1:50), or anti-Lewis B LeB glycoconjugate was labeled with 125I by (Signet Laboratories, Dedham, MA; diluted the chloramine-T method. One milliliter of 1:40), and incubated for 16 hours at 4°C. Sec- H. pylori bacteria (OD600 = 0.10) was incubated tions were washed three times for 5 minutes in with 400 ng of 125I-labeled LeB glycoconjugate PBS/0.2% (v/v) Tween 20, and then incubated for 30 minutes in PBS containing 0.5% (w/v) for 60 min in the dark with PBS-diluted (1:50), bovine serum albumin (BSA)/0.05% (v/v) Tween fluorescein isothiocyanate (FITC)-labeled anti- 20. After centrifugation, the radioactivity bound mouse secondary antibody (DAKO, Glostrup, to the H. pylori pellet was measured with a gamma- Denmark). Again, the sections were washed counter. Binding experiments were reproducible three times for 5 minutes in PBS/0.2% (v/v) and performed in triplicate. Tween 20. Per section, 40 µl [1.0 × 108 colony- forming units (cfu)/ml] of TR-labeled H. pylori was added, and then incubated for 60 minutes Texas Red Labeling of H. pylori in the dark at room temperature. Slides were H. pylori suspensions were centrifuged at washed 5 times for 5 minutes in PBS. Finally, 3000 × g for 5 minutes. Each pellet of bacteria sections were covered in Vectashield (Vector was resuspended in 500 µl of 0.15 mol/l NaCl Laboratories, Burlingame, UK), and were mounted

Print & Media 524 Van de Bovenkamp et al.

under cover-slips. Colocalization of immuno- Binding of H. pylori to Gastric Epithelium fluorescent staining of tissue antigens and bacteria was analyzed by fluorescent microscopy using a Antrum biopsies were collected from 20 TR/FITC double filter block (Nikon, Tokyo, patients. None of these patients suffered from Japan). Control stainings were performed leav- H. pylori infection as determined by standard ing each of the primary antibodies out of the histochemistry and microbiology, and the tissue procedure, resulting in an absence of FITC showed no signs of acute or chronic inflamma- staining. All binding assays on the tissue of each tion as assessed by standard hematoxylin and patient were performed at least in duplicate. The eosin staining (data not shown). Abundant results were highly reproducible. expression of the MUC5AC glycoprotein in the Separately, closely adjacent sections of each epithelial cells of the surface and of the neck of tissue sample of each patient were stained for the antrum glands could be identified in each three other major secretory mucins, MUC2 patient. In addition, extracellular remnants of the (monoclonal antibody: WE9, a gift of Prof. D. gastric mucus layer were observed, and these K. Podolsky, Massachusetts General Hospital, were also MUC5AC-positive. As reported ear- Boston, MA; diluted 1:50) [22], MUC5B (poly- lier [24], staining of adjacent tissue sections of clonal antibody: BGBM, a gift of Dr G. Offner, each patient with antibodies against the other Boston University Medical Center, Boston, MA; major secretory mucins, MUC2, MUC5B and diluted 1:3000) [23], and MUC6 (polyclonal MUC6, showed that the MUC5AC-positive antibody: 6.1, a gift of Dr C. de Bolos, IMIM cells did not contain any of these other secretory Hospital del Mar, Barcelona, Spain; diluted mucins (data not shown). 1:200) [13]. Single immunohistochemical stain- Sixteen of the 20 patients showed expression ing was performed using specific antibodies of the blood group antigen LeB in the gastric against each of these mucins and by standard surface epithelium, as determined with immuno- horseradish peroxidase/diamino-benzidine-based fluorescent staining. If a patient expressed LeB, staining according to previously reported proce- the expression colocalized very strongly with dures [19,20]. MUC5AC-positive cells as well as with extracellular MUC5AC-positive mucus (Fig. 1). In all 20 patients, binding of strains CCUG17875 and Results P466 was observed to the MUC5AC-positive epithelial cells of the surface and the neck Binding of Soluble LeB Conjugate to H. pylori region of the glands and also to the MUC5AC- To ascertain the expression of functional LeB positive extracellular mucus (Fig. 1A,B). Strain antigen-binding adhesin (BabA), each of the TIGR26695, which was unable to bind to soluble H. pylori strains was examined for binding of LeB conjugate, showed no binding to the soluble LeB conjugate. Strains CCUG17875 and epithelium or the mucus in any of the patients P466 were able to bind soluble LeB conjugate, (Fig. 1C). As LeB showed a very strong colocal- whereas TIGR26695 showed only very weak ization to MUC5AC, strains CCUG17875 and binding (Table 2). This binding experiment was P466 bound very specifically to the LeB-containing performed in triplicate and showed high repro- cells and mucus, while strain TIGR26695 did ducibility, which confirmed expression of func- not bind to LeB-positive structures in the tissue tional BabA for strains CCUG17875 and P466. (Fig. 1D–F). Interestingly, in four patients, in whom we were not able to detect LeB by immuno- Table 2 Binding of soluble LeB glycoconjugate to different fluorescence, the strains CCUG17875 and P466 H. pylori strains bound to MUC5AC-positive cells and mucus, H. pylori strain Binding (%) Range (%) while again no binding was found for strain TIGR26695 (data not shown). CCUG17875 28.6 27.2–30.0 P466 21.8 20.7–22.9 When bacteria were added to the tissue sec- TIGR26695 0.7 0.6–0.8 tions without prior staining by antibodies Binding of H. pylori in suspension to soluble 125I-labeled LeB glycoconjugate directed toward either MUC5AC or LeB, more was measured by gamma counting of bacteria that were pelleted after bacteria were able to bind to MUC5AC- 1 hour of incubation and extensive washing. Binding is expressed as containing cells and mucus (data not shown). percentage of the total amount of 125I conjugate added to each of the bacterial suspensions. Data are presented as mean percentage of maximal This effect was only found for the LeB-binding radioactivity and range of three separate experiments. strains CCUG17875 and P466, while the

Print & Media Adhesion of H. pylori to Human Gastric Mucin MUC5AC 525

Figure 1 Binding of H. pylori to gastric epithelium, showing an example of double immuno-fluorescence on human gastric antrum epithelium, of closely adjacent sections of a LeB- positive patient. Colocalization of TR-labeled H. pylori (in red) added to sections immunohistochemically stained for either MUC5AC (in green; A–C) or LeB (in green; D–F) was studied. MUC5AC-positive cells colocalized very strongly with LeB- positive cells in the surface epithelium. H. pylori strains (A) CCUG17875 and (B) P466 bound specifically to MUC5AC-positive cells and to extracellular MUC5AC-positive mucus (arrows in A and B, respectively) and also to LeB-positive cells and LeB- positive extracellular mucus (arrows in D and E, respectively). Strain TIGR26695 showed no specific binding to any particular structure in the antrum tissue (C and F). Magnification ×40.

binding behavior of TIGR26695 for the tissue was observed for both strains CCUG17875 and sections was not changed by previous staining P466. The binding of these strains of H. pylori with these antibodies. perfectly colocalized with MUC5AC-positive cells in the BE epithelium, whereas strain TIGR26695 showed no specific binding to BE Binding of H. pylori to Esophagus and BE Epithelium epithelium (Fig. 2A–C). As LeB strongly Recently we showed that BE epithelium expressed colocalized with MUC5AC in these BE tissues, the gastric-type mucin MUC5AC [20]. We were the same binding pattern was found as for interested as to whether H. pylori was also able MUC5AC, i.e. strains CCUG17875 and P466 to bind to MUC5AC or LeB in sections of BE were found to specifically bind to the LeB- tissue and normal esophagus epithelium. The positive epithelium, whereas strain TIGR26695 normal stratified epithelium of the esophagus did showed no specific binding to the LeB-positive not express MUC5AC or LeB, and, moreover, epithelium (Fig. 2D–F). this epithelium showed no adherence of any bac- Interestingly, in the tissue of seven individuals teria upon addition of the TR-labeled H. pylori identified with BE in whom LeB could not be strains to the tissue sections (data not shown). demonstrated by immunofluorescence, specific MUC5AC was expressed abundantly in tissue binding of strains CCUG17875 and P466 was sections of all BE patients (n = 14), and was found to the MUC5AC-positive epithelial localized in the surface epithelium of BE, and to cells of BE (Fig. 3A–D). In these LeB-negative a variable extent deeper into the glandular struc- tissues, strain TIGR26695 showed no specific tures of the BE epithelium. In the patients in binding to the BE epithelium (data not shown). whom LeB expression was detected by immuno- As in normal gastric tissues, it appeared that fluorescence (seven of 14 patients), the expres- BE tissues, to which no antibodies were bound, sion pattern of LeB colocalized very strongly bound more bacteria than sections that were with the MUC5AC expression pattern (Fig. 2). effectively stained with antibodies. For example, In each BE patient, binding to the BE epithelium when BE tissue sections did not bind any anti-LeB

Print & Media 526 Van de Bovenkamp et al.

Figure 2 Binding of H. pylori to Barrett’s esophagus (BE) epithelium. (A–F) An example of double immunofluorescence on LeB-positive human metaplastic esophagus epithelium. Colocalization of TR-labeled H. pylori (in red) added to sections immunohistochemically stained for either MUC5AC (in green; A–C) or LeB (in green; D–F) was studied. MUC5AC-positive cells colocalized very strongly with LeB-positive cells in the BE epithelium. H. pylori strains CCUG17875 and P466 bound specifically to MUC5AC-positive cells (A and B, respectively) and also to LeB-positive cells (D and E, respectively). Strain TIGR26695 (C and F) showed no specific binding to any particular structure in this LeB- positive BE tissue. Magnification ×40.

antibodies (as in Figs 3B,D), these sections Twelve patients were selected from the archive bound more bacteria than after effective binding in whom gastric metaplasia was detected in duo- of the anti-MUC5AC antibodies (compare denal bulb biopsy specimens. MUC5AC expres- Fig. 3A with B, and Fig. 3C with D). This effect sion was unequivocally found in these patients was found for both the LeB-binding strains in patches of metaplastic cells, and in a few goblet CCUG17875 and P466 (Fig. 3A–D), while the cells within the villi of the normal epithelium binding characteristics of TIGR26695 were not (Fig. 4). In contrast to both antrum and BE tis- changed by previous incubation with either of sue, H. pylori only adhered to duodenal tissue these antibodies (data not shown). samples in which we were able to demonstrate LeB by immunofluorescence (i.e. in nine of 12 patients). In these tissue samples, LeB was found Binding of H. pylori to Small Intestine Tissue and GMD in the cells of the GMD, in the brush border of Previously, we and other authors demonstrated the normal enterocytes and in a subset of the that MUC5AC in the duodenum was restricted normal goblet cells. In nine (of 12) patients in to cells of the GMD and occasional goblet cells whom we detected LeB-positive small intestine within the normal small intestine epithelium tissue, there was colocalization between LeB and [19,25]. Immunohistochemical staining for other MUC5AC in the epithelial cells of the GMD and secretory mucins on tissue sections of the GMD in occasional goblet cells of the normal duodenal patients in this study revealed that MUC2 epithelium (Fig. 4). In the small intestine tissue was expressed in all goblet cells of the small from three patients in which we could detect no intestine epithelium, and that Brunner’s glands, LeB, no specific adherence of H. pylori could which were present in most of the biopsy speci- be demonstrated with any of the three strains mens, produced MUC5B and MUC6 but not (data not shown). In LeB-positive tissue, strains MUC5AC or MUC2 (data not shown), as we CCUG17875 and P466 showed specific binding demonstrated previously for a large number of to MUC5AC-positive cells of the GMD epithe- individuals [19]. lium and to the occasional MUC5AC-positive

Print & Media Adhesion of H. pylori to Human Gastric Mucin MUC5AC 527

strains CCUG17875 and P466 was found to the brush border of enterocytes, and to the goblet cells in those tissue samples in which we were able to show LeB, colocalizing specifically with LeB in the brush border and these goblet cells (Fig. 4J,K). Strain TIGR26695 showed no specific adherence to the LeB-positive brush border of the enterocytes or to goblet cells (Fig. 4L). Upon immunohistochemical staining of the duodenal tissue sections with antibodies against MUC5AC or LeB, the Brunner’s glands in the mucosa of the duodenum were not stained for MUC5AC or LeB, respectively. None of the three H. pylori strains showed any adherence to the epithelial cells of the Brunner’s glands, both in LeB-positive and -negative small intestine tissue samples, as detected by immunofluorescence (data not shown).

Discussion Helicobacter pylori is known to reside in the gastric mucus layer, often close to or attached to the mucus-producing epithelium [10,26,27]. There- fore, it is of great interest to establish what is so special about this gastric mucus and these gastric mucus-producing cells that H. pylori is able to colonize this niche. As we demonstrated previously, H. pylori in the antrum of infected Figure 3 Binding of H. pylori to LeB-negative Barrett’s patients always colocalizes very specifically with esophagus (BE) epithelium. (A–D) An example of adherence MUC5AC and MUC5AC-producing cells [10]. of H. pylori to sections from a patient with LeB-negative BE epithelium. These sections were immunohistochemically MUC5AC is a secretory, mucus-forming mucin stained for either MUC5AC (in green; A and C) or LeB (in that is characteristically produced in very large green; B and D), and then incubated with the TR-labeled amounts in the gastric mucosa, making it a likely H. pylori (in red). The sections in (A) and (B) were incubated candidate for a H. pylori receptor. Another well- with CCUG17875, and the sections in (C) and (D) were characterized gastric receptor for H. pylori is the incubated with P466. Strain TIGR26695 showed no specific binding to any structure in this LeB-negative BE tissue (data not Lewis B blood group structure, which is a carbo- shown). Magnification ×40. hydrate structure primarily present on O-linked glycans [15]. Mucins are heavily O-glycosylated structures and were demonstrated to carry, goblet cells (Fig. 4A,B,G,H). No specific bind- among others, Lewis antigens, including LeB ing of strain TIGR26695 to MUC5AC-positive [28]. In order to make the two ends of this story cells of the GMD or to MUC5AC-positive meet, our hypothesis is that MUC5AC is the pri- goblet cells in the normal epithelium was found mary gene product that carries the LeB carbohy- (Fig. 4C,I). drate structures, which may form the foothold In GMD, there was a strong colocalization of for H. pylori in one of the steps necessary to col- LeB with MUC5AC, and therefore the adher- onize the human stomach. To test this theory, we ence of the three H. pylori strains to the LeB- studied the colocalization of H. pylori added to positive cells of the GMD was very similar to tissue sections in the presence of both MUC5AC that described above for MUC5AC (Fig. 4D– and LeB within the tissue. Colocalization of F). However, the most extensive LeB expression H. pylori to both these entities would support was found in the brush border of the intestinal our hypothesis. enterocytes, and in the goblet cells of normal First, we have to consider the uniqueness of duodenum epithelium (Fig. 4J–L). Binding of MUC5AC as the mucus-forming mucin in the

Print & Media 528 Van de Bovenkamp et al.

Figure 4 Binding of H. pylori to normal and gastric metaplastic epithelium (GMD) of the duodenum, showing an example of double immuno-ﬂuorescence on GMD epithelium (A–F) and normal villus epithelium of the duodenum (G–L). Colocalization of TR-labeled H. pylori (in red) added to sections immunohistochemically stained for either MUC5AC (in green; A–C and G–I) or LeB (in green; D–F and J–L) was studied. H. pylori strains added to the sections were: CCUG17875 (A, D, G, J), P466 (B, E, H, K) and TIGR26695 (C, F, I, L). Some goblet cells in the normal duodenal villi were MUC5AC-positive, indicated by arrows in (G–I). Magniﬁcation ×40.

human stomach. Gastrointestinal mucus is and intestinal-type metaplastic epithelium of the generally composed of secretory mucins of the esophagus, all four mucus-forming MUCs are MUC family, of which four members are gener- expressed, although MUC2 is restricted to ally considered to have the ability to form mucus intestinal-type metaplasia in BE [20]. The epi- gels: MUC2, MUC5AC, MUC5B, and MUC6 thelium of the gastric antrum, which forms the [29]. Each of these mucins shows a very distinct natural habitat of H. pylori in infected patients, expression pattern along the human gastrointes- produces MUC5AC in the superﬁcial epithelial tinal tract [30,31], indicating distinct and speciﬁc cells and the cells of the gastric pits [10,13,33]. functions for each of these four secretory MUC5B and MUC6 are produced in the epithe- mucins. In the normal esophagus, only MUC5B lial cells lower in the antral glands [10,13,33,34], is produced in the submucosal glands, and the whereas MUC2 is not produced at all in the surface epithelium does not produce gel-forming normal stomach. At the exit of the stomach, the MUCs [32]. However, within Barrett’s esopha- MUC expression pattern again changes dramat- gus (BE), which constitutes the gastric-type ically. The small intestine epithelium contains

Print & Media Adhesion of H. pylori to Human Gastric Mucin MUC5AC 529

characteristic goblet cells expressing MUC2 very recently that the H. pylori babA2 gene is [35]. The Brunner’s glands, which are character- strongly associated with H. pylori strains that istic for the proximal duodenum, produce both have caused severe disease [43]. This suggests MUC5B and MUC6 [24,33,34]. MUC5AC is that H. pylori strains that colonize the epithe- only found in rare goblet cells in the normal lium without the expression of BabA adhesin intestinal villi; however, MUC5AC is expressed cause a less severe gastric disease. Some workers unequivocally in all cells of the gastric metaplasia showed that LeB may not play an essential role that are found in the proximal duodenum in the colonization process of H. pylori in vivo [19,25]. Thus, MUC5AC is very characteristic of in patients [44] and in vitro experiments in a the normal habitat of H. pylori, that is the surface model system using isolated human gastric epi- epithelium of the normal stomach, whereas it is thelial cells [45]. It seems likely that the adher- normally absent from both the esophagus and ence of H. pylori via its BabA receptor to the the duodenum. host LeB structures effectively facilitates infec- Secondly, we have to consider mucins as car- tion, but is not an absolute necessity for eventual riers of carbohydrates, in particular the human colonization. Lewis-type blood group antigens. The expres- In normal stomach and in the epithelium of sion of Lewis antigens is related to the ABO BE, MUC5AC and LeB colocalize to the same blood groups, and is dependent on the ‘secretor’ epithelial cells and to the extracellular mucus. status of the individual. LeB, like Lewis Y, is only The H. pylori bacteria added to the tissue sec- expressed in those individuals (‘secretors’) that tions of antrum and BE colocalized very well to produce the α(1,2)-fucosyltransferase necessary both MUC5AC and LeB. Only the two LeB- to confer the H-structure to the glycans [36,37]. binding strains (CCUG17875 and P466) bound In the Western population, about 80% of indi- to the cells and mucus, whereas the strain that is viduals are ‘secretors’, and are able to generate LeB not able to bind to LeB (TIGR26695) did not antigens on their carbohydrates. Nonsecretors bind to the tissue. This strongly suggests that who lack the respective α(1,2)-fucosyltransferase LeB present on the MUC5AC molecules func- have only very low amounts of LeB on their tions as a receptor for H. pylori. carbohydrates, in the range of 1–5% of the levels We found indications in both the antrum and of secretors [12]. LeB is present abundantly in the BE epithelium that H. pylori was sometimes the gastric mucus of secretors, as a carbohy- able to bind to epithelial cells that could be drate side-chain of MUC5AC [28], but it is also stained for MUC5AC, whereas we were unable expressed in the normal esophagus [38], the to detect LeB through immunofluorescence. In duodenum [38,39], and in some areas of the meta- these seemingly LeB-negative tissues, strains plasia in the esophagus and intestine [40,41]. CCUG17875 and P466 bound to MUC5AC- Therefore, the distribution of LeB in the upper positive cells, which may indicate that other gastrointestinal tract is more widespread than structures of MUC5AC may also function as the distribution of MUC5AC. The affinity of receptors. Yet, this binding could only be dem- H. pylori for LeB has been demonstrated in an onstrated for the two strains carrying a func- in situ adherence assay. In this assay, fresh tional BabA adhesin. The individuals in whom H. pylori adhered to fixed sections of human we were not able to detect LeB were probably gastric tissue, whereas both soluble LeB and a nonsecretors, who nevertheless are known to monoclonal antibody to LeB interfered with this express 1–5% of the levels of LeB found in secre- adhesion [15]. The bacterial adhesin responsible tors [12]. H. pylori is possibly able to bind to this for LeB antigen binding, BabA, was more residual LeB in the nonsecretor tissues. recently identified [16]. Although the exact In the duodenum, H. pylori is, in infected pathophysiological role remains to be elucidated patients, always found closely associated with for infection of the human stomach, the BabA– gastric metaplastic cells [46–49]. Indeed, we LeB interaction may be an important factor in were able to demonstrate colocalization of H. the outcome of infection, as it worsened the pylori added to duodenal tissue sections with severity of gastritis in transgenic mice expressing MUC5AC as well as LeB present in metaplastic human LeB [42]. Nevertheless, both the trans- cells. However, in LeB-positive individuals genic animals carrying the LeB structure and the H. pylori bacteria of strains P466 and their LeB-negative controls were eventually CCUG17875 also bound to the LeB-positive colonized by H. pylori. Moreover, it was shown brush border on the normal villus enterocytes.

Print & Media 530 Van de Bovenkamp et al.

These strains demonstrated, at least in these This research was financially supported by the Nether- experimental circumstances in vitro, the ability lands Digestive Diseases Foundation (Nieuwegein), to bind to LeB structures that are not positioned Irene Children’s Hospital Foundation (Arnhem), Jan on MUC5AC. Thus, there is a notable discrep- Dekker/Ludgardine Bouman Foundation (Amster- ancy between the binding of H. pylori in vitro dam) and Foundation ‘De Drie Lichten’ (Leiden), all and that in vivo when binding to the brush in the Netherlands (JHBvdB), and the Swedish Med- ical Research Council (11218) and Swedish Cancer border is considered. A likely explanation is that Society (4101-B00–03XAB) (TB). The authors thank the H. pylori bacteria that may become attached Prof. Dr N. L. E. Y. Ectors (Leuven, Belgium), Dr to the brush border of the duodenum in vivo do E. H. Van Beers (Amsterdam, the Netherlands) and not survive on this surface. It was previously T. M. Rolf (Amsterdam, the Netherlands) for obtaining noted that the density of infection of the patches the human biopsy specimens. of metaplastic cells in the duodenum was very low, when compared to population densities References in the stomach [46–49]. This indicates that the circumstances for survival of H. pylori in the 1 Marshall BJ. Unidentified curved bacilli on gas- duodenum are far from optimal. Therefore, tric epithelium in active chronic gastritis (letter). Lancet 1983;1:1273–5. H. pylori might only be able to survive in very 2 Warren JR. Unidentified curved bacilli on gastric close association with the MUC5AC-producing, epithelium in active chronic gastritis (letter). Lancet gastric-type metaplastic epithelial cells, as 1983;1:1273. demonstrated by electron microscopy [49]. 3 Marshall BJ, Warren JR. Unidentified curved Although H. pylori may be able to attach to the bacilli in the stomach of patients with gastritis and LeB structures of the brush border in vivo, this peptic ulceration. Lancet 1984;1:1311–5. is not sufficient for survival, and therefore 4 Parsonnet J, Friedman GD, Vandersteen DP, et al. H. pylori is not detected in biopsy specimens of Helicobacter pylori infection and the risk of gastric H. pylori-infected individuals in any significant carcinoma. N Engl J Med 1991;325:1127–31. numbers. 5 Strous GJ, Dekker J. Mucin-type glycoproteins. It was found consistently in each of the sepa- Crit Rev Biochem Mol Biol 1992;27:57–92. 6 Klomp LW, Van Rens L, Strous GJ. Cloning and rate experiments that the bacteria of the LeB- analysis of human gastric mucin cDNA reveals binding strains, CCUG17875 and P466, bound two types of conserved cysteine-rich domains. better to the tissue sections when these sections Biochem J 1995;308:831–8. were not previously stained with antibodies 7 Van de Bovenkamp JH, Hau CM, Strous GJ, against MUC5AC or LeB. The antibodies, Büller HA, Dekker J, Einerhand AW. Molecular which bound to either MUC5AC or LeB within cloning of human gastric mucin MUC5AC the tissue sections, apparently hindered the reveals conserved cysteine-rich d-domains and a binding of the bacteria in the second step of our putative leucine zipper motif. Biochem Biophys colocalization protocol. Although these binding Res Commun 1998;245:853–9. assays are not quantitative, it is very likely that 8 Escande F, Aubert JP, Porchet N, Buisine MP. H. pylori and the anti-MUC5AC and anti-LeB Human mucin gene MUC5AC. organization of its 5′-region and central repetitive region. Bio- antibodies compete for binding to the same chem J 2001;358:763–72. structures in the tissue sections. Apparently, 9 Nordman H, Davies JR, Lindell G, Carlstedt I. these respective antibodies are able to block Human gastric mucins – a major population iden- the interaction between the BabA protein on tified as MUC5. Biochem Soc Trans 1995;23:533S. the H. pylori strains and LeB or MUC5AC in the 10 Van den Brink GR, Tytgat KM, Van Der Hulst tissue sections. RW, et al. H. pylori colocalises with MUC5AC in In summary, we demonstrated H. pylori binding the human stomach. Gut 2000;46:601–7. to mucin MUC5AC in gastric tissue, Barrett’s 11 Lloyd KO. Philip Levine award lecture. Blood esophagus epithelium and gastric metaplastic group antigens as markers for normal differentia- cells in the duodenum. Only H. pylori strains tion and malignant change in human tissues. Am that were able to bind to LeB adhered to J Clin Pathol 1987;87:129–39. 12 Sakamoto S, Watanabe T, Tokumaru T, Takagi H, MUC5AC in the tissue sections. We have Nakazato H, Lloyd KO. Expression of Lewis A, shown that MUC5AC is probably the most Lewis B, Lewis X, Lewis Y, sialyl Lewis A, and important carrier of LeB structures in these sialyl Lewis X blood group antigens in human tissues and forms a major receptor for the gastric carcinoma and in normal gastric tissue. bacterium. Cancer Res 1989;49:745–52.

Print & Media Adhesion of H. pylori to Human Gastric Mucin MUC5AC 531

13 De Bolos C, Garrido M, Real FX. MUC6 apomu- the role of local goblet cell transformation. Gut cin shows a distinct normal tissue distribution 2000;46:632–8. that correlates with Lewis antigen expression 26 Shimizu T, Akamatsu T, Sugiyama A, Ota H, in the human stomach. Gastroenterology 1995; Katsuyama T. Helicobacter pylori and the surface 109:723–34. mucous gel layer of the human stomach. Helico- 14 Evans D. Helicobacter pylori adhesins. Rev Per- bacter 1996;1:207–18. spect Helicobacter 2000;5:183–95. 27 Shimizu T, Akamatsu T, Ota H, Katsuyama T. 15 Boren T, Falk P, Roth KA, Larson G, Normark Immunohistochemical detection of Helicobacter S. Attachment of Helicobacter pylori to human pylori in the surface mucous gel layer and its gastric epithelium mediated by blood group anti- clinicopathological significance. Helicobacter gens. Science 1993;262:1892–5. 1996;1:197–206. 16 Ilver D, Arnqvist A, Ogren J, et al. Helicobacter 28 Nordman H, Davies JR, Lindell G, De Bolos C, pylori adhesin binding fucosylated histo-blood Real F, Carlstedt I. Gastric MUC5AC and MUC6 group antigens revealed by retagging. Science are large oligomeric mucins that differ in size, 1998;279:373–7. glycosylation and tissue distribution. Biochem J 17 Tomb JF, White O, Kerlavage AR, et al. The com- 2002;364:191–200. plete genome sequence of the gastric pathogen 29 Dekker J, Rossen JW, Buller HA, Einerhand AW. Helicobacter pylori. Nature 1997;388:539–47. The MUC family: an obituary. Trends Biochem 18 Falk PG, Bry L, Holgersson J, Gordon JI. Expres- Sci 2002;27:126–31. sion of a human alpha-1,3/4-fucosyltransferase 30 Van Klinken BJ, Dekker J, Buller HA, de Bolos in the pit cell lineage of FVB/N mouse stomach C, Einerhand AW. Biosynthesis of mucins results in production of Leb-containing glyco- (MUC2-6) along the longitudinal axis of the conjugates: a potential transgenic mouse model human gastrointestinal tract. Am J Physiol for studying Helicobacter pylori infection. Proc 1997;273:G296–302. Natl Acad Sci USA 1995;92:1515–9. 31 Reid CJ, Harris A. Developmental expression of 19 Van de Bovenkamp JH, Korteland-Van Male mucin genes in the human gastrointestinal sys- AM, Buller HA, Einerhand AW, Dekker J. Meta- tem. Gut 1998;42:220–6. plasia of the duodenum shows a Helicobacter 32 Arul GS, Moorghen M, Myerscough N, Alderson pylori-correlated differentiation into gastric-type DA, Spicer RD, Corfield AP. Mucin gene expres- protein expression. Hum Pathol 2003;34:156–65. sion in Barrett’s oesophagus: an in situ hybridisa- 20 Warson C, Van De Bovenkamp JH, Korteland-Van tion and immunohistochemical study. Gut 2000;47: Male AM, et al. Barrett’s esophagus is charac- 753–61. terized by expression of gastric-type mucins 33 Ho SB, Roberton AM, Shekels LL, Lyftogt CT, (MUC;5AC:MUC6) and TFF peptides (TFF1 Niehans GA, Toribara NW. Expression cloning and TFF2), but the risk of carcinoma develop- of gastric mucin complementary DNA and local- ment may be indicated by the intestinal-type ization of mucin gene expression. Gastroenter- mucin, MUC2. Hum Pathol 2002;33:660–8. ology 1995;109:735–47. 21 Falk P, Roth KA, Boren T, Westblom TU, Gordon JI, 34 Longman RJ, Douthwaite J, Sylvester PA, et al. Normark S. An in vitro adherence assay reveals Coordinated localisation of mucins and trefoil that Helicobacter pylori exhibits cell lineage- peptides in the ulcer associated cell lineage and specific tropism in the human gastric epithelium. the gastrointestinal mucosa. Gut 2000;47:792– Proc Natl Acad Sci USA 1993;90:2035–9. 800. 22 Tytgat KM, Klomp LW, Bovelander FJ, et al. 35 Chang SK, Dohrman AF, Basbaum CB, et al. Preparation of anti-mucin polypeptide antisera Localization of mucin (MUC2 and MUC3) mes- to study mucin biosynthesis. Anal Biochem senger RNA and peptide expression in human 1995;226:331–41. normal intestine and colon cancer. Gastroenter- 23 Van Klinken BJ, Dekker J, van Gool SA, van ology 1994;107:28–36. Marle J, Buller HA, Einerhand AW. MUC5B is 36 Lopez-Ferrer A, de Bolos C, Barranco C, et al. the prominent mucin in human gallbladder and is Role of fucosyltransferases in the association also expressed in a subset of colonic goblet cells. between apomucin and Lewis antigen expression Am J Physiol 1998;274:G871–8. in normal and malignant gastric epithelium. Gut 24 Van de Bovenkamp JHB, Korteland-Van Male 2000;47:349–56. AM, Büller HA, Einerhand AWC, Dekker J. 37 Kelly RJ, Rouquier S, Giorgi D, Lennon GG, Gastric H. pylori infection alters the expression Lowe JB. Sequence and expression of a candidate patterns of all major secretory proteins in the for the human secretor blood group alpha (1,2) antrum (Abstract). Gastroenterology 2001;120: fucosyltransferase gene (FUT2). Homozygosity A669. for an enzyme-inactivating nonsense mutation 25 Shaoul R, Marcon P, Okada Y, Cutz E, Forstner G. commonly correlates with the non-secretor phe- The pathogenesis of duodenal gastric metaplasia: notype. J Biol Chem 1995;270:4640–9.

Print & Media 532 Van de Bovenkamp et al.

38 Davidson JS, Triadaﬁlopoulos G. Blood group- 45 Clyne M, Drumm B. Absence of effect of Lewis related antigen expression in normal and meta- A and Lewis B expression on adherence of Heli- plastic human upper gastrointestinal mucosa. cobacter pylori to human gastric cells. Gastroen- Gastroenterology 1992;103:1552–61. terology 1997;113:72–80. 39 Mollicone R, Bara J, Le Pendu J, Oriol R. Immuno- 46 Wyatt JI, Rathbone BJ, Sobala GM, et al. Gastric histologic pattern of type 1 (Lea, Leb) and type epithelium in the duodenum: its association with 2 (X:Y, H) blood group-related antigens in the Helicobacter pylori and inﬂammation. J Clin human pyloric and duodenal mucosae. Lab Pathol 1990;43:981–6. Invest 1985;53:219–27. 47 Gisbert JP, Blanco M, Cruzado AI, Pajares JM. 40 Murata K, Egami H, Shibata Y, Sakamoto K, Helicobacter pylori infection, gastric metaplasia Misumi A, Ogawa M. Expression of blood group- in the duodenum and the relationship with related antigens, ABH, Lewis (a), Lewis (b), ulcer recurrence. Eur J Gastroenterol Hepatol Lewis (x), Lewis (y), CA19-9, and CSLEX1 in 2000;12:1295–8. early cancer, intestinal metaplasia, and uninvolved 48 Khulusi S, Badve S, Patel P, et al. Pathogenesis of mucosa of the stomach. Am J Clin Pathol 1992;98: gastric metaplasia of the human duodenum: role 67–75. of Helicobacter pylori, gastric acid, and ulcera- 41 Kobayashi K, Sakamoto J, Kito T, et al. Lewis tion. Gastroenterology 1996;110:452–8. blood group-related antigen expression in normal 49 Noach LA, Rolf TM, Tytgat GN. Electron micro- gastric epithelium, intestinal metaplasia, gastric scopic study of association between Helicobacter adenoma, and gastric carcinoma. Am J Gastro- pylori and gastric and duodenal mucosa. J Clin enterol 1993;88:919–24. Pathol 1994;47:699–704. 42 Guruge JL, Falk PG, Lorenz RG, et al. Epithelial 50 Xiang Z, Censini S, Bayeli PF, et al. Analysis of attachment alters the outcome of Helicobacter expression of CagA and VacA virulence factors pylori infection. Proc Natl Acad Sci USA 1998;95: in 43 strains of Helicobacter pylori reveals that 3925–30. clinical isolates can be divided into two major 43 Gerhard M, Lehn N, Neumayer N, et al. Clinical types and that CagA is not necessary for expres- relevance of the Helicobacter pylori gene for sion of the vacuolating cytotoxin. Infect Immun blood-group antigen-binding adhesin. Proc Natl 1995;63:94–8. Acad Sci USA 1999;96:12778–83. 51 Su B, Hellstrom PM, Rubio C, Celik J, Granstrom 44 Oberhuber G, Kranz A, Dejaco C, et al. Blood M, Normark S. Type I Helicobacter pylori shows groups Lewis (b) and ABH expression in gastric Lewis (b)-independent adherence to gastric mucosa: lack of inter-relation with Helicobacter cells requiring de novo protein synthesis in pylori colonisation and occurrence of gastric both host and bacteria. J Infect Dis 1998;178: MALT lymphoma. Gut 1997;41:37–42. 1379–90.

Print & Media II

R ESEARCH A RTICLE Leb antigen–independent binding. Ear- Helicobacter pylori lier studies identified nearly identical babA SabA Adhesin genes at different H. pylori chromosomal loci, each potentially encoding BabA. The in Persistent Infection babA2 gene encodes the complete adhesin, whereas babA1 is defective because sequenc- and Chronic Inflammation es encoding the translational start and signal peptide are missing (4). Our experiments be- Jafar Mahdavi,1* Berit Sondeń,1*† Marina Hurtig,1* gan with analyses of a babA2–knockout mu- Farzad O. Olfat,1,2 Lina Forsberg,1 Niamh Roche,3 tant derivative of the reference strain Jonas Ångstro¨m,3 Thomas Larsson,3 Susann Teneberg,3 CCUG17875 (hereafter referred to as 17875). Karl-Anders Karlsson,3 Siiri Altraja,4 Torkel Wadstro¨m,5 Unexpectedly, this 17875 babA2 mutant 6 6 7 bound to gastric mucosa from an H. pylori– Dangeruta Kersulyte, Douglas E. Berg, Andre Dubois, infected patient with gastritis. 8 8 9 Christoffer Petersson, Karl-Eric Magnusson, Thomas Norberg, A 17875 derivative with both babA genes Frank Lindh,10 Bertil B. Lundskog,11 Anna Arnqvist,1,12 inactivated (babA1A2) was constructed (14). Lennart Hammarstro¨m,13 Thomas Boreń1‡ This babA1A2 mutant also adhered (Fig. 1, B and C), which showed that adherence was not Helicobacter pylori adherence in the human gastric mucosa involves specific due to recombination to link the silent babA1 bacterial adhesins and cognate host receptors. Here, we identify sialyl-dimeric- gene with a functional translational start and Lewis x glycosphingolipid as a receptor for H. pylori and show that H. pylori signal sequence. Pretreatment with soluble Leb infection induced formation of sialyl-Lewis x antigens in gastric epithelium in antigen (structures in table S1) resulted in humans and in a Rhesus monkey. The corresponding sialic acid–binding adhesin Ͼ80% lower adherence by the 17875 parent (SabA) was isolated with the “retagging” method, and the underlying sabA gene strain (Figs. 1E and 3C) but did not affect (JHP662/HP0725) was identified. The ability of many H. pylori strains to adhere adherence by its babA1A2 derivative (Figs. 1F to sialylated glycoconjugates expressed during chronic inflammation might and 3C). thus contribute to virulence and the extraordinary chronicity of H. pylori In contrast to binding to infected gastric infection. mucosa (Fig. 1, A to I), the babA1A2 mutant did not bind to healthy gastric mucosa Helicobacter pylori persistently infects the shedding into the gastric lumen and ensur- from a person not infected with H. pylori gastric mucosa of more than half of all ing good access to nourishing exudate from (Fig. 1, J to M), whereas the 17875 parent people worldwide, causes peptic ulcer dis- gastric epithelium that has been damaged strain bound avidly (Fig. 1, M versus L). ease, and is an early risk factor for gastric by the infection. The best defined H. pylori These results implicated another adhesin cancer (1). Many H. pylori strains express adhesin-receptor interaction found to date that recognizes a receptor distinct from the adhesin proteins that bind to specific host- is that between the Leb blood group antigen Leb antigen and possibly associated with cell macromolecule receptors (2). This ad- binding adhesin, BabA, a member of a mucosal inflammation. herence may be advantageous to H. pylori family of H. pylori outer membrane pro- Adherence was also studied in tissue by helping to stabilize it against mucosal teins, and the H, Lewis b (Leb), and related from a special transgenic mouse that pro- ABO antigens (3–5). These fucose-contain- duces Leb antigen in the gastric mucosa, 1Department of Odontology/Oral Microbiology, ing blood group antigens are found on red the consequence of expression of a human- Umeå University, SE-901 87 Umeå, Sweden. 2The blood cells and in the gastrointestinal mu- derived ␣1,3/4 fucosyltransferase (FT) Swedish Institute for Infectious Disease Control, SE- cosa (6). Blood group–O individuals suffer (15). Strain 17875 and the babA1A2 mutant 171 82 Solna, Sweden. 3Institute of Medical Biochem- disproportionately from peptic ulcer dis- each adhered to Leb mouse gastric epithe- istry, Go¨teborg University, Box 440, SE-405 30 Go¨te- ease, suggesting that bacterial adherence to lium (Fig. 2A, ii and iii), whereas binding borg, Sweden. 4Institute of Molecular and Cell Biolo- gy, Tartu University, EE-51010 Tartu, Estonia. 5De- the H and Leb antigens affects the severity of each strain to the mucosa of nontrans- partment of Infectious Diseases and Medical of infection (7). Additional H. pylori–host genic (FVB/N) mice was poor and was Microbiology, Lund University, SE-223 62 Lund, Swe- macromolecule interactions that do not in- limited to the luminal mucus. Thus, Leb 6 den. Department of Molecular Microbiology, Wash- volve Leb-type antigens have also been mice express additional oligosaccharide ington University Medical School, St. Louis, MO 63110, USA. 7Laboratory of Gastrointestinal and Liver reported (8). chains (glycans), possibly fucosylated, but Studies, Department of Medicine, USUHS, Bethesda, H. pylori is a genetically diverse species, distinct from the Leb antigen that H. pylori MD 20814–4799, USA. 8Department of Molecular with strains differing markedly in virulence. could exploit as a receptor. and Clinical Medicine, Division of Medical Microbiol- Strains from persons with overt disease gener- sdiLex antigen–mediated binding. To ogy, Linko¨ping University, SE-581 85 Linko¨ping, Swe- den. 9Department of Chemistry, Swedish University ally carry the cag-pathogenicity island (cag- search for another receptor, thin-layer chro- of Agricultural Sciences, SE-750 07 Uppsala, Sweden. PAI) (9, 10), which mediates translocation of matography (TLC)–separated glycosphingo- 10IsoSep AB, Dalka¨rrsv. 11, SE-146 36 Tullinge, Swe- CagA into host cells, where it is tyrosine phos- lipids (GSLs) were overlaid with H. pylori den. 11Department of Medical Biosciences/Clinical phorylated and affects host cell signaling (11). cells and monoclonal antibodies (mAbs), as Cytology, Umeå University, SE-901 87 Umeå, Swe- 12 Leb antigen binding is most prevalent among appropriate. These tests (i) showed that the den. Department of Molecular Biology, Umeå Uni- ϩ versity, SE-901 87 Umeå, Sweden. 13Center for Bio- cag strains from persons with overt disease (4, babA1A2 mutant bound acid GSLs (Fig. 2B, technology, Karolinska Institute, Novum, SE-141 57 12). Separate studies using transgenic mice that iv,lanes2and4),(ii)confirmedthatitdidnot Huddinge, Sweden. express the normally absent Leb antigen sug- bind Leb GSL (lane 9), (iii) showed that its *These authors contributed equally to this work. gest that H. pylori adherence exacerbates in- binding was abrogated by desialylation (lanes †Present address: Unite´deGeńe´tique Mycobacte´ri- flammatory responses in this model (13). Taken 3 and 5), and (iv) revealed that it did not bind enne, Institut Pasteur, 25 rue du Dr Roux, 75724 Paris together, these results point to the pivotal role of sialylated GSLs of nonhuman origin (lane 1) Cedex 15, France. ‡To whom correspondence should be addressed. E- H. pylori adherence in development of severe [table S1, numbers 2 to 5, in (16)] (indicating mail: [email protected] disease. that sialylation per se is not sufficient for

www.sciencemag.org SCIENCE VOL 297 26 JULY 2002 573

Print & Media R ESEARCH A RTICLE adherence). In addition, the binding pattern of Further tests with soluble glycoconjugates mono and dimeric forms of sLex, 1 ϫ 108 MϪ1 the babA1A2 mutant matched that of the mAb showed that the 17875-parent strain bound both and 2 ϫ 108 MϪ1, respectively (Fig. 3B) (16). against sLex (Fig. 2B, ii versus iv), except sLex and Leb antigens, whereas its derivative These patterns suggest that the sialylated bind- that sLex-mono-GSL was bound more weak- bound only sLex (Fig. 3A). Pretreatment of the ing sites are best presented at the termini of ly by the babA1A2 mutant than by the mAb babA1A2 mutant with sLex conjugate reduced extended core chains containing multiple Lewis (Fig. 2B, iv) and no binding to sialyl-Lewis its in situ adherence by more than 90% (Figs. 1I x motifs, such as GSLs in cell membranes. a-GSL was detected (table S1). Thus, the and 3C) (14) but did not affect adherence of the Such optimization of steric presentation would babA1A2 mutant preferably binds sialylated 17875 parent strain (Figs. 1H and 3C). Similar- be less important for soluble receptors. gangliosides, possibly with multiple Lex (fu- ly, pretreatment of tissue sections with an mAb The Scatchard analyses (16) also estimat- cose-containing) motifs in the core chain that recognizes sdiLex reduced adherence by ed that 700 sLex-conjugate molecules were (thus, slower migration on TLC). the babA1A2 mutant by 72% (Fig. 3E). bound per babA1A2-mutant bacterial cell The babA1A2-mutant strain was next used Titration experiments showed that the (Fig.3B),anumbersimilartothatofLeb to purify a high-affinity binding GSL from babA1A2 mutant exhibited high affinity for the conjugates bound per cell of strain 17875. human adenocarcinoma tissue (14). The H. sdiLex GSLs, with a level of detection of 1 Clinical isolates. A panel of 95 Europe- pylori–binding GSL was identified by mass pmol (Fig. 2B, iv) (table S1, number 8). At least an clinical isolates was analyzed for sLex spectrometry and 1H nuclear magnetic reso- 2000-fold more (2 nmol) of the shorter sialyl- binding (14). Thirty-three of the 77 cagAϩ nance (NMR) as the sialyl-dimeric-Lewis x (mono)-Lewis x GSL was needed for binding strains (43%) bound sLex, but only 11% (2 antigen, abbreviated as the sdiLex antigen (table S1, number 7). In contrast, its affinity out of 18) of cagA– strains (P Ͻ 0.000).

(Fig.2,BandC)(14). (Ka) for soluble conjugates was similar for However, deletion of the cagPAI from strain G27 did not affect sLex binding, as had also been seen in studies of cagA and Leb-antigen binding. Out of the Swedish clinical isolates, 39% (35 out of 89) bound sLex, and the great majority of these sLex-binding isolates, 28 out of 35 (80%), also bound the Leb antigen. Fifteen of the 35 (43%) sLex-binding isolates also bound the related sialyl-Lewis a antigen (sLea) (table S1, number 6), whereas none of the remaining 54 sLex-nonbinding strains could bind to sLea. The clinical isolates SMI65 and WU12 (the isolate from the infected patient in Fig. 1, A to M) illustrate such combinations of binding modes (Fig. 3A). Of the two strains with sequenced genomes, strain J99 (17) bound sLex, sLea, and Leb antigens, whereas strain 26695 (18) bound none of them (Fig. 3A). Binding to inflamed tissue. Gastric tissue inflammation and malignant transformation each promote synthesis of sialylated glycoconjugates (19), which are rare in healthy human stomachs (20). Immunohisto- chemical analysis showed that the sialylated antigens were located to the apical surfaces of the surface epithelial cells (fig. S2). To study gastric mucosal sialylation in an H. pylori context, gastric biopsies from 29 endoscopy patients were scored for binding by the babA1A2 mutant and by the 17875 strain in situ, and for several markers of inflammation (table S2A) (14). Substantial correlations were found between babA1A2-mutant adherence and the following parameters: (i) levels of neutrophil (PMN) infiltration, 0.47 (P Ͻ 0.011); (ii) lymphocyte/plasma cell infiltration, 0.46 (P Ͻ 0.012); (iii) mAb staining for Fig. 1. The sLex antigen confers adherence of H. pylori to the epithelium of H. pylori–infected sLex in surface epithelial cells and in gastric (strain WU12) human gastric mucosa (Fig. 3A). H/E staining reveals mucosal inflammation (A). The pit regions, 0.52 (P Ͻ 0.004); and (iv) histo- 17875 parent strain (B) and the babA1A2 mutant (C) both adhere to the gastric epithelium. The logical gastritis score, 0.40 (P Ͻ 0.034). In surface epithelium stains positive (arrows) with both the Leb mAb (D) and sLex mAb (G) [AIS contrast, there was no significant correlation described in (14)]. The 17875 strain and babA1A2 mutant responded differently after pretreatment between babA1A2-mutant binding in situ and (inhibition) with soluble Leb antigen [(E) and (F), respectively)], or with soluble sLex antigen [(H) H. pylori density in biopsies from natural and (I), respectively)]. In conclusion, the Leb antigen blocked binding of the 17875 strain, whereas Ͻ the sLex antigen blocked binding of the babA1A2 mutant. H/E-stained biopsy with no H. pylori infection (0.14, P 0.47), nor between any infection (J). No staining was detected with the sLex mAb (K). Here, strain 17875 adhered (L), in inflammatory parameter and in situ adher- contrast to the babA1A2 mutant (M), because noninflamed gastric mucosa is low in sialylation (K). ence of strain 17875 (Leb and sLex binding).

574 26 JULY 2002 VOL 297 SCIENCE www.sciencemag.org

Print & Media R ESEARCH A RTICLE The series of 29 patient biopsies was then (even without infection), which each serve ity in these Leb-sLex interference interac- compared to a series of six biopsies of H. as receptors for H. pylori. tions contributes to our model of receptor pylori–noninfected individuals, and a consid- A finding that H. pylori pretreatment with positioning on cell surfaces. erable difference was found to be due to Leb conjugate blocked its adherence to Leb SabA identified. We identified the sLex- lower adherence of the babA1A2 mutant (P Ͻ mouse tissue, whereas sLex pretreatment did binding adhesin by “retagging.” This tech- 0.000) (table S2B), whereas strain 17875 not, had been interpreted as indicating that H. nique exploits a receptor-bound multifunc- showed no difference. pylori adherence is mediated solely by Leb tional biotinylated crosslinker, and ultraviolet Binding to infected tissue. Biopsy ma- antigen (22). However, because strain 17875 (UV) irradiation to mediate transfer of the terial from a Rhesus monkey was used to and its babA1A2 mutant bound similar levels of biotin tag to the bound adhesin (4). Here, we directly test the view that H. pylori infection soluble sLex conjugate (Fig. 3A), soluble Leb added the crosslinker to sLex conjugate and stimulates expression of sialylated epithelial seems to interfere sterically with interactions used more UV exposure (14) than had been glycosylation patterns that can then be ex- between sLex-specific H. pylori adhesins and used to isolate the BabA adhesin (4)tocom- ploited by H. pylori for adherence [monkey sLex receptors in host tissue (see also Fig. 1, E pensate for the lower affinity of the sLex- biopsies in (14)]. This monkey (21) had been versus F). Because an excess of soluble sLex than the Leb-specific adhesin for cognate sol- cleared of its natural H. pylori infection, and did not affect H. pylori binding to Leb receptors uble receptors (Fig. 3B). Strain J99 was used, gastritis declined to baseline. Gastric biopsies [Figs. 1H and 3C (in humans) and Figs. 2A, v, and a 66-kDa protein was recovered (Fig. taken at 6 months post-eradication showed and 3D (in Leb-mice)], the steric hindrance is 5A). Four peptides identified by mass spec- expression of sLex in the gastric gland region not reciprocal. Further tests showed that liquid trometry (MS)–matched peptides encoded by (Fig. 4A) and no expression in the surface phase binding is distinct. A 10-fold excess of gene JHP662 in strain J99 (17) (gene epithelium (Fig. 4A). In situ adherence of the soluble unlabeled Leb conjugate (3 ␮g) along HP0725 in strain 26695) (18).Twoofthe babA1A2 mutant was limited to gastric with 300 ng of 125I-sLex conjugate did not four peptides also matched those from the glands and was closely matched to the sLex affect strain 17875 binding to soluble sLex related gene JHP659 (HP0722) (86% protein expression pattern (Fig. 4B). No specific ad- glycoconjugate. level similarity to JHP662) (fig. S1). herence to the surface epithelium was seen Thus, soluble Leb conjugates interfere To critically test if JHP662 or JHP659 en- (Fig. 4B). with sLex-mediated H. pylori binding spe- codes SabA, we generated camR insertion al- At 6 months post-therapy, this gastritis-free cifically when the sLex moieties are con- leles of each gene in strain J99. Using radiola- animal had been experimentally infected with a strained on surfaces. The lack of reciproc- beled glycoconjugates, we found that both sLex cocktail of H. pylori strains, of which the J166 strain (a cagA-positive, Leb and sLex binding isolate) became predominant a few months later. This led to inflammation, infiltration by lymphocytes [Fig. 4C, bluish due to hematoxyline/eosine (H/E)–staining], and microscopic detection of H. pylori infection (Fig. 4, E and F) (21). The virulent H. pylori infection led to strong sLex-antigen expression in the surface epithelium (Fig. 4C) and maintained expression in the deeper gastric glands (Fig. 4C); thus, a bi-layered expression mode supported strong binding of the babA1A2 mutant to both regions (Fig. 4D). Bacterial pretreatment with sLex conjugate eliminated surface epithelial adherence and reduced gastric gland adherence by 88%. Thus, persistent H. pylori infection up- Fig. 2. (A) The sLex antigen con- regulates expression of sLex antigens, which H. fers adherence of H. pylori to the pylori can exploit for adherence to the surface transgenic Leb mouse gastric epithelium. mucosa. H/E-stained biopsy of Binding to Leb transgenic mouse gas- Leb mouse gastric mucosa (i). tric epithelium. We analyzed gastric mu- The 17875 strain (ii) and cosa of Leb mice for sLex antigen–depen- babA1A2 mutant (iii) both adhered to the surface epithelium, dent H. pylori adherence in situ [AIS, in which stained positive with the (14)]. Pretreatment with the sLex conjugate sLex mAb (iv). Adherence by the reduced binding by babA1A2-mutant bac- babA1A2 mutant was lost (vi), teria by more than 90% (Figs. 2A, vi, and while adherence by the 17875 3D) but did not affect binding by its 17875 strain was unperturbed (v), after parent (Figs. 2A, v, and 3D). In compari- pretreatment of the bacteria with soluble sLex antigen. (B) H. pylori binds to fucosylated gangliosides such as the sLex GSL. GSLs were separated on TLC and chemically stained (i) (14). son, pretreatment with soluble Leb antigen Chromatograms were probed with sLex mAb (ii), the 17875 strain (iii), and the babA1A2 mutant decreased adherence by Ͼ80% of the (iv). Lanes contained acid (i.e., sialylated) GSLs of calf brain, 40 ␮g; acid GSLs of human neutrophil 17875 strain (Leb and sLex binding), granulocytes, 40 ␮g; sample number 2 after desialylation, 40 ␮g; acid GSLs of adenocarcinoma, 40 whereas binding by the babA1A2 mutant ␮g; sample number 4 after desialylation, 40 ␮g; sdiLex GSL, 1 ␮g; sLea GSL, 4 ␮g; s(mono)Lex GSL, ␮ ␮ was not affected. mAb tests demonstrated 4 g; and Leb GSL, 4 g. Binding results are summarized in table S1. (C) The high-affinity H. pylori GSL receptor was structurally identified by negative ion fast atom bombardment mass spectrom- sLex antigen in the gastric surface epithe- ϩ etry. The molecular ion (M-H )– at m/z 2174 indicates a GSL with one NeuAc, two fucoses, two lium and pits of Leb mice (Fig. 2A, iv). N-acetylhexosamines, four hexoses, and d18:1-16:0; and the sequence NeuAcHex(Fuc)HexNAc- That is, these mice are unusual in produc- Hex(Fuc)HexNAcHexHex was deduced. 1H-NMR spectroscopy resolved the sdiLex antigen; ing sialyl as well as Leb glycoconjugates NeuAc␣2.3Gal␤1.4(Fuc␣1.3)GlcNAc␤1.3Gal␤1.4(Fuc␣1.3) GlcNAc␤1.3Gal␤1.4Glc␤1Cer (14).

www.sciencemag.org SCIENCE VOL 297 26 JULY 2002 575

Print & Media R ESEARCH A RTICLE and sLea antigen–binding activity was abol- Nevertheless, Leb conjugate pretreatment of OFF (non–sLex-binding) variant called ished in the JHP662 (sabA) mutant, but not in J99 (BabAϩ and SabAϩ) might have inter- 17875/Leb. In contrast, each of several hun- the JHP659 (sabB) mutant. Thus, the SabA fered with sLex antigen–mediated adherence dred isolates tested retained Leb antigen– adhesin is encoded by JHP662 (HP0725). This (see Fig. 1E). To determine if this was a steric binding capacity. gene encodes a 651-aa protein (70 kDa) and effect of the bulky glycoconjugate on expo- Upstream and within the start of the sabA belongs to the large hop family of H. pylori sure of SabA adhesin, single babA and sabA gene are poly T/CT tracts that should be outer membrane protein genes, including babA mutant J99 derivatives were used to further hotspots for ON/OFF frameshift regulation (17, 18). The sabA gene was then identified by analyze Leb and sLex adherence (Fig. 5C, i to [see HP0725 in (18)], which might underlie PCR in six sLex-binding and six non–sLex- iv). Both single mutants adhered to the in- the observed instability of sLex-binding ac- binding Swedish isolates, which suggests that flamed gastric epithelial samples, whereas tivity. Both strains’ genome sequences, sabA is present in the majority of H. pylori the babAsabA (double) mutant was unable to 26695 and J99, demonstrate CT repeats that isolates (14). bind this same tissue. suggest sabA to be out of frame (six and nine Parallel studies indicated that the sabA Instability of sLex binding. When CTs, respectively) (17, 18). Four sLex-bind- inactivation did not affect adherence mediat- screening for SabA mutants, we also ana- ing and four non–sLex-binding Swedish iso- ed by the BabA adhesin (Fig. 5B, i)andthat lyzed single colony isolates from cultures of lates, and in addition strain J99, were ana- pretreatment of the J99sabA mutant with sol- parent strain J99 (which binds both sLex and lyzed by PCR for CT repeats, and differences uble Leb antigen prevented its binding to Leb antigens) (Fig. 3A), which indicated that in length were found between strains. Ten CT gastric epithelium (Fig. 5B, ii). This implies 1% of colonies had spontaneously lost the repeats [as compared to nine in (17)] were that the SabA and BabA adhesins are orga- ability to bind sLex. Similar results were nized and expressed as independent units. obtained with strain 17875 (Fig. 3A) with an

Fig. 3. H. pylori binds sialylated antigens. (A) H. pylori strains and mutants (14) were analyzed for binding to different 125I-labeled soluble fucosylated and sialylated (Lewis) antigen-conjugates [RIA in (14)]. The bars give bacterial binding, and conjugates used are given in the diagram. (B) For affinity analyses (16), the sLex conjugate was added in titration series. The babA1A2 mutant was incubated for 3 hours with the s(mono)Lex conjugate to allow for Fig. 4. Infection induces expression of sLex equilibrium in binding, antigens that serve as binding sites for H. pylori which demonstrates an adherence. (A) and (B) came from a Rhesus ϫ 8 affinity (Ka)of1 10 monkey with healthy gastric mucosa. (C)to(F) MϪ1.(C) Adherence of came from the same Rhesus monkey 9 months strain 17875 (sLex and after established reinfection with virulent clin- Leb-antigen binding) ical H. pylori isolates. Sections were analyzed and babA1A2 mutant with the sLex mAb (A) and (C) and by adher- to biopsy with inflam- ence in situ with the babA1A2 mutant (B) and mation and H. pylori in- (D). In the healthy animal, both the sLex mAb fection, as scored by staining and adherence of the babA1A2 mutant the number of bound is restricted to the deeper gastric glands [(A) bacteria after pretreat- and (B), arrows] [i.e., no mAb-staining of sLex ment with soluble Leb antigens and no babA1A2-mutant bacteria (Fig. 1, E and F) or sLex present in the surface epithelium (A) and (B), antigen (Fig. 1, H and I) arrowhead]. In contrast, in the H. pylori–in- (14). The Leb antigen fected and inflamed gastric mucosa, the sLex reduced adherence of antigen is heavily expressed in the surface ep- strain 17875 by Ͼ80%, ithelium [(C), arrowhead with brownish immu- whereas the sLex anti- nostaining], in addition to the deeper gastric gen abolished adher- glands [(C), arrow]. The up-regulated sLex an- ence of the babA1A2 tigen now supports massive colocalized adher- mutant. (D) Adherence ence of the babA1A2 mutant in situ [(D), ar- of strain 17875 and rowhead] in addition to the constant binding to babA1A2 mutant to biopsy of Leb mouse gastric mucosa was scored by the number of bound bacteria the deeper gastric glands [(B) and (D), arrow]. after pretreatment with sLex conjugate. Adherence by the babA1A2 mutant was abolished (Fig. 2A, vi), The established infection was visualized by while adherence by strain 17875 was unperturbed (Fig. 2A, v). (E) Adherence of spontaneous phase Genta stain, where the H. pylori microbes variant strain 17875/Leb (Leb-antigen binding only in Fig. 3A) and babA1A2 mutant was analyzed after were present in the surface epithelium [(E) pretreatment of histo-sections of human gastric mucosa with mAbs recognizing the Leb antigen or the and (F), arrowhead; (F) is at a higher magni- sdiLex antigen (FH6), with efficient inhibition of adherence of both strain 17875/Leb and the babA1A2 fication], while no microbes were detected in mutant, respectively. Value P Ͻ 0.001 (***), value P Ͻ 0.01 (**), value P Ͻ 0.05 (*). the deeper gastric glands [(E), arrow].

576 26 JULY 2002 VOL 297 SCIENCE www.sciencemag.org

Print & Media R ESEARCH A RTICLE found in the sLex-binding J99 strain, which selectin cell adhesion proteins that help lated carbohydrate used to signal infection puts this ORF in frame, and could thus ex- guide leukocyte migration and thus regu- and inflammation and to guide defense re- plain the ON bindings. These results further late strength of response to infection or sponses can be co-opted by H. pylori as a support the possibility for a flexible locus that injury (24). For complementary attach- receptor for intimate adherence. confers ON/OFF binding properties (23). ment, the neutrophils themselves also ex- High levels of sialylated glycoconjugates Dynamics of sialylation during health press sialylated Lewis glycans, and such are associated with severe gastric disease, and disease. Our analyses of H. pylori ad- neutrophil glycans allow binding and infec- including dysplasia and cancer (27, 28). Sia- herence provide insight into human re- tion by human granulocytic erlichiosis (25). lylated glycoconjugates were similarly abun- sponses to persistent infections, where gas- However, sialylated glycoconjugates are dant in parietal cell–deficient mice (22). sLex tritis and inflammation elicit appearance of low in healthy gastric mucosa but are ex- was also present in the gastric mucosa of sdiLex antigens and related sialylated car- pressed during gastritis. This sialylation transgenic Leb mice (Fig. 2A). Whether this bohydrates in the stomach mucosa, which was correlated with the capacity for SabA- reflects a previously unrecognized pathology cagϩ (virulent) H. pylori strains by adap- dependent, but not BabA-dependent, H. py- stemming from the abnormal (for mice) gas- tive mechanisms exploit as receptors in lori binding in situ. Our separate tests on tric synthesis of ␣1.3/4FT or Leb antigen, or concert with the higher affinity binding to Rhesus monkeys for experimental H. pylori from fucosylation of already sialylated car- Leb. These two adherence modes may each infection confirmed that gastric epithelial bohydrates, is not known. benefit H. pylori by improving access to sialylation is induced by H. pylori infec- Persons with blood group O and “nonsecre- nutrients leached from damaged host tis- tion. In accord with this, high levels of tor” phenotypes (lacking the ABO blood sues, even while increasing the risk of bac- sialylated glycoconjugates have been found group–antigen synthesis in secretions such as tericidal damage by these same host defens- in H. pylori–infected persons, which de- saliva and milk) are relatively common (e.g., es (Fig. 6). In the endothelial lining, sialy- creased after eradication of infection and ϳ45 and ϳ15%, respectively, in Europe), and lated Lewis-glycans serve as receptors for resolution of gastritis (26). Thus, a sialy- each group is at increased risk for peptic ulcer disease (29). The H1 and Leb antigens are abundant in the gastric mucosa of secretors (of Fig. 5. Retagging of SabA and identifi- blood group O) (6), but not in nonsecretors, cation of the corresponding gene, sabA. where instead the sLex and sLea antigens are After contact-dependent retagging (of the babA1A2 mutant) with crosslinker found (30). The blood group O–disease asso- labeled sLex conjugate, the 66-kDa bi- ciation was postulated to reflect the adherence otin-tagged adhesin SabA [(A), lane 1] of most cagϩ H. pylori strains to H1 and Leb was identified by SDS–polyacrylamide antigens (3). We now suggest that H. pylori gel electrophoresis/steptavidin-blot, adherence to sialylated glycoconjugates con- magnetic-bead-purified, and analyzed tributes similarly to the increased risk of peptic by MS for peptide masses (14). As a control, the Leb conjugate was used to ulcer disease in nonsecretor individuals. retag 17875 bacteria, which visualized Adaptive and multistep–mediated at- the 75-kDa BabA adhesin [(A), lane 2] tachment modes of H. pylori. Our findings (4). (B) The J99/JHP662::cam (sabA) that the SabA adhesin mediates binding to the mutant does not bind the sLex antigen structurally related sialyl-Lewis a antigen but adheres to human gastric epitheli- (sLea, in table S1) is noteworthy because um [(B), i], due to the BabA-adhesin, because pretreatment with soluble Leb sLea is an established tumor antigen (31)and antigen inhibited binding to the epithe- marker of gastric dysplasia (27), which may lium [(B), ii]. (C) The J99 wild-type further illustrate H. pylori capacity to exploit strain (which binds both Leb and sLex a full range of host responses to epithelial antigens) [(C), i] and the J99 sabA mu- damage. The H. pylori BabA adhesin binds tant (which binds Leb antigen only) [(C), Leb antigen on glycoproteins (32), whereas ii] both exhibit strong adherence to the gastric mucosa. In comparison, the J99 its SabA adhesin binds sLex antigen in mem- babA mutant binds by lower-affinity interactions [(C), iii], while the J99 sabAbabA mutant, which brane glycolipids, which may protrude less is devoid of both adherence properties, does not bind to the gastric mucosa [(C), iv]. from the cell surface. Thus, H. pylori adher-

Fig. 6. H. pylori adherence in health and disease. This figure illus- trates the proficiency of H. pylori for adaptive multistep mediated attachment. (A) H. pylori (in green) adherence is mediated by the Leb blood group antigen expressed in glycoproteins (blue chains) in the gastric surface attachment and apposition. (C) At sites of vigorous local inflamma- epithelium (the lower surface) (3, 32). H. pylori uses BabA (green Y’s) for tory response, as illustrated by the recruited activated white blood strong and specific recognition of the Leb antigen (4). Most of the sLex- cell (orange “bleb”), those H. pylori subclones that have lost sLex- binding isolates also bind the Leb antigen (SabA, in red Y’s). (B) During binding capacity due to ON/OFF frameshift mutation might have persistent infection and chronic inflammation (gastritis), H. pylori triggers gained local advantage in the prepared escaping of intimate contact the host tissue to retailor the gastric mucosal glycosylation patterns to with (sialylated) lymphocytes or other defensive cells. Such adapta- up-regulate the inflammation-associated sLex antigens (red host, triangles). tion of bacterial adherence properties and subsequent inflammation Then, SabA (red Y structures) performs Selectin-mimicry by binding pressure could be major contributors to the extraordinary chronicity the sialyl-(di)-Lewis x/a glycosphingolipids, for membrane close of H. pylori infection in human gastric mucosa.

www.sciencemag.org SCIENCE VOL 297 26 JULY 2002 577

Print & Media R ESEARCH A RTICLE

ence during chronic infection might involve 8. K. A. Karlsson, Mol. Microbiol. 29, 1 (1998). 31. J. L. Magnani et al., Science 212, 55 (1981). two separate receptor-ligand, interactions—one 9. S. Censini et al., Proc. Natl. Acad. Sci. U.S.A. 93, 14648 32. P. Falk et al., Proc. Natl. Acad. Sci. U.S.A. 90, 2035 (1996). (1993). at “arm’s length” mediated by Leb, and anoth- 10. N. S. Akopyants et al., Mol. Microbiol. 28, 37 (1998). 33. We thank R. Clouse, H.M.T. El-Zimaity, D. Graham, and I. er, more intimate, weaker, and sLex-mediated 11. E. D. Segal et al., Proc. Natl. Acad. Sci. U.S.A. 96, Anan for human biopsy material; J. Gordon and P. Falk adherence. The weakness of the sLex-mediated 14559 (1999). for sections of Leb and FVB/N mouse stomach; L. Eng- 12. M. Gerhard et al., Proc. Natl. Acad. Sci. U.S.A. 96, strand and A. Covacci for H. pylori strains; H. Clausen for adherence, and its metastable ON/OFF switch- 12778 (1999). the FH6 mAb; the Swedish NMR Centre, Go¨teborg Uni- ing, may benefit H. pylori by allowing escape 13. J. L. Guruge et al., Proc. Natl. Acad. Sci. U.S.A. 95, versity; P. Martin and O¨ . Furberg for digital art/movie from sites where bactericidal host defense re- 3925 (1998). work; and J. Carlsson for critical reading of the manu- sponses are most vigorous (Fig. 6C). In sum- 14. Strains and culture, adherence in situ (AIS), H. pylori script. Supported by the Umeå University Biotechnology overlay to TLC, isolation and identification of the Fund, Swedish Society of Medicine/Bengt Ihre’s Fund, mary, we found that H. pylori infection elicits s-di-Lex GSL, apical localization of sLex antigen ex- Swedish Society for Medical Research, Lion’s Cancer gastric mucosal sialylation as part of the chron- pression (fig. S2), retagging and identification of Research Foundation at Umeå University, County Coun- ic inflammatory response and that many viru- SabA/sabA, alignment of JHP662/JHP659 (fig. S1), cil of Va¨sterbotten, Neose Glycoscience Research Award Grant ( T.B.), Swedish Medical Research Council [11218 lent strains can exploit Selectin mimicry and construction of adhesin gene mutants, analyses of sabA by PCR, RIA and Scatchard analyses, gastric ( T.B.), 12628 (S.T.), 3967 and 10435 (K.-A.K.), 05975 thus “home in” on inflammation-activated do- biopsies from patients and monkeys analyzed for H. (L.H.), and 04723 ( T.W.)], Swedish Cancer Society mains of sialylated epithelium, complementing pylori binding activity and inflammation, and a sum- [4101-B00-03XAB ( T.B.) and 4128-B99-02XAB (S.T.)], SSF programs “Glycoconjugates in Biological Systems” the baseline level of Leb receptors. The spec- mary of H. pylori binding to glycosphingolipids (table S1) are available as supporting online material. ( T.B., S.T., and K.-A.K.), and “Infection and Vaccinology” trum of H. pylori adhesin–receptor interactions 15. P. G. Falk et al., Proc. Natl. Acad. Sci. U.S.A. 92, 1515 ( T.B. and K.-A.K.), J. C. Kempe Memorial Foundation is complex and can be viewed as adaptive, (1995). (J. M., L. F., and M.H.), Wallenberg Foundation (S.T. and K.-A.K), Lundberg Foundation (K.-A.K.), ALF grant from contributing to the extraordinary chronicity of 16. G. Scatchard, Ann. N.Y. Acad. Sci. 51, 660 (1949). 17. R. A. Alm et al., Nature 397, 176 (1999). Lund University Hospital (T.W.), and grants from the H. pylori infection in billions of people world- 18. J. F. Tomb et al., Nature 388, 539 (1997). NIH [RO1 AI38166, RO3 AI49161, RO1 DK53727 (D.B.)] wide, despite human genetic diversity and host 19. S. i. Hakomori, in Gangliosides and Cancer,H.F. and from Washington University (P30 DK52574). These defenses. Oettgen, Ed. (VCH Publishers, New York, 1989), pp. experiments were conducted according to the principles 58–68. in the “Guide for the Care and Use of Laboratory Ani- 20. J. F. Madrid et al., Histochemistry 95, 179 (1990). mals,” Institute of Laboratory Animal Resources, NRC, References and Notes 21. A. Dubois et al., Gastroenterology 116, 90 (1999). HHS/NIH Pub. No. 85–23. The opinions and assertions 1. T. L. Cover et al.,inPrinciples of Bacterial Pathogen- 22. A. J. Syder et al., Mol. Cell 3, 263 (1999). herein are private ones of the authors and are not to be esis, E. A. Groisman, Ed. (Academic Press, New York, 23. A. Arnqvist et al., in preparation. construed as official or reflecting the views of the DOD, 2001), pp. 509–558. 24. J. Alper, Science 291, 2338 (2001). the Uniformed Services University of the Health Scienc- es, or the Defense Nuclear Agency. 2. M. Gerhard et al., in Helicobacter pylori: Molecular and 25. M. J. Herron et al., Science 288, 1653 (2000). Cellular Biology, S. Suerbaum and M. Achtman, Eds. 26. H. Ota et al., Virchows Arch. 433, 419 (1998). Supporting Online Material (Horizon Scientific Press, Norfolk, UK, 2001), chap. 12. 27. P. Sipponen, J. Lindgren, Acta Pathol. Microbiol. Im- www.sciencemag.org/cgi/content/full/297/5581/573/DC1 3. T. Boreń et al., Science 262, 1892 (1993). munol. Scand. 94, 305 (1986). Materials and Methods et al Science 279 4. D. Ilver ., , 373 (1998). 28. M. Amado et al., Gastroenterology 114, 462 (1998). Figs. S1 and S2 5. M. Hurtig, T. Boreń, in preparation. 29. P. Sipponen et al., Scand. J. Gastroenterol. 24, 581 Tables S1 and S2 6. H. Clausen, S. i. Hakomori, Vox Sang 56, 1 (1989). (1989). 7. T. Boreń, P. Falk, Science 264, 1387 (1994). 30. J. Sakamoto et al., Cancer Res. 49, 745 (1989). 17 December 2001; accepted 17 June 2002

R EPORTS

An Aligned Stream of that a quantity used to characterize variable stars falls into two rather well-defined class- Low-Metallicity Clusters in the es. Moreover, the two groups are known to differ in metal abundance (3) and kinematic Halo of the Milky Way properties (4), which may indicate distinct origins. Whatever the reasons for the dichot- Suk-Jin Yoon* and Young-Wook Lee omy, the question of whether the two groups originated under fundamentally different con- One of the long-standing problems in modern astronomy is the curious division ditions is of considerable interest regarding of Galactic globular clusters, the “Oosterhoff dichotomy,” according to the the formation scenarios of the Galactic halo. properties of their RR Lyrae stars. Here, we ﬁnd that most of the lowest Despite many efforts during the last decades, metallicity ([Fe/H] Ͻ –2.0) clusters, which are essential to an understanding of the origin of this phenomenon still lacks a this phenomenon, display a planar alignment in the outer halo. This alignment, convincing explanation. combined with evidence from kinematics and stellar population, indicates a Figure 1 shows the Oosterhoff dichotomy. captured origin from a satellite galaxy. We show that, together with the Clusters belong to groups I and II if their ͗ ͘ horizontal-branch evolutionary effect, the factor producing the dichotomy values of Pab fall near 0.55 and 0.65 days, could be a small time gap between the cluster-formation epochs in the Milky respectively (5). Group I is more metal-rich Way and the satellite. The results oppose the traditional view that the metal- than group II (3). Based on our horizontal- poorest clusters represent the indigenous and oldest population of the Galaxy. branch (HB) population models (6, 7), we have found that the presence of the relatively More than 60 years ago, Oosterhoff (1)dis- to the mean period of type ab RR Lyrae metal-rich (–1.9 Ͻ [Fe/H] Ͻ –1.6) clusters in ͗ ͘ covered that Galactic globular clusters could variables ( Pab ). This dichotomy was one of group II (hereafter group II-a) can be under- ͗ ͘ be divided into two distinct groups according the earliest indications of systematic differ- stood by the sudden increase in Pab at ence among globular clusters, whose reality [Fe/H] Ϸ –1.6 (indicated by a blue line in Center for Space Astrophysics, Yonsei University, has been strengthened by subsequent investi- Fig. 1). As [Fe/H] decreases, HB stars get Seoul 120–749, Korea. gations (2). Given that most characteristics of hotter (i.e., the HB morphology gets bluer), *To whom correspondence should be addressed. E- Galactic globular clusters appear to be dis- and there is a certain point at which the mail: [email protected] tributed in a continuous way, it is unusual zero-age portion of the HB just crosses the

578 26 JULY 2002 VOL 297 SCIENCE www.sciencemag.org

Print & Media Role of Helicobacter pylori SabA Adhesin During Persistent Infection and Chronic Inflammation

Jafar Mahdavi, Berit Sondén, Marina Hurtig, Farzad O. Olfat, Lina Forsberg, Niamh Roche, Jonas Ångström, Thomas Larsson, Susann Teneberg, Karl- Anders Karlsson, Siiri Altraja, Torkel Wadström, Dangeruta Kersulyte, Douglas E. Berg, Andre Dubois, Christoffer Petersson, Karl-Eric Magnusson, Thomas Norberg, Frank Lindh, Bertil B. Lundskog, Anna Arnqvist, Lennart Hammarström, Thomas Borén

Supplementary material

MATERIALS AND METHODS

Supplemental Methods 1. For Adherence In Situ (AIS) (S1), biopsies were obtained from Drs. Ray Clouse, Washington University Medical Center, St. Louis, David Graham, VA Medical Center, Houston, and Intissar Anan, Umeå University. Gastric tissue sections from Leb mice and FVB/N mice were from Drs. Jeff Gordon and Per Falk, Washington University. To inhibit AIS (S1) H. pylori was labeled with FITC and mixed with Leb conjugate (10 µg/mL) or sialyl-Le x/a-conjugates (20 µg/mL) (IsoSep AB, Tullinge, Sweden). Alternatively, histo sections were pre-treated with the Leb mAb or the FH6 mAb (which recognizes the sdiLex antigen), at 1:100 dilution for 3 h. Reduction in bacterial binding was estimated by the number of adherent bacteria under 200X magnification. Each value is the mean +- SEM of 10 different fields, with significance evaluated with the Student's t-Test.

______

Supplemental Methods 2. H. pylori strains 26695, CCUG17875 (designated 17875), the construction of the 17875babA2::cam-mutant, and the G27cagPAI- deletion mutant, were described in (S2). The construction of 17875babA1::kan babA2::cam (abbreviated the babA1A2-mutant), sabA(JHP662)::cam and the sabB(JHP659)::cam mutants were as described in (S2) with minor modifications (see Supplemental Methods 3). J99 was kindly provided by Drs. Tim Cover, John Atherton and Martin Blaser. The 77 cag+ and 12 cag- Swedish isolates, including SMI65, were kindly provided by Dr. Lars Engstrand, and 6 Italian cagA- strains were described in (S2). Strain WU12 was from a patient with gastritis (Fig 1A-M), treated at Washington University Medical Center, St.

Print & Media Louis. Strain J166 was described in (S3). The 17875/Leb strain, a spontaneous sLex- variant was isolated by screening single colonies of strain 17875. Bacteria were grown for 2 days on Brucella agar medium at 37°C, under 10 % CO2 and 5% O2, for optimal binding.

______

Supplemental Methods 3. Construction of babA1A2-, sabA-, sabB-, and babA/sabA-deletion mutants. The 17875babA1::kan babA2::cam, J99sabA(JHP662)::cam, J99sabB(JHP659)::cam, and the J99babA::cam sabA::kan-mutant strains were constructed as described in (S2), with the following modifications;

(3A) Strain CCUG17875 was used for construction of 17875babA1::kan babA2::cam (abbreviated the babA1A2-mutant). The babA1 gene was amplified using the F44 (forward) and R44 (reverse) primers, cloned into the pBluescript SK+/- EcoRV site (Stratagene, La Jolla CA), linearized with primers R41+F38, ligated with the KanR cassette from pILL600 (S4), and used to transform the original 17875babA2::cam mutant (S2). The transformants were analyzed by PCR using upstream primers F2 (babA2)orF44(babA1)in combination with the R11 babA primer (located in the segment replaced by the KanR cassette). The 17875babA1::kan babA2::cam (double)-mutant (abbreviated the babA1A2-mutant) could not be amplified with either primer pair.

F2: CTTAAATATCTCCCTATCCC R41: GCGAGCCTAAAGTTAATGA F38: ACGTGGCGAACTTCCAATTC F44: CAGTCAAGCCCAAAGCTATGC R11: CGATTTGATAGCCTACGCTTGTG R44: CTTAAAGGGATAGGAAGCGCT

(3B) Strain J99 was used for construction of the sabA(JHP662)::cam and the sabB(JHP659)::cam mutants. SabA was PCR-amplified using the primers F18 and R17 and cloned in pBluescript SK+/- EcoRV site. The plasmid clone was linearized with R20 and F21 and ligated with the camR gene, described in (S2). SabB was amplified using primers F16 and R15, and cloned in pCR2.1- TOPO vector (Invitrogen, Carlsbad, CA), linearized with HincII and ligated with the camR gene. H. pylori transformants were analyzed for binding to 125I- labeled sLex conjugate. The location of the camR gene in sabA and sabB was analyzed using primers R17+F18 and F16+R15, respectively, which verified

Print & Media that loss of binding was dependent on the cam-insertion and independent of spontaneous OFF-(phase)-variation in sLex binding.

R15: CTATTCATGTTTACAATA F16: GGGTTTGTTGTCGCACCACTAG R17: GGTTCATTGTAAATATAT F18: CGATTCTATTAGATCACCC R20: AGCGTTCAATAACCCTTACAGCG F21: GATTTAAATACTGGCTTAATTGCTCG BS22: CGCTTAAAGCATTGTTGACAGCC

(3C) Strain J99 was used for construction of the J99babA::cam sabA::kan- (double)-mutant. For the construction of the babAsabA-mutant strain, sabA was first cloned in the pBluescript vector and linearized as described above, and then ligated with the KanR cassette (see above). For the construction of the J99babA and babAsabA-double mutants the J99 and J99sabA::kan strains were transformed with the babA deletion vector described in (S2). The transformants were analyzed by PCR using primers F33 + R34. The correct J99babA::cam and the J99babA::cam sabA::kan-(double)-mutant could not be amplified with the primer pair. F33: ATCCTTTCATTAACTTTAGGATCGC R34: TTGAGCGCTATCAGGCACAC

______

Supplemental Methods 4. Retagging (of SabA) and Identification of sabA, the Gene which Corresponds to the Sialic acid binding Adhesin, SabA. For identification and purification of the SabA-adhesin, the Retagging technique was used, i.e., similar to the identification of the Leb antigen binding BabA-adhesin (S2), with some modifications. Here, the babA1A2-mutant was incubated with Sulfo-SBED (Pierce, Rockville, IL.) attached to sLex-conjugate. The crosslinker was activated by overnight UV irradiation, and biotin- (Re)tagged proteins were purified with magnetic streptavidin beads. The 66kDa band purified was digested with Trypsin (seq grade, Promega, USA) and four purified peptides were identified by mass spectrometry based on peptide masses and sequences. MALDI-TOF-MS on a Tof-Spec E mass spectrometer (Micromass, Manchester, England) (S5), and ProFound (www.proteometrics.com) was used for matching of the four peptide masses using NCBI database. Peptides 1 and 2 (see below) match the JHP662 (S6)/HP0725 (S7) gene. Peptides 3 and 4 also matched the JHP659 (S6)/HP0722) (S7) gene. Peptide identities were validated by ESI-MS/MS sequencing on a Q-Tof instrument (Micromass), using the nanospray source (S8).

Print & Media Mascot (www.matrixscience.com) identified the peptide sequences (numbered according to the JHP662 peptide sequence: (1)aa68-QSIQNANNIELVNSSLNYLK-aa87 (2)aa301-DIYAFAQNQK-aa310 (3)aa500-YYGFFDYNHGYIK-aa512 (4)aa620-IPTINTNYYSFLGTK-aa634

______

Supplemental Methods 5. Presence of the sabA gene. The presence of sabA in clinical H. pylori isolates was analyzed by PCR using primer pairs F1 + 5R, and 3F + 1R. 1F: CTCTAGCAATGTGTGGCAG 3F: CGCTAGTGTCCAGGGTAAC 1R: GCGCTGTAAGGGTTATTGAAC 5R: CCGCGTATTGCGTTGGGTAG

______

Supplemental Methods 6. H. pylori overlay to HPTLC separated glycosphingolipids (GSLs). Mixtures of GSLs (20-40 µg/lane) or pure compounds (0.002-4 µg/lane) were separated on silica gel 60 HPTLC plates (Merck) and chemically detected with anisaldehyde. Binding of 35S-labeled H. pylori to TLC separated GSLs was according to (S9). The KM-93 mAb (Seikagaku Corp., Tokyo, Japan) was detected using 125I -rabbit anti mouse antibodies from Dako, Glostrup, Denmark.

______

Supplemental Methods 7. Isolation and identification of the sdiLex GSL The babA1A2-mutant strain was used to purify a high affinity GSL with receptor activity from human gall bladder adenocarcinoma tissue, which is a rich source of extended a1,3-fucosylated gangliosides (S10), by chromatography on silicic acid columns, as described (S11). Fractions were tested for babA1A2- mutant binding. Desialylation was performed by mild acid hydrolysis in 1% (v/v) acetic acid for 1 hr at 100°C. Negative ion FAB mass spectra were recorded on a JEOL SX-102A mass spectrometer (JEOL, Tokyo, Japan). The ions were produced by 6 keV xenon atom bombardment, using triethanolamine as matrix and an accelerating voltage of -10 kV. 1H NMR spectra were obtained on a Varian 600 MHz machine at 30°C using dimethylsulfoxide-d6/D2O (98/2) as solvent. The NMR spectrum was compared with earlier published data for

Print & Media this structure recorded at 55°C (S12) and corresponding structural elements of the Y-6 glycosphingolipid recorded at 30°C (S13). The H. pylori binding GSL was then identified by negative ion FAB mass spectrometry and 1H NMR as NeuAca2.3Galß1.4(Fuca1.3)GlcNAcß1.3Galß1.4(Fuca1.3)GlcNAcß1.3Galß1. 4Glcß1Cer (Figs. 2B: lane 6, and 2C) (i.e., the sialyl-dimeric-Lewis x glycosphingolipid), abbreviated sdiLex.

______

Supplemental Methods 8. RIA and Scatchard analyzes SLea, sLex, and Leb glycoconjugates (IsoSep AB), and sdiLex- glycoconjugate synthesized according to (S14), (all based on albumin), were labeled with 125I by the chloramine T method and mixed with H. pylori bacteria for binding and Scatchard analyzes (S15), essentially as described in (S2). The binding experiments were performed in triplicates.

______

Supplemental Methods 9. Gastric biopsies analyzed for H. pylori binding activity and inflammatory scores Gastric biopsies from 29 individuals without dysplasia were H/E-stained and evaluated for lymphocyte/ plasmacell infiltration. PMN cell infiltration was evaluated from rare PMNs only found in the lamina propria, up to pit abscesses. SLex antigen expression was analyzed by the KM-93 mAb in the surface mucous cells/gastric pit region. Histological gastritis was also graded. H. pylori was Genta-stained and quantified. AIS was scored by the number of bacteria/gastric pit region. Each value is the mean of 5 different fields. All scores are available in Table S2A. Adherence scores were correlated with infiltration scores of lymphocytes/plasmacells, PMNs, staining scores by sLex mAb, gastritis and also H. pylori infections, and statistically analyzed according to Pearson.

______

Supplemental Methods 10. Gastric biopsies of monkey E6C were taken 6 months post-cure (for Figs. 4A and 4B). Final biopsy samples from E6C were taken 9 months after established re-infection (Figs. 4C-4F) (S3). Biopsies were stained with the KM-93 mAb, and AIS by the babA1A2-mutant was analyzed as described in Supplemental Methods 1.

Print & Media Supplemental Figure 1. Alignment of JHP662/ JHP659,

10 20 30 40 50 60 ....|.. ..|.. ..|.. ..|.. ..|.. ..|... .|... .|... .|... .|... .|... .| JHP662 MKKTI LLSLS LSLAS SLLHA EDNGF FVSAGY QIGEA VQMVK NTGEL KNLNE KYEQL SQYL JHP659_ MKKTI LLSLS LSLAS SLLHA EDNGF FVSAGY QIGEA VQMVK NTGEL KNLND KYEQL SQSL

70 80 90 100 110 120 ....|.. ..|.. ..|.. ..|.. ..|.. ..|... .|....|... .|... .|... .|... .| JHP662 NQVAS LKQSIQNAN NIELV NSSLN YLKSFTNNNY NSTTQ SPIFN AVQAV ITSVL GFWSLY JHP659_ AQLAS LKKSI QTANN IQAVN NALSD LKSFAS NNHTN KETSP IYNTA QAVIT SVLAF WSLY

130 140 150 160 170 180 ....|.. ..|.. ..|.. ..|.. ..|.. ..|... .|... .|... .|... .|... .|... .| JHP662 AGNYL TFFVV NKDTQ KPASV QGNPP FSTIVQ --NCS GIENC AMNQT TYDKM KKLAE DLQA JHP659_ AGNAL SFH-V ---TG LN-D- GSNSP LGRIHR DGNCT GLQQC FMSKE TYDKM KTLAE NLQK

190 200 210 220 230 240 ....|.. ..|.. ..|.. ..|.. ..|.. ..|... .|... .|... .|... .|... .|... .| JHP662 AQQNA TTKAN NLCAL SGCAT TQGQN PSSTVS NALNL AQQLM DLIAN TKTAM MWKNI VIAG JHP659_ A-Q------G NLCAL SECSS NQSNG GKTSMT TALQT AQQLM DLIEQ TKVSM VWKNI VIAG

250 260 270 280 290 300 ....|.. ..|.. ..|.. ..|.. ..|.. ..|... .|... .|... .|... .|... .|... .| JHP662 VSN-V --SGA IDSTG YPTQY AVFNN IKAMIP ILQQA VTLSQ SNHTL SASLQ AQATG SQTN JHP659_ VTNKP NGAGA ITSTG HVTDY AVFNN IKAMLP ILQQA LTLSQ SNHTL STQLQ ARAMG SQTN

310 320 330 340 350 360 ....|.. ..|.. ..|.. ..|.. ..|.. ..|... .|... .|... .|... .|... .|... .| JHP662 PKFAK DIYAFAQ NQKQVISYAQ DIFNL FSSIP KDQYRYLEKA YLKIPN AGKTP TNPYR QE JHP659_ REFAK DIYAL AQNQK QILSN ASSIF NLFNSI PKDQL KYLEN AYLKV PHLGK TPTNP YRQN

370 380 390 400 410 420 ....|.. ..|.. ..|.. ..|.. ..|.. ..|... .|... .|... .|... .|... .|... .| JHP662 VNLNQ EIQTI QNNVS YYGNR VDAAL SVAKDV YNLKS NQTEI VTTYN NAKNL SQEIS KLPY JHP659_ VNLNK EINAV QDNVA NYGNR LDSAL SVAKDV YNLKS NQTEI VTTYN DAKNL SEEIS KLPY

430 440 450 460 470 480 ....|.. ..|.. ..|.. ..|.. ..|.. ..|... .|... .|... .|... .|... .|... .| JHP662 NQVNT KDIIT LPYDQ NAPAA GQYNY QINPEQ QSNLS QALAA MSNNP FKKVG MISSQ NNNG JHP659_ NQVNV TNIVM SPKD- -S-TA GQ--Y QINPEQ QSNLN QALAA MSNNP FKKVG MISSQ NNNG

490 500 510 520 530 540 ....|.. ..|.. ..|.. ..|.. ..|.. ..|... .|... .|... .|... .|... .|... .| JHP662 ALNGL GVQVG YKQFF GESKR WGLR YYGFFDY NHGYI KSSFFNSS SDIWT YGGGS DLLVN F JHP659_ ALNGL GVQVG YKQFF GESKR WGLR YYGFFDY NHGYI KSSFFNSS SDIWT YGGGS DLLVN F

550 560 570 580 590 600 ....|.. ..|.. ..|.. ..|.. ..|.. ..|... .|... .|... .|... .|... .|... .| JHP662 INDSI TRKNN KLSVG LFGGI QLAGT TWLNSQ YMNLT AFNNP YSAKV NASNF QFLFN LGLR JHP659_ INDSI TRKNN KLSVG LFGGI QLAGT TWLNSQ YMNLT AFNNP YSAKV NASNF QFLFN LGLR

610 620 630 640 650 ....|.. ..|.. ..|.. ..|.. ..|.. ..|... .|... .|... .|... .|... .|. JHP662 TNLAT AKKKD SERSA QHGVE LGIK IPTINTN YYSFL GTKLE YRRLY SVYLNYVFAY JHP659_ TNLAT AKKKD SERSA QHGVE LGIK IPTINTN YYSFL GTKLE YRRLY SVYLNYVFAY

All four peptides were aligned with the JHP662 gene (4 peptide match), while only (2 (red) peptides matched) the JHP659 gene. Thus, the results suggest that sabA correspond to the JHP662 gene (S6)/ HP0725 (S7) gene. ______

Print & Media Supplemental Figure 2. Apical localization of epithelial sLex antigens in inflamed gastric epithelium

Sialylated glycoconjugates, such as sLex are rare in healthy human stomachs, but sialylation is upregulated during chronic inflammation and gastritis. The cellular (topical) localization of the sialylated antigens was investigated using a sLex specifik mAb. In the figure (400x magn.), the sLex antigen is visualized in dark staining lining the apical surfaces (single arrows). In contrast, the clue of nucleus (which is located towards the basolateral side of the cells) stained with Mayer´s hematoxylin (double arrow). The results suggest that the sLex-antigen is expressed at the apical surfaces of the epithelial cells, in response to H. pylori adherence and stimuli. For immunohistochemistry, sections (5 mm) of inflamed gastric mucosa were stained with the sLex specific mAb ((KM-93), Seikagaku Corp., Tokyo, Japan), in 1:10 dilution, and the immuno reactivity was assessed using the Vectastain Elite Kit/DAB (Vector Laboratories, NY). After counterstaining in Mayer´s hematoxyline, the sections were examined with Zeiss Axioscope and color video camera (ZVS-47E, Carl Zeiss Inc.). ______

Print & Media Calf brain Calf brain Human gall bladder carcinoma Human gall bladder carcinoma Human small intestine Synthetic from Symbicom Ltd. Calf brain Calf brain ) 3 + - - denotes a significant darkening on the autoradiogram when 1 pmol of +3 1 2 Source - -- +3 -- -- -( -+ -- – denotes no darkening even at 2 nmol. a1 3 binding to glycosphingolipids Fuc 3 mutant strain. Binding is defined as follows: a2 ) an occasional darkening at 2 nmol; while (+ NeuAc babA1A2 3 4 3 a2 1 a1 a1 3 a 4 Fuc a1 Fuc Fuc Fuc a8NeuAc 3 a3Galb3GalNAcb4Galb4Glcb1Cer a3Galb3GlcNAcb3Galb4Glcb1Cer a3Galb4GlcNAcb3Galb4Glcb1Cer a3Galb4Glcb1Cer a3Galb4GlcNAcb3Galb4GlcNAcb3Galb4Glcb1Cer a2 Helicobacter pylori a2Galb3GlcNAcb3Galb4Glcb1Cer NeuAc NeuAc Galb3GalNAcb4Galb4Glcb1Cer Galb3GalNAcb4Galb4Glcb1Cer Fuc NeuAc NeuAc NeuAc NeuAc NeuAc Sequence . Binding obtained with the + denotes a darkening at 2 nmol; 2 Lewis b GM3 GD1a GD1b Sialyl-Lewis a Sialyl-Lewis x Sialyl-di-Lewis x GM1 . Binding obtained with strain CCUG17875 Supplemental Table 1. Summary of No.1. Name 2. 4. 5. 6. 7. 8. 1 substance was applied on the thin-layer plate; 3.

Print & Media Supplemental Table 2A. Gastric biopsies from 29 patients were scored for binding by the babA1A2-mutant and the parental strain 17875 in situ, and for several markers of inflammation.

Biopsy sample 17875-binding babA1A2-binding Lymphocyte (1) PMN cell (2) IH-total IH-gastric pit H. pylori Hist. gastritis TB 21 5(687) 1(16) 0 0 1 1 0 0,5 TB 16 4(459) 1(14) 0 0 1 1 0 0,5 TB 15 1(38) 0(0) 0 0 1 101 TB 14 5(712) 1(15) 0 1 3 2 0 0,5 TB 12 3(289) 4(48) 2 2 5 533 TB 9 5(633) 1(17) 1 1 1 100 HS+B+A 1(38) 0(0) 1 0 1 1 0 0,5 16519 A3 5(573) 1(13) 2 3 3 212 14167 A4 5(529) 1(15) 2 1 3 412 14814 A3 5(667) 1(13) 3 2 1 123 15393 A3 4(381) 4(51) 3 2 2 313 8900 A2 5(793) 1(16) 1 1 2 221 8956 A2 5(605) 2(23) 1 2 1 1 0,5 1 9220 A4 5(593) 2(19) 2 3 4 312 12486 A4 5(558) 0(0) 1 1 4 312 15143 A3 2(111) 2(21) 2 2 5 512 15606 A4 5(629) 3(33) 1 1 3 403 15981 A3 5(803) 0(0) 2 2 3 423 16849 A4 5(587) 1(13) 2 5 4 212 17961 A3 5(839) 3(37) 3 3 4 412 15754 A5 3(223) 3(29) 2 5 5 5 0,5 2 15754 B5 4(439) 4(43) 1 3 5 5 0,5 1 15187 A5 5(750) 3(38) 3 5 4 312 15187 B6 5(713) 1(14) 1 3 4 311 14690 B5 1(39) 4(51) 3 5 4 313 14322 A4 3(267) 1(15) 2 5 3 332 14322 B4 4(419) 3(28) 2 5 4 221 14238 A3 1(38) 4(47) 2 5 5 413 14238 B6 1(41) 3(38) 1 2 5 411

Supplemental Table 2B. Gastric biopsies from 6 H. pylori non-infected individuals were scored for binding in situ by the babA1A2-mutant and the parental strain 17875.

Biopsy sample 17875-binding babA1A2-binding H. pylori infection No. 61 3(160) 1(12) 0 No. 62 4(485) 1(10) 0 No. 70 2(68) 0(7) 0 No. 64 4(463) 0(8) 0 D6 5(513) 0(8) 0 F73 2(96) 0(4) 0

Print & Media Grading scale used for Tables 2A and 2B

CCUG17875-binding Grading scale from 0 to 5, based on number of bacterial cells/gastric pit Grade 0 = no bacteria, Grade 1 = 1-50 bacteria, Grade 2 = 50-150 bacteria Grade 3 = 150-350 bacteria, Grade 4 = 350-500 bacteria, Grade 5 ≥500 bacteria

babA1A2-mutant binding Grading scale from 0 to 5, based on number of bacterial cells/ gastric pit Grade 0 = no bacteria, Grade 1 = 10-15 bacteria, Grade 2 = 15-25 bacteria Grade 3 = 25-40 bacteria, Grade 4 = 40-55 bacteria, Grade 5 ≥ 55 bacteria

Lymphocyte infiltration (1) Grading scale from 0 to 3, based on both lymphocyte and plasmacell infiltration Grade 0= normal, Grade 1 = low inflammation, Grade 2 = moderate inflammation, Grade 3 = heavy inflammation

PMN cell infiltration (2) Grading scale from 0 to 5 Grade 0 = none, Grade 1 = rare PMN, only in lamina propria (LP), Grade 2 ≤ 1 intraepithelial (IE) PMN/high power field (hpf), i.e. 400X magnification, Grade 3 = 1-10 IE/hpf, Grade 4 ≥ 10 IE/hpf, Grade 5 = pit abscess

Immunohisto-staining by anti-sLex-mAb (IH) Grading scale from 0 to 5 IH-total: IH-staining of whole tissue section IH-gastric pit: IH-staining of gastric pit region

H. pylori in surface epithelium (Genta-stained) 0.5 very few; 1 good colonization; 2 very good colonization; 3; heavy colonization

Histological gastritis 0.5-1 minimal; 2 superficial; 3: intense

______

Print & Media References and Notes 1. T. Borén, P. Falk, K. A. Roth, G. Larson, S. Normark, Science 262, 1892 (1993). 2. D. Ilver et al., Science 279, 373 (1998). 3. A. Dubois et al., Gastroenterology 116, 90 (1999). 4. S. Suerbaum, C. Josenhans, A. Labigne, J. Bacteriol. 175, 3278 (1993). 5. T. Larsson, J. Bergström, C. Nilsson, K. A. Karlsson, FEBS Letters 469, 155 (2000). 6. R. A. Alm et al., Nature 397, 176 (1999). 7. J. F. Tomb et al., Nature 388, 539 (1997). 8. O. Nørregaard-Jensen, M. Wilm, A. Shevchenko, M. Mann, in Methods in Molecular Biology, A. J. Link, Ed. (Humana Press, 1999), pp. 571-588. 9. J. Ångström et al., Glycobiology 8, 297 (1998) 10. S. i. Hakomori, Adv. Cancer Res. 52, 257 (1989). 11. K. A. Karlsson. Methods Enzymol. 138, 212 (1987). 12. S. B. Levery, E. D. Nudelman, N. H. Andersen, S. i. Hakomori, Carbohydr. Res. 151, 311 (1986). 13. M. Blaszczyk-Thurin et al., J. Biol. Chem. 262, 372 (1987). 14. M. Bårström, M. Bengtsson, O. Blixt, T. Norberg, Carbohydr. Res. 328, 525 (2000). 15. G. Scatchard, Ann. N.Y. Acad. Sci. 51, 660 (1949).

Print & Media

III

Effects of Helicobacter pylori inoculation on host glycosylation and H. pylori adhesion sites in rhesus monkey

Sara Lindén+¤, Jafar Mahdavi#, Cara Olsen*, Thomas Borén#, Ingemar Carlstedt+ and André Dubois¤

¤Digestive Diseases Division, Department of Medicine, and United States Military Cancer Institute, Uniformed Services University of the Health Sciences, Bethesda, MD 20814, USA +Mucosal Biology Group, Department of Cell- and Molecular Biology, BMC, Lund University, SE-22184 Lund, Sweden, #Department of Odontology/Oral microbiology, Umeå University, SE-90187 Umeå, Sweden; *Department of Preventive Medicine and Biometrics, Uniformed Services University of the Health Sciences, Bethesda, MD 20814, USA.

ABSTRACT Le expression modulate host-bacterial inter- Background & Aims: Adherence of bacteria to actions and thereby influence the clinical the host mucosal surfaces represents a pivotal outcome of the infection. step in gastrointestinal infections. Gastric mucins, carrying highly diverse carbohydrate INTRODUCTION structures, present functional binding sites for The stomach is lined by a protective mucus H. pylori. The aim of this study was to layer formed by high-molecular-mass oligo- determine the effects of H. pylori inoculation meric glycoproteins referred to as mucins. In on gastric mucin apoprotein expression/tissue the healthy stomach, MUC5AC is produced by localization, glycosylation and H. pylori the surface/foveolar epithelium and MUC6 by adherence. Methods: Gastric corpus and antral the mucous glands.1 Aberrant expression of biopsies were harvested at endoscopy and MUC6 in superficial cells may occur in H. studied using histological methods. Results: pylori-induced chronic gastritis, and expression After H. pylori inoculation, 8 of 10 rhesus of MUC2, MUC5AC, and MUC6 mucin genes monkeys developed persistent infection, with can be altered in gastric precancerous lesions gastritis score increasing with H. pylori density and cancer.2, 3 Oligosaccharides comprise most score. Expression of sialylated Lewis (Le) of the mucin molecular mass, and a single antigens increased 1 week after infection, and mucin molecule may be substituted with more peaked before 4 months in most animals. Lea than 100 different structures.4 Blood-group and/or Leb expression transiently decreased in antigens, which differ depending on the 5/7 Leb positive animals 1 week after infection, genotype of the individual, are usually present but later increased. In addition, Lea and/or Leb on these oligosaccharides. The carbohydrate expression increased in all Lea/ Leb negative structures on the gastrointestinal surface vary monkeys. In vitro H. pylori adherence with according to cell lineage and location along the SabA and BabA positive strains follows these GI tract. In addition, they act as receptor glycosylation changes. muc5ac was localized to molecules for microorganisms and undergo the mucous cells of the surface/foveolar changes during malignant transformation.5 In epithelium and muc6 to the glands during the the human stomach, the Lea and the Leb blood- entire 10-month observation period. group antigens are mainly expressed in the Conclusions: H. pylori infection induces time- surface epithelium, whereas the Lex and the Ley dependent changes in host mucosal sialyl-Le structures primarily are found in the glands, and and Leb expression and subsequently changes the Leb structure appears on the MUC5AC the binding sites available for H. pylori mucin.1, 5, 6 Expression of sialylated Le antigens adhesion. We propose that these alterations in are common in infected and inflamed gastric

Print & Media H. pylori induced host glycosylation changes

mucosa, and changes in mucin glycosylation (BG6), Lex (BG7) and Ley (BG8) (Signet, occur in the rat small intestine during parasite Dedham, MA); anti sialyl-Lex (clone KM93) infection and in human airway mucins from and anti sialyl-Lea (clone IH4) (Seikagaku individuals with cystic fibrosis or chronic America, Ijamsville, MD); anti sialyl-di-Lex bronchitis. 7-10 (FH6) (kindly provided by Dr. H. Clausen, University of Copenhagen, Denmark); anti H. pylori causes gastric and duodenal ulcers sulfo-Lea (Irma) (kindly provided by Dr. E. C. and gastric cancer in a subset of infected I. Veerman (Vrije Universiteit, The subjects.11 During natural infection, most H. Netherlands); biotinylated goat anti-mouse and pylori are found in the gastric mucus layer goat anti-rabbit sera and Strept AB complex- whereas some are attached to the epithelial /HRP (Vector Laboratories, Burlingame, CA); cells or have entered the mucosa.12, 13 Several and Biotin blocking system (Dako A/S, adhesins have been implicated in H. pylori Copenhagen, Denmark). binding, and the Leb and sialyl-Lex/sialyl-Lea binding adhesins have been extensively Experimental animals investigated.7, 14 H. pylori strains that bind to This research was conducted according to the Leb are associated with severe gastric disease.15 principles enunciated in the Guide for the Care H. pylori binding to gastric mucins is and Use of Laboratory Animals in a facility dependent on bacterial strain and host blood- accredited by the Association for Assessment group.6 Rhesus monkeys can be naturally and and Accreditation of Laboratory Animal Care persistently colonized by H. pylori, which leads International.22 All procedures involving to loss of mucus and gastritis.16, 17 Gastric animals were reviewed and approved by our ulcers and cancer also occur in rhesus institutional animal care and use committee. 10 monkeys.18 In addition, expression and tissue monkeys (82A49, 85D08, 86D02, 86D06, 8PZ, localization of mucins and Lewis antigens as 8V5, E6C, F436, F754, and T4C) were cleared well as mucin structure, density, glycoforms of H. pylori and H. heilmanii infection at least and H. pylori binding properties are similar in 6 months earlier and inoculated with a cocktail rhesus monkey and man.19 of 7 H. pylori strains (J258, J166, J238, J170, J178, J254 and J282) including CagA positive, Our aim was to study the time course of the sialyl-Lex and Leb binding ones.7, 23 In 4 of the effects of H. pylori infection on the gastric animals (82A49, 85D08, 8PZ, and E6C), the mucosa of corpus and antrum with respect to: effects of inoculation on gastritis and plasma 1) Mucin expression/tissue localization IgG, IgA and gastrin have been reported (muc5ac, muc6, muc2 and sulfomucin), 2) previously.23 The monkeys were 4-13 years old mucosal glycosylation (Lea, Leb, Lex, Ley, (mean 7.1 years). 7 of the monkeys were Lea sialyl-Lea, sialyl-Lex, sialyl-di-Lex, sulfo-Lea) and Leb positive (F754, 86D02, T4C, 8V5, and H. pylori binding sites. F436, 82A49 and 8PZ), whereas in 3 of the monkeys (86D06, E6C, 85D08), less than 0.5% MATERIALS AND METHODS of the cells were stained with the anti-Lea and Materials anti-Leb antibodies and these monkeys were Reagents were: polyclonal antibodies against considered Lea/Leb negative. In the result MUC6 (LUM6-320) and MUC2 (LUM2-321), section, the Leb status is indicated by /Leb+ or raised in rabbits using KLH-conjugated /Leb- after the monkey code. A detailed peptides; a monoclonal antibody against investigation of the Lewis status and tissue MUC5AC (45M1) (Sigma-Aldrich, Steinheim, localization of Lewis antigens in these monkeys Germany); monoclonal anti-Leb antibody (clone has been performed.19 2-25LE) and anti Lea (7LE) (kind gifts from Dr. J. Bara, INSERM, France); anti-Lea (BG5), Leb

Print & Media H. pylori induced host glycosylation changes

Methods variables that were least normally distributed, Histochemistry but the outcome of the test (i.e. whether Genta-stained sections were used to determine changes were significantly different from pre- infection status (H. pylori and H. heilmanii) inoculation values or not) was similar with both and gastritis score according to the Sydney methods. We calculated three different system (0=none, 1=mild, 2=moderate and correlation coefficients for each pair of 3=marked).24, 25 Sulfo-mucins were detected variables using analysis of variance (ANOVA) according to Bravo and Correa.26 with random effects. The within-subjects correlation (Rw) measures the extent to which Immunohistochemistry an increase in one variable over time is Immunohistochemistry was performed associated with an increase in the second according to standard procedures as previously variable over time.28 The between-subjects 19 described. For quantitative histochemistry, correlation (Rb) measures the extent to which tissue sections were stained simultaneously to monkeys with high values of one variable have ensure that changes in stain intensity were not high values of a second variable. Rb is due to batch-to-batch variations. Quantification essentially the correlation between the means of was carried out either with visual estimation of a certain parameter for each monkey.29 The intensity (un-sialylated carbohydrate structures) overall correlation (Ro) measures the extent to or with a locally developed computer program which high values for one variable are (sialylated Le antigens) (Jozsef Czege, PhD, associated with high values for a second Biomedical Instrumentation Center, USUHS). variable, across all monkeys and time points, The surface/foveolar epithelium, lamina propria thus Ro combines aspects of both Rw and Rb. and glands were outlined and the percentage of Correlations were calculated on data from 10 the area that was stained was calculated as an monkeys at 6 time points and the significance average from 3 fields/view. of the correlations (p) was determined after taking into account the lack of independence of Bacterial adherence in situ multiple observations on the same monkey. P- In vitro bacterial adherence to tissue sections values less than 0.05 were considered were analyzed as previously described.27 In statistically significant. Although some vitro adherence was determined with the Leb/H variables did not appear to follow a normal type 1-binding BabA-positive strain 176875- distribution, examination of residual plots /Leb and the sialyl-Lex binding babA1A2 showed that the assumptions of the significance mutant 17875babA1A2, whereas the non-Leb test for correlation were met. Correlations and non-sialyl-Lex binding strain P1 was used between variables were compared using a as a negative control.6 The area of adherent bootstrap resampling algorithm implemented in bacteria and epithelium were estimated in 10 STATA, and are reported as pRo (p value for Ro different gastric pit s on each section under bootstrap) and pRw (p value for Rw bootstrap). 200X magnification by using Leica Q-Win All analyses were conducted using STATA 7.0 (standard v 2.3) and Leica DC 200 (Leica for Windows (StatCorp, College Station, TX). Microsystems AG, Wetzlar, Germany). RESULTS Statistics H. pylori infection and gastritis Comparisons of means were reported from the After inoculation, 8 of the 10 monkeys eight persistently infected animals, and plotted (F754/Leb+, F436/Leb+, T4C/Leb+, 82A49/- with standard error bars. Changes over time Leb+, 8PZ/Leb+, 86D06/Leb-, E6C/Leb-, within animals were compared using Student’s 85D08/Leb-) developed persistent infection and paired t-test (two-sided). In addition, Wilcoxon gastritis (figure 1), 1 (8V5/Leb+) was signed-rank tests were calculated for the transiently infected and 1 (86D02/Leb+) was

Print & Media H. pylori induced host glycosylation changes

not infected. Correlations for gastritis score and small to draw general conclusions, the Leb H. pylori density are listed in Table 1A. positive monkeys were less affected by H. Gastritis score correlated significantly with H. pylori than the Leb negative ones. pylori density both in antrum (p <0.001) and in corpus (p =0.001). The Rb value was higher Mucin tissue localization remained than that of Rw for these correlations (Table unchanged 1A), indicating that individuals respond muc5ac was detected in the surface/foveolar differently to the same bacterial load. The mean epithelium of antrum and corpus, and muc6 in corpus gastritis score, antrum H. pylori score the antral glands and corpus mucous cells as and corpus H. pylori score were approximately well as in secreted mucus in the neck region twice as high in Leb negative as in Leb positive (data not shown). The localization remained persistently infected animals (data not shown). unchanged after inoculation, and muc2 or In addition, the animal that did not develop sulfo-mucins were not detected in the stomach infection and the one that spontaneously of any of the monkeys during the 10-month cleared the infection were both Leb positive. period (data not shown) Thus, although the number of individuals is too

Figure 1. Mean gastritis ( ) and H. pylori density ( ) scores of the 8 persistently infected monkeys. * p <0.05 vs. pre-inoculation.

Print & Media H. pylori induced host glycosylation changes

Table 1. Significant correlations found in this study. Correlated variables Ro Rb Rw p A. H. pylori density and gastritis score gastritis score, A gastritis score, C 0.58 0.73 0.51 <0.001 H. pylori density, A H. pylori density, C 0.56 0.66 0.50 <0.001 H. pylori density, A gastritis score, A 0.54 0.72 0.43 <0.001 H. pylori density, A gastritis score, C 0.57 0.76 0.34 <0.001 H. pylori density, C gastritis score, C 0.56 0.82 0.38 0.001 H. pylori density, C gastritis score, A 0.32 0.37 0.30 0.012 B. Sialylated Le antigens sialyl-Lea, A. S sialyl-Lea, A. L.P 0.28 0.06 0.43 0.002 sialyl-Lea, A. S sialyl-Lea, C. S 0.60 0.45 0.51 <0.001 sialyl-Lea, C. S sialyl-Lea, C. gland 0.26 0.07 0.41 0.004 sialyl-Lea, C. S sialyl-Lea, C. L.P 0.41 0.27 0.47 <0.001 sialyl-Lex, A. S sialyl-Lex, C. gland 0.40 0.72 0.28 0.009 sialyl-Lea, A. S sialyl-Lex, A. S 0.42 0.55 0.32 0.003 C. sialylated Le antigens and H. pylori density/gastritis score sialyl-Lex, A. S H. pylori density, A 0.59 0.94 0.24 <0.001 sialyl-Lea, A. S H. pylori density, A 0.49 0.55 0.46 <0.001 sialyl-Lex, A. S gastritis score, A 0.42 0.78 0.18 0.014 sialyl-Lea, A. S gastritis score, A 0.55 0.60 0.52 <0.001 D. In vitro adherence of H. pylori strains In.v.ad. babA1A2, A. S In v.ad. CCUG17875, A. S -0.39 -0.53 -0.22 0.038 E. In vitro adherence of H. pylori strains and H. pylori density/gastritis score In v.ad. CCUG17875, A. S H. pylori density, A -0.47 -0.77 -0.13 0.025 In.v.ad. babA1A2, A. S H. pylori density, A 0.58 0.77 0.40 <0.001 In v.ad. CCUG17875, A. S gastritis score, A -0.42 -0.56 -0.33 0.005 In.v.ad. babA1A2, A. S gastritis score, A 0.45 0.61 0.34 0.001 F. In vitro adherence of H. pylori strains and sialylated Le antigens In.v.ad. CCUG17875, A. S sialyl-Lex, A. S -0.52 -0.78 -0.22 0.004 in.v.ad. babA1A2, A. S sialyl-Lex, A. S 0.58 0.71 0.46 <0.001 In.v.ad. babA1A2, A. S sialyl-Lea, A. S 0.56 0.75 0.40 <0.001 In.v.ad. babA1A2, A. S sialyl-Lex +sialyl-Lea, A. S 0.66 0.84 0.50 <0.001 A. =antrum, C. =corpus, L.P. =lamina propria, S.=surface/foveolar epithelium, In.v.ad. =in vitro adherence of H. pylori strain.

Changes in expression of Lewis antigens higher than that (figure 2C). The decrease in varied between individuals Lea stain intensity was uniform in the entire Lea specimen and across multiple biopsies, In Lea positive monkeys, the surface/foveolar although the same percentage of cells tended to epithelium was Lea positive. One week after be stained. In the Lea negative individuals, the inoculation, the Lea expression was lower in 4 percentage of Lea-positive surface/foveolar (8V5/Leb+, F754/Leb+, F436/Leb+, epithelium increased at some time points, 86D02/Leb+) and disappeared in one especially in animal 85D08/Leb- (data not (8V5/Leb+; figure 2B). 2 months after shown). No sulfo-Lea was detected in any of inoculation, however, the Lea expression had the specimens (data not shown). returned to pre-inoculation levels or levels

Print & Media H DQGRU D . KVSRVWLQRF I post inoc L 10 months . SRVLWLYHDQLPDOV([SUHVVLRQRI E 2 months post inoc K H /H DQG& PRQWKVSRVWLQRF /H LQ LQSDQHOV* SUHLQRF + PRQWKVSRVWLQRF ZKLFKGLVSOD\HGWKHPRVWSURPLQHQWLQFUHDVH E D Before J inoculation G x a IRU VLDO\O/H E Sialyl-Le Sialyl-Le PRQWKVSRVWLQRF 6LDO\ODWHG /HDQWLJHQVWUDQVLHQWO\LQFUHDVHGLQWK LQSDQHOV- SUHLQRF . PRQWKVSRVWLQRF DQG/ PRQW [ . 2 months C F post inoc QHJDWLYHPRQNH\V'DWDIURPPRQNH\(&/H E /H H[SUHVVLRQLQLWLDOO\GHFUHDVHGDQGODWHUWHQGHGWRLQFUHDVH D E 1 week LVVKRZQLQSDQHO$ SUHLQRFXODWLRQ % ZHHNSRVWLQRF B E post inoc. E DQGRU /H D Before /H D A inoculation b a LQDQLPDO9/H LQFUHDVHGLQDOO/H D E Le Le /H LV VKRZQLQ' SUHLQRF ( ZHHNSRVWLQRF DQG) /H DQG, PRQWKVSRVWLQRF DQGIRU VLDO\O/H DQWUDO VXUIDFHIRYHRODU HSLWKHOLXP DVVKRZQ PRQNH\3=/H )LJXUH

Print & Media H. pylori induced host glycosylation changes

Leb corpus, the glands were positive, but not the In antrum, all surface/foveolar epithelial surface/foveolar epithelium (data not shown). mucous cells and 20-70 % of the glands were Following inoculation, Ley expression Leb positive in the monkeys that were Lea transiently decreased in the antrum of all but 1 positive (data not shown). Following monkey (85D08/Leb-) in early infection, inoculation, staining did not change in 4 whereas no change was detected in corpus or individuals (F754/Leb+, 86D02/Leb+, in the non-infected monkey 86D02/Leb+ (data T4C/Leb+ and 82A49/Leb+) and initially not shown). decreased in 3 (8PZ/Leb+, F436/Leb+ and 8V5/Leb+). Starting at 2-4 months, the Leb Sialylated Lewis antigens transiently level was approximately back to pre- increased after infection inoculation levels or higher (similar to the Lea Sialyl-Lea reactivity in figure 2 A-C). Leb was detected The percentage of sialyl-Lea positive following inoculation in the 3 monkeys surface/foveolar epithelium increased in all 9 classified as Leb negative before inoculation infected monkeys (figure 2G-I and 3A), and with the increase being particularly strong in the mean percentage of sialyl-Lea positive E6C/Leb- (figure 2D-F). No change was cells significantly increased in the persistently detected in the non-infected animal (data not infected animals (figure 3B and C). In seven shown). of the nine infected monkeys, this increase was transient (figure 3A). In contrast, no Lex increase was detected in the non-infected Before inoculation, Lex was detected in the monkey (data not shown). Sialyl-Lea in antral foveolar epithelium in 8/9 corpus and in 3/10 surface/foveolar epithelium significantly antral biopsies (data not shown). The corpus correlated with sialyl-Lea in antral lamina glands, chief and parietal cells were stained to propria (p =0.002) and corpus a varying degree but the antral glands were surface/foveolar epithelium (p <0.001). In negative (data not shown). After inoculation, corpus, sialyl-Lea in the surface/foveolar staining of the mucin-producing cells epithelium significantly correlated with sialyl- remained unchanged in 6 animals (F436/Leb+, Lea in the glands (p = 0.004) and in the lamina 86D06/Leb-, 82A49/Leb+, 85D08/Leb-, propria (p <0.001), although the R values 8PZ/Leb+ and the non-infected 86D02/Leb+), were low (table 1B). The correlations within b b increased in 2 (T4C/Le + and F754/Le +), animals (Rw) were higher than those (Rb) and decreased in 2 (8V5/Leb+ and E6C/Leb-; between them (table 1B) showing that an data not shown). increase of sialyl-Lea in one tissue localization is associated with an increase at other sites Ley within the same animal at the same time In antrum, Ley was expressed in the glands of point, but that the levels vary between all monkeys, and in the surface/foveolar different animals. epithelium of 2 animals (data not shown). In

Print & Media H. pylori induced host glycosylation changes

Fi gure 3. Panel A shows the percentage of sialyl-Lea positive surface/foveolar epithelium in the persistently infected monkeys 85D08/Leb- (z), 8PZ/Leb+ (T), E6C/Leb- (V), F754/Leb+ () and the transiently infected monkey 8V5/Leb+ (+). The 82A49/Leb+ was similar to E6C/Leb- and T4C/Leb+ to 8V5/Leb+ whereas 86D06/Leb- and F436/Leb+ were similar to 85D08/Leb-. The mean percentage of sialyl-Lea positive surface/foveolar epithelium (S) and glands (U) for the 8 persistently infected monkeys in antrum and corpus are shown in panels B and C respectively. * indicates that the mean significantly (p <0.05) differed from the pre-inoculation value.

Sialyl-Lex spontaneously cleared the infection (data not In all persistently infected monkeys, the shown). The percentage of sialyl-Lex positive percentage of sialyl-Lex positive surface/foveolar epithelium was significantly (p surface/foveolar epithelium transiently =0.011) higher in pre-inoculation biopsies of increased in antrum (5/8 monkeys) and/or Leb positive than in Leb negative animals (8 and corpus (5/8 monkeys), but remained elevated 76 times higher in antrum and corpus only in 2 animals (fig 2J-L and 4A). The mean respectively). In post-inoculation biopsies, percentage of sialyl-Lex positive antral however, the differences were less pronounced, surface/foveolar epithelium increased from 2% and sialyl-Lex was twice as high in Leb negative before to 18% at 1-week after inoculation as in Leb positive animals (figure 4A). A (figure 4B). However, this increase did not significant correlation was found between reach a level of statistical significance (p sialyl-Lex and sialyl-Lea in surface/foveolar =0.053) because the response varied between epithelium of antrum (p =0.003), but not in individuals (figure 4A). Interestingly, sialyl-Lex corpus (Table 1B). levels did not increase in the monkey that

Print & Media H. pylori induced host glycosylation changes

x Before inoculation, all monkeys were negative Le is mainly between animals (Rb), showing for sialyl-di-Lex except for a few positive cells that individuals with high H. pylori density and in the glands of the antrum and corpus in 2 gastritis also have high levels of sialyl-Lex, but animals (85D08 and 82A49). The only post not necessarily in the same tissue inoculation change detected was a moderate specimen/time point (Table 1C). In contrast, the increase in 2 monkeys (86D02 and 86D06) at correlations to sialyl-Lea have a higher within 10 months (data not shown). Thus, this animal correlation (Rw) suggesting that sialyl- structure does not seem to be a major adhesion Lea correlates to the H. pylori density and factor for H. pylori in rhesus monkeys, at least gastritis score in the same biopsy (Table 1C). up to10 months. Although the correlation between sialylated antigens and gastritis score was higher than that H. pylori density and gastritis correlated to H. pylori density, the difference between with sialylated Lewis antigens those correlations was not significant (pRo H. pylori density and gastritis score =0.570, pRw = 0.112). Thus, it can not be significantly correlated with sialyl-Lex (p concluded that the correlation between <0.001 and p =0.014) and sialyl-Lea (p <0.001 sialylation and H. pylori density occur because for both) expression in surface/foveolar H. pylori density and gastritis score correlate. epithelium of antrum. The correlation to sialyl-

Figure 4. Panel A shows the percentage sialyl-Lex positive surface/foveolar epithelium in the persistently infected monkeys T4C/Leb+ (c), 85D08/Leb- (z), 8PZ/Leb+ (T), E6C/Leb- (V), 86D06/Leb- (), 82A49/Leb+ ( ), F754/Leb+ (), F436/Leb+ (). The mean sialyl-Lex positive percentage of surface/foveolar epithelium (S) and glands (U) for the 8 persistently infected monkeys are shown in panel B (antrum) and C (corpus).

Print & Media H. pylori induced host glycosylation changes

In vitro adherence of H. pylori follows the progressed in opposite directions during glycosylation changes infection compared to the Leb binding H. pylori Leb-binding strain 17875/Leb: strain (17875/Leb) (compare figure 5A and B), In vitro adherence of strain 17875/Leb and adherence of those two strains inversely significantly (p =0.028) decreased early during correlated (p =0.038; table 1D). No in vitro infection (figure 5A). In vitro adherence to the adherence was detected with AlpA positive mucosa of the transiently infected monkey strain p1 (data not shown). (8V5/Leb+) initially decreased as in the persistently infected animals, but later In vivo H. pylori density, gastritis score and increased as in the non-infected one with the sialylated Le antigens inversely correlated increase preceding clearance of infection with in vitro H. pylori adherence of the (figure 5A). No in vitro adherence to the antral Leb/H-type-1 binding BabA positive strain. glands was detected in any of the monkeys In vivo H. pylori density and gastritis score (data not shown), although Leb was detected in inversely correlated with the in vitro adherence the glands of most animals, supporting the of strain 17875/Leb (p =0.025 vs p =0.005; theory that the topographic presentation of this table 1E). In addition, in vitro adherence of the structure is important for binding.6 In Leb- Leb binding strain 17875/Leb correlated positive individuals, in vitro adherence to the inversely with sialyl-Lex (p =0.004; Table 1F). antral surface epithelium was slightly higher The correlation is higher between individuals before inoculation (mean 18 % vs 15%), and (Rb; Table 1F) than within them, indicating that significantly higher after inoculation (1.8 times, animals with high sialyl-Lex levels bind less p =0.007), than in Leb-negative individuals. 17875/Leb, but that this is not necessarily However, adherence occurred in all individuals, reflected in individual biopsies. indicating that structures other than Leb (e.g. H type 1) also mediate binding. In vivo H. pylori density, gastritis score and sialylated Le antigens correlated with in vitro Sialyl-Lex binding babA1A2 mutant: H. pylori adherence of the sialyl-Lex binding In vitro adherence to antral surface/foveolar SabA positive strain. epithelium significantly (p =0.015) increased in In vivo H. pylori density and gastritis score persistently infected monkeys (figure 5B). The correlated with in vitro adherence of the mean adherence to antral glands was 20% and babA1A2 mutant (p <0.001 vs p =0.001; table to corpus 7%, and it did not change 1E) to antral surface/foveolar epithelium. In significantly after inoculation (data not shown). vitro adherence of the sialyl-Lex binding In Leb negative animals, adherence of the babA1A2 mutant correlated significantly with babA1A2 mutant to antral surface/foveolar sialyl-Lex (p <0.001) and sialyl-Lea (p <0.001) epithelium was twice as high as in the Leb in surface/foveolar epithelium of antrum (Table positive ones (data not shown). In vitro 1F), and these correlations did not differ adherence to antral surface/foveolar epithelium significantly (PRo =0.729, pRw = 0.625).

Print & Media H. pylori induced host glycosylation changes

Figure 5. Mean in vitro adherence of the BabA positive strain (17875/Leb; panel A) and of the SabA positive, BabA negative mutant (BabA1A2: panel B) to antral surface/foveolar epithelium of 8 persistently infected monkeys ( ), the transiently infected one (8V5/Leb+, S) and the non-infected one (86D02/Leb+, ).

DISCUSSION and an increase in adherence of the Lex binding The present study demonstrates that H. pylori strain. In subsequent months, in vitro adherence infection can induce time-dependent modifica- of the two H. pylori strains to antral tions in mucin glycosylation. During the early surface/foveolar epithelium continued to phase of infection, Leb decreased and sialyl-Lex progress in opposite directions, supporting the as well as sialyl-Lea increased in the hypothesis that the BabA and SabA adhesins surface/foveolar epithelium. From 4 through 10 play complementary roles at different time months after inoculation, sialyl-Lea remained points of infection.7 higher than before inoculation whereas sialyl- Lex returned to pre-inoculation levels and Leb In contrast, muc5ac and muc6 tissue localiza- increased. Thus, the rhesus monkey immedi- tion remained unchanged in all animals during ately responds to H. pylori infection by modi- the 10-month period. However, the fying the expression of carbohydrate structures surface/foveolar cells lost their bulginess and important in adherence of this microbe, such as looked flat and depleted of mucins in some Leb, sialyl-Lea and sialyl-Lex. These early biopsies. KATO III cell mucin synthesis has alterations in glycosylation are reflected in the previously been shown to be partially inhibited in vitro adherence test by an initial decrease in when cells were incubated with H. pylori, adherence of the Leb binding H. pylori strain although no effect was found on mucin secre-

Print & Media H. pylori induced host glycosylation changes

tion, which could explain the depleted appear- on a putative membrane associated mucin.6 ance.30 No muc2 was detected in the gastric (Lindén, S. Mahdavi, J. Hedenbro, J. Borén T. specimens. Possibly, aberrant expression of and Carlstedt, I., Unpublished). However, muc6 or muc2 requires a >10-month exposure adhesion to Leb is stronger than to H type 1.6, 32 to H. pylori or was present at a level that is not After infection, when fucosylation changes and detected by the present methods. Leb seems to increase apically on the surface/foveolar cells, it is likely that this Changes in glycosylation were detected in all proportion is changed. Competition between H. animals. As expected from a predominantly pylori binding to membrane-bound and antral infection, changes and correlations were secreted mucins is likely to influence the more pronounced at this location. The majority outcome of the host-microbe interaction, since of the tested correlations were significant with the membrane-bound ones have potential for p values generally less than 0.01 and thus it is signaling.33, 34 highly likely that correlations are real and not occurring by chance. In all correlations with H. The increases in sialyl-Lea and sialyl-Lex pylori density, the values of Rb are higher than expression are most prominent during the first those of Rw, demonstrating that individuals 2 months after inoculation. In humans, sialyl- differ in their response to this pathogen. Lea expression was higher before than after eradication, but only in about 50% of speci- One week after inoculation, the Lea stain inten- mens,8 as explained by the change observed in sity was markedly lower in 4/7 Lea positive monkey being time-dependent. In situ H. pylori monkeys. Of these, only 2 became persistently density and in vitro adherence of the SabA infected, and then only mildly (mean post positive mutant, correlated significantly with inoculation gastritis score 1.4 and H. pylori sialyl-Lea and sialyl-Lex expression in antrum density 0.4), suggesting that this decrease could (table 1), supporting the theory that these anti- have a protective function. In total, a decrease gens function as receptors for the SabA in Lea and/or Leb was detected in 5/7 Lea/Leb adhesin.7 In addition, SabA may also bind other positive monkeys. In addition, an initial sialylated structures that are not recognized by decrease in fucosylation affecting other struc- the antibodies used in this study. tures than Lea/Leb seems to occur since in vitro adherence with H. pylori strain 17875/Leb, H. pylori density and gastritis score tended to which binds to fucosylated antigens like Leb be lower in Leb positive than Leb negative and H type 1, decreased in 7/8 infected monkeys and the animal that did not develop monkeys, including the Leb negative ones. infection as well as the one that spontaneously Although Lea and Leb expression initially cleared the infection were both Leb positive. decreased in the Leb positive animals, there was Although the number of individuals is too small a tendency to an increase later during infection. to draw general conclusions, attachment of H. In addition, in the three animals that were Leb pylori to Leb-positive gastric mucin may reduce and Lea negative before inoculation, Leb and/or colonization by inhibiting attachment of the Lea were detected after inoculation. A similar organism to epithelial cells, thus assisting effect is induced by some commensal bacteria removal of the bacteria by the continuous flow (e.g. B. thetaiotaomicron) that can signal to the of mucus and decreasing colonization of the host to produce more glycosidically bound underlying mucosa. The Leb host phenotype is fucose.31 In some animals, this increase tended not associated with H. pylori infection, to be strongest apically (figure 2C). We have although patients who express Leb have a observed that in the non-infected stomach, the higher H. pylori density than those who do not, Leb binding BabA positive strains seem to bind and H. pylori density increases with Leb both to Leb on secreted mucin and to H type 1 expression.35-37 These seemingly contradictory

Print & Media H. pylori induced host glycosylation changes

results may be explained by our results that Leb glycoproteins of a patient suffering expression increase both in Leb positive and from bronchiectasis. Eur J Biochem Leb negative monkeys later during infection, 1993;211:491-500. since studies in humans do not account for H. 5. Murata K, Egami H, Shibata Y, pylori induced changes. Sakamoto K, Misumi A, Ogawa M. Expression of blood group-related In conclusion, the present study demonstrates antigens, ABH, Lewis(a), Lewis(b), that H. pylori infection can modify host glyco- Lewis(x), Lewis(y), CA19-9, and sylation within mucus producing cells without CSLEX1 in early cancer, intestinal modifying mucin apoprotein expression or metaplasia, and uninvolved mucosa of tissue localization. The host glycosylation the stomach. Am J Clin Pathol changes are time-dependent and the rapid 1992;98:67-75. response influences the structure of putative 6. Lindén S, Nordman H, Hedenbro J, colonization targets. These structural changes Hurtig M, Borén T, Carlstedt I. Strain- probably result in bacterial adaptation and and blood group-dependent binding of selection of those bacterial strains that are best Helicobacter pylori to human gastric adapted to a particular host. These host-bacte- MUC5AC glycoforms. rial interactions may determine the outcome of Gastroenterology 2002;123:1923-30. the infection, i.e. persistence or transience, and 7. Mahdavi J, Sonden B, Hurtig M, Olfat perhaps also whether colonization will cause FO, Forsberg L, Roche N, Angstrom J, subsequent overt disease. Larsson T, Teneberg S, Karlsson KA, Altraja S, Wadstrom T, Kersulyte D, REFERENCES Berg DE, Dubois A, Petersson C, 1. De Bolos C, Garrido M, Real FX. Magnusson KE, Norberg T, Lindh F, MUC6 apomucin shows a distinct Lundskog BB, Arnqvist A, normal tissue distribution that correlates Hammarstrom L, Boren T. Helicobacter with Lewis antigen expression in the pylori SabA adhesin in persistent human stomach. Gastroenterology infection and chronic inflammation. 1995;109:723-34. Science 2002;297:573-8. 2. Byrd JC, Yan P, Sternberg L, Yunker 8. Ota H, Nakayama J, Momose M, CK, Scheiman JM, Bresalier RS. Hayama M, Akamatsu T, Katsuyama T, Aberrant expression of gland-type Graham DY, Genta RM. Helicobacter gastric mucin in the surface epithelium pylori infection produces reversible of Helicobacter pylori-infected patients. glycosylation changes to gastric mucins. Gastroenterology 1997;113:455-64. Virchows Arch 1998;433:419-26. 3. Buisine MP, Devisme L, Maunoury V, 9. Karlsson NG, Olson FJ, Jovall PA, Deschodt E, Gosselin B, Copin MC, Andersch Y, Enerback L, Hansson GC. Aubert JP, Porchet N. Developmental Identification of transient glycosylation mucin gene expression in the alterations of sialylated mucin gastroduodenal tract and accessory oligosaccharides during infection by the digestive glands. I. Stomach. A rat intestinal parasite Nippostrongylus relationship to gastric carcinoma. J brasiliensis. Biochem J 2000;350 Pt Histochem Cytochem 2000;48:1657-66. 3:805-14. 4. Klein A, Carnoy C, Lamblin G, Roussel 10. Lamblin G, Degroote S, Perini JM, P, van Kuik JA, Vliegenthart JF. Delmotte P, Scharfman A, Davril M, Isolation and structural characterization Lo-Guidice JM, Houdret N, Dumur V, of novel sialylated oligosaccharide- Klein A, Rousse P. Human airway alditols from respiratory-mucus mucin glycosylation: a combinatory of

Print & Media H. pylori induced host glycosylation changes

carbohydrate determinants which vary bacteria infection in humans. in cystic fibrosis. Glycoconj J Gastroenterology 1994;106:1405-17. 2001;18:661-84. 18. Parker GA, Gilmore CJ, Dubois A. 11. Uemura N, Okamoto S, Yamamoto S, Spontaneous gastric ulcers in a rhesus Matsumura N, Yamaguchi S, Yamakido monkey. Brain Res Bull 1981;6:445-7. M, Taniyama K, Sasaki N, Schlemper 19. Lindén S, Borén T, Dubois A, Carlstedt RJ. Helicobacter pylori infection and I. Rhesus monkey gastric mucins and the development of gastric cancer. N their Helicobacter pylori binding Engl J Med 2001;345:784-9. properties. Biochem J;Conditionally 12. Shimizu T, Akamatsu T, Sugiyama A, accepted. Ota H, Katsuyama T. Helicobacter 20. Nordman H, Davies JR, Lindell G, de pylori and the surface mucous gel layer Bolos C, Real F, Carlstedt I. Gastric of the human stomach. Helicobacter MUC5AC and MUC6 are large 1996;1:207-18. oligomeric mucins that differ in size, 13. Semino-Mora C, Doi SQ, Marty A, glycosylation and tissue distribution. Simko V, Carlstedt I, Dubois A. Biochem J 2002;364:191-200. Intracellular and interstitial expression 21. Herrmann A, Davies JR, Lindell G, of Helicobacter pylori virulence genes Martensson S, Packer NH, Swallow in gastric precancerous intestinal DM, Carlstedt I. Studies on the metaplasia and adenocarcinoma. J "insoluble" glycoprotein complex from Infect Dis 2003;187:1165-77. human colon. Identification of 14. Ilver D, Arnqvist A, Ogren J, Frick IM, reduction-insensitive MUC2 oligomers Kersulyte D, Incecik ET, Berg DE, and C-terminal cleavage. J Biol Chem Covacci A, Engstrand L, Boren T. 1999;274:15828-36. Helicobacter pylori adhesin binding 22. Commission on Life Sciences. Guide fucosylated histo-blood group antigens for the Care and Use of Laboratory revealed by retagging. Science Animals. National Research Council, 1998;279:373-7. National Academy Press, Washington, 15. Prinz C, Schoniger M, Rad R, Becker I, DC, 1996. Keiditsch E, Wagenpfeil S, Classen M, 23. Dubois A, Berg DE, Incecik ET, Fiala Rosch T, Schepp W, Gerhard M. Key N, Heman-Ackah LM, Del Valle J, importance of the Helicobacter pylori Yang M, Wirth HP, Perez-Perez GI, adherence factor blood group antigen Blaser MJ. Host specificity of binding adhesin during chronic gastric Helicobacter pylori strains and host inflammation. Cancer Res responses in experimentally challenged 2001;61:1903-9. nonhuman primates. Gastroenterology 16. Dubois A, Fiala N, Weichbrod RH, 1999;116:90-6. Ward GS, Nix M, Mehlman PT, Taub 24. Genta RM, Robason GO, Graham DY. DM, Perez-Perez GI, Blaser MJ. Simultaneous visualization of Seroepizootiology of Helicobacter Helicobacter pylori and gastric pylori gastric infection in nonhuman morphology: a new stain. Hum Pathol primates housed in social environments. 1994;25:221-6. J Clin Microbiol 1995;33:1492-5. 25. Dixon MF, Genta RM, Yardley JH, 17. Dubois A, Fiala N, Heman-Ackah LM, Correa P. Classification and grading of Drazek ES, Tarnawski A, Fishbein WN, gastritis. The updated Sydney System. Perez-Perez GI, Blaser MJ. Natural International Workshop on the gastric infection with Helicobacter Histopathology of Gastritis, Houston pylori in monkeys: a model for spiral

Print & Media H. pylori induced host glycosylation changes

1994. Am J Surg Pathol 1996;20:1161- response. FEMS Immunol Med 81. Microbiol 1998;20:257-66. 26. Bravo JC, Correa P. Sulphomucins 36. de Mattos LC, Rodrigues Cintra J, favour adhesion of Helicobacter pylori Sanches FE, Alves da Silva Rde C, Ruiz to metaplastic gastric mucosa. J Clin MA, Moreira HW. ABO, Lewis, Pathol 1999;52:137-40. secretor and non-secretor phenotypes in 27. Falk P, Roth KA, Boren T, Westblom patients infected or uninfected by the TU, Gordon JI, Normark S. An in vitro Helicobacter pylori bacillus. Sao Paulo adherence assay reveals that Med J 2002;120:55-8. Helicobacter pylori exhibits cell 37. Sheu BS, Sheu SM, Yang HB, Huang lineage-specific tropism in the human AH, Wu JJ. Host gastric Lewis gastric epithelium. Proc Natl Acad Sci expression determines the bacterial U S A 1993;90:2035-9. density of Helicobacter pylori in babA2 28. Bland JM, Altman DG. Calculating genopositive infection. Gut correlation coefficients with repeated 2003;52:927-32. observations: Part 1- -Correlation within subjects. Bmj 1995;310:446. ACKNOWLEDGEMENTS 29. Bland JM, Altman DG. Calculating The work was supported by grants from Sixten correlation coefficients with repeated Gemzeus Stiftelse; the Swedish Foundation for observations: Part 2- -Correlation Strategic Research (Glycoconjugates in between subjects. Bmj 1995;310:633. Biological Systems); J. C. Kempe Memorial 30. Byrd JC, Yunker CK, Xu QS, Sternberg Foundation; the Swedish Research Council LR, Bresalier RS. Inhibition of gastric (grants 7902 and 11218); the Swedish Cancer mucin synthesis by Helicobacter pylori. Society (Project No. 4101-B00-03XAB); Gastroenterology 2000;118:1072-9. Österlunds Stiftelse; Council for Medical 31. Bry L, Falk PG, Midtvedt T, Gordon JI. Tobacco Research, Sweden; the County A model of host-microbial interactions Council of Västerbotten; the Mizutani in an open mammalian ecosystem. Foundation for Glycoscience; and the National Science 1996;273:1380-3. Institutes of Health (grant CA82312). 32. Boren T, Falk P, Roth KA, Larson G, Normark S. Attachment of Helicobacter The opinions and assertions contained herein pylori to human gastric epithelium are the private ones of the authors and are not mediated by blood group antigens. to be construed as official or reflecting the Science 1993;262:1892-5. views of the Department of Defense or the 33. Gendler SJ, Spicer AP. Epithelial mucin Uniformed Services University of the Health genes. Annu Rev Physiol 1995;57:607- Sciences. 34. 34. Quin RJ, McGuckin MA. Presented in part at the 2003 Digestive Phosphorylation of the cytoplasmic Diseases Week in Orlando, Florida and the domain of the MUC1 mucin correlates 2003 American Society for Biochemistry and with changes in cell-cell adhesion. Int J Molecular Biology meeting in San Diego, Cancer 2000;87:499-506. California. 35. Heneghan MA, Moran AP, Feeley KM, Egan EL, Goulding J, Connolly CE, Address requests for reprint to: Andre Dubois, McCarthy CF. Effect of host Lewis and MD, PhD, Dept of Medicine, USUHS, Room ABO blood group antigen expression on A3075, Bethesda MD, 20814, Tel: 301-295- Helicobacter pylori colonisation density 3607 Fax: 301-295-3676 or 301-295-3557, and the consequent inflammatory [email protected]

Print & Media

NOTES

Limited Role of Lipopolysaccharide Lewis Antigens in Adherence of Helicobacter pylori to the Human Gastric Epithelium Jafar Mahdavi,1 Thomas Bore´n,1 Christina Vandenbroucke-Grauls,2 and Ben J. Appelmelk2* Department of Odontology/Oral Microbiology, Umea˚University, 901 87 Umea˚, Sweden,1 and Department of Medical Microbiology, Vrije Universiteit Medical Center, 1081 BT Amsterdam, The Netherlands2

Received 3 October 2002/Returned for modiﬁcation 18 November 2002/Accepted 17 January 2003

In vitro and in vivo studies from various groups have suggested that Helicobacter pylori lipopolysaccharide (LPS) Lewis x (Lex) antigens mediate bacterial adhesion. We have now reevaluated this hypothesis by studying the adherence in situ of H. pylori strain 11637 and its corresponding Lex-negative rfbM mutant to human with various gastric pathologies. Signiﬁcant binding of the parent strain (22 ؍ gastric mucosa from patients (n was observed in only 8 out of 22 sections; in four out of eight patients, the Lex-negative mutant bound less well. One of these four patients displayed no gastric abnormalities, and the other three showed dysplasia, metaplasia, and adenocarcinoma, respectively; hence, we are unable to deﬁne the circumstances under which LPS-mediated adhesion takes place. We conclude that H. pylori LPS plays a distinct but minor role in adhesion.

More than 80% of Helicobacter pylori strain express Lewis that the Lex LPS antigens might confer adhesive properties to blood group antigens on their lipopolysaccharide (LPS); most H. pylori (5). However, the results were based on the charac- often, Lewis x (Lex) and/or Ley is expressed (2, 13). Thus, in terization of adherence properties of a single H. pylori strain contrast to the case for many other pathogens (for example, and its isogenic mutants, and for the binding studies histolog- Escherichia coli), the H. pylori LPS O antigen is strongly con- ical sections from a single patient with gastric carcinoma were served. This suggests that it may play a role in pathogenesis used (G. Faller, personal communication). In contrast, in sev- other than its role as a (weak) endotoxin. Despite intense eral studies the H. pylori BabA adhesin has consistently been efforts, no such role has been assigned with certainty, but the demonstrated to mediate binding of bacterial cells to gastric following three options have been investigated in some detail epithelial cells, specifically the mucosal Leb blood group (2): (i) H. pylori evades the host immune response by molecular epitope (4, 6). x mimicry of its Le antigen with similar blood group antigens in The results described above raise the question of when H. the gastric mucosa, (ii) H. pylori induces a gastric autoimmune pylori would use LPS-carbohydrate-based interactions for ad- x response by inducing anti-Le antibodies that bind to its LPS herence, as alternatives to regular adhesin proteins. Could LPS and also to gastric epithelium, or (iii) H. pylori LPS could binding possibly optimize targeting of the microbe to unique demonstrate adhesive properties. microniches, or could it possibly increase binding strength by The data to support a role of H. pylori LPS in adhesion are the use of multiple binding sites simultaneously (multivalent as follows. Inactivation of H. pylori genes which encode glyco- binding)? Alternatively, would the mechanisms of phase vari- syltransferases of importance for LPS glycosylation patterns ation as described for expression of LPS antigen variation (1, yields mutants that do not express certain Lewis antigens. In a 3) endow the microbe with adhesive properties that would lead series of studies, such Lewis antigen-negative mutants colo- to escape to the immune response? One obvious answer for an nized less well in experimental mouse infection studies (9, 7, LPS-dependent binding activity would be to complement 11). In a recent study it was shown that Lewis antigen-negative BabA adhesin-mediated adherence, such as in individuals who LPS mutants did not adhere to the gastric mucosa; that study do not express Leb antigen (nonsecretor individuals), or for was based on adherence of bacterial cells in vitro, i.e., to multivalent glycan-glycan interactions with highly glycosylated histological tissue sections (5). Moreover, synthetic Lex applied structures such as gastric mucins. to the surface of fluorescent latex beads bound to the gastric Thus, we decided to reevaluate the functional role of LPS sections in patterns similar to the adherence “blueprint” dis- H. pylori. played by H. pylori bacterial cells. This series of results suggests antigens in adhesion of In this work we studied the influence of LPS Lex antigen expression among H. pylori strains that express (positive) or do not express (negative) the BabA adhesin for its role in adherence to gastric sections from * Corresponding author. Mailing address: Department of Medical many different patients, including an individual of the nonse- Microbiology, VUMC Vrije Universiteit Medical Center, van der Boechorststraat 7, 1081 BT Amsterdam, The Netherlands. Phone: 31 cretor phenotype. 20 4448297. Fax: 31 20 4448318. E-mail: [email protected]. The strains used are shown in Table 1. Most strains have

2876

Print & Media VOL. 71, 2003 NOTES 2877

TABLE 1. Strains used in this study and their LPS phenotypes, expression of functional BabA, and ability to bind to healthy gastric mucosa

In situ adhesion to gastric epitheliumb (mean Ϯ SEM) Strain testeda LPS phenotype Leb bindingb Reference(s) Surface Parietal cells Deep glands mucus cells 17875 No Lex or Ley 44 Ϯ 2.06 647 Ϯ 24 0 0 4, 6 17875 babA KO No Lex or Ley Ͻ1 Ϯ 0.03 36 Ϯ 50 04,6 ATCC 43504 Lex,Ley 25 Ϯ 1.98 545 Ϯ 13 0 0 1, 3 ATCC 43504 variant 1b Ley 29.5 Ϯ 0.97 596 Ϯ 22 21 Ϯ 401,3 ATCC 43504 variant 1c Lex,Ley 32.8 Ϯ 1.0 607 Ϯ 90 28Ϯ 21,3 ATCC 43504 variant D1.1 No Lex or Ley 29.8 Ϯ 1.22 537 Ϯ 11 25 Ϯ 579Ϯ 71,3 ATCC 43504 variant K4.1 i-antigen, H type I 24.8 Ϯ 1.5 512 Ϯ 735Ϯ 3 113 Ϯ 91,3 ATCC 43504 babA KO Lex,Ley Ͻ1 Ϯ 0.08 298 Ϯ 19 0 0 This study K4.1 babA KO i-antigen, H type I Ͻ1 Ϯ 0.06 259 Ϯ 28 34 Ϯ 4 108 Ϯ 13 This study 4187 Lex,Ley 3.3 Ϯ 0.25 391 Ϯ 80 18Ϯ 23 4187 KO 379/651 i-antigen, H type I 1.3 Ϯ 0.12 538 Ϯ 14 0 84 Ϯ 93 NCTC 11637 Lex,Ley Ͻ1 Ϯ 0.03 0 0 0 5 NCTC 11637 galE mutant No Lex or Ley Ͻ1 Ϯ 0.07 0 0 0 5 NCTC 11637 rfbM mutantc No Lex or Ley Ͻ1 Ϯ 0.03 0 0 0 5

a Compared to the NCTC 11637 parent, variant 1b phase varies in an as-yet-unidentified N-acetylglusosaminyltransferase, 1c varies in ␣3-fucosyltransferase HP0651, K4.1 varies in ␣3-fucosyltransferase HP0379, and D1.1 varies both in N-acetylglusosaminyltransferase and HP0379. In strain 4187 KO 379/651, both HP0379 and HP0379 are inactivated. The Lewis phenotypes of all strains were tested repeatedly and found to be stable. b Based on two to four independent experiments. Bacterial adherence was defined as the number of bacteria per gastric pit. c rfbM codes for GDP mannose pyrophosphorylase, an enzyme specific for LPS biosynthesis.

been described before (1, 3, 6, 4), apart from strains ATCC chloramine T method, and approximately 20,000 cpm of la- 45304 KO babA and K4.1 KO babA, which were derived from beled material was incubated with bacterial cells Binding of their respective parent strains by insertional activation of the Leb to bacterial cells was expressed as the percentage of counts babA gene as described previously (4, 6). Serotyping with anti- per minute added. Binding studies were performed on three or Lewis monoclonal antibodies was done as described previously four independent occasions. In situ binding of bacteria to gas- (13). Expression of a functional BabA adhesin was investigated tric tissue was done essentially as described previously (6, 4). through binding studies with Leb coupled to human serum Briefly, bacteria were grown on agar plates, washed, and la- albumin (Isosep, Tullinge, Sweden) as described previously (4, beled with fluorescein isothiocyanate, and 200 ␮l of bacterial 6). Briefly, the neoglycoprotein was labeled with 125Ibythe suspension with an optical density at 600 nm of 0.2 was incu-

TABLE 2. In situ binding of H. pylori strain NCTC 11637 and its Lewis x-negative rfbM mutant to gastric surface mucus epithelia from patients of diverse histopathological status

Binding (mean Ϯ SEM)a of strain Patient characteristics

Patient ABO blood Lewis blood NCTC 11637 rfbM KO Gastric histopathologyb group group 10 0Normal ALeb 2 0 0 Gastritis, atrophy B Leb 357Ϯ 626Ϯ 8Normal ALeb 40 0Normal NDc Leb 5 0 0 Gastritis, atrophy ND Leb 6 134 Ϯ 838Ϯ 7** Dyplasia A Leb 7 0 0 Gastritis ND Leb 8 140 Ϯ 6 156 Ϯ 8Normal ALeb 90 0Normal NDLeb 10 6 Ϯ 2 0 Normal ND Leb 11 10 Ϯ 37Ϯ 4Normal NDLeb 12 0 20 Ϯ 3* Normal A Leb 13 306 Ϯ 21 32 Ϯ 6** Gastritis, atrophy, metaplasia ND Leb 14 0 0 Dysplasia ND Leb 15 0 0 Dysplasia ND Leb 16 119 Ϯ 18 59 Ϯ 13 Gastritis O Leb 17 336 Ϯ 8 283 Ϯ 66 Hyperplasia ND Leb 18 329 Ϯ 12 30 Ϯ 8** Normal ND Leb negative 19 0 0 Adenocarcinoma ND Leb 20 331 Ϯ 12 25 Ϯ 11** Adenocarcinoma ND Leb 21 0 0 Adenocarcinoma ND ND

a Based on two to four independent experiments. Signiﬁcant differences in binding between parent and rfbM mutant: *, P Ͻ 0.05, **, P Ͻ 0.01. b For an overview of gastric histopathology, see reference 10. c ND, not done.

Print & Media 2878 NOTES INFECT.IMMUN.

strain 17875 bound Leb very well, while its corresponding babA knockout strain was devoid of Leb binding activity. Likewise, strains ATCC 43504 and its phase variants, as well as strains 4187and 4187 KO 379/651, were found to bind Leb, although the latter two strains were less active. Hence, a potential effect of LPS structure on in situ adhesion might be concealed by BabA-dependent binding. For this reason, we constructed babA knockout mutations in strain ATCC 43504 and its Lex- negative phase variant K4.1. Inactivation indeed led to a complete loss of Leb binding. However, again no effect of LPS structure on adhesion was observed. The original observation (5) of the role of LPS in adhesion was made with strain NCTC 11637 and its Lex-negative mutants (galE and rfbM knockout strains), with the rfbM knockout strain showing the largest of decrease in adhesion. Further- FIG. 1. Binding of H. pylori 43504 (left panels) and its H type more, the binding data presented in Table 1 were obtained I-expressing LPS phase variant K4.1 (right panels) to superficial mu- with serial sections from a single patient without gastric abnor- cosa (upper panels) or deeper glandular region (lower panels). Both malities. Strikingly, strain 11637 does not bind Leb and also strains bind well to superficial mucosa, but variant K4.1 displays en- hanced binding to the deeper region does not bind to gastric tissue of this patient; the reason for this lack of binding to Leb is not known. Recently we showed that gastric inflammation affects H. pylori adhesion (8). We therefore decided to test NCTC 11637 and its rfbM knockout mutant bated with deparaffinated gastric sections from the corpus or for in situ binding to a large series of gastric tissue sections antrum. After FITC labeling, the bacteria are dead. Bacterial obtained from patients with various gastric histopathological adherence was evaluated by visually counting the number of abnormalities (Table 2). As this strain is negative for Leb adherent bacteria per gastric pit for 10 pits, each in a different binding, its binding is not mediated through an active BabA. microscopic field (magnification, ϫ200). In situ binding studies Significant binding (Ͼ50 bacteria per pit) was observed in 8 out were done on two to four independent occasions, and hence in of 21 patient sections tested. In 4 out of 21 patients, namely, total 20 to 40 pits (fields) were evaluated per strain tested. The patients 6, 13, 18, and 20, a statistically significant effect of LPS average number of adherent bacteria per pit was calculated, as structure was found, where the rfbM mutant bound less well; an well as the standard error of the mean. Significant binding was example is shown in Fig. 2. The series of sections tested were defined as Ͼ50 bacteria per gastric pit. Differences in binding obtained from patients with widely varying gastric inflamma- were calculated with the Student’s t test. In initial studies tory status, ranging from no inflammation at all through gas- (Table 1), three zones of binding were discriminated: surface tritis and atrophy, to dys-, hyper-, and metaplasia and gastric mucus cells, the parietal cell region, and the glandular region. adenocarcinoma. The sections on which the rfbM knockout In later studies (see Table 2), only the most relevant zone, i.e., strain showed decreased binding were obtained from one pa- the surface mucus epithelium, was evaluated. tient with dysplasia (patient 6), one patient with atrophy and Table 1 shows that LPS structure had no influence on in situ intestinal metaplasia (patient 13), a nonsecretor patient with- adherence to surface mucus cells. The isogenic strains not out gastric inflammation (patient 18), and one patient with expressing Lex and or Ley adhere most similarly to the parental gastric adenocarcinoma and metaplasia (patient 20), and strain. LPS phase variants D1.1 and K4.1 were compared with hence we are unable to define the circumstances under which the parental strain ATCC 43504, and the ␣3-fucosytransferase LPS-mediated adhesion, within the context of this adherence double-knockout strain 4187 KO 379/651 was compared with model, takes place. the parental strain 4187. Interestingly in comparison to the Up to now a role of LPS in in situ adhesion of H. pylori has wild-type strains, D1.1, K4.1, and 4187 KO 379/651 actually been reported for tissue sections of five patients only, i.e., the demonstrated some adherence to the deeper glandular region four described above in this study and the one described before also (binding of K4.1 is shown in Fig. 1), which suggests the by Edwards et al. (5). Therefore, NCTC 11637 and its rfbM unmasking of additional binding properties. Strains K4.1 and mutant were tested for adhesion to sections obtained from the 4187 KO 379/651 strongly express the H type I and i antigen same gastric carcinoma patient from the previous study (5), epitopes, and hence adhesion might be H type I (or i-antigen) although we used corpus sections (patient 21), while in the mediated. other study (5) antral sections were tested. To our surprise, the In contrast, inactivation of babA in strain 17875 strongly parent strain did not bind, which demonstrates that the puta- affected adherence. We reasoned that the observed lack of tive gastric lectin is unevenly distributed over the stomach. In effect of LPS structure on adhesion might be due to a BabA- a very recent study no effect of LPS structure on in situ adher- Leb high-affinity-mediated interaction, dominant over LPS- ence of H. pylori to gastric tissue sections was observed (12). mediated binding, with the gastric mucosa for strains NCTC We conclude that H. pylori LPS has a limited but distinct role 43504 and 4187 (and their phase variants and mutants, respec- in adhesion. However, the data presented here were obtained tively). We therefore decided to investigate the expression of a from in vitro adhesion experiments, and hence we dot not yet functional BabA adhesin activity through Leb-neoglycoprotein know how necessary H. pylori Lewis antigens are for in vivo binding studies for a variety of strains. Table 1 shows that colonization. Several studies have shown that they are crucial

Print & Media VOL. 71, 2003 NOTES 2879

FIG. 2. Binding of H. pylori strains to gastric mucosa in situ (histological sections) of diverse pathological conditions. The strains tested were NCTC 11637 (left column) and its galE and rfbM knockout mutants (middle and right columns, respectively). Upper row, healthy tissue, with no binding of parent and knockout strains. Second row, metaplastic tissue; the parent strain binds well, while LPS mutants show strongly decreased binding. Third row, hyperplastic tissue; LPS structure has almost no effect on binding. Lower row, noninﬂamed gastric tissue of a nonsecretor patient, with strongly decreased binding of the rfbM mutant.

Print & Media 2880 NOTES INFECT.IMMUN.

for colonization of mice. However, one recent study demon- Roberts, and N. J. High. 2000. Lewis X structures in the O antigen side-chain strated LPS structure also to be irrelevant to mouse coloniza- promote adhesion of Helicobacter pylori to the gastric epithelium. Mol. Mi- crobiol. 35:1530–1539. tion, and ␣3-fucosyltransferase knockout mutants not express- 6. Ilver, D., A. Arnqvist, J. Ogren, I. M. Frick, D. Kersulyte, E. T. Incecik, D. E. ing Lex or Ley colonized mice well (14). In addition, the Berg, A. Covacci, L. Engstrand, and T. Boren. 1998. Helicobacter pylori adhesin binding fucosylated histo-blood group antigens revealed by retag- knockout strain adhered well to human gastric celline cells. To ging. Science 279:373–377. what degree the H. pylori Lewis antigens are required for 7. Logan, S. M., J. W. Conlan, M. A. Monteiro, W. W. Wakarchuk, and E. colonization of humans remains an unanswered question, as Altman. 2000. Functional genomics of Helicobacter pylori: identification of a x beta-1,4 galactosyltransferase and generation of mutants with altered lipo- does the nature of Le -binding gastric receptors. polysaccharide. Mol. Microbiol. 35:1156–1167. 8. Mahdavi, J., B. Sonden, M. Hurtig, F. O. Olfat, L. Forsberg, N. Roche, J. We thank N. High (Manchester, United Kingdom) for providing Angstrom, T. Larsson, S. Teneberg, K. A. Karlsson, S. Altraja, T. Wadstrom, strain 11637 and its galE and rfbM knockout mutants. We thank G. D. Kersulyte, D. E. Berg, A. Dubois, C. Petersson, K. E. Magnusson, T. Faller for providing corpus sections from a patient with gastric adeno- Norberg, F. Lindh, B. B. Lundskog, A. Arnqvist, L. Hammarstrom, and T. Boren. 2002. Helicobacter pylori SabA adhesin in persistent infection and carcinoma. chronic inflammation. Science 297:573–578. We thank the Dutch Organization for Scientific Research (NWO) 9. Martin, S. L., A. A. McColm, and B. J. Appelmelk. 2000. Helicobacter pylori and Swedish Medical Research Council for a Research Visit Grant. adhesion and Lex. Gastroenterology 119:1414–1416. 10. Meining, A., A. Morgner, S. Miehlke, E. Bayerdorffer, and M. Stolte. 2001. REFERENCES Atrophy-metaplasia-dysplasia-carcinoma sequence in the stomach: a reality 1. Appelmelk, B. J., S. L. Martin, M. A. Monteiro, C. A. Clayton, A. A. McColm, or merely an hypothesis? Best Pract. Res. Clin. Gastroenterol. 15:983–998. P. Y. Zheng, T. Verboom, J. J. Maaskant, D. H. van den Eijnden, C. H. 11. Moran, A. P., E. Sturegard, H. Sjunnesson, T. Wadstrom, and S. O. Hynes. Hokke, M. B. Perry, C. M. J. E. Vandenbroucke-Grauls, and J. G. Kusters. 2000. The relationship between O-chain expression and colonization ability 1999. Phase variation in Helicobacter pylori lipopolysaccharide due to of Helicobacter pylori in a mouse model. FEMS Immunol. Med. Microbiol. changes in the lengths of poly(C) tracts in ␣3-fucosyltransferase genes. In- 29:263–270. fect. Immun. 67:5361–5366. 12. Odenbreit, S., G. Faller, and R. Haas. 2002. Role of the alpAB proteins and 2. Appelmelk, B. J., M. A. Monteiro, S. L. Martin, A. P. Moran, and C. M. lipopolysaccharide in adhesion of Helicobacter pylori to human gastric tissue. Vandenbroucke-Grauls. 2000. Why Helicobacter pylori has Lewis antigens. Int. J. Med. Microbiol. 292:247–256. Trends Microbiol. 8:565–570. 13. Simoons-Smit, I. M., B. J. Appelmelk, T. Verboom, R. Negrini, J. L. Penner, 3. Appelmelk, B. J., B. Shiberu, C. Trinks, N. Tapsi, P. Y. Zheng, T. Verboom, G. O. Aspinall, A. P. Moran, S. F. Fei, B. S. Shi, W. Rudnica, A. Savio, and J. Maaskant, C. H. Hokke, W. E. Schiphorst, D. Blanchard, I. M. Simoons- J. de Graaff. 1996. Typing of Helicobacter pylori with monoclonal antibodies Smit, D. H. van den Eijnden, and C. M. Vandenbroucke-Grauls. 1998. Phase against Lewis antigens in lipopolysaccharide. J. Clin. Microbiol. 34:2196– variation in Helicobacter pylori lipopolysaccharide. Infect. Immun. 66:70–76. 2200. 4. Boren, T., P. Falk, K. A. Roth, G. Larson, and S. Normark. 1993. Attachment 14. Takata, T., E. El Omar, M. Camorlinga, S. A. Thompson, Y. Minohara, P. B. of Helicobacter pylori to human gastric epithelium mediated by blood group Ernst, and M. J. Blaser. 2002. Helicobacter pylori does not require Lewis X antigens. Science 262:1892–1895. or Lewis Y expression to colonize C3H/HeJ mice. Infect. Immun. 70:3073– 5. Edwards, N. J., M. A. Monteiro, G. Faller, E. J. Walsh, A. P. Moran, I. S. 3079.

Editor: J. D. Clements

Print & Media Cover legend: Sialyl-Lewis x antigen-mediated adherence of the H. pylori babA-deletion mutant in situ, to gastric mucosa from a healthy (non-H. pylori infected) Rhesus monkey. The binding is confined to the deeper gastric glands where sLex antigen is expressed. In contrast, no binding was detected in surface epithelium.

Print & Media