Promoter-Targeted Phage Display Selections with Preassembled Synthetic Zinc Finger Libraries for Endogenous Gene Regulation

doi:10.1016/j.jmb.2004.04.057 J. Mol. Biol. (2004) 340, 599–613

Promoter-targeted Phage Display Selections with Preassembled Synthetic Zinc Finger Libraries for Endogenous Gene Regulation

Caren V. Lund, Pilar Blancafort, Mikhail Popkov and Carlos F. Barbas III*

The Skaggs Institute for Regulation of endogenous gene expression has been achieved using Chemical Biology and synthetic zinc finger proteins fused to activation or repression domains, Department of Molecular zinc finger transcription factors (TFZFs). Two key aspects of selective gene Biology, The Scripps Research regulation using TFZFs are the accessibility of a zinc finger protein to its Institute, 10550 North Torrey target DNA sequence and the interaction of the fused activation or repres- Pines Road, La Jolla, CA 92037 sion domain with endogenous proteins. Previous work has shown that USA predicting a biologically active binding site at which a TFZF can control gene expression is not always straightforward. Here, we used a library of preassembled three-finger zinc finger proteins (ZFPs) displayed on fila- mentous phage, and selected for ZFPs that bound along a 1.4 kb promoter fragment of the human ErbB-2 gene. Following affinity selection by phage display, 13 ZFPs were isolated and sequenced. Transcription factors were prepared by fusion of the zinc finger proteins with a VP64 activation domain or a KRAB repression domain and the transcriptional control imposed by these TFZFs was evaluated using luciferase reporter assays. Endogenous gene regulation activity was studied following retroviral delivery into A431 cells. Additional ZFP characterization included DNase I footprinting to evaluate the integrity of each predicted protein:DNA interaction. The most promising TFZFs able to both up-regulate and down-regulate ErbB-2 expression were extended to six-finger proteins. The increased affinity and refined specificity demonstrated by the six-finger proteins provided reliable transcriptional control. As a result of studies with the six-finger proteins, the specific region of the promoter most accessible to transcriptional control by VP64-ZFP and KRAB-ZFP fusion proteins was elucidated and confirmed by DNase I footprinting, flow cytometric analysis and immunofluorescence. The ZFP phage display library strategy disclosed here, coupled with the growing availability of genome sequencing information, provides a route to identifying gene-regulating TFZFs without the prerequisite of well-defined promoter elements. q 2004 Elsevier Ltd. All rights reserved. Keywords: phage display selection; zinc finger; gene regulation; ErbB-2; *Corresponding author immunofluorescence

Introduction and chromatin remodeling proteins associate with the promoter regions of genes.1,2 The presence or Transcription factors (TFs), mediator proteins, absence of these proteins determines the timing

Supplementary data associated with this article can be found at doi: 10.1016/j.jmb.2004.04.057

Abbreviations used: TF, transcription factor; ZFP, zinc finger protein; TFZF, zinc finger transcription factor; UTR, untranslated region; ELISA, enzyme-linked immunosorbent assay; FACS, fluorescence-activated cell sorting; KRAB, Kruppel-associated box; HA, hema-glutinin; DAPI, 40,6-diamidino-2-phenylindole dihydro-chloride; P/PMR, polypurine/polypyrimidine mirror repeat; GFP, green fluorescent protein; VP64, tetrameric repeat of herpes simplex VP16’s minimal activation domain. E-mail address of the corresponding author: [email protected]

0022-2836/$ - see front matter q 2004 Elsevier Ltd. All rights reserved. 600 Phage Display Selection of Zinc Finger Transcription Factors and duration of gene transcription. One of the scriptional control is far from complete for any most common classes of TFs contains the DNA- promoter. binding zinc finger transcription factors.3,4 In Here, we have studied the application of phage order to impart artificial control on gene transcrip- display to provide ZFP-based TFs that bind tion, synthetic zinc finger proteins (ZFPs) have throughout a given promoter sequence with the been engineered to bind specific DNA sequences. aim of applying these proteins to endogenous A subset of these engineered proteins (TFZFs) has gene regulation. This strategy resulted in the been shown to control endogenous gene identification of a site at which a three-finger or a expression selectively when fused to activation or six-finger TFZF could provide regulation of ErbB-2 repression domains.5–17 The prediction of success- expression in human epidermoid carcinoma A431 ful target sites for TFZFs in endogenous promoters cells. The site identified would not have been pre- has been based on ZFP affinity, position within the dicted from the linear sequence of the promoter, 50 untranslated region (UTR), and their location known TF binding sites, or chromatin characteri- within DNase I-hypersensitive regions.6–8,10 Appli- zation, suggesting that this approach can be used cation of these criteria, however, has not resulted to synthesize gene regulators without prior charac- consistently in specific gene regulation. With the terization of a target gene’s promoter. roles of endogenous TFs, mediator proteins, and chromatin remodeling proteins largely uncharacterized for any given promoter, a more empirical Results method of sampling binding sites across a promoter is required to achieve robust, imposed gene Phage display optimization and selection regulation. against an ErbB-2 promoter fragment Synthetic ZFPs have been derived from the framework of naturally occurring zinc finger TFs, Previous studies of zinc finger proteins using including Sp1 and the murine Zif268, which have phage display have focused on the selection of 5 three zinc finger domains. The C2H2 zinc finger zinc finger variants of altered specificity. These domain consists of an a helix packed against two studies have utilized short pieces of DNA as the antiparallel b sheets and stabilized via coordination target for selection, typically oligonucleotides that of a zinc ion. The side-chains of amino acid resi- present the 9 bp binding site for a three-finger dues at the terminus of the b-sheet and continuing protein.9,28 – 30 Our goal was to select zinc fingers into the a helix, constitute the DNA reading-head that bound optimally within a 1.4 kb promoter of the domain that is responsible for sequence- fragment. The phage display library used in this specific interaction with the DNA. A single zinc study contained 9177 three-finger ZFPs, each finger domain typically recognizes 3 bp of DNA, capable of recognizing 9 bp of DNA. The construc- primarily through major groove interactions. tion of the library was based on a combinatorial Synthetic ZFPs typically consist of a repeat of assembly of a subset of defined zinc-finger DNA three to six zinc finger domains, allowing the sequences recognizing GNN, ANN and TNN resulting polydactyl proteins to recognize DNA triplets.9,14,30,31 There were only a few TNN sequences of 9–18 bp. Transcription factors have domains available at the time of the library’s been constructed by fusion of an activation or construction, so the library is biased towards repression domain to the ZFP, creating TFZFs. recognition of RNN triplets, where R ¼ Gor Naturally occurring activators and repressors, or A. Theoretically, the double-stranded human 14 variants thereof, are commonly used with ZFPs, genome contains 750 million (RNN)3 sites. In particularly the VP16 activation domain and the addition, many promoters contain GNN-rich Kruppel associated box (KRAB).5,18 – 20 regions of DNA, which makes the library particu- The target of imposed gene regulation is not larly applicable to the isolation of promoter bind- simply DNA, but rather the three-dimensional ing proteins.32 landscape of chromatin structure constructed from As the length of the DNA target was far in excess DNA:protein interactions and protein:protein of any used previously, we first evaluated the interactions along a promoter. The linear sequence ability of the previously established phage display of DNA provides little indication of a promoter’s protocol to recover ZFPs. A six-finger protein, dynamic topology. Eukaryotic gene promoter E2C, with a dissociation constant of 0.75 nM for sequences often stretch over many thousands of an 18 bp site in the ErbB-2 promoter (see Figure bases, and include both positive and negative 2), was used as a positive control.5 Using phage regulatory elements. Genome-wide characteri- expressing the six-finger protein E2C on its surface, zation of promoters employing deletion constructs, test selections were done to compare the recovery linker scanning, computational TF binding site of E2C phage by a biotinylated 1.4 kb promoter or analyses, and TF isolation, is ongoing.21 – 25 In a biotinylated 18 bp hairpin oligonucleotide. Both addition, experiments have begun to address selections had the E2C phage diluted into control the chromatin state of promoters, the location phage bearing a different selective marker at a of nucleosomes, and the nature of histone ratio of 1:10,000. The 1.4 kb promoter DNA yielded modifications.26,27 In spite of this information, the 90% fewer phage compared to the number of understanding of the precise mechanism of tran- phage recovered using the 18 bp oligonucleotide. Phage Display Selection of Zinc Finger Transcription Factors 601

Panning conditions were subsequently optimized, of panning was subcloned into a retroviral vector and phage selection using E2C phage was and expressed as fusions with the activation improved to 85% relative to the phage recovered domain, VP64, which is a tetrameric repeat of the with the 18 bp oligonucleotide. minimal activation domain of herpes simplex The library of preassembled three-finger proteins virus VP16 activator protein.5,33 The ability of each was then selected over four rounds of panning pool of proteins to activate ErbB-2 expression in using the 1.4 kb ErbB-2 promoter fragment. The A431 cells was evaluated using fluorescence- first and second rounds of panning contained activated cell sorting (FACS) analysis (Figure 1C). 125 nM promoter DNA per binding reaction. The The unselected library did show some activation third and fourth rounds contained 62 nM and of ErbB-2 expression. However, proteins selected 31 nM promoter DNA per binding reaction in subsequent rounds of phage display, particu- respectively, to increase the stringency of selection larly round 4, were more efficient activators of and to favor recovery of higher-affinity ZFPs. The endogenous gene expression. effectiveness of each round of panning to select ZFPs specific for the target was initially evaluated Characterization of selected zinc finger proteins using a phage enzyme-linked immunosorbent assay (ELISA) (Figure 1B). As a functional evalua- ZFP clones from round 4 of panning were tion of the ZFPs recovered, DNA from each round selected for characterization. Five clones were

Figure 1. Phage display strategy with in vitro and in vivo characterization of the rounds. A, Using a 50-biotinylated primer, the promoter of interest was PCR-amplified and conjugated to streptavidin-coated magnetic beads. Incubation of the phage displaying a preassembled synthetic zinc finger protein library with target-coated beads provided recovery of zinc finger proteins with binding sites in the promoter. Multiple rounds of selection were conducted with decreasing amounts of promoter target to select for a narrowed pool of proteins with high binding affinities. B, Phage ELISA analysis was used to determine the relative binding affinities of the unselected library (US) phage compared to phage selected from four subsequent rounds of panning. Phage were amplified from each round of panning and incubated with biotinylated ErbB-2 promoter fragment immobilized on ELISA plates. Bound phage were detected with an anti-M13/horseradish peroxidase antibody conjugate. Fluorescence of activated ABTS (2,20-azino-bis(3-ethyl- benzthiazoline-6-sulfonic acid) was detected at 405 nm and quantified by a microplate reader. The maximal signal of round 2 was normalized to 1. C, Each round of panning was subcloned into a retroviral vector for expression as fusion proteins with VP64 in A431 cells. The ability of the zinc finger fusion proteins from each round to activate endogenous ErbB-2 expression in A431 cells was monitored by FACS analysis. The tallest, dotted peak is A431 cells infected with stuffer DNA fused to VP64. The unselected library peak is the second tallest peak and is in bold. The third tallest peak is round 1 represented with a thin line. The peaks for rounds 2, 3, and 4 overlap, and are shown with a single bold line that is shifted furthest to the right. 602 Phage Display Selection of Zinc Finger Transcription Factors

Figure 2. A representation of the ErbB-2 promoter fragment, 21440 to þ1. The ErbB-2 promoter fragment is sepa- rated into three 480 bp regions. Two sections of region 3 (sub-regions 3A and 3B) are magnified to show the binding sites of the proximal ZFPs. Binding sites of the 3Fn-ZFPs listed in Table 1 are indicated along with the associated promoter sequence (50-30). Open arrowheads designate binding sites of transcription factors, AP-2, p300, Sp1, adenovirus 5 E1A and Ets binding site (EBS), that have been characterized in ErbB-2 gene regulation.35,45,46,55,56 The CCAAT and TATAA sites are marked with hatched rectangles to represent the boundaries of the DNase I hypersensitive region of the ErbB-2 promoter.34 initially sequenced and labeled 1A, 2A, 3A, 8A, fold concentration range to confirm binding to the and 9A. Subsequently, 25 more clones were predicted sites. The proteins bound their predicted screened for binding to the biotinylated 1.4 kb sites within the promoter DNA with affinities that ErbB-2 promoter using an ELISA assay (data not ranged from 1.0 nM to 88 nM (Table 1). Seven out shown). The clones with the best binding signals of nine clones showed additional, lower-affinity were designated 2, 4, 5, 6, 8, 11, 13, and 16, and binding sites. None of the footprints observed for were sequenced. On the basis of previous studies, the predicted sites extended outside the expected the DNA sequence that each ZFP is predicted to 9 bp region by more than 3 bp, indicating the bind is based on the amino acid sequence of each maltose-binding protein fused to each ZFP for pro- domain’s reading head.9,30 Table 1 lists the pre- tein purification did not interfere with the binding dicted DNA-binding sequence for each ZFP and site analyses. For each footprint, the predicted the corresponding sites within the ErbB-2 promo- binding site of each ZFP is marked with a lower- ter. Six of the ZFP proteins sequenced encoded case letter. Proximal to site 2285 is the poly- pairs of identical sequence: 3A and 8, 4 and 11, purine/polypyridmidine repeat region (P/PMR) and 5 and 13. Most of the proteins were predicted of the ErbB-2 promoter. The P/PMR region is a to bind with eight out of nine matches to sites in GNN-rich region of DNA that is located within a the ErbB-2 promoter, while 8A, 9A, 6, and 8 have DNase I-hypersensitive region of the ErbB-2 pro- perfect 9 bp matching sites in the promoter moter between the CCAAT and TATAA boxes.34,35 fragment. Transfection and retroviral infection of zinc Footprinting analysis of the zinc finger finger transcription factors proteins along the promoter In order to study the potential of each of DNase I footprinting analysis was used to con- the selected ZFPs for gene regulation, the genes firm the binding of the selected ZFPs at their pre- encoding them were transferred into mammalian dicted sites within the promoter DNA. ZFP1A and expression vectors and expressed as fusions with 2A could not be purified in sufficient quantity for the VP64 activation domain. The ability of the these studies. The other zinc finger proteins were resulting transcription factors to activate a lucifer- footprinted on the fragment of DNA that contained ase reporter gene driven by the 1.4 kb ErbB-2 pro- the predicted sites (only data for ZFP16 are shown moter was studied in A431 cells (Table 2). TFZFs in Figure 3). Each protein was titrated over a 100- 1A and 11 showed the highest level of activation, Phage Display Selection of Zinc Finger Transcription Factors 603

Figure 3. DNase I footprinting analysis of ZFP16 and three six-ﬁnger proteins –642, –369 and –285. Storage phos- phor autoradiograms of DNase I footprint titrations analyzed on 8 M urea/6% (w/v) polyacrylamide gels. For each gel: lane 1 (–) is the DNA fragment without digestion; lane 2 is the G þ A ladder (L); lane 3, DNase I digestion of the labeled fragment without protein (D); lanes 4–10 contain 100 nM, 50 nM, 20 nM, 10 nM, 5 nM, 2 nM, 1 nM puriﬁed ZFP incubated with the DNA fragment. The location of the predicted binding sites are indicated to the right of each 32 gel with lower-case letters. All reactions contained 15,000 cpm of P end-labeled PCR fragment. Kd values are calculated as described.54

with 52.6-fold and 47.4-fold increases in luciferase vation of luciferase expression. Considering TFZFs expression over expression of luciferase in the 11 and 13, whose affinities were determined to be absence of a transiently expressed transcription similar for the same region of DNA, their acti- factor. TFZFs 2, 6, and 8 displayed less than twofold vation of luciferase expression was 47-fold versus activation, while the level of activation derived 5.8-fold, respectively. Therefore, there was no strict from TFZFs 2A, 8A, 9A, 13, and 16 ranged from correlation between stronger affinity and greater 3.2-fold to 15.2-fold. Initially, the various affinities activation. This may be due, in part, to the multi- derived from footprinting analysis (Table 1) were plicity of binding sites available to a three-finger compared with activation of a luciferase reporter protein in the 1.4 kb target region and elsewhere construct (Table 2). The TFZFs with affinities stron- in the cell. However, the inability of transient trans- ger than 52 nM generated at least fivefold acti- fection reporter assays to correlate activation with 604 Phage Display Selection of Zinc Finger Transcription Factors

Table 1. Selected sequences and their position in the ErbB-2 promoter used Zinc ﬁnger protein Predicted DNA recognition Times selected Binding sites in promoter Afﬁnity (nM)

3Fn 1A TAG GAG GTG 1 237 ND 3Fn-2A GAG GCG GTG 1 237 ND 3Fn-8A GAG AAG GAG 1 341 ND 243 8.9 ^ 3.8 237a 4.6 ^ 1.4 228 3.6 ^ 1.2 3Fn-9A TAG GAG GGA 1 369 ND 3Fn-2 GGA GCG GAT 1 – ND 3Fn-6 GGG GCA GAG 1 454 88.0 ^ 58 3Fn-8 GAG GCG GGA 2 1014 ND 878 ND 3Fn-11 GAG GAG AAG 2 416 ND 246 3.9 ^ 1.6 237a 1.0 ^ 0.3 228 1.2 ^ 0.3 3Fn-13 GCG GAG GAG 2 231 5.1 ^ 1.8 228 4.3 ^ 2.0 3Fn-16 TAG GAG GGG 1 642 2.9 ^ 0.6 369 51.6 ^ 29 284 5.9 ^ 1.8 The three finger (3Fn) ZFP proteins used in this work are listed with their predicted binding sites, the recognition sequences predicted for each ZFP (50-30), the number of times each binding motif was identified, the location of each predicted binding site in the promoter target, and the corresponding affinity of the ZFPs at the predicted sites. a Sites that were observed in DNase I footprinting experiments and for which associated affinities are included.

affinity or, more importantly, predict endogenous sites within a GNN-rich region of DNA charac- regulation, has been observed with other three- terized previously as a P/PMR mirror repeat.35 7 finger TFZFs. Therefore, the activity of the The P/PMR region can form a triple helix and transcription factors on the endogenous gene was prevent binding of endogenous TFs adjacent to studied. the neighboring TATAA box.35,36 The P/PMR The ability of the TFZFs to activate or repress region has been characterized to have an increased endogenous ErbB-2 expression was studied using level of chromatin-relaxing proteins associated retroviral delivery of the transcription factors into with it in cell-lines expressing high levels of cells. The retroviral vector pMX, which contains a ErbB-2, compared to cells with low-level ErbB-2 transcription factor expression cassette linked to expression.37 Considering the substantial level of an internal ribosome entry sequence (IRES) fused ErbB-2 expression in A431 cells, the P/PMR region to the coding sequence of green fluorescent protein would be expected to be an accessible region of (GFP), was used for these studies. 53GFP expression binding. The inability of the same ZFP to provide from this construct is then correlated with tran- both up and down-regulation, depending on the scription factor activity. Immunofluorescence fused effector domain, in spite of being in a pre- studies were used to confirm the nuclear sumably accessible region of DNA, supports expression of zinc finger proteins and the cyto- the hypothesis that the topology of a promoter plasmic expression of GFP in retrovirally infected varies from position to position, depending on A431 cells. endogenous factors. Table 2 lists the values for activation and repres- With the predicted binding sites and functional sion levels obtained with each TFZF. Transcriptional data collected, we were surprised to find that activation was studied using VP64, and repression TFZF9A and TFZF16 did not share the same tran- was studied using the Kox-1 Kruppel-associated scriptional control profiles. Both ZFP9A and 5,6,19 box (KRAB) domain. Six TFZFs had greater ZFP16 are predicted to bind at site 2369, with 9A than twofold activation of endogenous ErbB-2 being a perfect match. While TFZF16 is able to both expression in A431 cells. TFZFs 1A and 16 enhanced up-regulate and down-regulate ErbB-2 expression expression 5.2-fold and 4.8-fold, respectively, robustly, TFZF9A up-regulates ErbB-2 expression relative to cells transduced with control virus. In only moderately. Studies are ongoing to determine contrast, only two of the ten TFZFs were able to if subtle differences in binding between these two repress ErbB-2 expression greater than twofold: proteins explains their differences in regulation. 2A with 2.2-fold repression, and 16 with 7.1-fold repression. Figure 4(a–d) presents the FACS pro- Affinity of ZFP16 for its three potential files of the two best activating (1A and 16) and binding sites repressing (2A and 16)TFZFs. Only 16 was able to both up and down-regulate ErbB-2 expression. Since TFZF16 was differentiated by its ability to The six proteins that showed activation or repres- both up-regulate and down-regulate, we sought to sion of ErbB-2 expression had predicted binding determine which of its three potential binding Phage Display Selection of Zinc Finger Transcription Factors 605

Figure 4. FACS analysis and immunofluorescence of A431 cells transduced with zinc finger fusion proteins. a–d, FACS profiles are shown for cells transduced with the fusion proteins that displayed activation and repression of endogenous ErbB-2 expression. Black indicates the staining of A431 cells with IgG1 isotype control antibody, blue is the level of ErbB-2 expression in cells transduced with a stuffer fragment, and red is the level of ErbB-2 expression as a result of transduction with the fusion protein expression construct indicated in each panel. e–l, Maximal projections of 3D datasets show the total cellular distribution of TFZF (g and k). A431 cells were transduced with TFZF 16K (i–l) and control StufferK (e–h). The top panels show A431 nuclei in blue; the upper middle panels show GFP in green; the lower middle panels show TFZF in red; and the bottom panels show merge signals of TFZF (red), GFP (green), and nuclei (blue). TFZF localization in nuclei was observed in TFZF 16K-transduced cells (l). No TFZF was detected in control, StufferK-tranduced A431 (h). sites within the ErbB-2 promoter sequences (Table the DNase I footprinting for each DNA:ZFP inter- 1) was responsible for the biological phenotype. action site. Three independent binding reactions The prediction of the biologically relevant site was were used to calculate Kd values. DNase I footprint first addressed by determining the affinity of analysis of ZFP16 bound on the fragment con- ZFP16 for each of the three sites. Figure 3 shows taining site 2642 (Figure 3 panel a) shows one 606 Phage Display Selection of Zinc Finger Transcription Factors

Figure 5. FACS analysis of six finger proteins 2642, 2369 and 2285. Flow cytometric analyses of ErbB-2 expression in cells retrovirally transduced with the six different fusion proteins are indicated. Two days after transduction, cells were stained with the ErbB-2 specific antibody TA-1 in combination with Cy5-labeled secondary antibody. The broken line represents transduced cells stained with IgG1 isotype control antibody, the thin line represents ErbB-2 expression of cells transduced with stuffer DNA, and the bold line is ErbB-2 expression as a result of TFZF transduction. binding site that extends over the sequence shows the DNase I footprinting analysis of 50-GGGGAGGAA-30. The affinity of ZFP16 for this 6Fn-642 on a 180 bp fragment containing the pre- site was determined to be 2.9 (^0.6) nM. ZFP16 dicted site. The site bound is 50-CACATCCCCCT was also predicted to bind a site at 2369. Footprint CCTTGA-30. Figure 3e is the DNase I footprint analysis of ZFP16 on a 189 bp fragment containing of 6Fn-369 on a 189 bp fragment at the site 50- the 2369 binding site showed binding of ZFP16 at GGCGCTAGGAGGGACG-30. Figure 3f is the two regions. The predicted binding site on this DNase I footprint of 6Fn-285 on a 165 bp fragment fragment at 2369 was 50-TAGGAGGGA-30 and at the site 50-CGTCAACCTCCCCCGCTC-30. The the associated affinity was determined to be 51.6 affinities of 6Fn-642, 6Fn-369 and 6Fn-285 for their (^29) nM. ZFP16 also bound a second site with respective sites were 4.8 (^1.1) nM, 4.8 (^1.3) nM, seven out of nine matches to the promoter and 9.5 (^4.8) nM. It was interesting to find sequence: 50-GGGGAGGGG-30. The affinity of that two of the three six-finger proteins had lower ZFP16 for this site was not determined. The third affinities for the same target sites as their three- predicted binding site for ZFP16 was site 2285. finger counterpart, ZFP16. Typically, six-finger The binding site extended over the predicted proteins are associated with higher affinity.5,20,38 binding sequence, 50-TTGGAGGGG-30, with an To evaluate the biological effect of retroviral associated affinity of 5.9 (^1.8) nM. Additional expression of each of the six-finger proteins fused binding sites were found between positions 2243 to activation or repression domains, cell-surface and 2218 that included three adjacent sites, each expression of ErbB-2 was monitored by FACS with seven out of nine matches with ZFP16’s analysis. Each of the constructs was infected into predicted DNA recognition: A431 cells in two independent experiments and 50-GAGAAGGAGGAGGTGGAGGAGGAGGGCT-30. the resulting up-regulation and down-regulation profiles of each are illustrated in Figure 5. 6Fn-285 In vitro and in vivo characterization of three showed no ability to up-regulate or down-regulate six-finger proteins for specific regulation of ErbB-2 expression in A431 cells, 6Fn-642 could ErbB-2 slightly down-regulate ErbB-2 expression, and 6Fn-369 was able to up-regulate and down-regulate In order to determine the biologically relevant ErbB-2 expression approximately tenfold from site for TFZF16, three six-finger proteins were con- basal expression levels. DNase I footprint analysis structed; 6Fn-642, 6Fn-369 and 6Fn-285. Six-finger showed that 6Fn-369, with an affinity of 4.8 nM proteins recognize 18 bp of DNA and were for site 2369, does not bind at sites 2285 or 2642 designed to bind each of ZFP16’s three predicted with equal or better affinity (data not shown). sites independently. The six-finger proteins were Immunofluorescence studies included A431 cells characterized by sequencing, by evaluation of transduced to express the three-finger protein binding to oligonucleotides displaying the target ZFP16 fused to KRAB (ZFP16K), the six-finger pro- sequence, and by DNase I footprinting. Figure 3d tein 6Fn-369 fused to KRAB (6F3K), and cells Phage Display Selection of Zinc Finger Transcription Factors 607

Figure 6.TFZF and ErbB-2 visualization on A431. Maximal projections of 3D datasets show the total cellular distribution of ErbB-2 (d and f) and TFZF (g–i). A431 cells were transduced with the following fusion proteins: ZFP16K (a, d, g, and j), 6Fn-369K (b, e, h, and k), and control StufferK (c, f, i, and l). The top panels show nuclei in blue; the upper middle panels show ErbB-2 receptor in green; the lower middle panels show ZFP in red; and the bottom panels show merge signals of TFZF (red), ErbB-2 (green), and nuclei (blue). TFZF localization in nuclei was observed in ZFP16K-transduced and 6Fn3K-transduced cells, and correlated with ErbB-2 down-regulation (j and k). No ZFP was detected in control Stuffer-transduced A431 (l). 608 Phage Display Selection of Zinc Finger Transcription Factors transduced with a negative control DNA fragment that ZFPs can be isolated that bind various regions fused to KRAB (StufferK) (Figure 6). Immunofluor- of the promoter and with a range of affinities. The escence studies confirmed the down-regulation of resulting pool of proteins is screened to identify cell surface ErbB-2 expression shown by FACS the combination of position and affinity that pro- analysis of ZFP16-KRAB and 6Fn369-KRAB vides transcriptional control of the target gene. (Figure 6d and e versus f). Immunofluorescence Here, the most successful TFZF had a dissociation studies also showed a correlation of TFZF constant of 52 nM for the biologically relevant tar- expression of ErbB-2 (Figure 6j and k versus l). The get site, an affinity much lower than would be bottom three panels of Figure 6 have correspond- expected. However, the affinity of a ZFP for this ing movies in Supplementary Material. site was improved to 4.8 nM with assembly of a six-finger protein. Therefore, even if the affinity that the phage display screen provides is not Discussion optimal, if function is demonstrated, an extended ZFP can typically improve the affinity.5,6,20,39

Previous guidelines for the selection of TFZFs for The lack of a strict correlation between affinity control of endogenous gene expression have and transcriptional regulation using TFZFs has included affinity, proximity to transcription start been acknowledged in the field. Investigation of sites, and proximity to DNase I hypersensitive the role of chromatin structure as it effects TFZF tar- regions in cellular chromatin.5–8,10 None of these geting is ongoing.40,41 One method of determining parameters have proven to be absolute rules for the accessible regions of chromatin-associated successful, specific gene regulation. With the roles DNA, is DNase I-hypersensitive site mapping. The of endogenous TFs, mediator proteins, and chro- identification of a hypersensitive region was a matin remodeling proteins largely uncharacterized valuable approach in the targeting of VEGF-A.42 for any given promoter, an empirical method of However, the same approach in the design of sampling different binding sites is needed. The TFZFs selective for PPARg2 regulation provided availability of the phage display library used in differing levels and extents of regulation of both this work, coupled with the growing availability of the PPARg isoforms, g1 and g2.10 In the targeting of genome sequencing information, allowed us to of the EPO gene, there was no hypersensitive site identify gene-regulating TFZFs without the need associated with site 2862, although additional for a well-characterized promoter, or a detailed characterization indicated proximity of the site to zinc finger assembly strategy. Here, we describe a positioned nucleosome.7 In this study, 6Fn-369 isolation of ZFPs that bind along the ErbB-2 pro- was able to up-regulate and down-regulate ErbB-2 moter, and characterize the ability of the selected expression, and did not map within the DNase I- zinc finger fusion proteins to up-regulate or hypersensitive region of the ErbB-2 promoter. Of down-regulate endogenous ErbB-2 expression in the six TFZFs that showed binding in the hyper- human epidermoid carcinoma A431 cells. sensitive region by DNase I footprinting analysis, Phage display provided means for selecting three showed activation of ErbB-2 expression, one ZFPs with high affinity for the binding sites pro- showed repression of ErbB-2 expression, and one vided by a 1.4 kb ErbB-2 promoter fragment. was unable to modulate the transcription of ErbB- In previous work, protein:DNA affinity was con- 2 in either direction. The inconsistency of targeting sidered a key requirement for achieving gene based on hypersensitive regions and the incom- regulation with a synthetic transcription factor plete characterization of chromatin structure for such as a TFZF. With more examples of endogenous many promoters, supports the use of an empirical gene regulation by TFZFs available, the data indi- method, without biases, to target TFZFsasprovided cate that the position of targeting is as important by phage display and a given linear DNA sequence. as affinity. For example, six-finger proteins pE2X, Retroviral expression of each selected ZFP as a pE3Y and pE3Z were designed to regulate ErbB-2 fusion protein with an activation or repression and ErbB-3 expression.9 Only pE3Y both up-regu- domain was assessed by FACS analysis of ErbB-2. lated and down-regulated ErbB-3 expression, and The most significant finding from the FACS data yet all three proteins had DNA-binding affinities was that activation and repression of ErbB-2 of ,10 nM. Similarly, only one of three TFZFs expression were not usually accessible from the targeted to the erythropoietin (EPO) promoter up- same DNA-binding domain. For example, TFZF11 regulated EPO transcription, and only three of ten was able to up-regulate, but not down-regulate TFZFs were able to up-regulate VEGF-A secretion, ErbB-2 expression. Considering that both fusion despite all these ZFPs having dissociation proteins had the same DNA-binding domain, the constants of ,10 nM.7,8 The minimum affinity up-regulation data suggests that the DNA-binding required for a ZFP to function as an effective TFZF domain was able to bind the DNA of the promoter amongst endogenous factors is not known. Theo- in the context of cellular chromatin. Therefore, the retically, this value would vary depending on the inability of TFZFs 1A, 2A, 8A, 9A or 11 to effect accessibility of a binding site(s), the number of transcriptional control of ErbB-2 is hypothesized to binding sites, and the position of the binding be associated with the proteins recruited by KRAB site(s) amongst promoter-associated proteins. The or VP64 that were unable to form a functional unit advantage of using the phage display method is or, if the functional unit was assembled, was Phage Display Selection of Zinc Finger Transcription Factors 609

unable to modify the promoter’s transcriptional Table 2. Luciferase reporter activation by TFZFs and retro- program.18,43 By sampling different sites along a viral transduction mediated activation and repression of promoter, sites amenable to VP64 and KRAB endogenous ErbB-2 expression by ZFPs assembly and function can be elucidated to pro- Zinc finger Luciferase vide gene regulation. Site 2369 was a site from protein reporter assay which activation and repression could be coordi- (ZFP) Retroviral transduction nated. In the context of the ErbB-2 promoter, site Fold Fold 2369 lies 20 bp from an upstream AP-2 binding activation repression site and 20 bp from a downstream p300 binding 1A 52.6 ^ 4.4 5.2 ^ 2.5 – site. The AP-2 site acts in coordination with an 2A 5.6 ^ 3.1 – 2.2 ^ 0.23 8A 15.2 ^ 10.2 2.9 ^ 2.1 – upstream AP-2 site to activate ErbB-2 expression ^ ^ 44 9A 3.2 0.7 3.2 1.2 – in breast cancer cells. AP-2 activation can be 2 0.55 ^ 0.2 – – countered by an estrogen-suppressible enhancer in 6 1.85 ^ 0.13 – – the first intron of the ErbB-2 gene.45 Binding of 8 1.63 ^ 0.21 – – 11 47.4 ^ 15.2 3.1 ^ 2.0 – p300 in the ErbB-2 promoter provides a target for ^ the adenovirus 5 E1A mediated repression of 13 5.8 1.0 – – 16 10.9 ^ 2.1 4.8 ^ 0.84 10.7 ^ 3.6 ErbB-2, which is in clinical trials for breast cancer 46,47 treatment. Considering the characterization of A431 cells were cotransfected with each TFZF listed and an 5 endogenous factors for the ErbB-2 promoter, site ErbB-2 promoter-luciferase reporter construct. Luciferase activity in total cell extracts was measured 48 hours after trans- 2369 is in proximity to regions accessible for the fection. Fold activation and standard deviation are derived recruitment of activation and repression mediator from triplicate measurements. Fold activation and repression of proteins. the endogenous ErbB-2 promoter were evaluated in A431 cells using FACS analysis following retroviral expression of each Once a successful three-finger TFZF was iden- TFZF listed. Two independent transductions were used to deter- tified, it was unclear which of ZFP16’s three poten- mine the fold activation and repression from basal ErbB-2 tial binding sites was biologically relevant, or if expression levels and the corresponding standard deviation binding at all three sites contributed to the tran- values. scriptional regulation observed. Six-finger fusion proteins, which have extended recognition of 18 bp of DNA, were designed to bind inde- 2.6 £ 105 bp,50 this is an underestimate of the poten- pendently at each of TFZF16’s best match sites to tial binding sites given the binding of eight out of evaluate transcriptional regulation derived from 9 bp, or seven out of 9 bp match sites with affinities each site. Even before ZFPs were described, von- ,100 nM as observed here. Taking into consider- Hippel’s study of transcription factors and nucleo- ation this degeneracy, by increasing the number of tide sequence recognized that binding of extended contacts needed to provide a minimum threshold sequences would increase the information content of binding affinity, the importance of using six- of a DNA-binding protein and reduce binding to finger proteins for specific gene regulation is other DNA sites.48 This theory is supported by the emphasized. DNase I footprint analysis of the six-finger proteins Phage display for the selection of TFZFs has assembled for this study. Figure 3d–f shows that many advantages. First, the investigation is not only one 18 bp site was bound by each of the limited to sites that fit the guidelines previously six-finger proteins on the fragments footprinted. used for the selection of TFZF binding sites. Second, This is in contrast to the upper panels of Figure 3 the method provides TFZFs more rapidly than by that show cross-reactive binding of the three-finger individual construction and testing. Finally, this protein, ZFP16, outside of the region labeled as the empirical approach requires only the preassembled best match site on each DNA fragment. Cross-reac- library of ZFPs and a linear sequence of DNA to tivity of the three-finger ZFPs was most extensive allow selection. Our application of this approach in the P/PMR region that contains nine consecu- has resulted in the successful regulation of the tive GNN triplets. Although the footprinting data human ErbB-2 promoter. An advantage of using were used to confirm the ability of the phage dis- phage display is that each round of panning can play selection method to isolate ZFPs that could be tested in various cell lines to determine which be associated with sites in the promoter fragment, pool of TFZFs is amenable to transcriptional regu- the footprinting analysis provided valuable insight lation in a particular cell type. We suggest that into the type of recognition provided by three- this strategy holds potential for the rapid prepa- finger proteins versus six-finger proteins. The ration of transcription factors for the characteri- subtlety of amino acid interactions within the ZFP zation of genes and for therapeutic application via protein structure as well as in proximity to DNA, gene therapy. continues to be an area of study for the zinc finger field.49 DNase I footprinting presents a ZFP with a biologically relevant diversity of binding sites not Materials and Methods represented by specificity ELISAs, gel mobility- shift assays, CAST assays, or available microarray Selection by phage display chips.38,50,51 While statistics predict a 9 bp perfect match site for a given ZFP should be once every Construction of zinc finger libraries has been 610 Phage Display Selection of Zinc Finger Transcription Factors described.14 PCR-generated libraries were subcloned in BSA) prior to staining. Two wells for each sample were pComb3H and amplified. Growth and precipitation of prepared with 105 cells; one received 5 mg/ml of TA-1 phage were as described.30 Streptavidin-coated magnetic antibody and the other 5 mg/ml of IgG1 control antibody beads (Dynal) were optimized to bind the 1.4 kb target in 100 ml of FACS buffer. After incubation on ice for one (0.05 mg target/ml beads). The beads were washed four hour, cells were washed twice in FACS buffer. Bound times with zinc buffer A (ZBA) (10 mM Tris, 90 mM antibodies were stained with Cy5-labeled donkey anti- KCl, 1 mM MgCl2,90mM ZnCl2), 5 mM DTT and once mouse secondary antibody in 100 ml of a 1:100 (v/v) with ZBA, 5 mM DTT, 5% (w/v) non-fat dry milk. Target dilution in FACS buffer. Finally, the cells were washed was prepared in ZBA, 5 mM DTT, 5% non-fat dry milk, twice in FACS buffer, resuspended in 500 ml of FACS 1 M NaCl, added to the washed beads, and incubated buffer, and analyzed for their fluorescence with a Becton for one hour at 37 8C on a rotating wheel. After incu- Dickinson FACSort. bation, beads were washed once with ZBA, 5 mM DTT, Fold activation and repression were calculated based on 5% non-fat dry milk. Then 100 ml of filtered phage (1013 gating the GFP-positive population (examples shown in colony-forming units), 100 ml of ZBA, 5 mM DTT, 5% Figure 4a–d). From the GFP-gated profiles, the geometric Blotto, 4 mg of sheared herring sperm DNA (Sigma), mean value for the center of the peak derived from the pro-

294 ml of ZBA and 2.5 ml of 1 M DTT were added to the tein expression as a result of TFZF infection (in Figure 4a–d beads and the samples were incubated for three hours this peak is red) and the geometric mean value for at room temperature on a rotating wheel. the center of the peak derived from cells transduced with a stuffer DNA fragment fused to VP64 or KRAB Phage ELISA (Figure 4a–d, the blue peak) were calculated using Cell- Quest software. To calculate fold activation, the TFZF Phage ELISA was performed as described.52 derived peak value (red) was divided by the basal expression peak (blue). For fold repression, the basal expression peak (blue) was divided by the TFZF-derived Luciferase assays peak (red).

Luciferase assays were performed as described,5 Construction and characterization of the except that A431 cells were used. six-finger proteins Antibodies For the construction of the six-finger proteins, two three-finger proteins binding each of the 9 bp half-sites ErbB-2 expression was detected using TA-1 antibody of each of the three 18 bp target sequences were con- (Calbiochem). Control staining was done using mouse 0 structed by grafting the appropriate DNA recognition F(ab )2 IgG1-UNLB (SouthernBiotech). The secondary helices into the framework of the three-finger protein antibody for both was Cy5-labeled, affinity-purified don- 0 Sp1C. DNA fragments encoding the two three-finger key F(ab )2 anti-mouse IgG (Jackson ImmunoResearch). proteins were assembled from six overlapping oligonucleotides as described.5 The oligonucleotides used were Retroviral gene targeting based on DNA recognition helices characterized from finger 2 variants of Zif268.9,30 6Fn-654 was designed to bind 0 0 For retroviral expression of the three-finger and six- 5 -GTCAAGGAGGGGGATGTG-3 and was assembled finger proteins, the zinc finger-KRAB and zinc finger- from domains pGTC, pAAG, pmGAG, pmGGG, pGAT and GTG. 6Fn-369 was designed to bind 50-GGCGCTAGG VP64 coding regions were cloned into a modified 0 pMX-IRES-GFP53 using SfiI restriction sites (IRES, AGGGACGAC-3 and was assembled from domains internal ribosome-entry site; GFP, green fluorescent pro- pmGGC,pmGCT,pAGG(t),pAGG(j),pmGACand pmGAC. 6Fn-275 was designed to bind 50-GCAGTTGGA tein). As a control for the retroviral infection, a construct 0 containing a stuffer fragment of DNA inserted at the Sfi GGGGGCGAG-3 andwasassembledfromdomains sites was prepared. The stuffer sequence coded for a pGCA, pmGTT, GGA, pmGGG, pmGGC, pmGAG. single-chain Fab modified with stop codons that prevent expression. The retroviral pMX-IRES-GFP/zinc finger Purification and footprinting constructs were transiently transfected into the packa- 6 ging cell line 293 gag/pols by using Lipofectamine Zinc finger-coding DNA was subcloned into a modi- Plus (GIBCO/BRL). Three hours after transfection the fied pMAL-c2 (New England Biolabs) bacterial medium was changed to 6 ml of fresh DMEM with 10% expression vector and transformed into XL-1 Blue (v/v) fetal calf serum (FCS) and penicillin/strepto- (Stratagene). Protein was purified using the Protein mycin/anti-mycotic antibiotics. Approximately 42 hours Fusion and Purification System (New England Biolabs) later, culture supernatants were used for infection of following the manufacturer’s protocol, except that m target cells in the presence of 8 g/ml of Polybrene. ZBA/5 mM DTT was used as the column buffer. Protein Four infections were performed, the first after 42 hours purity was determined by staining 4%–12% Novex gels of transfection, then 50, 66 and 74 hours following trans- with Coomassie brilliant blue. The protein concentration fection. At 90 hours post-transfection, the mediumwas was determined by Bradford assay with bovine serum changed to 10 ml of fresh DMEM, 10% FCS, antibiotics. albumin (BSA) standards. The radiolabeled DNA frag- One week from the start of the transfection the cells ments were generated by PCR using the human ErbB-2 were harvested for analysis. promoter cloned into pGL35 with High Fidelity PCR Master (Roche) with 60 pmol of the following (50-32P)- Flow cytometric analysis labeled primers (designated with an F) and 30 primers (designated with a B): Cells were trypsinized and washed in FACS buffer 342F (GCATTTTGAAGAATTGAGATAGAAGTCTTT (PBS, 1 mM EDTA, 25 mM Hepes (pH 7.0), 1% (w/v) TTGGG) Phage Display Selection of Zinc Finger Transcription Factors 611

(GGATTACAGGCATGTGCCACCATGACC) Acknowledgements 450F (GGAGTTCAAGACCAGCCTCACCAACGTGG AGAACC) The authors thank Joel Gottesfeld, Christian (GCTCTTGTTGCCCAGGCTGGAGAGC) Melander and David Segal for their invaluable (CCAAATTTGTAGACCCTCTTAAGATCATGC) assistance. This work was supported by the (CCAAGCCTATTTGTTTTAATATCAAATAATGG) US National Institutes of Health CA86258 and (CCTGAGACTTAAAAGGGTGTTAAGAGTGGCAGC) DK61803. C.V.L. is a Skaggs Predoctoral Fellow. 1110B (GCTTCACTTTCTCCCTCTCTTCGC) (CCTAGGGAATTTATCCCGGACTCC) 1150B (CGAAGTCTGGGAGTCGGCAACTCC) 1090F (GCGAAGAGAGGGAGAAAGTGAAGC) References 1270B (GCTTCACAACTTCATTCTTATACTTCC) 1. Levine, M. & Tjian, R. (2003). Transcription regu- Buffer for PCR with all primers except 1270 and 1150 lation and animal diversity. Nature, 424, 147–151. included 10% (v/v) DMSO The PCR program was two 2. Wray, G. A., Hahn, M. W., Abouheif, E., Balhoff, J. P., minutes at 94 8C, (30 seconds at 94 8C, 30 s at 55 8C, 30 Pizer, M., Rockman, M. V. & Romano, L. A. (2003). seconds at 72 8C) for 30 cycles, seven minutes at 72 8C, The evolution of transcriptional regulation in then 4 8C. The footprinting assay was carried out in eukaryotes. Mol. Biol. Evol. 20, 1377–1419. triplicate as described.54 The 5 £ TKMC buffer (50 mM 3. Tupler, R., Perini, G. & Green, M. R. (2001). Expres-

Tris–HCl (pH 7.0), 50 mM KCl, 50 mM MgCl2,25mM sing the human genome. Nature, 409, 832–833.

CaCl2,) was supplemented with 50 mM ZnCl2 and 4. Iuchi, S. (2001). Three classes of C2H2 zinc finger 5 mM DTT was added fresh to the binding reactions proteins. Cell. Mol. Life Sci. 58, 625–635. Equilibrations were incubated for 12–18 hours at 4 8C 5. Beerli, R. R., Segal, D. J., Dreier, B. & Barbas, C. F., or for one hour at 37 8C and were subsequently 3rd (1998). Toward controlling gene expression at digested with 13 ml of a 0.00012 unit/ml solution of will: specific regulation of the erbB-2/HER-2 pro- DNase I, 1 mM DTT (Roche Diagnostics) Samples were moter by using polydactyl zinc finger proteins con- electrophoresed through an 8 M urea/6% poly-acrylamide structed from modular building blocks. Proc. Natl gel The gels were exposed on phosphorimager Acad. Sci. USA, 95, 14628–14633. plates, recorded by a PhosphorImager SI (Molecular 6. Beerli, R. R., Dreier, B. & Barbas, C. F., 3rd (2000). Dynamics), and subsequently analyzed using Image- Positive and negative regulation of endogenous Quant (Molecular Dynamics) and KaleidaGraph genes by designed transcription factors. Proc. Natl Acad. Sci. USA, 97, 1495–1500. software (Synergy, Reading, PA) to give Kd values as described.54 7. Zhang, L., Spratt, S. K., Liu, Q., Johnstone, B., Qi, H., Raschke, E. E. et al. (2000). Synthetic zinc finger transcription factor action at an endogenous chromo- somal site. Activation of the human erythropoietin Immunocytochemical analysis of TFZF localization gene. J. Biol. Chem. 275, 33850–33860. 8. Liu, P. Q., Rebar, E. J., Zhang, L., Liu, Q., Jamieson, For analysis of TF expression in transduced A431 A. C., Liang, Y. et al. (2001). Regulation of an ZF endogenous locus using a panel of designed zinc fin- cells (TFZFs ZFP16K and 6Fn3K), cells were seeded on poly(L-lysine)-coated Lab-Tek coverglasses and incu- ger proteins targeted to accessible chromatin regions. bated for 30 minutes. Cells were washed with copious Activation of vascular endothelial growth factor A. J. Biol. Chem. 276, 11323–11334. amounts of PBS, incubated with 4% (v/v) paraformalde- 9. Dreier, B., Beerli, R. R., Segal, D. J., Flippin, J. D. & hyde for 20 minutes, washed again, and incubated in a Barbas, C. F., 3rd (2001). Development of zinc finger humidifying chamber at room temperature for one hour domains for recognition of the 50-ANN-30 family of with a mixture of biotinylated rat anti-HA mAb (2 mg/ DNA sequences and their use in the construction ml, Roche Diagnostics, Indianapolis, IN) and rabbit anti- of artificial transcription factors. J. Biol. Chem. 276, m human ErbB-2 polyclonal antibody (5 g/ml, Calbio- 29466–29478. chem, La Jolla, CA) in FACS buffer, 0.1% (w/v) saponin. 10. Ren, D., Collingwood, T. N., Rebar, E. J., Wolffe, A. P. The cells were then stained for one hour at room tem- & Camp, H. S. (2002). PPARgamma knockdown by perature with the mixture of Cy5-conjugated donkey engineered transcription factors: exogenous PPAR- anti-rabbit IgG polyclonal antibodies and Streptavidin/ gamma2 but not PPARgamma1 reactivates adipo- rhodamine Red-X (both from Jackson Immunoresearch, genesis. Genes Dev. 16, 27–32. West Grove, PA) diluted 1:100 (v/v) in FACS buffer, 11. Xu, D., Ye, D., Fisher, M. & Juliano, R. L. (2002). 0.1% (w/v) saponin. Finally, the cells were incubated 0 Selective inhibition of P-glycoprotein expression in with 4 ,6-diamidino-2-phenylindole dihydrochloride multidrug-resistant tumor cells by a designed tran- (DAPI) solution for five minutes, washed with PBS, and scriptional regulator. J. Pharmacol. Expt. Ther. 302, covered with SlowFade Antifade reagent. Four-color 963–971. (DAPI, GFP, rhodamine Red-X, and Cy5) three-dimen- 12. Guan, X., Stege, J., Kim, M., Dahmani, Z., Fan, N., sional datasets were collected with a DeltaVision system Heifetz, P. et al. (2002). Heritable endogenous gene (Applied Precision, Issaquah, WA). Exposure times regulation in plants with designed polydactyl zinc were 0.2–0.5 s (2-binning), and images were obtained finger transcription factors. Proc. Natl Acad. Sci. with either 60 £ or 100 £ magnification oil objectives. USA, 99, 13296–13301. Three-dimensional reconstruction was generated by 13. Jouvenot, Y., Ginjala, V., Zhang, L., Liu, P. Q., capturing 150 nm serial sections along the z-axis. Oshimura, M., Feinberg, A. P. et al. (2003). Targeted Images were deconvolved (based on the Agard-Sadat regulation of imprinted genes by synthetic zinc- inverse matrix algorithm) and analyzed with softWorX finger transcription factors. Gene Ther. 10, 513–522. Version 2.5. 14. Blancafort, P., Magnenat, L. & Barbas, C. F. (2003). 612 Phage Display Selection of Zinc Finger Transcription Factors

Scanning the human genome with combinatorial Insights into the molecular recognition of the transcription factor libraries. Nature Biotechnol. 21, 50-GNN-30( family of DNA sequences by zinc finger 269–274. domains. J. Mol. Biol. 303, 489–502. 15. Falke, D., Fisher, M., Ye, D. & Juliano, R. L. (2003). 32. Hapgood, J. P., Riedemann, J. & Scherer, S. D. (2001). Design of artificial transcription factors to selectively Regulation of gene expression by GC-rich DNA cis- regulate the pro-apoptotic bax gene. Nucl. Acids Res. elements. Cell. Biol. Intl, 25, 17–31. 31, e10. 33. Seipel, K., Georgiev, O. & Schaffner, W. (1992). Dif- 16. Reynolds, L., Ullman, C., Moore, M., Isalan, M., ferent activation domains stimulate transcription West, M. J., Clapham, P. et al. (2003). Repression of from remote (“enhancer”) and proximal (“promo- the HIV-1 50 LTR promoter and inhibition of HIV-1 ter”) positions. EMBO J. 11, 4961–4968. replication by using engineered zinc-finger transcrip- 34. Scott, G. K., Daniel, J. C., Xiong, X., Maki, R. A., tion factors. Proc. Natl Acad. Sci. USA, 100, Kabat, D. & Benz, C. C. (1994). Binding of an ETS- 1615–1620. related protein within the DNase I hypersensitive 17. Segal, D. J., Gonclaves, J., Eberhardy, S., Swan, C. H., site of the HER2/neu promoter in human breast Torbett, B. E. & Barbas, C. F., 3rd (2004). Attenuation cancer cells. J. Biol. Chem. 269, 19848–19858. of HIV-1 replication in primary human cells with a 35. Scott, G. K., Chang, C. H., Erny, K. M., Xu, F., designed zinc finger transcription factor. J. Biol. Fredericks, W. J., Rauscher, F. J., 3rd et al. (2000). Ets Chem. 279, 14509–14519. regulation of the erbB2 promoter. Oncogene, 19, 18. Wysocka, J. & Herr, W. (2003). The herpes simplex 6490–6502. virus VP16-induced complex: the makings of a regu- 36. Noonberg, S. B., Scott, G. K., Hunt, C. A., Hogan, latory switch. Trends Biochem. Sci. 28, 294–304. M. E. & Benz, C. C. (1994). Inhibition of transcription 19. Margolin, J. F., Friedman, J. R., Meyer, W. K., Vissing, factor binding to the HER2 promoter by triplex- H., Thiesen, H. J. & Rauscher, F. J., 3rd (1994). forming oligodeoxyribonucleotides. Gene, 149, Kruppel-associated boxes are potent transcriptional 123–126. repression domains. Proc. Natl Acad. Sci. USA, 91, 37. Mishra, S. K., Mandal, M., Mazumdar, A. & Kumar, 4509–4513. R. (2001). Dynamic chromatin remodeling on the 20. Liu, Q., Segal, D. J., Ghiara, J. B. & Barbas, C. F., 3rd HER2 promoter in human breast cancer cells. FEBS (1997). Design of polydactyl zinc-finger proteins for Letters, 507, 88–94. unique addressing within complex genomes. Proc. 38. Tan, S., Guschin, D., Davalos, A., Lee, Y. L., Natl Acad. Sci. USA, 94, 5525–5530. Snowden, A. W., Jouvenot, Y. et al. (2003). Zinc-finger 21. Ronicke, V., Risau, W. & Breier, G. (1996). Characteri- protein-targeted gene regulation: genomewide zation of the endothelium-specific murine vascular single-gene specificity. Proc. Natl Acad. Sci. USA, 100, endothelial growth factor receptor-2 (Flk-1) promo- 11997–12002. ter. Circ. Res. 79, 277–285. 39. Kim, J. S. & Pabo, C. O. (1998). Getting a handhold 22. Kappel, A., Schlaeger, T. M., Flamme, I., Orkin, S. H., on DNA: design of poly-zinc finger proteins with Risau, W. & Breier, G. (2000). Role of SCL/Tal-1, femtomolar dissociation constants. Proc. Natl Acad. GATA, and ets transcription factor binding sites Sci. USA, 95, 2812–2817. for the regulation of flk-1 expression during murine 40. Urnov, F. D. (2002). A feel for the template: zinc vascular development. Blood, 96, 3078–3085. finger protein transcription factors and chromatin. 23. Perier, R. C., Praz, V., Junier, T., Bonnard, C. & Biochem. Cell. Biol. 80, 321–333. Bucher, P. (2000). The eukaryotic promoter database 41. Urnov, F. D., Rebar, E. J., Reik, A. & Pandolfi, P. P. (EPD). Nucl. Acids Res. 28, 302–333. (2002). Designed transcription factors as structural, 24. Heinemeyer, T., Wingender, E., Reuter, I., Hermjakob, functional and therapeutic probes of chromatin in H., Kel, A. E., Kel, O. V. et al. (1998). Databases on vivo. Fourth in review series on chromatin dynamics. transcriptional regulation: TRANSFAC, TRRD and EMBO Rep. 3, 610–615. COMPEL. Nucl. Acids Res. 26, 362–367. 42. Liang, Y., Li, X. Y., Rebar, E. J., Li, P., Zhou, Y., Chen, 25. Vityaev, E. E., Orlov, Y. L., Vishnevsky, O. V., B. et al. (2002). Activation of vascular endothelial Pozdnyakov, M. A. & Kolchanov, N. A. (2002). Com- growth factor A transcription in tumorigenic glio- puter system “gene discovery” for promoter struc- blastoma cell lines by an enhancer with cell type- ture analysis. In Silico Biol. 2, 257–262. specific DNase I accessibility. J. Biol. Chem. 277, 26. Turner, B. M. (2002). Cellular memory and the 20087–20094. histone code. Cell, 111, 285–291. 43. Peng, H., Begg, G. E., Schultz, D. C., Friedman, J. R., 27. Georgel, P. T. (2002). Chromatin structure of eukary- Jensen, D. E., Speicher, D. W. & Rauscher, F. J., 3rd otic promoters: a changing perspective. Biochem. (2000). Reconstitution of the KRAB-KAP-1 repressor Cell. Biol. 80, 295–300. complex: a model system for defining the molecular 28. Choo, Y. & Klug, A. (1994). Selection of DNA binding anatomy of RING-B box-coiled-coil domain- sites for zinc fingers using rationally randomized mediated protein–protein interactions. J. Mol. Biol. DNA reveals coded interactions. Proc. Natl Acad. Sci. 295, 1139–1162. USA, 91, 11168–11172. 44. Vernimmen, D., Begon, D., Salvador, C., Gofflot, S., 29. Wu, H., Yang, W. P. H. & Barbas, C. F., 3rd (1995). Grooteclaes, M. & Winkler, R. (2003). Identification Building zinc fingers by selection: toward a thera- of HTF (HER2 transcription factor) as an AP-2 peutic application. Proc. Natl Acad. Sci. USA, 92, (activator protein-2) transcription factor and contri- 344–348. bution of the HTF binding site to ERBB2 gene over- 30. Segal, D. J., Dreier, B., Beerli, R. R. & Barbas, C. F., expression. Biochem. J. 370, 323–329. 3rd (1999). Toward controlling gene expression at 45. Perissi, V., Menini, N., Cottone, E., Capello, D., Sacco, will: selection and design of zinc finger domains M., Montaldo, F. & De Bortoli, M. (2000). AP-2 tran- recognizing each of the 50-GNN-30 DNA target scription factors in the regulation of ERBB2 gene sequences. Proc. Natl Acad. Sci. USA, 96, 2758–2763. transcription by oestrogen. Oncogene, 19, 280–288. 31. Dreier, B., Segal, D. J. & Barbas, C. F., 3rd (2000). 46. Chen, H., Yu, D., Chinnadurai, G., Karunagaran, D. Phage Display Selection of Zinc Finger Transcription Factors 613

& Hung, M. C. (1997). Mapping of adenovirus 5 E1A growth factor beta-induced phosphorylation of domains responsible for suppression of neu- Smad3 is required for growth inhibition and tran- mediated transformation via transcriptional repres- scriptional induction in epithelial cells. Proc. Natl sion of neu. Oncogene, 14, 1965–1971. Acad. Sci. USA, 94, 10669–10674. 47. Wang, S. C., Zhang, L., Hortobagyi, G. N. & Hung, 54. Trauger, J. W. & Dervan, P. B. (2001). Footprinting M. C. (2001). Targeting HER2: recent developments methods for analysis of pyrrole–imidazole poly- and future directions for breast cancer patients. amide/DNA complexes. Methods Enzymol. 340, Semin. Oncol. 28, 21–29. 450–466. 48. von Hippel, P. (1979). On the molecular bases of the 55. Chen, H. & Hung, M. C. (1997). Involvement of specificity of interaction of transcriptional proteins co-activator p300 in the transcriptional regulation with genomic DNA. Biological Regulation of the HER-2/neu gene. J. Biol. Chem. 272, 6101–6104. and Development (Goldberger, R., ed.), vol. 1, pp. 56. Chen, Y. & Gill, G. N. (1994). Positive and negative 279–347, Plenum Press, New York. regulatory elements in the human erbB-2 gene 49. Miller, J. C. & Pabo, C. O. (2001). Rearrangement of promoter. Oncogene, 9, 2269–2276. side-chains in a Zif268 mutant highlights the com- plexities of zinc finger-DNA recognition. J. Mol. Biol. 313, 309–315. 50. Segal, D. J., Beerli, R. R., Blancafort, P., Dreier, B., Edited by F. Schmid Effertz, K., Huber, A. et al. (2003). Evaluation of a modular strategy for the construction of novel polydactyl zinc finger DNA-binding proteins. Bio- (Received 14 January 2004; received in revised form chemistry, 42, 2137–2148. 21 April 2004; accepted 22 April 2004) 51. Bulyk, M. L., Huang, X., Choo, Y. & Church, G. M. (2001). Exploring the DNA-binding specificities of zinc fingers with DNA microarrays. Proc. Natl Acad. Sci. USA, 98, 7158–7163. 52. Barbas, C. I., Burton, D. R., Scott, J. K. & Silverman, G. J. (2001). Phage Display: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 53. Liu, X., Sun, Y., Constantinescu, S. N., Karam, E., Supplementary Material for this paper compris- Weinberg, R. A. & Lodish, H. F. (1997). Transforming ing one movie is available on Science Direct