DOCSLIB.ORG

Tomosyn Interacts with the T-Snares Syntaxin4 and SNAP23 and Plays a Role in Insulin-Stimulated GLUT4 Translocation*

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Tomosyn Interacts with the T-Snares Syntaxin4 and SNAP23 and Plays a Role in Insulin-Stimulated GLUT4 Translocation* THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 278, No. 37, Issue of September 12, pp. 35093–35101, 2003 © 2003 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Tomosyn Interacts with the t-SNAREs Syntaxin4 and SNAP23 and Plays a Role in Insulin-stimulated GLUT4 Translocation* Received for publication, April 23, 2003, and in revised form, June 25, 2003 Published, JBC Papers in Press, June 27, 2003, DOI 10.1074/jbc.M304261200 Charlotte H. Widberg, Nia J. Bryant‡, Milena Girotti§, Shane Rea¶, and David E. Jamesʈ From the Garvan Institute of Medical Research, 384 Victoria Street, Darlinghurst, 2010 Sydney, New South Wales, Australia The Sec1p-like/Munc18 (SM) protein Munc18a binds to priate target membrane. Different sets of v-/t-SNAREs control the neuronal t-SNARE Syntaxin1A and inhibits SNARE discrete membrane transport steps. For example, synaptic ves- complex assembly. Tomosyn, a cytosolic Syntaxin1A- icle exocytosis is facilitated by the t-SNAREs Syntaxin1A and binding protein, is thought to regulate the interaction SNAP25 that localize to the presynaptic plasma membrane and between Syntaxin1A and Munc18a, thus acting as a pos- bind with high affinity to the v-SNARE, VAMP-2, present on itive regulator of SNARE assembly. In the present study synaptic vesicles (1). A defining feature of v- and t-SNAREs is we have investigated the interaction between b-Tomo- the presence of a conserved ␣-helical domain in the juxtamem- Downloaded from syn and the adipocyte SNARE complex involving Syn- brane region of their cytosolic tail. During SNARE-mediated taxin4/SNAP23/VAMP-2 and the SM protein Munc18c, in membrane fusion, four of these SNARE domains contribute to vitro, and the potential involvement of Tomosyn in reg- a parallel four-helical bundle arrangement (5, 6). ulating the translocation of GLUT4 containing vesicles, in vivo. Tomosyn formed a high affinity ternary complex The assembly of functional SNARE complexes in eukaryotic cells occurs in several discrete stages, each of which represents with Syntaxin4 and SNAP23 that was competitively in- http://www.jbc.org/ hibited by VAMP-2. Using a yeast two-hybrid assay we a potential site of regulation. For example, there is the priming demonstrate that the VAMP-2-like domain in Tomosyn step where cis-SNARE complexes, found in both donor and facilitates the interaction with Syntaxin4. Overexpres- target membranes, are disassembled by the ATPase NSF and sion of Tomosyn in 3T3-L1 adipocytes inhibited the ␣-SNAP (7, 8). Once primed, tethering machinery may guide translocation of green fluorescent protein-GLUT4 to the the SNAREs in each membrane into close proximity, and a plasma membrane. The SM protein Munc18c was shown proof-reading machinery likely ensures fidelity of the aligned at University of Washington on October 3, 2018 to interact with the Syntaxin4 monomer, Syntaxin4 con- v-/t-SNARE pairs (9). Following this, formation of the high taining SNARE complexes, and the Syntaxin4/Tomosyn affinity trans-SNARE complex results in the committed step of complex. These data suggest that Tomosyn and Munc18c docking (10). Many different molecules play a role in various operate at a similar stage of the Syntaxin4 SNARE as- stages of this SNARE assembly cycle. One family of proteins sembly cycle, which likely primes Syntaxin4 for entry that regulates SNARE assembly is the Sec1p/Munc18 (SM) into the ternary SNARE complex. family. However, the role of SM proteins in SNARE assembly is complex and somewhat controversial (11). The neuronal SM protein Munc18a binds with high affinity Soluble N-ethylmaleimide-sensitive factor (NSF)1 attach- (K ϭ 80 nM) to Syntaxin1A, reducing the affinity of ment protein (SNAP) receptors (SNAREs) play a critical role in d vesicular transport by regulating membrane docking and fu- Syntaxin1A for VAMP-2 (12). Consistent with the conclusion sion (1–4). Transport vesicles contain membrane proteins, that Munc18a plays a negative role in SNARE complex forma- known as v-SNAREs, that bind in a highly specific manner to tion is the observation that Munc18a does not bind to the cognate membrane proteins, t-SNAREs, present in the appro- Syntaxin1A/SNAP25/VAMP-2 ternary fusion complex (13–15). The Syntaxin1A monomer has been shown to adopt a closed conformation because of interactions between the amino-termi- * This work was supported by the National Health and Medical nal Habc helical domain and the SNARE-forming H3 helix at Research Council of Australia. The costs of publication of this article were defrayed in part by the payment of page charges. This article must the carboxyl terminus (16). In the ternary complex Syntaxin1A therefore be hereby marked “advertisement” in accordance with 18 undertakes a more open conformation, thus facilitating inter- U.S.C. Section 1734 solely to indicate this fact. actions between the H3 domain and the SNARE motifs present The nucleotide sequence(s) reported in this paper has been submitted in SNAP25 and VAMP-2 (16, 17). Because Munc18a binds to, to the GenBankTM/EBI Data Bank with accession number(s) AF516607 and AF516608. and possibly stabilizes, Syntaxin1A in its closed conformation a ‡ Present address: Division of Biochemistry and Molecular Biology, major objective has been to identify factors that could disrupt Inst. of Biomedical and Life Sciences, University of Glasgow, Davidson the Munc18a/Syntaxin1A heterodimer, thus enhancing Bldg., Glasgow G12 8QQ, Scotland, United Kingdom. SNARE complex formation. Tomosyn was identified as a mol- § Present address: Dept. of Pediatrics, National Jewish Research Inst., 1400 Jackson St., Denver, CO 80206. ecule with properties consistent with such a role. Tomosyn was ¶ Present address: University of Colorado, UCB 447, 1480 30th St., found to interact specifically with Syntaxin1A and in so doing Boulder, CO 80309. displace Munc18a (18). ʈ To whom correspondence should be addressed. Tel.: 61-02-9295- Tomosyn contains a series of conserved amino-terminal 8210; Fax: 61-02-9295-8201; E-mail: [email protected]. 1 The abbreviations used are: NSF, N-ethylmaleimide sensitive fac- WD-40 repeats and a carboxyl-terminal VAMP-2-like domain tor; SNAP, soluble NSF attachment protein; SNARE, SNAP receptors; that is necessary for binding to Syntaxin1A and participation VAMP, vesicle-associated membrane protein; SM proteins, Sec1/ in a 10 S complex with SNAP25 and the synaptic membrane Munc18-like proteins; eGFP, enhanced green fluorescent protein; RT, protein Synaptotagmin (18–20). Despite the fact that Tomosyn reverse transcriptase; GST, glutathione S-transferase; PBS, phosphate- buffered saline; BSA, bovine serum albumin; NEM, N-ethylmaleimide; was shown to interact only with the neuronal t-SNARE PM, plasma membrane; LDM, low density microsomes. Syntaxin1A its ubiquitous tissue distribution raised the possi- This paper is available on line at http://www.jbc.org 35093 35094 Tomosyn’s Involvement with SNAREs Executing GLUT4 Vesicle Fusion bility that it may participate in vesicle transport steps con- epitope-tagged pMEXneo using BamHI and EcoRI. The FLAG epitope Ј trolled by other syntaxin isoforms (18, 20). Intriguingly, the was constructed using the following primers: 5, 5 gaaggatccgtcgacacc- atggactacaaagaccatgacggtgattataaagatcatgat3Ј;6,5Јatcatgatctttataat- v-SNARE VAMP-2, in addition to binding to Syntaxin1A, also caccgtcatggtctttgtagtccatggtgtcgacggatccttc3Ј;7,5Јgaagatatcgattacaag- binds to the ubiquitously expressed t-SNARE Syntaxin4 (14, gatgacgatgacggatccggg3Ј;8,5Јcccggatccgtcatcgtcatccttgtaatcgatatcttc- 21). Further, Syntaxin4 has been shown to form an SDS-resist- 3Ј. Primers 5–8 were annealed and digested with EcoRV before being ant SNARE complex with SNAP23 and VAMP-2 (22). This subcloned as a double stranded fragment into pMEXneo using SalI and complex plays a role in a number of regulated exocytic pro- BamHI. Truncated Tomosyn cDNAs encoding bp 1–1050, 1–3225, cesses including the insulin-regulated trafficking of the facili- 1050–3225, and 3199–3459 were obtained by PCR using primers 9, 5Јcccgaattcaggaaattcaacatc3Ј; 10, 5Јcccctcgagtcatgtgagaaagtcaac3Ј; 11, tative glucose transporter GLUT4 in fat and muscle cells (21– 5Јcccctcgagtcaggaggcctttcccga3Ј; 12, 5Јcccgaattcacactctgtgaaacg3Ј; 13, 25). Furthermore, this SNARE complex resembles the synaptic 5Јcccgaattcggagagtcgtcctcg3Ј; and 14, 5Јcccctcgagtcagaactggtaccactt3Ј. ternary complex and is subject to regulation by the ubiqui- The Tomosyn cDNAs were cloned into pBTM116 using EcoRI and SalI. tously expressed SM protein Munc18c (21, 26, 27). We have pBTM116-Munc18c and pAct-Syntaxin4 cDNAs were kind gifts from investigated the role of b-Tomosyn in exocytosis of GLUT4 Dr. Y. Le Marchand-Brustel (Nice, France). eGFP-tagged GLUT4 vesicles and in the assembly of Syntaxin4/SNAP23/VAMP-2 (GLUT4-GFP-pcDNA3) was received from Dr. J. Pessin (University of Iowa). All cDNAs obtained by PCR were confirmed by sequencing. ternary complexes. The present study shows that b-Tomosyn Generation of Antibodies—Rabbit antiserum that specifically recog- binds with high affinity to Syntaxin4 via its VAMP-2 like nizes Munc18c was raised against a glutathione S-transferase (GST) domain and that overexpression of Tomosyn in 3T3-L1 adipo- fusion protein comprising a tandem repeat of the carboxyl-terminal 14 cytes inhibits the insulin-dependent translocation of GLUT4- amino acids of mouse Munc18c (MLNKSKDKVSFKDE). Following pu- rification on glutathione-agarose beads (Sigma) the immunogen was eGFP to the cell surface. In contrast to the situation
Load more

Recommended publications
  • Protein Interaction Network of Alternatively Spliced Isoforms from Brain Links Genetic Risk Factors for Autism
    ARTICLE Received 24 Aug 2013 | Accepted 14 Mar 2014 | Published 11 Apr 2014 DOI: 10.1038/ncomms4650 OPEN Protein interaction network of alternatively spliced isoforms from brain links genetic risk factors for autism Roser Corominas1,*, Xinping Yang2,3,*, Guan Ning Lin1,*, Shuli Kang1,*, Yun Shen2,3, Lila Ghamsari2,3,w, Martin Broly2,3, Maria Rodriguez2,3, Stanley Tam2,3, Shelly A. Trigg2,3,w, Changyu Fan2,3, Song Yi2,3, Murat Tasan4, Irma Lemmens5, Xingyan Kuang6, Nan Zhao6, Dheeraj Malhotra7, Jacob J. Michaelson7,w, Vladimir Vacic8, Michael A. Calderwood2,3, Frederick P. Roth2,3,4, Jan Tavernier5, Steve Horvath9, Kourosh Salehi-Ashtiani2,3,w, Dmitry Korkin6, Jonathan Sebat7, David E. Hill2,3, Tong Hao2,3, Marc Vidal2,3 & Lilia M. Iakoucheva1 Increased risk for autism spectrum disorders (ASD) is attributed to hundreds of genetic loci. The convergence of ASD variants have been investigated using various approaches, including protein interactions extracted from the published literature. However, these datasets are frequently incomplete, carry biases and are limited to interactions of a single splicing isoform, which may not be expressed in the disease-relevant tissue. Here we introduce a new interactome mapping approach by experimentally identifying interactions between brain-expressed alternatively spliced variants of ASD risk factors. The Autism Spliceform Interaction Network reveals that almost half of the detected interactions and about 30% of the newly identified interacting partners represent contribution from splicing variants, emphasizing the importance of isoform networks. Isoform interactions greatly contribute to establishing direct physical connections between proteins from the de novo autism CNVs. Our findings demonstrate the critical role of spliceform networks for translating genetic knowledge into a better understanding of human diseases.
    [Show full text]
  • 5850.Full.Pdf
    Soluble NSF Attachment Protein Receptors (SNAREs) in RBL-2H3 Mast Cells: Functional Role of Syntaxin 4 in Exocytosis and Identification of a Vesicle-Associated This information is current as Membrane Protein 8-Containing Secretory of September 25, 2021. Compartment Fabienne Paumet, Joëlle Le Mao, Sophie Martin, Thierry Galli, Bernard David, Ulrich Blank and Michèle Roa Downloaded from J Immunol 2000; 164:5850-5857; ; doi: 10.4049/jimmunol.164.11.5850 http://www.jimmunol.org/content/164/11/5850 http://www.jimmunol.org/ References This article cites 60 articles, 36 of which you can access for free at: http://www.jimmunol.org/content/164/11/5850.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision by guest on September 25, 2021 • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2000 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Soluble NSF Attachment Protein Receptors (SNAREs) in RBL-2H3 Mast Cells: Functional Role of Syntaxin 4 in Exocytosis and Identification of a Vesicle-Associated Membrane Protein 8-Containing Secretory Compartment1 Fabienne Paumet,* Joe¨lle Le Mao,* Sophie Martin,* Thierry Galli,† Bernard David,* Ulrich Blank,* and Miche`le Roa2* Mast cells upon stimulation through high affinity IgE receptors massively release inflammatory mediators by the fusion of spe- cialized secretory granules (related to lysosomes) with the plasma membrane.
    [Show full text]
  • Transcriptional Recapitulation and Subversion Of
    Open Access Research2007KaiseretVolume al. 8, Issue 7, Article R131 Transcriptional recapitulation and subversion of embryonic colon comment development by mouse colon tumor models and human colon cancer Sergio Kaiser¤*, Young-Kyu Park¤†, Jeffrey L Franklin†, Richard B Halberg‡, Ming Yu§, Walter J Jessen*, Johannes Freudenberg*, Xiaodi Chen‡, Kevin Haigis¶, Anil G Jegga*, Sue Kong*, Bhuvaneswari Sakthivel*, Huan Xu*, Timothy Reichling¥, Mohammad Azhar#, Gregory P Boivin**, reviews Reade B Roberts§, Anika C Bissahoyo§, Fausto Gonzales††, Greg C Bloom††, Steven Eschrich††, Scott L Carter‡‡, Jeremy E Aronow*, John Kleimeyer*, Michael Kleimeyer*, Vivek Ramaswamy*, Stephen H Settle†, Braden Boone†, Shawn Levy†, Jonathan M Graff§§, Thomas Doetschman#, Joanna Groden¥, William F Dove‡, David W Threadgill§, Timothy J Yeatman††, reports Robert J Coffey Jr† and Bruce J Aronow* Addresses: *Biomedical Informatics, Cincinnati Children's Hospital Medical Center, Cincinnati, OH 45229, USA. †Departments of Medicine, and Cell and Developmental Biology, Vanderbilt University and Department of Veterans Affairs Medical Center, Nashville, TN 37232, USA. ‡McArdle Laboratory for Cancer Research, University of Wisconsin, Madison, WI 53706, USA. §Department of Genetics and Lineberger Cancer Center, University of North Carolina, Chapel Hill, NC 27599, USA. ¶Molecular Pathology Unit and Center for Cancer Research, Massachusetts deposited research General Hospital, Charlestown, MA 02129, USA. ¥Division of Human Cancer Genetics, The Ohio State University College of Medicine, Columbus, Ohio 43210-2207, USA. #Institute for Collaborative BioResearch, University of Arizona, Tucson, AZ 85721-0036, USA. **University of Cincinnati, Department of Pathology and Laboratory Medicine, Cincinnati, OH 45267, USA. ††H Lee Moffitt Cancer Center and Research Institute, Tampa, FL 33612, USA. ‡‡Children's Hospital Informatics Program at the Harvard-MIT Division of Health Sciences and Technology (CHIP@HST), Harvard Medical School, Boston, Massachusetts 02115, USA.
    [Show full text]
  • Novel Targets of Apparently Idiopathic Male Infertility
    International Journal of Molecular Sciences Review Molecular Biology of Spermatogenesis: Novel Targets of Apparently Idiopathic Male Infertility Rossella Cannarella * , Rosita A. Condorelli , Laura M. Mongioì, Sandro La Vignera * and Aldo E. Calogero Department of Clinical and Experimental Medicine, University of Catania, 95123 Catania, Italy; [email protected] (R.A.C.); [email protected] (L.M.M.); [email protected] (A.E.C.) * Correspondence: [email protected] (R.C.); [email protected] (S.L.V.) Received: 8 February 2020; Accepted: 2 March 2020; Published: 3 March 2020 Abstract: Male infertility affects half of infertile couples and, currently, a relevant percentage of cases of male infertility is considered as idiopathic. Although the male contribution to human fertilization has traditionally been restricted to sperm DNA, current evidence suggest that a relevant number of sperm transcripts and proteins are involved in acrosome reactions, sperm-oocyte fusion and, once released into the oocyte, embryo growth and development. The aim of this review is to provide updated and comprehensive insight into the molecular biology of spermatogenesis, including evidence on spermatogenetic failure and underlining the role of the sperm-carried molecular factors involved in oocyte fertilization and embryo growth. This represents the first step in the identification of new possible diagnostic and, possibly, therapeutic markers in the field of apparently idiopathic male infertility. Keywords: spermatogenetic failure; embryo growth; male infertility; spermatogenesis; recurrent pregnancy loss; sperm proteome; DNA fragmentation; sperm transcriptome 1. Introduction Infertility is a widespread condition in industrialized countries, affecting up to 15% of couples of childbearing age [1]. It is defined as the inability to achieve conception after 1–2 years of unprotected sexual intercourse [2].
    [Show full text]
  • Low-Resolution Solution Structures of Munc18:Syntaxin Protein Complexes Indicate an Open Binding Mode Driven by the Syntaxin N-Peptide
    Low-resolution solution structures of Munc18:Syntaxin protein complexes indicate an open binding mode driven by the Syntaxin N-peptide Michelle P. Christiea,1, Andrew E. Whittena,1,2, Gordon J. Kinga, Shu-Hong Hua, Russell J. Jarrotta, Kai-En Chena, Anthony P. Duffb, Philip Callowc, Brett M. Collinsd, David E. Jamese, and Jennifer L. Martina,2 Divisions of aChemistry and Structural Biology and dMolecular Cell Biology, Institute for Molecular Bioscience, University of Queensland, St. Lucia, Queensland 4072, Australia; bNational Deuteration Facility, Australian Nuclear Science and Technology Organisation, Lucas Heights, New South Wales 2234, Australia; cLarge Scale Structures Group, Institut Laue-Langevin, 3800 Grenoble, France; and eDiabetes and Obesity Research Program, Garvan Institute of Medical Research, Darlinghurst, New South Wales 2010, Australia Edited by Axel T. Brunger, Stanford University, Stanford, CA, and approved May 4, 2012 (received for review October 14, 2011) When nerve cells communicate, vesicles from one neuron fuse with closed conformation inactivates Sx1a by preventing H3 interact- the presynaptic membrane releasing chemicals that signal to the ing with SNARE partners, SNAP25 on the plasma membrane and next. Similarly, when insulin binds its receptor on adipocytes or vesicle associated membrane protein 2 (VAMP2, also known as muscle, glucose transporter-4 vesicles fuse with the cell membrane, synaptobrevin) on the vesicle membrane. Conversely, when the allowing glucose to be imported. These essential processes require intramolecular Habc interaction is removed, Sx1a can adopt an the interaction of SNARE proteins on vesicle and cell membranes, as open conformation and H3 is then free to participate in SNARE well as the enigmatic protein Munc18 that binds the SNARE protein complex assembly by forming a SNARE binary complex with Syntaxin.
    [Show full text]
  • Isoproterenol Stimulates Transient SNAP23–VAMP2 Interaction in Rat
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector FEBS Letters 587 (2013) 583–589 journal homepage: www.FEBSLetters.org Isoproterenol stimulates transient SNAP23–VAMP2 interaction in rat parotid glands ⇑ Taishin Takuma a, , Akiko Shitara a, Toshiya Arakawa a, Miki Okayama b, Itaru Mizoguchi b, Yoshifumi Tajima c a Department of Biochemistry, School of Dentistry, Health Sciences University of Hokkaido, Tobetsu, Hokkaido 061-0293, Japan b Department of Orthodontics, School of Dentistry, Health Sciences University of Hokkaido, Tobetsu, Hokkaido 061-0293, Japan c Department of Oral Pathology, School of Dentistry, Meikai University, Sakado, Saitama 350-0283, Japan article info abstract Article history: The exocytosis of salivary proteins is mainly regulated by cAMP, although soluble N-ethylmalei- Received 11 December 2012 mide-sensitive factor attachment protein receptors (SNAREs), which mediate cAMP-dependent exo- Revised 10 January 2013 cytic membrane fusion, have remained unidentified. Here we examined the effect of isoproterenol Accepted 20 January 2013 (ISO) and cytochalasin D (CyD) on the level of SNARE complexes in rat parotid glands. When SNARE Available online 1 February 2013 complexes were immunoprecipitated by anti-SNAP23, the coprecipitation of VAMP2 was signifi- Edited by Gianni Cesareni cantly increased in response to ISO and/or CyD, although the coprecipitation of VAMP8 or syntaxin 4 was scarcely augmented. These results suggest that the SNAP23–VAMP2 interaction
    [Show full text]
  • Molecular Genetics of Schizophrenia from Approximately Dehydrogenase (PRODH2, 22Q11.21), G72 (13Q34) with the Middle of 2001
    Moleculargenetics of schizophrenia:a review of the recent literature DouglasF. Levinson Purpose of review Abbreviations The recent literatureon the moleculargenetics of schizophrenia ASP affected sibling pair is reviewed, to familiarizethe reader with several important LD linkage disequilibrium NIMH National Institute of Mental Health developments as well as a broad range of research efforts in a NMDA N-methyl-o-asparlate rapidly progressing field. SNP single-nucleotidepolymorphism UTR untranslated region Recent findings VCFS velo-cardio facial svndrome New genome scan projects, seen in the light of previousscans, provide support for schizophreniacandidate regions on :a.,2003 LippincottWilliams & Wilkins -7367 chromosomes1q, 2q, 5q, 6p, 6q, 8p, 10p, 13q, 15q and 22q. 0951 Linkage disequilibriummapping studiesof severalof these regions have produced evidence from relativelylarge samples lntroduction supportingthe associationof schizophreniato neuregulin-1 This article will revicw new literature relevant ro rhe (NRG1, 8p21-p12), dysbindin(DfNBPt, 6p22.3),protine molecular genetics of schizophrenia from approximately dehydrogenase (PRODH2, 22q11.21), G72 (13q34) with the middle of 2001. Remarkable progress has been made weaker evidence implicating its interactinggene o-amino acid in the 15 years since serious investigation began in this oxidase (DAAO, 12q24), and catechol-O-methyltransferase field. The past year alone witnessed the publication of (COMT,22q11.21). Other reportshave described including the eight new genome scans [,"-6",7',8"] and a meta- application of microarray techniques to schizophreniapost- analysis of published genome scans [9"], rvirh evidence mortem tissue, candidate gene studies in diverse regions, that gcnome scan data are starting to converge on a sct of efforts to develop quantitativephenotypes (e.g. neuroimaging chromosomal regions; five reporusof substantial evidence and neuropsychologicalvariables) and proposed models of for the associationof schizophrenia with specific genes in schizophreniapathogenesis.
    [Show full text]
  • Molecular Characterization of the Cytotoxic Mechanism of Multiwall
    NANO LETTERS 2005 Molecular Characterization of the Vol. 5, No. 12 Cytotoxic Mechanism of Multiwall 2448-2464 Carbon Nanotubes and Nano-Onions on Human Skin Fibroblast Lianghao Ding,†,‡ Jackie Stilwell,†,‡ Tingting Zhang,†,‡,§ Omeed Elboudwarej,† Huijian Jiang,†,| John P. Selegue,⊥ Patrick A. Cooke,#,¶ Joe W. Gray,†,+ and Fanqing Frank Chen*,†,+ Lawrence Berkeley National Laboratory, Berkeley, California 94720, Department of Chemistry, UniVersity of Kentucky, Lexington, Kentucky 40506-0055, Affymetrix Inc., 3380 Central Expressway, Santa Clara, California 95051, and Department of Laboratory Medicine and the ComprehensiVe Cancer Center, UniVersity of California, San Francisco, California 94143 Received September 1, 2005; Revised Manuscript Received October 18, 2005 ABSTRACT The increasing use of nanotechnology in consumer products and medical applications underlies the importance of understanding its potential toxic effects to people and the environment. Although both fullerene and carbon nanotubes have been demonstrated to accumulate to cytotoxic levels within organs of various animal models and cell types and carbon nanomaterials have been exploited for cancer therapies, the molecular and cellular mechanisms for cytotoxicity of this class of nanomaterial are not yet fully apparent. To address this question, we have performed whole genome expression array analysis and high content image analysis based phenotypic measurements on human skin fibroblast cell populations exposed to multiwall carbon nano-onions (MWCNOs) and multiwall carbon nanotubes (MWCNTs). Here we demonstrate that exposing cells to MWCNOs and MWCNTs at cytotoxic doses induces cell cycle arrest and increases apoptosis/necrosis. Expression array analysis indicates that multiple cellular pathways are perturbed after exposure to these nanomaterials at these doses, with material-specific toxigenomic profiles observed.
    [Show full text]
  • Structure of the Munc18c/Syntaxin4 N-Peptide Complex Defines Universal Features of the N-Peptide Binding Mode of Sec1/Munc18 Proteins
    Structure of the Munc18c/Syntaxin4 N-peptide complex defines universal features of the N-peptide binding mode of Sec1/Munc18 proteins Shu-Hong Hu*, Catherine F. Latham*†, Christine L. Gee*‡, David E. James§, and Jennifer L. Martin*¶ *Institute for Molecular Bioscience and Special Research Centre for Functional and Applied Genomics, University of Queensland, Brisbane, Queensland 4072, Australia; and §Garvan Institute of Medical Research, 384 Victoria Road, Darlinghurst, Sydney, New South Wales 2010, Australia Edited by Thomas C. Su¨dhof, The University of Texas Southwestern Medical Center, Dallas, TX, and approved April 3, 2007 (received for review February 7, 2007) Sec1/Munc18 proteins (SM proteins) bind to soluble NSF attach- The case for a positive role is strengthened by observations in the ment protein receptors (SNAREs) and play an essential role in yeast endoplasmic reticulum/Golgi system involving the SM protein membrane fusion. Divergent modes of regulation have been pro- Sly1p and its cognate Stx Sed5p. Sly1p binds to monomeric Sed5p posed for different SM proteins indicating that they can either as well as higher order SNARE complexes. Moreover, these promote or inhibit SNARE assembly. This is in part because of interactions are facilitated by a short N-terminal peptide in Sed5p, discrete modes of binding that have been described for various which fits into a hydrophobic pocket in Sly1p. These data are SM/SNARE complexes. One mode suggests that SM proteins bind consistent with a positive regulatory role for Sly1p in SNARE only to Syntaxins (Stx) preventing SNARE assembly, whereas in assembly and emphasize the importance of the N-peptide interac- another they facilitate SNARE assembly and bind to SNARE com- tion (13–15).
    [Show full text]
  • Regulated Delivery of Molecular Cargo to Invasive Tumour-Derived Microvesicles
    ARTICLE Received 13 Aug 2014 | Accepted 13 Mar 2015 | Published 21 Apr 2015 DOI: 10.1038/ncomms7919 Regulated delivery of molecular cargo to invasive tumour-derived microvesicles James W. Clancy1, Alanna Sedgwick1, Carine Rosse2, Vandhana Muralidharan-Chari1, Graca Raposo2, Michael Method3, Philippe Chavrier2 & Crislyn D’Souza-Schorey1 Cells release multiple, distinct forms of extracellular vesicles including structures known as microvesicles, which are known to alter the extracellular environment. Despite growing understanding of microvesicle biogenesis, function and contents, mechanisms regulating cargo delivery and enrichment remain largely unknown. Here we demonstrate that in amoeboid-like invasive tumour cell lines, the v-SNARE, VAMP3, regulates delivery of microvesicle cargo such as the membrane-type 1 matrix metalloprotease (MT1-MMP) to shedding microvesicles. MT1-MMP delivery to nascent microvesicles depends on the association of VAMP3 with the tetraspanin CD9 and facilitates the maintenance of amoeboid cell invasion. VAMP3-shRNA expression depletes shed vesicles of MT1-MMP and decreases cell invasiveness when embedded in cross-linked collagen matrices. Finally, we describe functionally similar microvesicles isolated from bodily fluids of ovarian cancer patients. Together these studies demonstrate the importance of microvesicle cargo sorting in matrix degradation and disease progression. 1 Department of Biological Sciences, University of Notre Dame, Notre Dame, Indiana 46556, USA. 2 Institut Curie, Centre de Recherche, Paris F-75248, France. 3 Northern Indiana Cancer Consortium, Michiana Hematology Oncology, Mishawaka, Indiana 46545, USA. Correspondence and requests for materials should be addressed to C.D.-S. (email: [email protected]). NATURE COMMUNICATIONS | 6:6919 | DOI: 10.1038/ncomms7919 | www.nature.com/naturecommunications 1 & 2015 Macmillan Publishers Limited.
    [Show full text]
  • VAMP2 Is Implicated in the Secretion of Antibodies by Human Plasma Cells and Can Be Replaced by Other Synaptobrevins
    Cellular & Molecular Immunology (2018) 15, 353–366 & 2018 CSI and USTC. All rights reserved 2042-0226/18 $32.00 www.nature.com/cmi RESEARCH ARTICLE VAMP2 is implicated in the secretion of antibodies by human plasma cells and can be replaced by other synaptobrevins Laura Gómez-Jaramillo1, Raquel Romero-García1, Gema Jiménez-Gómez1, Lisa Riegle2, Ana Belén Ramos-Amaya1, José Antonio Brieva1, Marie Kelly-Worden2 and Antonio Campos-Caro1 The production and secretion of antibodies by human plasma cells (PCs) are two essential processes of humoral immunity. The secretion process relies on a group of proteins known as soluble N-ethylmaleimide-sensitive factor attachment protein receptors (SNAREs), which are located in the plasma membrane (t-SNAREs) and in the antibody-carrying vesicle membrane (v-SNARE), and mediate the fusion of both membranes. We have previously shown that SNAP23 and STX4 are the t-SNAREs responsible for antibody secretion. Here, using human PCs and antibody-secreting cell lines, we studied and characterized the expression and subcellular distribution of vesicle associated membrane protein (VAMP) isoforms, demonstrating that all isoforms (with the exception of VAMP1) are expressed by the referenced cells. Furthermore, the functional role in antibody secretion of each expressed VAMP isoform was tested using siRNA. Our results show that VAMP2 may be the v-SNARE involved in vesicular antibody release. To further support this conclusion, we used tetanus toxin light chain to cleave VAMP2, conducted experiments to verify co-localization of VAMP2 in antibody-carrying vesicles, and demonstrated the coimmunoprecipitation of VAMP2 with STX4 and SNAP23 and the in situ interaction of VAMP2 with STX4.
    [Show full text]
  • How Alternative Splicing Affects Membrane-Trafficking Dynamics R
    © 2018. Published by The Company of Biologists Ltd | Journal of Cell Science (2018) 131, jcs216465. doi:10.1242/jcs.216465 REVIEW How alternative splicing affects membrane-trafficking dynamics R. Eric Blue1, Ennessa G. Curry1,*, Nichlas M. Engels1,*, Eunice Y. Lee1 and Jimena Giudice1,2,3,‡ ABSTRACT et al., 2012). Tissue-specific exons encode disordered segments The cell biology field has outstanding working knowledge of the within proteins that function in microtubule-based transport, fundamentals of membrane-trafficking pathways, which are of critical endocytosis and membrane deformation (Buljan et al., 2012; Ellis importance in health and disease. Current challenges include et al., 2012) (Box 1). understanding how trafficking pathways are fine-tuned for In humans, 90-95% of genes undergo alternative splicing, specialized tissue functions in vivo and during development. In expanding protein function beyond genetic diversity (Pan et al., parallel, the ENCODE project and numerous genetic studies have 2008; Wang et al., 2008). Splicing of intronic regions is regulated by revealed that alternative splicing regulates gene expression in tissues the strength of the splice sites; strong splice sites lead to constitutive and throughout development at a post-transcriptional level. This splicing, whereas weak splice sites are used in a context-dependent Review summarizes recent discoveries demonstrating that alternative manner (alternative splicing). Usage of weak splice sites is regulated splicing affects tissue specialization and membrane-trafficking by cis-regulatory sequences, trans-acting factors such as RNA- proteins during development, and examines how this regulation is binding proteins (RBPs) and epigenetics (Kornblihtt et al., 2013). altered in human disease. We first discuss how alternative splicing of Depending on splice site locations, different types of alternative clathrin, SNAREs and BAR-domain proteins influences endocytosis, splicing events are produced, which comprise insertion of secretion and membrane dynamics, respectively.
    [Show full text]