Efficient Construction and Effective Screening of Synthetic Domain Antibody Libraries

Protocol Efficient Construction and Effective Screening of Synthetic Domain Antibody Libraries

Arghavan Solemani Zadeh 1,2,3 , Alissa Grässer 1,3, Heiko Dinter 1, Maximilian Hermes 1,3 and Katharina Schindowski 1,*

1 Institute for Applied Biotechnology, Biberach University of Applied Science, Hubertus-Liebrecht-Strasse 35, 88400 Biberach, Germany; [email protected] (A.S.Z.); [email protected] (A.G.); [email protected] (H.D.); [email protected] (M.H.) 2 Faculty of Medicine, Graduate School “Molecular Medicine”, University of Ulm, Albert-Einstein-Allee 11, 89081 Ulm, Germany 3 Faculty of Natural Sciences, University of Ulm, Albert-Einstein-Allee 11, 89081 Ulm, Germany * Correspondence: [email protected]; Tel.: +49-735-158-2498



Received: 28 December 2018; Accepted: 11 February 2019; Published: 14 February 2019


Abstract: Phage display is a powerful technique for drug discovery in biomedical research in particular for antibody libraries. But, several technical challenges are associated with the selection process. For instance, during the panning step, the successful elution of the phages bound to the antigen is critical in order to avoid losing the most promising binders. Here, we present an efficient protocol to establish, screen and select synthetic libraries of domain antibodies using phage display. We do not only present suitable solutions to the above-mentioned challenges to improve elution by 50-fold, but we also present a step by step in-depth protocol with miniaturized volumes and optimized procedures to save material, costs and time for a successful phage display with domain antibodies. Hence, this protocol improves the selection process for an efficient handling process. The here presented library is based on the variable domain (vNAR) of the naturally occurring novel antibody receptor (IgNAR) from cartilage fishes. Diversity was introduced in the Complementarity-Determining Region 3 (CDR3) of the antigen-binding site with different composition and length.

Keywords: display technology; antibody engineering; synthetic antibody library; shark antibody; vNAR; phage display; panning

1. Introduction Antibodies in particular immunoglobulin G (IgGs) are some of the most important biopharmaceutical molecules with a highly relevant market volume. Antibodies or other scaffolds have broad and diverse applications for the therapy of several diseases since they can bind almost any pharmaceutical target. To develop suitable therapeutic antibodies an efficient screening and selection technology is phage display, which allows the screening of large libraries [1,2]. Antibody phage libraries have become practical tools for the generation of monoclonal antibodies (mAb), antibody fragments like single-chain variable fragment (ScFv), antigen-binding fragments (Fab) or recombinant single-domain antibodies from camel (VHH) or shark (vNAR). The success of the selection process depends on a variety of elements including the quality and diversity of the initial library. The initial library can be either of a fully synthetic, semi-synthetic, naïve (non-immunized) or immunized (antigen-specific) origin [3–6]. However, sometimes antibodies selected from synthetic, semi-synthetic or naïve libraries show lower affinities for their antigen than antibodies selected from libraries of immunized animals, in which multiple rounds of immunization with the antigen were

Methods Protoc. 2019, 2, 17; doi:10.3390/mps2010017 www.mdpi.com/journal/mps Methods Protoc. 2019, 2, 17 2 of 19 performed. This problem can be overcome by further refinement through in vitro affinity maturation using site-directed mutagenesis or error-prone Polymerase Chain Reaction (PCR). Technically, construction of synthetic antibody libraries has the advantage of simplicity compared to the process of immunizing animals, amplifying their B-cells’ variable Ig sequences and, finally, introducing them into a phagmid vector for the phage display. Since this type of library obviates the need for animal immunization and allows selection of antibodies against many antigens including auto-antigens. Synthetic antibody libraries are constructed by introduction of degenerated nucleotides into the complementarity-determining regions (CDR) [4]. It is important to choose the appropriate framework (FR) in order to introduce diversity in the CDRs. Framework for synthetic libraries can be selected based on properties such as stability and expression of the antibody into E. coli (Escherichia coli) when phage display will be used as a technique for screening. The variable domain of shark antibody has four (hyper) variable loops: CDR1, hypervariable loop 2 (HV2), hypervariable loop 4 (HV4) and CDR3. Several studies have shown that the diversity of antibodies belongs predominantly to CDR3 loops which are tolerant to sequence and length variations [7,8]. Although methods for screening and selecting antigen-specific antibody fragments have become much more accessible, techniques for high-throughput selection with high yield, low cost and low effort are still required. Phage display is a widely used method to screen libraries. The physical linkage between the genotype and phenotype is the main strength of phage display. Therefore, filamentous phages express a foreign protein fused to a phage coat protein, i.e., pIII, displayed on their surface (phenotype). The DNA sequence of the foreign protein is cloned in-frame in front of the gene encoding the phage coat protein (genotype). The phage library is used to select and isolate binders with high affinities to the target antigen. The selection process is called biopanning [9,10]. Biopanning involves four main steps [11,12]. First, the displayed phage library is incubated on the antigen immobilized on a surface. After incubation, unbound and low-affinity binders are washed away while binders with higher affinities remain bound to the immobilized antigen. In the elution step, bound phages are eluted by pH shift or enzymatic treatment and used to infect E. coli cells for amplification. Typically, three to five rounds of biopanning are performed to enrich specifically binding phage particles. With each round of panning, the stringency of the washing steps increases and thereby the affinity of the binders improves. Even though construction and screening of synthetic libraries by phage display technology has been widely used, several challenging problems can occur:

1. By introducing randomly selected nucleotides as a cost-efficient method during the construction of the synthetic library, stop codons can occur that significantly decrease its quality by lowering the number of clones expressing a full-length protein. 2. The stronger the binders, the harder it is to elute them from their antigen and, hence, the best binders can be easily lost during the selection process. 3. A significant bottleneck of a phage display selection is the production of sufficient amounts of bioactive monoclonal binders since the low expression level of properly folded proteins from the periplasmic space can be challenging.

In this protocol, we describe a simple method for the construction of a synthetic vNAR library with codon-wise mutagenesis by using degenerated NNK codons (N means a 25% mix each of adenine, thymine, cytosine and guanine nucleotides; and K stands for a 50% mix each of thymine and guanine nucleotides). The probability of introducing a stop codon exceeds 50% after using ten continuous NNN codons, while this will only happen after sixteen codons in case of using NNK codons. The NNK degenerated codons code for all 20 amino acids and only for the amber stop codon (TAG or amber codon) while NNN primers code for all three stop codons [4,13]. The TAG stop codon can be translated to glutamine in E. coli strains with a glutamine-inserting amber (UAG) suppressor tRNA (SupE), such as TG1. Hence, using TG1 can abolish the effect of introducing stop codons. Furthermore, using NNK primers decreases codon redundancy, i.e., arginine encoded with six codons is reduced Methods Protoc. 2019, 2, 17 3 of 19 to three possible codons. Hence, this design increases the possibility of introducing amino acids like tryptophan, which are encoded by one codon only. The advantage of such a design is that the oligonucleotide can be easily synthesized at low costs [14] compared to other methods avoiding stop codons [15,16]. Another challenging step in the phage display process is the elution of bound phages during biopanning. In general, one of these three methods are used to either reduce the antigen-binder interaction or to cleave the phages from their displayed binder protein: (1) low pH [17], (2) high pH [18], or (3) enzymatic cleavage by trypsin. For this protocol, a phagemid was chosen, which possesses a cleavage site for trypsin. However, since the standard procedure for the trypsin digest was insufficient (see Table 2), we have improved the elution process by applying trypsin in two steps. By using these measures, we could improve the elution by 50-fold. Sufficient production of monoclonal binders in a 96-well plate is highly critical for phage display selection. Because of the small volume of medium in the wells of a 96-well plate, it is difficult to express them in a sufficient amount. Furthermore, expression of immunoglobulin-based binding proteins in the periplasmic space can result in partially unfolded or aggregated species [19] and such proteins exhibit a decreased bioactivity in the enzyme-linked immunosorbent assay (ELISA) [20]. Therefore, we have implemented a tailored periplasmic buffer, which results in an improved release of proteins from the periplasmic space. The increased amount of bioactive binding protein results in higher signals in the monoclonal ELISA.

2. Experimental Design The vNAR antibody scaffold used for synthetic shark antibody library is based on HEL-5A7, a type I vNAR produced by Helen Dooley from an immunized library against lysozyme [21]. This template was used by Shao et al. to construct a synthetic vNAR library [22]. The framework was chosen due to its high stability and functional expression in prokaryotic systems. It was synthesized with flanking NcoI and NotI restriction sites at its 5’ and 3’ end, respectively, for subsequent cloning into a pSEX81 phagemid vector. Sequence diversity is confined to the CDR3 region. Completely randomized sequences are used with different lengths (Table1) and with two cysteines in conserved positions, corresponding to a type I vNAR. CDR3 diversification is achieved in a two-step splicing by overlap extension polymerase chain reaction (OE-PCR; Figure1). Diversity in CDR3 is introduced by using randomized primer and HEL-5A7 as a template.

Table 1. List of used oligonucleotides. N: any base; A: Adenine; G: Guanine; C: Cytosine; T: Thymine; M means a 50% mix each of amino (A or C) nucleotides in reverse primers.

Name Sequence (50-30) ForFR1_NcoI GCATGACCATGGCTCGAGTGGACCAAACACCG RevFR4_NotI GCATGAGCGGCCGCTTTATTCACAGTCACGGCAGTGCCAT For_pSex GTATGTTGTGTGGAATTGTG Rev_pSex GTTTTGTCGTCTTTCCAG CGGCAGTGCCATCTCCGCA(MNN) GCA(MNN) - RevRan_12 3 2 ACA(MNN)5GAGACCGCAACGATACGTGCCAC CGGCAGTGCCATCTCCGCA(MNN) GCA(MNN) - RevRan_13 6 1 ACA(MNN)4GAGACCGCAACGATACGTGCCAC CGGCAGTGCCATCTCCGCA(MNN) GCA(MNN) - RevRan_16 6 3 ACA(MNN)5GAGACCGCAACGATACGTGCCAC CGGCAGTGCCATCTCCGCA(MNN) GCA(MNN) - RevRan_18 6 4 ACA(MNN)6GAGACCGCAACGATACGTGCCAC CGGCAGTGCCATCTCCGCA(MNN) GCA(MNN) - RevRan_20 5 5 ACA(MNN)8GAGACCGCAACGATACGTGCCAC CGGCAGTGCCATCTCCGCA(MNN) GCA(MNN) - RevRan_23 6 5 ACA(MNN)10GAGACCGCAACGATACGTGCCAC Methods Protoc. 2019, 1, x FOR PEER REVIEW 1 of 20 Methods Protoc. 2019, 2, 17 4 of 19

Figure 1. Schematic representation of the improved protocol.protocol.

Methods Protoc. 2019, 1, x; doi: FOR PEER REVIEW www.mdpi.com/journal/mps Methods Protoc. 2019, 2, 17 5 of 19

The amplified vNAR fragments and the pSEX81 vector are digested with NcoI and NotI and ligated to construct the recombinant phagemid ((Figure1A 1 ). Then, the ligated phagemid is transformed into electrocompetent E. coli TG1 and plated on 2X TY-GA agar plate (Figure1A 2 – 3 ). 90 clones of this produced library are sent for sequencing for qualification and quantification of the library. Afterwards, collected clones are used for infection with helper phage and production of phage antibody library (Figure1B 4 ). After infection, amplified phages that are present in the supernatant are precipitated and ready for selection of binders (Figure1B 5 ). Panning is performed according to Hust et al. [23] with some improvements. Here, four panning rounds against recombinant human tumor necrosis factor alpha (TNF alpha) are described. But, this protocol can be used for any other protein antigen, as well. When the antigen is incubated with the phages, the wells are washed stringently, and the phages are eluted by incubation with trypsin for proteolytic cleavage. The eluted phages are then used to infect E. coli TG1 bacteria and titers are determined by plating of different dilutions. For subsequent rounds of selections, colonies from the first round are scraped from agar plates, and phages are produced in liquid culture, PEG-purified and selected by binding to antigen. After three or four rounds of panning, 109 phages of each round are used for a polyclonal phage ELISA to evaluate the enrichment (Figure1C 6 ). Individual clones are isolated from the enriched rounds of panning (usually last round of panning), grown overnight, and soluble fragments are produced in a 96-well plate format (Figure1C 7 ). ELISA identifies antigen-specific monoclonal binders (Figure1C 8 ). Finally, the positive clones are sequenced and analyzed. Based on the ELISA results, suitable clones can be selected and sub-cloned into either a prokaryotic or a eukaryotic expression plasmid for protein production.

2.1. Materials • MICROLON® microplate, 96-well, F-bottom, high-binding (Greiner, Frickenhausen, Germany; Cat. no.: 655 061) • Cellstar®, 96 Well Suspension Culture Plate, U-bottom (Greiner, Frickenhausen, Germany; Cat. no.:650001) • PCR grade water (Thermo Fisher Scientific, Darmstadt, Germany; Cat. no.: AM9932) • dNTP mix (Thermo Fisher Scientific, Darmstadt, Germany; Cat. no.: R0191) • Platinum™ II Hot-Start Green PCR Master Mix (2X) (Thermo Fisher Scientific, Darmstadt, Germany; Cat. no.: 1400101) • T4 DNA ligase (5 U/µL; Thermo Fisher Scientific, Darmstadt, Germany; Cat. no.: EL0011) • Agarose (Carl Roth, Karlsruhe, Germany; Cat. no.: 11388983001) • 100 base pair(s) (bp) ladder (New England Biolabs, Frankfurt am Main, Germany; Cat. no.: N0551G) • NcoI Restriction Enzyme (New England Biolabs, Frankfurt am Main, Germany; Cat. no.: R0193) • NotI Restriction Enzyme (New England Biolabs, Frankfurt am Main, Germany; Cat. no.: R0189) • Anti-human IgG Peroxidase conjugate (Sigma-Aldrich Chemie GmbH, Munich, Germany; Cat. no.: A0545) • Anti-M13 pIII monoclonal antibody (New England Biolabs, Frankfurt am Main, Germany; Cat. no.: E8033) • Anti-M13 pVIII filamentous phages antibody (PROGEN, Heidelberg, Germany; Cat. no: 65197) • Anti-mouse IgG Peroxidase conjugate (Sigma-Aldrich Chemie GmbH, Munich, Germany; Cat. no.: A8924) • Anti-Penta-His TM monoclonal antibody (Merck Millipore, Darmstadt, Germany; Cat. no.: 70796) • GeneRuler™ DNA Ladder Mix (Thermo Fisher Scientific, Darmstadt, Germany; Cat. no.: SM0331) • Lysozyme (Carl Roth, Karlsruhe, Germany; Cat. no.: 8259.1) • Maximo Taq DNA Polymerase (GeneOn, Ludwigshafen, Germany; Cat. no.: S101) • Ampicillin (Sigma-Aldrich Chemie GmbH, Munich, Germany; Cat. no.: A9393) • Kanamycin (Sigma-Aldrich Chemie GmbH, Munich, Germany; Cat. no.: 60615) Methods Protoc. 2019, 2, 17 6 of 19

• Trypsin (Sigma-Aldrich Chemie GmbH, Munich, Germany; Cat. no.: T1426) • E. coli TG1:F0 [traD36 proAB+ lacIq lacZ∆M15] supE thi-1 ∆(lac-proAB) ∆(mcrB-hsdSM)5, (rK-mK-) (Lucigen, Middleton, USA; Cat. no.: 60502). • Phagemid pSEX81 (PROGEN, Heidelberg, Germany; Cat. no: PR3005) • Hyperphage (PROGEN, Heidelberg, Germany; Cat. no. PRHYPE-XS) • Oligonucleotide primers for PCR are listed in Table1. • Gene Pulser®/MicroPulser™ Electroporation Cuvettes, 0.2 cm gap (Micropulser™, Bio-Rad, Munich, Germany; Cat. no.: 1652082) • PEG-8000 (Sigma-Aldrich Chemie GmbH, Munich, Germany; Cat. no.: 729108-1G) • Monarch™ DNA Gel Extraction Kit (New England Biolabs, Frankfurt am Main, Germany; Cat. no.: T1020G) • M13KO7 helper phages (New England BioLabs, Frankfurt am Main, Germany; Cat. no.: N0315S) • 1-Step™ Ultra 3,30,5,50-Tetramethylbenzidine-enzyme-linked immunosorbent assay (TMB-ELISA) (Thermo Fisher Scientific, Darmstadt, Germany; Cat. no.: 34028) • 6X DNA Gel Loading Dye (Thermo Fisher Scientific, Darmstadt, Germany; Cat. no.: R0611) • Agar-Agar Carl Roth (Carl Roth, Karlsruhe, Germany; Cat. no.: 6494.4) • Agarose (Biozym Scientific, Oldendorf, Germany; Cat. no.: 840004) • 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Carl Roth, Karlsruhe, Germany; Cat. no.: 9105.4) • Roti-Safe Gel Stain (Carl Roth, Karlsruhe, Germany; Cat. no.: 3865.1) • Tryptone/Peptone (Carl Roth, Karlsruhe, Germany; Cat. no.: 8952.4) • Tween® 20 (Carl Roth, Karlsruhe, Germany; Cat. no.: 9127.2) • Yeast extract (Carl Roth, Karlsruhe, Germany; Cat. no.: 2363.1) • Roti®-Prep Plasmid MINI (Carl Roth, Karlsruhe, Germany; Cat. no.: HP29.2) • GeneJet PCR purification kit (Thermo Fisher Scientific, Darmstadt, Germany; Cat. no.: K0702)

2.2. Oligonucleotides The oligonucleotides used in this protocol are listed in Table1. The primers ForFR1_NcoI and RevFR4_NotI are designed to add the restriction enzyme sites NotI and NcoI to both ends of the vNAR gene. RevRan_13-20 primers contain NNK repeats used to randomize the CDR3 region of the vNAR during PCR.

2.3. Equipment • Toptable Centrifuge 5427R (Eppendorf, Hamburg, Germany; Cat. no.: 5409000012) • Electrophoresis gel tank and power pack (VWR Peqlab, Lutterworth, UK; Cat. no.: 700-0444) • Electroporator Gene Pulser® (Micropulser™) (Bio-Rad, Munich, Germany; Cat. no.: 1652100) • Fusion FX Gel Documentation (Vilber Lourmat, Collégien, France; Cat.: no.: 826) • New Brunswick Innova 4200 Incubator (Eppendorf, Hamburg, Germany; Cat. no.: NB-4200) • NanoDrop 1000 Spectrophotometer (Thermo Scientific, Waltham, MA, USA; Cat.: 25627) • PCR Cycler Eppendorf Mastercycler (Eppendorf, Hamburg, Germany; Cat. no.: 5332) • SpectraMax M Series Multi-Mode Microplate Readers (Molecular Devices, San Jose, CA, USA; Cat. no.: MLDVM2)

2.4. Software • Vector NTI Advance 11 • GraphPad Prism version 7 Software (GraphPad Software Inc., La Jolla, CA, USA) • CLC Main Workbench 8.0.1 (QIAGEN Redwood City, CA, USA) Methods Protoc. 2019, 1, x FOR PEER REVIEW 3 of 20

Methods Protoc. 2019, 2, 17 7 of 19 fusion proteins on the surface of M13 bacteriophages. It further contains the bacterial pectate lysate (pelB) signal sequence responsible for periplasmic transport of the fusion proteins. It also codes for 3.an Procedure ampicillin resistance by β-lactamase for antibiotic selection. The antibody-pIII fusion protein can be overexpressed by Isopropyl β-D-1-thiogalactopyranoside (IPTG) induction through the lactose β- The phagemid pSEX81 is used for the construction of the library and preparation of phage galactosidase (LacZ) promotor. Finally, the vector contains the bacterial ColE1 ori and the intergenic antibody particles. This vector is designed for the expression of functional recombinant scFv-pIII region of phage f1 as the origin of replication. The plasmid map and the used restriction enzyme NcoI fusion proteins on the surface of M13 bacteriophages. It further contains the bacterial pectate lysate and NotI locations are depicted in Figure 2. (pelB) signal sequence responsible for periplasmic transport of the fusion proteins. It also codes for For the first round of panning, hyperphages are used to infect the library for oligovalent display. an ampicillin resistance by β-lactamase for antibiotic selection. The antibody-pIII fusion protein can For the subsequent panning rounds, helper phages are used for monovalent display. This will be overexpressed by Isopropyl β-D-1-thiogalactopyranoside (IPTG) induction through the lactose increase the selection stringency. β-galactosidase (LacZ) promotor. Finally, the vector contains the bacterial ColE1 ori and the intergenic Affinity maturation may be performed to improve the binding of a selected antibody by region of phage f1 as the origin of replication. The plasmid map and the used restriction enzyme NcoI introducing more diversity into hypervariable regions 1 or 2 or CDR1. and NotI locations are depicted in Figure2.

Figure 2. Vector map of phagemid pSEX81. (A) Original pSEX81 phagemid with single chain variable fragments.Figure 2. Vector (B) Recombinant map of phagemid pSEX81_vNARs. pSEX81. (A The) Original variable pSEX81 domain phagemid of shark wi antibodyth single is chain cloned variable into a pSEX81fragments. plasmid (B) Recombinant by NcoI and NotpSEX81_vNARs.I restriction enzymes, The variable in fusion doma within of the shark pelB antibody leader at is the cloned N-terminal into a andpSEX81 pIII plasmid at the C-terminal by NcoI and part Not ofIthe restriction antibody. enzymes, in fusion with the pelB leader at the N-terminal and pIII at the C-terminal part of the antibody. For the first round of panning, hyperphages are used to infect the library for oligovalent display. For3.1. theIn vitro subsequent Synthesis panning of Variable rounds, DNA helper Fragments phages and are Cloning used forinto monovalent the Phagemid display. pSEX81. This will increase the selection stringency. AffinityTime for maturationCompletion: may 3 days be performed to improve the binding of a selected antibody by introducing1. For each more reaction diversity with into different hypervariable randomized regions reverse 1 or 2 primer, or CDR1. add the followings material to nuclease-free water to make a final volume of 50 µL in a PCR tube on ice: 25 µL of Platinum™ II 3.1. In vitro Synthesis of Variable DNA Fragments and Cloning into the Phagemid pSEX81 Hot-Start Green PCR Master Mix, 10 µL Platinum™ GC Enhancer (provided by PCR master mix), 5Time ng of for template Completion: DNA (HEL-5A7) 3 days and finally add 1 µL of each 10 µM primers (final concentration 0.2 µM). Use ForFR1_NcoI as forward primer and one of the randomized reverse primers 1. (RevRan_12For each reaction to RevRan_23) with different for each randomized reaction. Mi reversex well and primer, briefly add centrifuge the followings the contents. material to 2. Performnuclease-free PCR with water the to following make a final set up: volume initial of denaturation 50 µL in a PCR at 94 tube °C onfor ice:2 min. 25 µThenL of proceed Platinum for™ 20II cycles Hot-Start as follows: Green PCR 5 s at Master 98 °C, Mix,annealing 10 µL at Platinum 60 °C for™ 15GC s and Enhancer elongation (provided of fragments by PCR for master 15 s atmix), 68 °C. 5 ng of template DNA (HEL-5A7) and finally add 1 µL of each 10 µM primers (final 3. Loadconcentration PCR samples 0.2 µ ontoM). Usea 1% ForFR1_NcoI agarose gel and as forwardrun the gel primer at 110 and V. oneInspect of the the randomized gel under UV reverse light. Exciseprimers the (RevRan_12 bands around to RevRan_23) 350 bp length for and each extract reaction. them Mix from well the and agarose briefly centrifugegel using the the DNA contents. gel ◦ 2. extractionPerform PCR kit, according with the following to manufacturer’s set up: initial protocol. denaturation Elute the at DNA 94 C of for each 2 min. PCR Then reaction proceed with for 10 ◦ ◦ µL20 nuclease-free cycles as follows: water. 5 s at 98 C, annealing at 60 C for 15 s and elongation of fragments for 15 s ◦ 4. Useat 68 theC. eluted PCR product for a second PCR to introduce restriction digestion sites. Proceed as 3. itLoad is described PCR samples in step onto 2, use a 1% ForFR1_NcoI agarose gel and runRevFR4_NotI the gel at 110as primers V. Inspect for the the gel reaction. under UV light. 5. DigestExcise both, the bands the PCR around products 350 bp and length the andpSEX81 extract plasmid them fromwith theNco agaroseI and Not gelI. usingFor this, the prepare DNA gel a totalextraction volume kit, of according50 µL digestion to manufacturer’s reaction for the protocol. PCR products Elute the (at DNA least of 4 eachµg) by PCR adding reaction 2 µL with (20 units)10 µL of nuclease-free each enzyme water. NcoI and NotI, 5 µL of 10X NEB3 buffer and adjust the volume reaction up 4. toUse 50 theµL with eluted nuclease-free PCR product water. for a secondFor the PCRplasmi tod, introduce digest 20 restriction µg of the digestionpSEX81 vector, sites. Proceedadd 15 µL as it is described in step 2, use ForFR1_NcoI and RevFR4_NotI as primers for the reaction. Methods Protoc. 2019, 1, x; doi: FOR PEER REVIEW www.mdpi.com/journal/mps

Methods Protoc. 2019, 1, x FOR PEER REVIEW 4 of 20

units) of each enzyme NcoI and NotI, 5 µL of 10X NEB3 buffer and adjust the volume reaction up to 50 µL with nuclease-free water. For the plasmid, digest 20 µg of the pSEX81 vector, add 15 µL of 10X NEB3 buffer, 10 µL (100 units) of each enzyme NcoI and NotI and add nuclease-free water up to 150 µL. Incubate for 3 h at 37 °C following 10 min at 65 °C. 6. After restriction digestion, purify DNA fragments using GeneJet PCR purification kit according to the manufacturer’s instruction. Elute each purified digested sample in 20 µL water. 7. Run the digested plasmid on a 1% agarose gel and cut out the target band quickly with a scalpel on a UV-transilluminator table. Purify the DNA fragments from the agarose gel using the Monarch™ DNA Gel Extraction Kit, following the manufacturer’s instructions. Elute in 100 µL Methodspreheated Protoc. 2019sterile, 1, x H FOR2O. PEER Determine REVIEW the concentration by Nanodrop 1000 spectrophotometer. 4 of 20 PAUSE STEP: The extracted and purified digested DNA fragments can be stored at −20 °C Methods Protoc.units)until2019 of use. ,each2, 17 enzyme NcoI and NotI, 5 µL of 10X NEB3 buffer and adjust the volume reaction8 of 19 up 8. Ligateto 50 theµL digestedwith nuclease-free fragments water. by preparing For the plasmifollowingd, digest material: 20 µg Calculate of the pSEX81 the amount vector, of add needed 15 µL insertof 10X for NEB3 100 ng buffer, of the 10 plasmid µL (100 with units) these of each molar enzyme ratios: Nco 1:0.5,I and 1:1, Not 1:2I vector:and add insert. nuclease-free Add 1 µL water of 5. Digest both, the PCR products and the pSEX81 plasmid with NcoI and NotI. For this, prepare ligase,up to 1 150 µL µL.of Ligase Incubate buffer for 3(10X) h at and37 °C water following to 10 µL.10 min Keep at at65 16°C. °C overnight following 10 min a total volume of 50 µL digestion reaction for the PCR products (at least 4 µg) by adding 2 µL 6. at After65 °C. restriction digestion, purify DNA fragments using GeneJet PCR purification kit according (20 units) of each enzyme NcoI and NotI, 5 µL of 10X NEB3 buffer and adjust the volume reaction 9. Transformto the manufacturer’s 2 µL of ligation instructio reactionn. Eluteby elec eachtroporation purified digestedinto TG1 samplecells. Plate in 20 100 µL µL water. of 10 −2, 10−3, up to 50 µL with nuclease-free water. For the plasmid, digest 20 µg of the pSEX81 vector, add 7. andRun 10 −the4 dilutions digested on plasmid 2X TY-GA on a agar 1% agaroseplates and gel incubateand cut out overnight the target at 37band °C. quickly with a scalpel 15 µL of 10X NEB3 buffer, 10 µL (100 units) of each enzyme NcoI and NotI and add nuclease-free 10. Measureon a UV-transilluminator the cloning efficiency table. by colony Purify PCR the wiDNAth For_pSEX fragments and from Rev_pSEX the agarose primers. gel Forusing this, the water up to 150 µL. Incubate for 3 h at 37 ◦C following 10 min at 65 ◦C. pickMonarch™ 50 individual DNA clones, Gel Extraction mix each Kit,clone following with 20 µLthe of manufacturer’s water and cook instructions. them at 95 °CElute for in10 100min. µL 6. After restriction digestion, purify DNA fragments using GeneJet PCR purification kit according Laterpreheated centrifuge sterile them H2 O.and Determine take 2 µL the of thconcentratione supernatant by as Nanodrop a template 1000 for thespectrophotometer. PCR. to the manufacturer’s instruction. Elute each purified digested sample in 20 µL water. 11. Based PAUSEon the STEPresult: Theof cloning extracted efficiency, and purified prep digestedare the DNAfinal fragmentsligation reaction can be storedfor the at best-−20 °C 7. Run the digested plasmid on a 1% agarose gel and cut out the target band quickly with a scalpel on determineduntil use.ratio. For each insert with specific CDR3 length, add 2 µg of plasmid and an a UV-transilluminator table. Purify the DNA fragments from the agarose gel using the Monarch™ 8. appropriateLigate the amountdigested of fragments each insert by intopreparing 100 µL foll reactionowing volume.material: Incubate Calculate at the 16 °Camount for 16 of h, needed heat DNA Gel Extraction Kit, following the manufacturer’s instructions. Elute in 100 µL preheated forinsert 10 min for at100 65° ng C of and the purify plasmid using with GeneJet these molar PCR purificationratios: 1:0.5, kit.1:1, Elute1:2 vector: each insert.reaction Add in 201 µL µL of sterile H O. Determine the concentration by Nanodrop 1000 spectrophotometer. andligase, pool 21 all µL the of sampleLigase buffertogether. (10X) and water to 10 µL. Keep at 16 °C overnight following 10 min atPAUSE PAUSE65 °C. STEP STEP:: The After extracted stopping and the purified reaction, digested the mix DNA can be fragments stored at can−20° be C storeduntil further at −20 use.◦C 9. untilTransform use. 2 µL of ligation reaction by electroporation into TG1 cells. Plate 100 µL of 10−2, 10−3, −4 8.3.2. TransformationLigateand 10 the digesteddilutions in Electrocompetent fragmentson 2X TY-GA by preparing TGagar1 and plates Library following and Construction.incubate material: overnight Calculate at 37 the °C. amount of needed 10. Measure the cloning efficiency by colony PCR with For_pSEX and Rev_pSEX primers. For this, insertTime forfor 100Completion: ng of the plasmidtwo days with or four these days molar including ratios: 1:0.5,preparation 1:1, 1:2 of vector: competent insert. cells Add 1 µL of ligase,pick 50 1 µ individualL of Ligase clones, buffer (10X)mix each and clone water with to 10 20µ L.µL Keep of water at 16 and◦C overnightcook them following at 95 °C for 10 10 min min.

atCRITICALLater 65 ◦C. centrifuge STEP: them In order and taketo increase 2 µL of the the transformation supernatant as efficiency,a template prepare for the PCR.electrocompetent cells on the same day of transformation and avoid freezing the cells before transformation. 9. 11.TransformBased on 2 µtheL ofresult ligation of reactioncloning byefficiency, electroporation prepare into the TG1 final cells. ligation Plate 100reactionµL of 10for− 2,the 10 −best-3, anddetermined 10−4 dilutions ratio. on For 2X TY-GAeach insert agar plateswith specif and incubateic CDR3 overnight length, add at 37 2◦ C.µg of plasmid and an 3.2.1. Preparationappropriate ofamount Electrocompetent of each insert TG1. into 100 µL reaction volume. Incubate at 16 °C for 16 h, heat 10. Measure the cloning efficiency by colony PCR with For_pSEX and Rev_pSEX primers. For this, for 10 min at 65° C and purify using GeneJet PCR purification kit. Elute each reaction in 20 µL pickThe 50protocol individual described clones, here mix is each based clone on withthe method 20 µL of from water the and Sidhu cook and them co-workers at 95 ◦C for[24,2]. 10 min. and pool all the sample together. Later centrifuge them and take 2 µL of the supernatant as a template for the PCR. CRITICAL PAUSE STEP: STEP: Chill After all stopping the material the reaction, including the HEPES, mix can glycerol, be stored H at2O, − 20°pipettes C until and further tips at use. 0 11. Based°C. Centrifuge on the result and of rotor cloning must efficiency, be precooled prepare to the 2 °C. final ligation reaction for the best-determined 12. ratio.Pick a Forfresh each clone insert of E.coli with TG1 specific from CDR3 2X TY-agar length, addplate 2 intoµgof 20 plasmid mL 2X TY and medium an appropriate in a 125 amountmL flask 3.2. Transformation in Electrocompetent TG1 and Library Construction.◦ ◦ ofand each incubate insert at into 37 100°C withµL reaction vigorous volume. shaking Incubate at 220 rounds at 16 perC for min 16 (rpm) h, heat overnight. for 10 min at 65 C Time for Completion: two days or four days including preparation of competentµ cells 13. andThe next purify day, using add GeneJet the overnight PCR purification culture to 1 kit.L fresh Elute 2X each TY in reaction a 5 L flask in 20 (withL and starting pool OD all600 the at samplearound CRITICAL together.0.1) and STEP: incubate In order at 37 °Cto increaseand 180 therpm transformation until an optical efficiency, density OD prepare600 of 0.7. electrocompetent 14. DistributePAUSEcells on STEP:the the flask sameAfter content day stopping of equallytransformation the into reaction, two and ster the avile mixoid 500 canfreezing mL be centrifuge stored the cells at − bottles 20before◦ C untiland transformation. cool further down use. on ice for 30 min. 3.2.15.3.2.1. TransformationCentrifuge Preparation for in 5 Electrocompetentof min Electrocompetent with 5,000 TG1x g atTG1. and 2 °C. Library All subsequent Construction. centrifugation steps should be done with 5,000 x g at 2 °C. TimeThe for protocol Completion: described two dayshere is or based four days on the including method preparationfrom the Sidhu of competent and co-workers cells [24,2]. 16. Remove the supernatant of both bottles carefully and re-suspend each pellet in 500 mL cold H CRITICAL2O/HEPESCRITICAL (see STEP: STEP: reagentIn Chill order setup). all to the increase Addmaterial a the sterile including transformation magn HEPES,etic stir efficiency, glycerol,bar to prepareeach H2O, bottle pipettes electrocompetent to completelyand tips at 0 dissolvecells°C. Centrifuge on the the pellets same and on day arotor ofmagnetic transformation must bestirrer. precooled and avoid to 2 °C. freezing the cells before transformation. 17.12. Centrifuge Pick a fresh for clone 10 min of E.coliand repeat TG1 from the prev 2X TY-agarious step plate with into another 20 mL 500 2X mLTY mediumcold H2O/HEPES. in a 125 mL flask 3.2.1. Preparationand incubate of Electrocompetentat 37 °C with vigorous TG1. shaking at 220 rounds per min (rpm) overnight. 13.The The protocol next day, described add the here overnight is based culture on the to method 1 L fresh from 2X the TY Sidhu in a 5 and L flask co-workers (with starting [2,24]. OD600 at Methods Protoc. 2019, 1, x; doi: FOR PEER REVIEW www.mdpi.com/journal/mps around 0.1) and incubate at 37 °C and 180 rpm until an optical density OD600 of 0.7. CRITICAL STEP: Chill all the material including HEPES, glycerol, H O, pipettes and tips at 14. Distribute the flask content equally into two sterile 500 mL centrifuge2 bottles and cool down on 0 ◦C. Centrifuge and rotor must be precooled to 2 ◦C. ice for 30 min.

12. 15.PickCentrifuge a fresh clone for 5 ofminE. with coli TG1 5,000 from x g 2Xat 2 TY-agar °C. All platesubsequent into 20 centrifugation mL 2X TY medium steps should in a 125 be mL done flaskwith and 5,000 incubate x g at at2 °C. 37 ◦C with vigorous shaking at 220 rounds per min (rpm) overnight. 16. Remove the supernatant of both bottles carefully and re-suspend each pellet in 500 mL cold 13. The next day, add the overnight culture to 1 L fresh 2X TY in a 5 L flask (with starting OD600 at H2O/HEPES (see reagent setup).◦ Add a sterile magnetic stir bar to each bottle to completely around 0.1) and incubate at 37 C and 180 rpm until an optical density OD600 of 0.7. dissolve the pellets on a magnetic stirrer. 14. Distribute the flask content equally into two sterile 500 mL centrifuge bottles and cool down on 17. Centrifuge for 10 min and repeat the previous step with another 500 mL cold H2O/HEPES. ice for 30 min. 15. Centrifuge for 5 min with 5000× g at 2 ◦C. All subsequent centrifugation steps should be done Methodswith Protoc. 5000× 2019g at, 1,2 x;◦ doi:C. FOR PEER REVIEW www.mdpi.com/journal/mps

Methods Protoc. 2019, 1, x FOR PEER REVIEW 4 of 20

units) of each enzyme NcoI and NotI, 5 µL of 10X NEB3 buffer and adjust the volume reaction up to 50 µL with nuclease-free water. For the plasmid, digest 20 µg of the pSEX81 vector, add 15 µL of 10X NEB3 buffer, 10 µL (100 units) of each enzyme NcoI and NotI and add nuclease-free water up to 150 µL. Incubate for 3 h at 37 °C following 10 min at 65 °C. 6. After restriction digestion, purify DNA fragments using GeneJet PCR purification kit according to the manufacturer’s instruction. Elute each purified digested sample in 20 µL water. 7. Run the digested plasmid on a 1% agarose gel and cut out the target band quickly with a scalpel on a UV-transilluminator table. Purify the DNA fragments from the agarose gel using the Monarch™ DNA Gel Extraction Kit, following the manufacturer’s instructions. Elute in 100 µL preheated sterile H2O. Determine the concentration by Nanodrop 1000 spectrophotometer. PAUSE STEP: The extracted and purified digested DNA fragments can be stored at −20 °C until use. 8. Ligate the digested fragments by preparing following material: Calculate the amount of needed insert for 100 ng of the plasmid with these molar ratios: 1:0.5, 1:1, 1:2 vector: insert. Add 1 µL of ligase, 1 µL of Ligase buffer (10X) and water to 10 µL. Keep at 16 °C overnight following 10 min at 65 °C. 9. Transform 2 µL of ligation reaction by electroporation into TG1 cells. Plate 100 µL of 10−2, 10−3, and 10−4 dilutions on 2X TY-GA agar plates and incubate overnight at 37 °C. 10. Measure the cloning efficiency by colony PCR with For_pSEX and Rev_pSEX primers. For this, pick 50 individual clones, mix each clone with 20 µL of water and cook them at 95 °C for 10 min. Later centrifuge them and take 2 µL of the supernatant as a template for the PCR. 11. Based on the result of cloning efficiency, prepare the final ligation reaction for the best- Methods Protoc. 2019, 2, 17 9 of 19 determined ratio. For each insert with specific CDR3 length, add 2 µg of plasmid and an appropriate amount of each insert into 100 µL reaction volume. Incubate at 16 °C for 16 h, heat 16. Removefor 10 min the supernatantat 65° C and ofpurify both using bottles GeneJet carefully PCR and purification re-suspend kit. each Elute pellet each in reaction 500 mL in cold 20 µL H2andO/HEPES pool all (seethe sample reagent together. setup). Add a sterile magnetic stir bar to each bottle to completely dissolve PAUSE the pellets STEP: on After a magnetic stopping stirrer. the reaction, the mix can be stored at −20° C until further use. 17. Centrifuge for 10 min and repeat the previous step with another 500 mL cold H2O/HEPES. 18. 3.2.Discard Transformation the supernatant in Electrocompetent and resuspend TG1 and each Library pellet Construction. in 50 mL cold glycerol/HEPES. Pool the bacteriaTime for suspension Completion: of both two bottles days or into four a fresh days sterileincluding centrifugation preparation bottle of competent without transferringcells the stir bars. CRITICAL STEP: In order to increase the transformation efficiency, prepare electrocompetent 19. Centrifuge for 15 min. Remove the supernatant and re-suspend the pellet in 1 mL cold cells on the same day of transformation and avoid freezing the cells before transformation. glycerol/HEPES (see reagent setup). 20. Distribute this volume into 300 µL aliquots. Use immediately for transformation. 3.2.1. Preparation of Electrocompetent TG1. 3.2.2. TransformationThe protocol described of Electrocompetent here is basedE. colion theTG1 method by Electroporation from the Sidhu and co-workers [24,2]. ◦ CRITICAL CRITICAL STEP: STEP:Cool Chill at leastall the 6 cuvettesmaterial andincluding slides ofHEPES, the gene glycerol, pulser H down2O, pipettes to 2 C. and For tips each at 0 control°C. Centrifuge and test sample, and rotor prepare must 0.950be precooled mL of SOC to 2 in °C. 2 mL tubes and 5 sterile 100 mL Erlenmeyer 12. Pickflasks a fresh with 25clone mL of SOC E.coli each TG1 for from the 2X samples. TY-agar plate into 20 mL 2X TY medium in a 125 mL flask and incubate at 37 °C with vigorous shaking at 220 rounds per min (rpm) overnight. µ 21. 13.Apply The next this settingday, add for the the overnight gene pulser: culture 2.5 kV to and1 L fresh 25 F. 2X TY in a 5 L flask (with starting OD600 at 22. Foraround negative 0.1) control, and incubate dry the at aluminum 37 °C and electrodes 180 rpm until of the an first optical cuvette density with tissueOD600 paper,of 0.7. add 50 µL 14.of Distribute electrocompetent the flask cells content to the equally cuvette, into put two the cuvettesterile 500 in the mL holder, centrifuge push bottles in into and the genecool pulserdown on andice start for 30 the min. electric pulse. Now, the cells are very fragile and you need to add pre-warmed SOC 15.medium Centrifuge immediately. for 5 min Rinsewith 5,000 the cuvette x g at 2 a °C. few All times subsequent with SOC centrifugation medium and steps put it should quickly be into done thewith incubator. 5,000 x g at 2 °C. 23. 16.For Remove the positive the supernatant control add 1ofµ Lboth of highly bottles pure carefull pSEX81y and plasmid re-suspend to 50 µ Leach of the pellet cells in and 500 perform mL cold theH electroporation2O/HEPES (see asreagent described setup). above. Add a sterile magnetic stir bar to each bottle to completely 24. Adddissolve 10–15 theµL pellets of purified on a ligationmagnetic mixture stirrer. to 300 µL of electrocompetent E. coli. Gently tab the 17.bottom Centrifuge of cuvette for 10 on min the and bench repeat to avoid the prev bubbleious formation.step with another After electroporation, 500 mL cold H2O/HEPES. immediately transfer the cells into the 125 mL flask and wash the cuvette with the prewarmed medium. 25. Repeat step 24 for the other ligation reactions. Methods Protoc. 2019, 1, x; doi: FOR PEER REVIEW www.mdpi.com/journal/mps ◦ 26. Shake the entire samples at 37 C in 220 rpm for 45–60 min. 27. Pool the library and plate 100 µL of 10−2 to 10−5 dilutions of the library, 10−1 and 10−2 dilutions of the positive control and 100 µL of the undiluted negative control on 2X TY-GA plates. 28. Centrifuge the rest of library suspension at 3220× g for 10 min and discard the supernatant. Resuspend the pellet in 5 mL SOC medium and plate on five 150-mm 2X TY-GA plates. 29. Incubate the plates overnight at 37 ◦C. 30. To estimate the transformation titer, plate 100 µL of 10−3 and 10−4 dilutions of the cells on 2X TY-GA agar plates. 31. The transformation titer is calculated as:

no. o f colonies × (ml recovery medium culture) × 1000 (µl/ml) 100 (µl plated) × dilution fold (10−3 or 10−4)

32. Centrifuge the remaining cells (2000× g, 15 min), and resuspend the pellet in 1000 µL of 2X TY medium. Plate the suspended bacteria on a 150 mm diameter 2X TY-GA agar plate and incubate overnight at 37 ◦C. 33. The next morning, add 5 mL of SB medium to the 150 mm diameter agar plates and scrape the bacteria using flame-sterilized glass spreader. Add glycerol to the final concentration of 10% glycerol and mix well. 34. Prepare 1 mL aliquots, and store at −80 ◦C. Methods Protoc. 2019, 2, 17 10 of 19

3.3. Phage Preparation and Selection of vNARs against Antigen by Phage Display Total time for completion: 3–4 weeks (includes 3 days for packaging, 2 weeks for panning, 2 days for packaging, 2 days for phage titration)

3.3.1. Packaging of Synthetic Library Employing Hyperphage (M13KO7∆pIII). 35. Thaw aliquot of frozen antibody library on ice. Add it to 500 mL 2X TY-GA medium. The initial ◦ OD600 should be approximately 0.1. Grow the culture at 37 C, 250 rpm in a 2 L glass flask until OD600 = 0.5 (approximately 1.5–2 h). 36. Add 1 × 1012 M13KO7 hyperphages to the culture and incubate at 37 ◦C without shaking for 15 min following 30 min vigorous shaking. 37. Spin the culture at 3200× g for 15 min and discard the supernatant. 38. Resuspend pellets in 500 mL of 2X TY-AK medium. 39. Grow for 16–20 h at 28 ◦C, 250 rpm in a 2 L glass flask. 40. The next day, centrifuge the culture for 20 min at 5500× g and 4 ◦C. 41. Add 1/4 volume of PEG/NaCl solution (see Reagent setup) to precipitate the produced phage binder from the culture supernatant. 42. Following four hours of incubation on ice, pellet the antibody phages by centrifugation for 60 min at 5500× g and 4 ◦C. 43. Re-suspend the white phage pellet in 1 mL PBS. 44. To remove E. coli particles and bacterial debris, centrifuge the solution three times for 5 min. 45. Collect the supernatant and transfer it to a new 1.5 mL tube containing 250 µL of PEG/NaCl. 46. Incubate it on ice for 30 min. Then pellet the precipitated phages by centrifugation at 17,900× g for 10 min and discard the supernatant. 47. To remove the final traces of PEG, centrifuge again for another 2 min at 17,900× g and carefully remove the remaining supernatant. 48. Re-suspend the phages in 0.5 mL PBS. This supernatant contains the phage particles. Store them at 4 ◦C. These phages are used for the first round of panning.

3.3.2. Panning of vNAR Library against an Antigen (Here TNF Alpha Was Used) 49. For the first panning round, use 4 µg protein/well per panning, for the following rounds use 1 µg protein/well for more stringent conditions. Dissolve the antigen and incubate in a microtiter plate well overnight at 4 ◦C. Coating conditions (incubation temperature and coating buffer) should be set-up for the antigen of interest. Prepare overnight culture of TG1 cells grown on minimal medium (M9) by transferring 1 colony from fresh culture to 5 mL LB. Growth of TG1 on minimal medium selects for cells with F’ factor. 50. For biopanning of the synthetic library, coat 2 µg of the antigen TNF alpha in 150 µL of 50 mM ◦ NaHCO3 (pH 9.6) on a 96-well well plate incubated at 4 C overnight 51. The following day, remove the coating solution from the plate by tapping on a clean tissue. Wash the coated well three times with PBST in an ELISA washer or squirt bottle and block with 300 µL MPBST for 2 h at room temperature (RT). 52. After blocking, wash the well once with PBST and one to three times with PBS. 53. For binding of the antibody phages, incubate 1011 antibody phages in 200 µL blocking buffer for 1 h without shaking and 1 h at RT and gentle agitation (200 rpm). Meanwhile, inoculate 5 mL 2X ◦ TY with 500 µL of the overnight culture of E. coli TG1 and grow at 37 C, 250 rpm to an OD600 0.5. The culture can be kept at 4 ◦C until use. For the following round of panning change the blocking buffer to BSA-PBST to eliminate nonspecific binding of phages to the blocking buffer. 54. Discard the unbound phages by washing 10 times with PBST and 10 times with PBS for 2 min each. Increase the Tween® 20 concentration by 0.1% for each washing step. For the subsequent Methods Protoc. 2019, 2, 17 11 of 19

panning rounds, increase the washing steps to 15 (round 2) and 20 (round 3 and 4) steps with PBST, respectively. 55. Elute phage particles by using 50 µL trypsin solution (corresponding to Solution A in Table2) for 30 min at 37 ◦C. Repeat this step two times. Decrease the incubation time to 20 min. This will ensure the detachment of all bound phage particle and increase the yield of the panning process. Remove the supernatant containing the eluted phages and store it at 4 ◦C for the infection.

Table 2. Comparison of the efficiency of different elution protocols: solution A: 10 mM Tris pH 7.4, 137

mM NaCl, 1 mM CaCl2 and 100 µg/mL Trypsin; solution B: 1.4% Triethylamin in H2O pH 10; solution C: 0.2 M glycine-HCl, pH 2.2.

Elution Method Readout Solutions Used Time (min) Normalized Phage Titer solution A 30 32× solution B 10 3× solution C 10 1× solution A + solution B 30 + 10 30× solution B (two times) 10 + 10 18× solution A (two times) 30 + 20 50×

56. Add 100 µL of a log-phased E. coli TG1 to the trypsinated well and infect 500 µL of a log-phased E. coli TG1 culture in 2X TY medium with the eluted phages from step 55. Incubate both, first for 30 min at 37 ◦C without shaking and then the following 30 min with moderate shaking (250 rpm). Combine both suspensions. 57. After infection, plate 100 µL of the total volume from step 56 in serial dilutions (10−2 to 10−4 in 2X TY medium) on 2X TY-GA agar plates and incubated overnight at 37 ◦C. 58. Centrifuge the rest of the suspension for 20 min at 3200× g at RT. 59. Suspend the pellet in 1000 µL 2X TY-GA medium and incubate overnight at 30 ◦C and 200 rpm. 60. The next day, centrifuge the suspension for 10 min at 3200× g and suspend the pellet in 1000 µL fresh 2X TY-GA medium. 61. Scrap the colonies from the agar plates and add to the suspension. Add 100 µL glycerol (100%) and mix thoroughly. 62. Prepare 100 µL aliquots and store at –20 ◦C until further use.

3.3.3. Packaging of Phagemid 63. For the subsequent round of panning, the eluted phages should be packaged and reamplified. Inoculate 1 mL of 2X TY-GA medium with 20 µL of the glycerol stock obtained after panning. Grow the culture for about 3 h at 37 ◦C 200 rpm. 64. Infect the cells with 2 × 109 cfu (colony forming units) of M13KO7 helper phages and incubate for 1 h at 37 ◦C and 200 rpm. 65. To remove the medium, centrifuge the infected culture for 30 min at 3200× g and 4 ◦C. Discard the supernatant. 66. Suspend the pellet in 500 µL 2X TY/AK medium and incubate for 16 h at 30 ◦C 200 rpm for phage production. 67. The next day, pellet the bacteria twice by centrifugation for 10 min at 3200 rpm and 4 ◦C to precipitate the phages. Add 1/5 volume of PEG/NaCl solution to the supernatant and incubate for 1 h on ice. 68. To pellet the phages, centrifuge the solution for 1 h at 3200× g and 4 ◦C. 69. Resuspend the white phage pellet in 100 µL PBS and store at 4 ◦C. Methods Protoc. 2019, 2, 17 12 of 19

3.3.4. Phage Titration. 70. Make serial dilutions of the phage suspension in PBS. The number of eluted phage depends on several parameters (e.g., antigen, library, panning rounds, washing stringency). 71. Infect 50 µL bacteria with 10 µL of different phage dilutions (10−6, 10−7, 10−8) and incubate 30 min at 37 ◦C.

• Note: Check all solutions for phage contamination. To check the PBS or PEG solutions, use 10 µL of these solutions for E. coli “infection”. In parallel, plate out non-infected TG1 to check the bacteria.

72. Plate the 60 µL infected bacteria on 2X TY-GA agar plates. 73. Incubate the plates overnight at 37 ◦C. 74. Count the colonies and calculate the cfu or cfu/mL titer according to the dilution:

c f u number of colonies = µl (the volume of phages used) x (dilution)

3.4. Screening and Selection of Antigen Binders. Total time for completion (without sequencing): 3–4 days (includes 5–6 h for polyclonal ELISA, 1–2 days for production, 7–8 h for monoclonal ELISA).

3.4.1. Polyclonal Phage ELISA The enrichment of antigen-binding phages is evaluated via a polyclonal phage ELISA. Here, the vNARs from each round of panning are displayed on the tip of the phages. Therefore, the immobilized phages are detected by an antibody against pVIII expressed on the phages’ surface.

75. For this, coat a 96-well plate with 50 ng of TNF alpha in 100 µL 50 mM NaHCO3 (pH 9.6) in duplicate for each round of panning and incubated overnight at 4 ◦C. 76. The following day, wash the coated wells three times with 200 µL PBST and then block with 300 µL MPBST for 2 h at RT. 77. After three washing steps with each 200 µL PBST, add 109 cfu phage amplificate from each panning round to each well and incubate the plate for 1.5 h at RT. 78. After incubation, wash the wells three times with 200 µL PBST 79. Add 100 µL of a 1:100 dilution of anti-pVIII monoclonal antibody in blocking buffer and incubate for an additional 1 h at RT. 80. Wash the plates as above, and add 100 µL of a 1:10,000 dilution of the secondary antibody anti-mouse IgG peroxidase conjugate in blocking buffer and incubate for a further hour at RT. 81. After three washing steps add 100 µL of 1-Step™ Ultra TMB-ELISA substrate for color development to each well.

82. Stop the reaction by the addition of 100 µL of 1 M sulfuric acid (H2SO4). 83. Measure the absorbance at 450 nm using a SpectraMax Reader or a similar absorption reader.

3.4.2. Production of Soluble Monoclonal Antibody Fragments in Microtitre Plates

The soluble vNARs are produced in fusion with pIII of the phagemid (vNAR-pIII, Figure1C 8 ). Therefore, the soluble fragments are detected with an anti-pIII antibody in the ELISA described below.

84. Take 20 µL of phage-antibody particles either from the last round of panning or the one with the highest enrichment, add 50 µL of trypsin solution and incubate for 30 min at 37 ◦C. 85. Infect 500 µL exponentially growing TG1 bacteria for 30 min at 37 ◦C. Methods Protoc. 2019, 2, 17 13 of 19

86. Prepare different dilution series; 10−2–10−4 and plate them on 2X TY-GA and incubate overnight at 37 ◦C. 87. The next day, fill each well of a 96 well U-bottom polypropylene plate with a total volume of 1 mL per well with 100 µL 2X TY-GA. 88. Inoculate each well with an individual clone using sterile tips. Consider two wells for negative control to check the contamination of the wells and two wells for positive clone (containing pSEX81-Hel5A7). Seal the plate with a breathable sealing film. 89. Incubate overnight at 37 ◦C and 250 rpm. 90. Transfer 10 µL of overnight culture to a new 96 well plate and add 150 µL 2X TY-GA. Incubate ◦ at 37 C and 250 rpm for approximately 2–3 h to reach an OD600 of 0.7–0.9. To the rest of the overnight culture add 10 µL glycerol, mix well, and store at −80 ◦C. 91. Centrifuge the plate for 10 min at 4000 rpm, remove the medium carefully and add 150 µL 2X TY medium, suspend the pellet and centrifuge again. 92. Add 150 µL 2X TY-A with 100 µM IPTG and incubate overnight at 30 ◦C and 250 rpm. 93. Centrifuge for 10 min at 4000 rpm. Transfer the antibody fragment containing supernatant to a new polypropylene plate (first supernatant) and store at 4 ◦C. 94. Add 100 µL of the periplasmic buffer to the pellet, resuspend and incubate on ice for 30 min. Centrifuge the plate, remove the supernatant (second supernatant) and combine it with the first supernatant. Keep at 4 ◦C until the next step.

3.4.3. ELISA for Detection of Antigen Binding Monoclonal Soluble Antibody Fragments

95. Coat 50 ng of antigen into 96 well plates in 100 µL of carbonate buffer (50 mM NaHCO3; pH 9.6) or PBS for coating. For the positive control, coat 100 µL of 1 mg/mL of lysozyme and 50 ng of BSA as a negative control. Incubate overnight at 4 ◦C or 1 h at 37 ◦C. 96. Next day, wash the coated wells three times with 200 µL PBST and then block with 300 µL MPBST for at least 1 h at RT. 97. Mix 100 µL of soluble antibody fragments (combined first and second supernatant) with 100 µL of blocking buffer and add them to coated wells. Incubate for 90 min at RT. 98. Wash 3 times with PBST. 99. As a primary antibody, use a 1:1000 dilution of an anti pIII monoclonal antibody and incubate for 1 h at RT. 100. Add secondary antibody and proceed with the steps 80–83 of Section 3.4.1.

3.4.4. Sequencing 101. To determine the nucleotide sequence of plasmid DNA, DNA samples should be sent to sequencing. The sequencing of our sample was performed at GATC BIOTECH AG (Köln, Germany). The resulting data of the sequencing can be analyzed using the software of Vector NTI or CLC Main Workbench 8 or any similar software.

4. Expected Results

4.1. In Vitro Synthesis of Variable DNA Fragments After the amplification of DNA fragment using the reverse randomized primer with different lengths, you will get different bands from 350 to 400 bp based on each reverse primer used for the PCR reaction (see Figure3). The PCR reaction can be improved by decreasing the template and/or primers. Methods Protoc. 2019, 1, x FOR PEER REVIEW 9 of 20

102.Methods Add Protoc. secondary 2019, 1, xantibody FOR PEER and REVIEW proceed with the steps 80–83 of Section 3.4.1. 9 of 20 102. Add secondary antibody and proceed with the steps 80–83 of Section 3.4.1. 3.4.4. Sequencing. 103.3.4.4. To Sequencing. determine the nucleotide sequence of plasmid DNA, DNA samples should be sent to sequencing. The sequencing of our sample was performed at GATC BIOTECH AG (Köln, 103. To determine the nucleotide sequence of plasmid DNA, DNA samples should be sent to Germany). The resulting data of the sequencing can be analyzed using the software of Vector sequencing. The sequencing of our sample was performed at GATC BIOTECH AG (Köln, NTI or CLC Main Workbench 8 or any similar software. Germany). The resulting data of the sequencing can be analyzed using the software of Vector NTI or CLC Main Workbench 8 or any similar software. 4. Expected Results 4. Expected Results 4.1. In Vitro Synthesis of Variable DNA Fragments 4.1. AfterIn Vitro the Synthesis amplification of Variable of DNA DNA fragment Fragments using the reverse randomized primer with different lengths, you will get different bands from 350 to 400 bp based on each reverse primer used for the After the amplification of DNA fragment using the reverse randomized primer with different PCR reaction (see Figure 3). The PCR reaction can be improved by decreasing the template and / or lengths, you will get different bands from 350 to 400 bp based on each reverse primer used for the primers. PCR reaction (see Figure 3). The PCR reaction can be improved by decreasing the template and / or Methodsprimers. Protoc. 2019, 2, 17 14 of 19

Figure 3. Amplified vNAR fragments with randomized CDR3 separated on 1% agarose gel. M: 6 µL FigureGeneRuler™ 3. Amplified DNA Ladder vNAR Mi fragmentsx is used with as a randomizedmarker. R1 to CDR3 R6: PCR separated reactions on with 1% agarose degenerated gel. M: CDR3 6 µL Figure 3. Amplified vNAR fragments with randomized CDR3 separated on 1% agarose gel. M: 6 µL GeneRulerprimers with™ DNAthe length Ladder of 12, Mix 13, is 14, used 18, as 20 a and marker 23 bp,. R1 respectively. to R6: PCR reactions with degenerated CDR3 GeneRuler™ DNA Ladder Mix is used as a marker. R1 to R6: PCR reactions with degenerated CDR3 primers with the length of 12, 13, 14, 18, 20 and 23 bp, respectively. primers with the length of 12, 13, 14, 18, 20 and 23 bp, respectively. 4.2. Colony PCR 4.2. Colony PCR 4.2. Colony PCR PCR is used to evaluate the quality of cloning and transformation and to determine Colony PCR is used to evaluate the quality of cloning and transformation and to determine whether the insert is present in the plasmid. The position of primers on the plasmid and expected whetherColony the insert PCR isis presentused to inevaluate the plasmid. the quality The position of cloning of primersand transformation on the plasmid and and to determine expected size of the fragments are shown in Figure 4B. For a successful construction of the antibody library, at sizewhether of the the fragments insert is arepresent shown in inthe Figure plasmid.4B. ForThe a position successful of constructionprimers on the of plasmid the antibody and expected library, least 90% of the clones should give a PCR band (Figure 4A). This will ensure that it can be used for atsize least of 90%the fragments of the clones are should shown givein Figure a PCR 4B. band For (Figurea successful4A). This construction will ensure of thatthe antibody it can be usedlibrary, for at the selection of binders against the antigen of interest. theleast selection 90% of of the binders clones against should thegive antigen a PCR of band interest. (Figure 4A). This will ensure that it can be used for the selection of binders against the antigen of interest.

(A) (B) Figure 4. (A) Gel electrophoresis(A ofof) colony-PCRcolony-PCR fromfrom randomlyrandomly pickedpicked(B clones)clones toto estimateestimate thethe correctcorrect insertioninsertion rate.rate. Positive Positive clones clones are are defined defined by havinghaving an insert in thethe rangerange 570–600570–600 bpbp (+,(+, positivepositive Figure 4. (A) Gel electrophoresis of colony-PCR from randomly picked clones to estimate the correct control HEL-5A7; −, negative control H2O). (B) The position of primers used for colony PCR is shown insertion rate. Positive clones are defined by having an insert in the range 570–600 bp (+, positive on the plasmid map (bla, beta-lactamase/ampicillin resistance). Methods Protoc. 2019, 1, x; doi: FOR PEER REVIEW www.mdpi.com/journal/mps 4.3. Sequencing of Selected Clones from vNAR Library with Randomized CDR3 Methods Protoc. 2019, 1, x; doi: FOR PEER REVIEW www.mdpi.com/journal/mps To further evaluate the quality of the library, the distribution of amino acids in the artificial CDR3 libraries needs to be assessed via sequencing. As shown in Figure5, the clones of the library constructed with a randomized primer for CDR3 differed in the length and composition of their CDR3. Figure5 shows some possible sequences for CDR3 when using randomized primers. Some clones will be the same as the used template. For this synthetic library, 5% of the sequenced clones were identical to the template Hel-5A7. To decrease the number of identical clones, it is recommended to either use as less template as possible for the PCR reaction or to digest the parental DNA with DpnI in case the parental DNA plasmid was propagated in standard E. coli strains. Also, frameshift mutations can be detected in amplified fragments, although the primers used contain only multiples of 3 codons. These errors introduced by oligonucleotides can lead to nonsense codon (clone 2) or very different sequence in CDR3 and the rest of vNAR framework 4 (clone 3). Such framework shifts occurred in 40% of the sequenced clones. Errors in primers also can lead to deletion of conserved cysteine, which prevents the formation of the stabilizing disulphide bond (clone 4). Presence of amber stop codon (clone 5) occurred in 8% of the sequenced clones. As long as SupE strains of E. coli are used in phage display, this codon can be mostly read as glutamine (Q). Finally, other clones will represent the array used in primers Methods Protoc. 2019, 1, x FOR PEER REVIEW 10 of 20

control HEL-5A7; −, negative control H2O). (B) The position of primers used for colony PCR is shown on the plasmid map (bla, beta-lactamase/ampicillin resistance).

4.3. Sequencing of Selected Clones from vNAR Library with Randomized CDR3 To further evaluate the quality of the library, the distribution of amino acids in the artificial CDR3 libraries needs to be assessed via sequencing. As shown in Figure 5, the clones of the library constructed with a randomized primer for CDR3 differed in the length and composition of their CDR3. Figure 5 shows some possible sequences for CDR3 when using randomized primers. Some clones will be the same as the used template. For this synthetic library, 5% of the sequenced clones were identical to the template Hel-5A7. To decrease the number of identical clones, it is recommended to either use as less template as possible for the PCR reaction or to digest the parental DNA with DpnI in case the parental DNA plasmid was propagated in standard E. coli strains. Also, frameshift mutations can be detected in amplified fragments, although the primers used contain only multiples of 3 codons. These errors introduced by oligonucleotides can lead to nonsense codon (clone 2) or very different sequence in CDR3 and the rest of vNAR framework 4 (clone 3). Such framework shifts occurred in 40% of the sequenced clones. Errors in primers also can lead to deletion of conserved cysteine, which prevents the formation of the stabilizing disulphide bond (clone 4). Presence of amber stop codon (clone 5) occurred in 8% of the sequenced clones. As long as SupE strains of E.coli are used Methods Protoc. 2019, 2, 17 15 of 19 in phage display, this codon can be mostly read as glutamine (Q). Finally, other clones will represent the array used in primers with different length and two conserved cysteines (clone 6 to clone 13). By withusing different this protocol length and twoby ensuring conserved that cysteines the librar (cloney is large 6 to clone enough, 13). Bythe usingnumber this of protocol clones with and bythe ensuringabove-mentioned that the library problems is large is enough,rather low, the numberand a sufficient of clones amount with the of above-mentioned binding protein problems against the is ratherantigen low, of andinterest a sufficient can be obtained. amount of binding protein against the antigen of interest can be obtained.

FigureFigure 5. The5. The amino amino acid compositionacid composition of a synthetic of a vNARsynthetic library vNAR with variablelibrary CDR3:with variable Representative CDR3: sequencesRepresentative of different sequences clones of are different compared clones to theare templatecompared sequence to the template (Hel-5A7). sequence For simplicity, (Hel-5A7). only For CDR3simplicity, is presented only CDR3 here. Stopis presented codons are here. shown Stop as co andons asterisk are shown (*) and aas dash an asterisk (-) represents (*) and deletion a dash of (-) anrepresents amino acid. deletion of an amino acid. 4.4. Enrichment of Panning Round 4.4. Enrichment of Panning Round One critical step in each panning round is the elution of bound phages with their displayed vNAR to theOne antigen critical of interest. step in So,each harsh panning washing round steps is arethe usedelution in thisof bound process. phages For example, with their the displayed number ofvNAR washing to the steps antigen is increased of interest. and So, the harsh concentration washing steps of Tween are ®used20 isin alsothis increasedprocess. For in subsequentexample, the ® panningnumber round. of washing In addition, steps non-specificis increased elutionand the may concentration cause a problem. of Tween Rather 20 harsh is also conditions increased are in neededsubsequent to elute panning strong round. binders, In butaddition, they shall non-specific not harm elution the quality may ofcause the phages.a problem. The Rather titer of harsh the elutedconditions phages are is needed determined to elute to evaluatestrong binders, the enrichment but they andshall thereby not harm the the quality quality of thisof the panning phages. step The aftertiter each of the round eluted of panning.phages is After determined using standard to evalua conditionste the enrichment for elution and (i.e., thereby solution the C), quality a polyclonal of this panning step after each round of panning. After using standard conditions for elution (i.e., solution ELISA was performed on the plate used for biopanning. Surprisingly, a high ELISA signal (data not shown)Methods correspondingProtoc. 2019, 1, x; doi: to aFOR high PEER number REVIEW of phages that are still bound either specificallywww.mdpi.com/journal/mps to the antigen or un-specifically to the well. Therefore, we tested several different methods to elute the phages after biopanning (Table2 and Figure6). Figure6 shows the recovered phages after each panning around with different elution buffers. To sum up the results, using two trypsinization steps in solution A increased the number of colony forming units (cfu) that arose after infection with the eluted phages on average by 50-fold. Moreover, by adding the bacteria directly to the well with potentially remaining target-bound phages after the trypsinization, even more phages harboring potential good binders can be recovered by infecting the bacteria with their phagemid. In the above-presented protocol, all these steps are already included to guarantee an optimal result after biopanning. Methods Protoc. 2019, 1, x FOR PEER REVIEW 11 of 20

C), a polyclonal ELISA was performed on the plate used for biopanning. Surprisingly, a high ELISA signal (data not shown) corresponding to a high number of phages that are still bound either specifically to the antigen or un-specifically to the well. Therefore, we tested several different methods to elute the phages after biopanning (Table 2 and Figure 6). Figure 6 shows the recovered phages after each panning around with different elution buffers. To sum up the results, using two trypsinization steps in solution A increased the number of colony forming units (cfu) that arose after infection with the eluted phages on average by 50-fold. Moreover, by adding the bacteria directly to the well with potentially remaining target-bound phages after the trypsinization, even more phages harboring potential good binders can be recovered by infecting the bacteria with their phagemid. In the above-presented protocol, all these steps are already included to guarantee an optimal result after biopanning.

Table 2. Comparison of the efficiency of different elution protocols: solution A: 10 mM Tris pH 7.4,

137 mM NaCl, 1 mM CaCl2 and 100 µg/mL Trypsin; solution B: 1.4% Triethylamin in H2O pH 10; solution C: 0.2 M glycine-HCl, pH 2.2.

Elution Method Readout Solutions Used Time (min) Normalized Phage Titer solution A 30 32× solution B 10 3× solution C 10 1× solution A + solution B 30 + 10 30× solution B (two times) 10 + 10 18× Methods Protoc. 2019, 2, 17 16 of 19 solution A (two times) 30 + 20 50×

Figure 6.6. TheThe numbernumber of of transforming transforming phages phages after after each ea roundch round of panning of panning varies varies with different with different elution elutionmethods. methods. Two subsequent Two subsequent trypsinization trypsinization steps in step solutions in solution A clearly A demonstratedclearly demonstrated the highest the highest elution elutionefficiency efficiency of infectious of infectious phages. phages.

To checkcheck the the enrichment enrichment of specificallyof specifically binding binding phages, phages, a polyclonal a polyclonal phage ELISA phage was ELISA performed. was Thisperformed. ELISA providesThis ELISA essential provides information essential about information the enrichment about the during enrichment the screening during process the screening in phage processdisplay. in Here, phage a representative display. Here, synthetic a representative vNAR library synthetic waspanned vNAR againstlibrary thewas immobilized panned against antigen the TNFimmobilized alpha and antigen four rounds TNF alpha of biopanning and four wererounds performed. of biopanning The stringency were performed. of washing The wasstringency increased of washingeach selection was roundincreased while each the amountselection of round immobilized while TNFthe alphaamount is decreasedof immobilized from one TNF round alpha to the is decreasednext. The resultsfrom one of a round representative to the next. polyclonal The results phage of ELISA a representative are shown inpoly Figureclonal7: aphage steady ELISA increase are Methods Protoc. 2019, 1, x FOR PEER REVIEW 12 of 20 shownin the antigen in Figure binding 7: a steady was observed increase forin the polyclonalantigen binding phage was over observed the four selectionfor the polyclonal rounds. phage over the four selection rounds. Polyclonal phage ELISA

0.8

Round 1 0.6 Round 2 Methods Protoc. 2019, 1, x; doi: FOR PEER REVIEW www.mdpi.com/journal/mps Round 3 0.4

bance [450 nm] [450 bance Round 4 r 0.2 Abso

0.0 a a SA h ha lp ph lpha B a BSA al BSA BSA alp F TN TNF TNFa TNF

Figure 7. Polyclonal phage ELISA for all rounds of panning against TNF alpha as an antigen and BSA Figureas a control. 7. Polyclonal Phage pools phage of ELISA each panning for all rounds round of are panni exposedng against to immobilized TNF alpha TNF as alpha.an antigen BSA and was BSA used asas a a control. control antigenPhage pools for each of each panning panning round roun sinced are BSA exposed was used to immobili for blockingzed TNF the wells. alpha. Increase BSA was in usedabsorbance as a control was observedantigen for during each panning the selection round rounds. since BSA was used for blocking the wells. Increase in absorbance was observed during the selection rounds. 4.5. Monoclonal Selection of Antibody Fragments 4.5. MonoclonalAfter performing Selection the of Antibody panning Fragments rounds for selection, large numbers of enriched clones should be evaluatedAfter performing by polyclonal the phagepanning ELISA rounds or byfor ELISA selection, for thelarge monoclonal numbers of soluble enriched antibody clones fragments.should be evaluatedHere, we by describe polyclonal a direct phage approach ELISA or to by analyze ELISA the for selectedthe monoclonal clones basedsoluble on antibody their expression fragments. as Here,functional we describe vNAR–pIII a direct fusion approach proteins to andanalyze detection the selected via an clones anti-pIII based monoclonal on their antibody.expression Theas functionalprocedure vNAR–pIII for the production fusion prot of solubleeins and antibody detection fragments via an inanti fusion-pIII withmonoclonal pIII was antibody. adapted fromThe procedureMersmann for et al.the [ 25production] and Hust of et soluble al. [20]. antibody Based on fragments their methods in fusion for soluble with pIII expression was adapted in a 96-well from Mersmannformat, these et fusional. [25] proteins and Hust are et produced al. [20]. Based and released on their into methods the medium for soluble by E. coliexpressionand can bein a harvested 96-well format,from the these supernatants. fusion proteins But, we are found produced out that and in released many cases into the the produced medium levelsby E. ofcoli soluble and can native be harvestedproteins are from too the low supernatants. for further But, characterization. we found out Hence,that in many a special cases periplasmic the produced buffer levels was of soluble used to nativeimprove proteins the recovery are too low of proteins for further from characterizat the periplasmicion. Hence, space aand special to increase periplasmic the concentrationbuffer was used of to improve the recovery of proteins from the periplasmic space and to increase the concentration of vNARs in the supernatant. As shown in Figure 8, this procedure using both, the periplasmic and the supernatant fractions, improved the detection of the soluble fragments by two- to threefold compared to the conventional harvesting of the supernatant only. Clones with OD450 ten-fold higher to blank are chosen for further investigation. Figure 8 shows some representative clones selected from the 4th round of panning, which showed the highest binding to their antigen according to results of the polyclonal ELISA (see Section 4.4). Here, as a positive control, lysozyme was coated and detected with Hel-5A7, the starting template of this synthetic library. Hel-5A7 was cloned into phagemid vector and expressed under the same condition as other clones obtained from the 4th round of panning (see Section 3.4.2).

Methods Protoc. 2019, 1, x; doi: FOR PEER REVIEW www.mdpi.com/journal/mps

Methods Protoc. 2019, 2, 17 17 of 19 vNARs in the supernatant. As shown in Figure8, this procedure using both, the periplasmic and the supernatant fractions, improved the detection of the soluble fragments by two- to threefold compared to the conventional harvesting of the supernatant only. Clones with OD450 ten-fold higher to blank are chosen for further investigation. Figure8 shows some representative clones selected from the 4th round of panning, which showed the highest binding to their antigen according to results of the polyclonal ELISA (see Section 4.4). Here, as a positive control, lysozyme was coated and detected with Hel-5A7, the starting template of this synthetic library. Hel-5A7 was cloned into phagemid vector and expressed under the same condition as other clones obtained from the 4th round of panning Methods(see Section Protoc. 3.4.22019, ).1, x FOR PEER REVIEW 13 of 20

Figure 8.8.Enzyme-linked Enzyme-linked immunosorbent immunosorbent assay (ELISA)assay of(ELISA) soluble vNAR-pIIIof soluble fusion vNAR-pIII proteins againstfusion proteins(A) Tumor against necrosis (A factor) Tumor (TNF) necrosis alpha as factor antigen (TNF) and (alphaB) Bovine as antigen serum albumin and (B) (BSA) Bovine as controlserum albuminfrom selected (BSA) clones as control of the mostfrom enrichedselected roundclones of of panning. the most Data enriched obtained round with of the panning. conventional Data method are displayed as white bars and data from the improved method as grey bars. For higher obtained with the conventional method are displayed as white bars and data from the throughput, clones were determined as n=1. HEL-5A7 was determined against coated lysozyme as a improved method as grey bars. For higher throughput, clones were determined as n=1. positive control and against BSA as blank. HEL-5A7 was determined against coated lysozyme as a positive control and against BSA 5. Reagentsas blank. Setup 1. Kanamycin solution: Dissolve kanamycin powder at 50 mg/mL in deionized water. Filterthrough 5. Reagents Setup 0.2 µm filter. Aliquot in 1 mL portions. Can be stored at −20 ◦C. 1.2. KanamycinAmpicillin solution: solution: Dissolve Dissolve kanamycin ampicillin powder powder at at 100 50 mg/mL in in deionized deionized water. water. Filterthrough Filterthrough 0.20.2 µmµm filter. filter. Aliquot Aliquot in in 1 1mL mL portions. portions. Can Can be be stored stored at at−20− °C.20 ◦ C indefinitely. ThawedAliquots 2. Ampicillinshould be solution: freshly diluted Dissolve 1000-fold ampicillin into powder medium at or 100 agar. mg/mL in deionized water. Filterthrough 3. 0.2Glucose µm filter. solution Aliquot (40%): in Dissolve1 mL portions. 400 g of Can glucose be stored in 1 L at of deionized−20 °C indefinitely. water. Filter ThawedAliquots through0.2 µm shouldfilter. Canbe freshly be stored diluted at 4 ◦1000-foldC for several into months.medium or agar. 3. Glucose solution (40%): Dissolve 400 g of glucose in 1 L of deionized water. Filter through0.2 µm 4. 2X TY medium pH 7.0: 1.6% (w/v) tryptone, 1% (w/v) yeast extract, 0.5% (w/v) NaCl) filter. Can be stored at 4 °C for several months. 5. 2X TY-GA: 2X TY, 100 mg/mL ampicillin, 100 mM glucose 4. 2X TY medium pH 7.0: 1.6% (w/v) tryptone, 1% (w/v) yeast extract, 0.5% (w/v) NaCl) 6. 2X TY-GA agar plates: Dissolve 10 g tryptone, 5 g yeast extract, and 10 g NaCl in 1L water. Add 5. 2X TY-GA: 2X TY, 100 mg/mL ampicillin, 100 mM glucose 15 g agar-agar and autoclave. Cool down below 50 ◦C, add 1 mL of filter-sterilized ampicillin 6. 2X TY-GA agar plates: Dissolve 10 g tryptone, 5 g yeast extract, and 10 g NaCl in 1L water. Add (100 mg/mL) and 50 mL of 40% (w/v) filter sterilized glucose. Mix with gentle stirring and fill 15 g agar-agar and autoclave. Cool down below 50 °C, add 1 mL of filter-sterilized ampicillin (100 one-third of 100 mm or 150 mm diameter polystyrene Petri dishes. Keep the plates at 4 ◦C. mg/mL) and 50 mL of 40% (w/v) filter sterilized glucose. Mix with gentle stirring and fill one- third of 100 mm or 150 mm diameter polystyrene Petri dishes. Keep the plates at 4 °C. 7. SB medium pH 7.0: Dissolve 30 g tryptone, 20 g yeast extract and 10 g MOPS (3-[ N-morpholino]– propanesulfic acid) in 1L water. Dissolve and autoclave. 8. Minimal medium agar plate: Add 5.6 g 5X M9 salt and 15 g agar to 500 mL of deionized water and autoclave. When cooled to 50-45° C, add 1 mL of 1 M MgSO4 (autoclaved), 0.1 mL of 1 M CaSO4 (autoclaved), 5 mL of 40% glucose, and 0.25 mL of 1% thiamine HCl (filter-sterilized). Mix with gentle stirring and pour on polystyrene Petri dishes. Keep the plates at 4 °C. 9. SOC medium: Add 20 g of tryptone, 5 g of yeast extract and 0.5 g of NaCl to 950 mL of deionized water. Shake well and add 10mL of a 250 mM KCl. Adjust the pH of the medium to 7.0. autoclave for 20 min. Add 5 mL of a sterile solution of 2 M MgCl2.

Methods Protoc. 2019, 1, x; doi: FOR PEER REVIEW www.mdpi.com/journal/mps

Methods Protoc. 2019, 2, 17 18 of 19

7. SB medium pH 7.0: Dissolve 30 g tryptone, 20 g yeast extract and 10 g MOPS (3-[N-morpholino]– propanesulfic acid) in 1L water. Dissolve and autoclave. 8. Minimal medium agar plate: Add 5.6 g 5X M9 salt and 15 g agar to 500 mL of deionized water ◦ and autoclave. When cooled to 50-45 C, add 1 mL of 1 M MgSO4 (autoclaved), 0.1 mL of 1 M CaSO4 (autoclaved), 5 mL of 40% glucose, and 0.25 mL of 1% thiamine HCl (filter-sterilized). Mix with gentle stirring and pour on polystyrene Petri dishes. Keep the plates at 4 ◦C. 9. SOC medium: Add 20 g of tryptone, 5 g of yeast extract and 0.5 g of NaCl to 950 mL of deionized water. Shake well and add 10mL of a 250 mM KCl. Adjust the pH of the medium to 7.0. autoclave for 20 min. Add 5 mL of a sterile solution of 2 M MgCl2. 10. Agarose electrophoresis gel: For 1% agarose gel, use 1 g of agarose and 100 mL TAE buffer (40 mM Tris, 20 mM acetic acid, and 1 mM EDTA, pH 8.0). Change the amount of agarose as needed to make 1.5 or 2% gels.

11. H2O/HEPES: Add 1 mL of sterile HEPES 1M to 1 L of autoclaved ultra-pure water. 12. Glycerol/HEPES: Add 1 mL of sterile HEPES 1M to 1L 10% glycerol.

13. TBSC buffer: 10 mM Tris pH 7.4, 137 mM NaCl, 1 mM CaCl2. Dissolve 1.5 g of TrisBase, 8 g NaCl and 0.15 g CaCl2 in 1 L of deionized water. Adjust to pH 7.4 and autoclave. 14. PEG solution: 20% PEG, 2.5 M NaCl. Dissolve 100 g of PEG 8000 and 73 g of NaCl in 500 mL of deionized water. Filter through 0.2 µm filter. 15. Trypsin solution: Dissolve trypsin powder at 10 mg/mL in TBSC (trypsin stock). Freeze in 20 µL aliquots in liquid nitrogen. This can be stored at −20 ◦C for several months. For the experiment, dissolve 100 µlL of trypsin stock in 10 mL of TBSC (trypsin solution). 16. PBST: 1X PBS + 0.1% (v/v) Tween® 20 up to 1X PBS + 1% (v/v) Tween® 20. 17. MPBST: 2% skimmed milk in PBST, prepare freshly. 18. Panning block solution: MPBST or BSA-PBST: 1% (w/v) BSA in PBST, prepare freshly. 19. Periplasmic buffer: 100 mM Tris; 0.5 M Sucrose; 1 mM EDTA; pH 8.0

Author Contributions: A.S.: established the methods, designed and performed most experiments and bioinformatic analysis, and prepared the manuscript; A.G., H.D. and M.H.: participated in the experiments and analysis; K.S.: conceived of the study, participated in its design and coordination and prepared the manuscript. Funding: This study was supported with funds and a fellowship to AS by the Ulm and Biberach joint graduate school in pharmaceutical biotechnology funded by the Baden-Württemberg State Ministry of Science, Research and Arts. Acknowledgments: A special thanks to Pierre Martineau from the Institute of Cancer Research/Inserm U1194, University of Montpellier, France for his support, advice, input and fruitful discussions. Finally, the authors like to thank Rene Handrick from Biberach University for excellent advisory and technical support whenever needed. Conflicts of Interest: The authors declare no conflict of interest.

References

1. Pande, J.; Szewczyk, M.M.; Grover, A.K. Phage Display: Concept, Innovations, Applications and Future. Biotechnol. Adv. 2010, 28, 849–858. [CrossRef][PubMed] 2. Caucheteur, D.; Robin, G.; Parez, V.; Martineau, P. Construction of Synthetic Antibody Libraries. Methods Mol. Biol. 2018, 1827, 93–108. [CrossRef] 3. Ponsel, D.; Neugebauer, J.; Ladetzki-Baehs, K.; Tissot, K. High Affinity, Developability and Functional Size: The Holy Grail of Combinatorial Antibody Library Generation. Molecules 2011, 16, 3675–3700. [CrossRef] 4. Paduch, M.; Koide, A.; Uysal, S.; Rizk, S.S.; Koide, S.; Kossiakoff, A.A. Generating Conformation-Specific Synthetic Antibodies to Trap Proteins in Selected Functional States. Methods 2013, 60, 3–14. [CrossRef] [PubMed] 5. Feng, M.; Bian, H.; Wu, X.; Fu, T.; Fu, Y.; Hong, J.; Fleming, B.D.; Flajnik, M.F.; Ho, M. Construction and Next-Generation Sequencing Analysis of a Large Phage-Displayed VNAR Single-Domain Antibody Library from Six Naïve Nurse Sharks. Antib. Ther. 2019, 2, 1–11. [CrossRef][PubMed] Methods Protoc. 2019, 2, 17 19 of 19

6. Haußner, C.; Lach, J.; Eichler, J. Synthetic Antibody Mimics for the Inhibition of Protein–ligand Interactions. Curr. Opin. Chem. Biol. 2017, 40, 72–77. [CrossRef] 7. Barelle, C.; Gill, D.S.; Charlton, K. Shark Novel Antigen Receptors—The Next Generation of Biologic Therapeutics? Adv. Exp. Med. Biol. 2009, 655, 49–62. [CrossRef][PubMed] 8. Barelle, C.; Porter, A. VNARs: An Ancient and Unique Repertoire of Molecules That Deliver Small, Soluble, Stable and High Affinity Binders of Proteins. Antibodies 2015, 4, 240–258. [CrossRef] 9. Zhao, A.; Tohidkia, M.R.; Siegel, D.L.; Coukos, G.; Omidi, Y. Phage Antibody Display Libraries: A Powerful Antibody Discovery Platform for Immunotherapy. Crit. Rev. Biotechnol. 2016, 36, 276–289. [CrossRef] 10. Smith, G.P. Filamentous Fusion Phage: Novel Expression Vectors That Display Cloned Antigens on the Virion Surface. Science 1985, 228, 1315–1317. [CrossRef] 11. Smith, G.P.; Scott, J.K. Libraries of Peptides and Proteins Displayed on Filamentous Phage. Methods Enzymol. 1993, 217, 228–257. [PubMed] 12. Nelson, R.S.; Valadon, P. A Universal Phage Display System for the Seamless Construction of Fab Libraries. J. Immunol. Methods 2017, 450, 41–49. [CrossRef][PubMed] 13. Lindner, T.; Kolmar, H.; Haberkorn, U.; Mier, W. DNA Libraries for the Construction of Phage Libraries: Statistical and Structural Requirements and Synthetic Methods. Molecules 2011, 16, 1625–1641. [CrossRef] [PubMed] 14. Jacobs, T.M.; Yumerefendi, H.; Kuhlman, B.; Leaver-Fay, A. SwiftLib: Rapid Degenerate-Codon-Library Optimization through Dynamic Programming. Nucleic Acids Res. 2015, 43, e34. [CrossRef][PubMed] 15. Yagodkin, A.; Azhayev, A.; Roivainen, J.; Antopolsky, M.; Kayushin, A.; Korosteleva, M.; Miroshnikov, A.; Randolph, J.; Mackie, H. Improved Synthesis of Trinucleotide Phosphoramidites and Generation of Randomized Oligonucleotide Libraries. Nucleosides Nucleotides Nucleic Acids 2007, 26, 473–497. [CrossRef] [PubMed] 16. Van den Brulle, J.; Fischer, M.; Langmann, T.; Horn, G.; Waldmann, T.; Arnold, S.; Fuhrmann, M.; Schatz, O.; O’Connell, T.; O’Connell, D.; et al. A Novel Solid Phase Technology for High-Throughput Gene Synthesis. Biotechniques 2008, 45, 340–343. [CrossRef][PubMed] 17. Stark, Y.; Venet, S.; Schmid, A. Whole Cell Panning with Phage Display. Methods Mol. Biol. 2017, 1575, 67–91. [CrossRef] 18. de Bruin, R.; Spelt, K.; Mol, J.; Koes, R.; Quattrocchio, F. Selection of High-Affinity Phage Antibodies from Phage Display Libraries. Nat. Biotechnol. 1999, 17, 397–399. [CrossRef] 19. Goemans, C.; Denoncin, K.; Collet, J.-F. Folding Mechanisms of Periplasmic Proteins. Biochim. Biophys. Acta Mol. Cell Res. 2014, 1843, 1517–1528. [CrossRef] 20. Hust, M.; Steinwand, M.; Al-Halabi, L.; Helmsing, S.; Schirrmann, T.; Dübel, S. Improved Microtitre Plate Production of Single Chain Fv Fragments in Escherichia Coli. Nat. Biotechnol. 2009, 25, 424–428. [CrossRef] 21. Dooley, H.; Flajnik, M.F.; Porter, A.J. Selection and Characterization of Naturally Occurring Single-Domain (IgNAR) Antibody Fragments from Immunized Sharks by Phage Display. Mol. Immunol. 2003, 40, 25–33. [CrossRef] 22. Shao, C.Y.; Secombes, C.J.; Porter, A.J. Rapid Isolation of IgNAR Variable Single-Domain Antibody Fragments from a Shark Synthetic Library. Mol. Immunol. 2007, 44, 656–665. [CrossRef][PubMed] 23. Hust, M.; Mersmann, M. Phage Display and Selection in Microtitre Plates. In Antibody Engineering; Springer: Berlin/Heidelberg, Germany, 2010; pp. 139–149. 24. Sidhu, S.S.; Lowman, H.B.; Cunningham, B.C.; Wells, J.A. Phage Display for Selection of Novel Binding Peptides. Methods Enzymol. 2000, 328, 333–363. [CrossRef][PubMed] 25. Mersmann, M.; Schmidt, A.; Tesar, M.; Schoneberg, A.; Welschof, M.; Kipriyanov, S.; Terness, P.; Little, M.; Pfizenmaier, K.; Moosmayer, D. Monitoring of ScFv Selected by Phage Display Using Detection of ScFv—PIII Fusion Proteins in a Microtiter Scale Assay. J. Immunol. Methods 1998, 220, 51–58. [CrossRef]

© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).