DOCSLIB.ORG

Supplementary File 1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplementary File 1 Supplementary material Supplementary table S1 List of the antibodies used in this work. The antibody, the host species, the distributor, the product number and the dilution are reported in the table. Antibody Host Species Distributor, Cat. Num. Diluition WB Anti-Actin (AC-40) (Actin) mouse, Sigma-Aldrich, Milan, Italy #A4700 1:1000 monoclonal Anti-AMPKα (Thr172) (D4D6D) (AMPKα) rabbit, polyclonal Cell Signaling Technology, Danvers, USA 1:1000 # 2532 Phospho-AMPKα (Thr172) (D4D6D) (p-AMPK) rabbit, Cell Signaling Technology, Danvers, 1:1000 monoclonal USA #50081 Anti-Akt (Akt) rabbit, polyclonal Cell Signaling Technology, Danvers, USA 1:1000 #9272 Anti phospho-Akt (Ser-473) (p-AKT) rabbit, polyclonal Cell Signaling Technology, Danvers, USA 1:1000 #9271 anti-Caspase-1 (caspase-1) rabbit, polyclonal Cell Signaling Technology, Danvers, USA 1:1000 #2225 Anti-Cytochrome c (A-8) (cyt c) mouse, Santa Cruz Biotechnology, Dallas, TX, 1:500 monoclonal USA #sc-13156 Anti-Cytochrome c oxidase (F-8) (COX IV) mouse, Santa Cruz Biotechnology, Dallas, TX, 1:700 monoclonal USA #sc-376731 Anti-IL-1β (3A6) (IL-1β ) mouse, Cell Signaling Technology, Danvers, USA 1:1000 monoclonal #12242 Anti-Manganese superoxide dismutase (SOD2) rabbit, Cell Signaling Technology, Danvers, USA 1:1000 monoclonal #13141 anti-Phospho-NF-kB p65 (Ser536) (93H1) (NF- rabbit, Cell Signaling Technology, Danvers, USA 1:1000 kB) monoclonal #3033 Anti-β-Tubulin (Tubulin) mouse, Proteintech, Rosemont, USA #66240-1-Ig 1:5000 monoclonal Supplementary table S2. List of the primers used in this work. Forward and reverse primers for the genes tested in this work are reported in the supplementary table. Additionally, the miR-21 stem loop used is also reported. Gene name Forward primer Reverse primer XCt CAACTAGAAGCGTGACAGGT GATGCATGTGCTTTTGTATG NQO-1 GGGTATCTTTCCAGGCTTCC TTTCTACATCTTTCCCTAAGTGGC HO-1 TGTGGCAGCTGTCTCAAACCTCCA TTGAGGCTGAGCCAGGAACAGAGT GAPDH TGGTATCGTGGAAGGACTCATGAC ATGCCAGTGAGCTTCCCGTTCAGC miR-21 ACACTCCAGCTGGGTAGCTTATCAGACTGA TGGTGTCGTGGAGTCG miR21 stem-loop CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTCAACATC Supplementary table S3 . Differential protein expression between H2O2 -treated and control (Ctr) ARPE-19 cells. The protein groups identified using MaxQuant computational platform were analysed using limma statistics to calculate significance values and fold change of different comparisons. log2FC: log2 fold change H2O2 vs Ctr, AveExpr: average expression across all the samples according to normalised log2 iBAQ intensities, t: moderated t statistic of the limma analysis, P Value: p-value of limma statistics, adj P Value: adjusted p-value of limma statistics according to Benjamini and Hochberg FDR. Sequence Mol_weight Nr. Protein name Gene name uniprotID coverage log2FC AveExpr t P.Value adj.P.Val kDa Peptides (%) Protein-glutamine gamma-glutamyltransferase 2 TGM2 P21980 14.8 77.3 7 4.6 25.5 8.0 1.0E-04 1.4E-02 Protein FAM177A1 FAM177A1 Q8N128 15.5 23.8 3 2.9 23.1 3.0 2.1E-02 1.8E-01 Isoform 2 of Glutathione S-transferase Mu 2 GSTM2 P28161-2 31.4 22.6 4 2.5 25.8 6.8 2.9E-04 2.3E-02 Cysteine and glycine-rich protein 1 CSRP1 P21291 20.7 20.6 3 2.5 25.1 7.2 2.0E-04 2.0E-02 Plasminogen activator inhibitor 1 SERPINE1 P05121 67.4 45.1 20 1.8 30.9 10.9 1.5E-05 3.9E-03 Laminin subunit beta-1 LAMB1 P07942 5.2 198.0 5 1.8 25.7 4.9 1.8E-03 4.7E-02 Isoform 2 of MAP7 domain-containing protein 1 MAP7D1 Q3KQU3-2 10.8 88.7 7 1.5 26.5 6.8 2.9E-04 2.3E-02 Isoform 2 of Acid ceramidase ASAH1 Q13510-2 14.8 46.5 5 1.5 26.1 4.9 1.9E-03 4.8E-02 Superoxide dismutase [Mn], mitochondrial SOD2 P04179 53.6 24.8 8 1.5 30.7 6.4 4.1E-04 2.5E-02 Dynein light chain 1, cytoplasmic DYNLL1 P63167 20.2 10.4 2 1.4 27.7 3.8 6.7E-03 1.0E-01 Isoform 4 of Coiled-coil domain-containing protein 9B CCDC9B Q6ZUT6-4 24.7 49.7 9 1.4 27.0 7.0 2.5E-04 2.2E-02 GSK3B-interacting protein GSKIP Q9P0R6 38.8 15.6 2 1.4 25.8 3.8 6.7E-03 1.0E-01 Glutathione S-transferase Mu 3 GSTM3 P21266 19.6 26.6 3 1.4 25.6 5.6 9.2E-04 3.4E-02 Importin subunit alpha-1 KPNA2 P52292 35.3 57.9 9 1.4 27.1 7.4 1.7E-04 1.8E-02 OCIA domain-containing protein 2 OCIAD2 Q56VL3 14.3 17.0 2 1.4 26.5 6.5 3.7E-04 2.4E-02 Major prion protein PRNP P04156 7.9 27.7 2 1.3 26.3 4.4 3.3E-03 6.7E-02 Isoform 4 of NADPH:adrenodoxin oxidoreductase, mitochondrial FDXR P22570-4 16.9 48.1 7 1.3 26.8 7.8 1.3E-04 1.5E-02 Glutathione peroxidase 1 GPX1 P07203 29.6 22.1 5 1.3 26.6 6.0 6.1E-04 2.8E-02 Beta-2-microglobulin B2M P61769 31.1 13.7 3 1.3 28.9 4.6 2.8E-03 6.0E-02 Isoform 2 of Sequestosome-1 SQSTM1 Q13501-2 31.7 38.6 7 1.3 27.2 5.3 1.2E-03 3.7E-02 Phostensin PPP1R18 Q6NYC8 17.8 67.9 7 1.3 26.8 5.2 1.4E-03 4.2E-02 CCN family member 2 CCN2 P29279 6.3 38.1 2 1.3 24.8 4.6 2.6E-03 5.8E-02 ATP synthase-coupling factor 6, mitochondrial ATP5PF P18859 35.2 12.6 4 1.3 26.5 3.6 8.7E-03 1.2E-01 28S ribosomal protein S23, mitochondrial MRPS23 Q9Y3D9 10.5 21.8 2 1.3 24.5 4.3 3.6E-03 7.0E-02 Isoform PML-4 of Protein PML PML P29590-5 21.3 70.0 8 1.2 26.9 6.0 5.8E-04 2.8E-02 HLA class I histocompatibility antigen, B alpha chain HLA-B P01889 22.1 40.5 6 1.2 27.8 6.1 5.4E-04 2.8E-02 NADH dehydrogenase [ubiquinone] iron-sulfur protein 5 NDUFS5 O43920 27.4 12.5 3 1.2 25.7 3.7 8.5E-03 1.2E-01 Aldo-keto reductase family 1 member B1 AKR1B1 P15121 44.3 35.9 11 1.2 29.9 5.3 1.3E-03 3.9E-02 Anillin ANLN Q9NQW6 4.4 124.2 4 1.2 24.5 5.7 8.2E-04 3.2E-02 V-type proton ATPase subunit G 1 ATP6V1G1 O75348 16.9 13.8 2 1.2 25.9 3.6 8.6E-03 1.2E-01 HLA class I histocompatibility antigen, alpha chain G HLA-G P17693 6.8 38.2 2 1.2 26.9 4.9 2.0E-03 4.9E-02 Sequence Mol_weight Nr. Protein name Gene name uniprotID coverage log2FC AveExpr t P.Value adj.P.Val kDa Peptides (%) Isoform 2 of Tropomyosin beta chain TPM2 P07951-2 57.7 33.0 25 1.1 31.7 3.9 6.1E-03 9.6E-02 Alpha- and gamma-adaptin-binding protein p34 AAGAB Q6PD74 23.2 34.6 4 1.1 24.6 3.9 5.9E-03 9.3E-02 Isoform 2 of Deoxyuridine 5-triphosphate nucleotidohydrolase, mitochondrial DUT P33316-2 32.9 17.7 4 1.1 26.1 5.1 1.5E-03 4.4E-02 Isoform 3 of Adenosine kinase ADK P55263-3 14.4 34.1 2 1.1 25.5 4.0 5.6E-03 9.1E-02 28S ribosomal protein S28, mitochondrial MRPS28 Q9Y2Q9 26.2 20.8 3 1.1 24.2 5.0 1.6E-03 4.6E-02 Selenoprotein F SELENOF O60613 17.6 18.1 2 1.1 24.3 4.9 2.0E-03 4.9E-02 Leucine-rich repeat-containing protein 59 LRRC59 Q96AG4 29.0 34.9 9 1.1 29.2 5.4 1.2E-03 3.7E-02 Isocitrate dehydrogenase [NAD] subunit alpha, mitochondrial IDH3A P50213 22.1 39.6 7 1.1 27.4 5.3 1.2E-03 3.7E-02 Isoform Beta-4D of Integrin beta-4 ITGB4 P16144-4 11.7 194.5 15 1.1 27.1 5.4 1.1E-03 3.7E-02 Endonuclease domain-containing 1 protein ENDOD1 O94919 23.0 55.0 6 1.0 25.4 4.7 2.5E-03 5.8E-02 Transgelin TAGLN Q01995 70.1 22.6 15 1.0 31.1 5.0 1.8E-03 4.7E-02 Myosin regulatory light chain 12A MYL12A P19105 72.5 19.8 13 1.0 28.1 3.3 1.5E-02 1.5E-01 Cytochrome b-c1 complex subunit 1, mitochondrial UQCRC1 P31930 23.1 52.6 8 1.0 28.7 5.4 1.1E-03 3.7E-02 Myosin regulatory light polypeptide 9 MYL9 P24844 72.1 19.8 12 1.0 28.4 4.4 3.6E-03 7.0E-02 Annexin A6 ANXA6 P08133 39.7 75.9 24 1.0 29.7 4.4 3.5E-03 6.8E-02 Isoform p18 of 7,8-dihydro-8-oxoguanine triphosphatase NUDT1 P36639-4 25.6 18.0 3 1.0 24.1 4.3 3.8E-03 7.2E-02 Cytochrome c CYCS P99999 54.3 11.7 5 1.0 27.3 3.9 6.6E-03 1.0E-01 Isoform Short of Proliferation marker protein Ki-67 MKI67 P46013-2 6.8 319.4 11 1.0 26.1 5.0 1.7E-03 4.7E-02 39S ribosomal protein L12, mitochondrial MRPL12 P52815 40.4 21.3 4 1.0 27.8 3.2 1.6E-02 1.6E-01 Integrin beta-5 ITGB5 P18084 6.9 88.1 4 0.9 25.8 6.0 5.8E-04 2.8E-02 Cytochrome c oxidase subunit 7C, mitochondrial COX7C P15954 28.6 7.2 2 0.9 26.1 3.5 1.0E-02 1.3E-01 Ubiquitin-conjugating enzyme E2 C UBE2C O00762 38.5 19.7 4 0.9 24.6 3.0 1.9E-02 1.8E-01 Cytochrome c oxidase subunit 5A, mitochondrial COX5A P20674 51.3 16.8 6 0.9 29.5 3.4 1.2E-02 1.4E-01 39S ribosomal protein L13, mitochondrial MRPL13 Q9BYD1 14.0 20.7 2 0.9 25.6 3.1 1.8E-02 1.7E-01 TP53-binding protein 1 TP53BP1 Q12888 3.6 213.6 5 0.9 25.2 3.3 1.3E-02 1.5E-01 Isoform 3 of Na(+)/H(+) exchange regulatory cofactor NHE-RF2 SLC9A3R2 Q15599-3 11.5 24.7 2 0.9 23.8 2.9 2.4E-02 1.9E-01 Isoform 4 of Branched-chain-amino-acid aminotransferase, cytosolic BCAT1 P54687-4 22.1 42.8 6 0.9 26.9 3.2 1.6E-02 1.6E-01 Isoform 2 of ATPase family AAA domain-containing protein 3A ATAD3A Q9NVI7-2 9.7 66.2 5 0.9 25.8 3.8 7.0E-03 1.0E-01 Isoform 3 of Nucleoside diphosphate kinase B NME2 P22392-2 69.7 30.1 13 0.9 31.7 5.0 1.7E-03 4.6E-02 39S ribosomal protein L38, mitochondrial MRPL38 Q96DV4 7.9 44.6 3 0.9 25.4 5.1 1.5E-03 4.4E-02 Cytosolic Fe-S cluster assembly factor NUBP2 NUBP2 Q9Y5Y2 19.6 28.8 2 0.9 25.3 2.8 2.7E-02 2.0E-01 Ubiquitin carboxyl-terminal hydrolase isozyme L1 UCHL1 P09936 66.4 24.8 10 0.9 32.6 4.4 3.4E-03 6.8E-02 Fructose-2,6-bisphosphatase TIGAR TIGAR Q9NQ88 10.4 30.1 2 0.9 25.0 3.7 8.5E-03 1.2E-01 Isoform 3 of Protein O-glucosyltransferase 3 POGLUT3 Q7Z4H8-3 7.3 47.4 2 0.8 24.2 3.1 1.7E-02 1.7E-01 Phosphatidylinositol transfer protein beta isoform PITPNB P48739 21.8 31.5 4 0.8 25.2 2.7 3.3E-02 2.3E-01 Sequence Mol_weight Nr.
Load more

Recommended publications
  • I HIGH MASS ACCURACY COUPLED to SPATIALLY-DIRECTED
    HIGH MASS ACCURACY COUPLED TO SPATIALLY-DIRECTED PROTEOMICS FOR IMPROVED PROTEIN IDENTIFICATIONS IN IMAGING MASS SPECTROMETRY EXPERIMENTS By David Geoffrey Rizzo Dissertation Submitted to the Faculty of the Graduate School of Vanderbilt University in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY in Chemistry August, 2016 Nashville, Tennessee Approved: Richard M. Caprioli, Ph.D. Kevin L. Schey, Ph.D. John A. McLean, Ph.D. Michael P. Stone, Ph.D. i Copyright © 2016 by David Geoffrey Rizzo All Rights Reserved ii This work is dedicated to my family and friends, who have shown nothing but support for me in all of life’s endeavors. iii ACKNOWLEDGEMENTS “As we express our gratitude, we must never forget that the highest appreciation is not to utter words, but to live by them.” - John F. Kennedy – There are many people I must thank for showing kindness, encouragement, and support for me during my tenure as a graduate student. First and foremost, I would like to thank my research advisor, Richard Caprioli, for providing both ample resources and guidance that allowed me to grow as a scientist. Our discussions about my research and science in general have helped me become a much more focused and discerning analytical chemist. I must also thank my Ph.D. committee members, Drs. Kevin Schey, John McLean, and Michael Stone, who have brought valuable insight into my research and provided direction along the way. My undergraduate advisor, Dr. Facundo Fernández, encouraged me to begin research in his lab and introduced me to the world of mass spectrometry.
    [Show full text]
  • KO Kidney.Xlsx
    Supplemental Table 18: Dietary Impact on the CGL KO Kidney Sulfhydrome DR/AL Accession Molecular Cysteine Spectral Protein Name Number Alternate ID Weight Residues Count Ratio P‐value Ig gamma‐2A chain C region, A allele P01863 (+1) Ighg 36 kDa 10 C 5.952 0.03767 Heterogeneous nuclear ribonucleoprotein M Q9D0E1 (+1) Hnrnpm 78 kDa 6 C 5.000 0.00595 Phospholipase D3 O35405 Pld3 54 kDa 8 C 4.167 0.04761 Ig kappa chain V‐V region L7 (Fragment) P01642 Gm10881 13 kDa 2 C 2.857 0.01232 UPF0160 protein MYG1, mitochondrial Q9JK81 Myg1 43 kDa 7 C 2.333 0.01613 Copper homeostasis protein cutC homolog Q9D8X1 Cutc 29 kDa 7 C 10.333 0.16419 Corticosteroid‐binding globulin Q06770 Serpina6 45 kDa 3 C 10.333 0.16419 28S ribosomal protein S22, mitochondrial Q9CXW2 Mrps22 41 kDa 2 C 7.333 0.3739 Isoform 3 of Agrin A2ASQ1‐3 Agrn 198 kDa 2 C 7.333 0.3739 3‐oxoacyl‐[acyl‐carrier‐protein] synthase, mitochondrial Q9D404 Oxsm 49 kDa 11 C 7.333 0.3739 Cordon‐bleu protein‐like 1 Q3UMF0 (+3)Cobll1 137 kDa 10 C 5.833 0.10658 ADP‐sugar pyrophosphatase Q9JKX6 Nudt5 24 kDa 5 C 4.167 0.15819 Complement C4‐B P01029 C4b 193 kDa 29 C 3.381 0.23959 Protein‐glutamine gamma‐glutamyltransferase 2 P21981 Tgm2 77 kDa 20 C 3.381 0.23959 Isochorismatase domain‐containing protein 1 Q91V64 Isoc1 32 kDa 5 C 3.333 0.10588 Serpin B8 O08800 Serpinb8 42 kDa 11 C 2.903 0.06902 Heterogeneous nuclear ribonucleoprotein A0 Q9CX86 Hnrnpa0 31 kDa 3 C 2.667 0.5461 Proteasome subunit beta type‐8 P28063 Psmb8 30 kDa 5 C 2.583 0.36848 Ig kappa chain V‐V region MOPC 149 P01636 12 kDa 2 C 2.583 0.36848
    [Show full text]
  • Mutations in DCPS and EDC3 in Autosomal Recessive Intellectual
    Human Molecular Genetics, 2015, Vol. 24, No. 11 3172–3180 doi: 10.1093/hmg/ddv069 Advance Access Publication Date: 20 February 2015 Original Article Downloaded from ORIGINAL ARTICLE Mutations in DCPS and EDC3 in autosomal recessive intellectual disability indicate a crucial role for mRNA http://hmg.oxfordjournals.org/ decapping in neurodevelopment Iltaf Ahmed1,2,†, Rebecca Buchert3,†, Mi Zhou5,†, Xinfu Jiao5,†, Kirti Mittal1, Taimoor I. Sheikh1, Ute Scheller3, Nasim Vasli1, Muhammad Arshad Rafiq1, 6 1 7 2 M. Qasim Brohi , Anna Mikhailov , Muhammad Ayaz , Attya Bhatti , at Universitaet Erlangen-Nuernberg, Wirtschafts- und Sozialwissenschaftliche Z on August 15, 2016 Heinrich Sticht4, Tanveer Nasr8,9, Melissa T. Carter10, Steffen Uebe3, André Reis3, Muhammad Ayub7,11, Peter John2, Megerditch Kiledjian5,*, John B. Vincent1,12,13,* and Rami Abou Jamra3,* 1Molecular Neuropsychiatry and Development Lab, Campbell Family Mental Health Research Institute, Centre for Addiction and Mental Health, 250 College Street, Toronto, Ontario, Canada M5T 1R8, 2Atta-ur-Rehman School of Applied Biosciences (ASAB), National University of Sciences and Technology (NUST), Islamabad 44000, Pakistan, 3Institute of Human Genetics and 4Bioinformatics, Institute of Biochemistry, Friedrich-Alexander-Universität Erlangen-Nürnberg, Erlangen 91054, Germany, 5Department of Cell Biology and Neuroscience, Rutgers University, Piscataway, NJ 08854, USA, 6Sir Cowasji Jehangir Institute of Psychiatry, Hyderabad, Sindh 71000, Pakistan, 7Lahore Institute of Research and Development,
    [Show full text]
  • Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model
    Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A.
    [Show full text]
  • Silencing of Phosphoinositide-Specific
    ANTICANCER RESEARCH 34: 4069-4076 (2014) Silencing of Phosphoinositide-specific Phospholipase C ε Remodulates the Expression of the Phosphoinositide Signal Transduction Pathway in Human Osteosarcoma Cell Lines VINCENZA RITA LO VASCO1, MARTINA LEOPIZZI2, DANIELA STOPPOLONI3 and CARLO DELLA ROCCA2 Departments of 1Sense Organs , 2Medicine and Surgery Sciences and Biotechnologies and 3Biochemistry Sciences “A. Rossi Fanelli”, Sapienza University, Rome, Italy Abstract. Background: Ezrin, a member of the signal transduction pathway (5). The reduction of PIP2 ezrin–radixin–moesin family, is involved in the metastatic induces ezrin dissociation from the plasma membrane (6). spread of osteosarcoma. Ezrin binds phosphatydil inositol-4,5- The levels of PIP2 are regulated by the PI-specific bisphosphate (PIP2), a crucial molecule of the phospholipase C (PI-PLC) family (7), constituting thirteen phosphoinositide signal transduction pathway. PIP2 levels are enzymes divided into six sub-families on the basis of amino regulated by phosphoinositide-specific phospholipase C (PI- acid sequence, domain structure, mechanism of recruitment PLC) enzymes. PI-PLCε isoform, a well-characterized direct and tissue distribution (7-15). PI-PLCε, a direct effector of effector of rat sarcoma (RAS), is at a unique convergence RAS (14-15), might be the point of convergence for the point for the broad range of signaling pathways that promote broad range of signalling pathways that promote the RAS GTPase-mediated signalling. Materials and Methods. By RASGTPase-mediated signalling (16). using molecular biology methods and microscopic analyses, In previous studies, we suggested a relationship between we analyzed the expression of ezrin and PLC genes after PI-PLC expression and ezrin (17-18).
    [Show full text]
  • Structure of Human Aspartyl Aminopeptidase Complexed With
    Chaikuad et al. BMC Structural Biology 2012, 12:14 http://www.biomedcentral.com/1472-6807/12/14 RESEARCH ARTICLE Open Access Structure of human aspartyl aminopeptidase complexed with substrate analogue: insight into catalytic mechanism, substrate specificity and M18 peptidase family Apirat Chaikuad1, Ewa S Pilka1, Antonio De Riso2, Frank von Delft1, Kathryn L Kavanagh1, Catherine Vénien-Bryan2, Udo Oppermann1,3 and Wyatt W Yue1* Abstract Backround: Aspartyl aminopeptidase (DNPEP), with specificity towards an acidic amino acid at the N-terminus, is the only mammalian member among the poorly understood M18 peptidases. DNPEP has implicated roles in protein and peptide metabolism, as well as the renin-angiotensin system in blood pressure regulation. Despite previous enzyme and substrate characterization, structural details of DNPEP regarding ligand recognition and catalytic mechanism remain to be delineated. Results: The crystal structure of human DNPEP complexed with zinc and a substrate analogue aspartate-β- hydroxamate reveals a dodecameric machinery built by domain-swapped dimers, in agreement with electron microscopy data. A structural comparison with bacterial homologues identifies unifying catalytic features among the poorly understood M18 enzymes. The bound ligands in the active site also reveal the coordination mode of the binuclear zinc centre and a substrate specificity pocket for acidic amino acids. Conclusions: The DNPEP structure provides a molecular framework to understand its catalysis that is mediated by active site loop swapping, a mechanism likely adopted in other M18 and M42 metallopeptidases that form dodecameric complexes as a self-compartmentalization strategy. Small differences in the substrate binding pocket such as shape and positive charges, the latter conferred by a basic lysine residue, further provide the key to distinguishing substrate preference.
    [Show full text]
  • Dcps Is a Transcript-Specific Modulator of RNA in Mammalian Cells
    Downloaded from rnajournal.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press DcpS is a transcript-specific modulator of RNA in mammalian cells MI ZHOU,1 SOPHIE BAIL,1 HEATHER L. PLASTERER,2 JAMES RUSCHE,2 and MEGERDITCH KILEDJIAN1 1Department of Cell Biology and Neuroscience, Rutgers University, Piscataway, New Jersey 08854, USA 2Repligen Corporation, Waltham, Massachusetts 02453, USA ABSTRACT The scavenger decapping enzyme DcpS is a multifunctional protein initially identified by its property to hydrolyze the resulting cap structure following 3′ end mRNA decay. In Saccharomyces cerevisiae, the DcpS homolog Dcs1 is an obligate cofactor for the 5′-3′ exoribonuclease Xrn1 while the Caenorhabditis elegans homolog Dcs-1, facilitates Xrn1 mediated microRNA turnover. In both cases, this function is independent of the decapping activity. Whether DcpS and its decapping activity can affect mRNA steady state or stability in mammalian cells remains unknown. We sought to determine DcpS target genes in mammalian cells using a cell-permeable DcpS inhibitor compound, RG3039 initially developed for therapeutic treatment of spinal muscular atrophy. Global mRNA levels were examined following DcpS decapping inhibition with RG3039. The steady-state levels of 222 RNAs were altered upon RG3039 treatment. Of a subset selected for validation, two transcripts that appear to be long noncoding RNAs HS370762 and BC011766, were dependent on DcpS and its scavenger decapping catalytic activity and referred to as DcpS-responsive noncoding transcripts (DRNT) 1 and 2, respectively. Interestingly, only the increase in DRNT1 transcript was accompanied with an increase of its RNA stability and this increase was dependent on both DcpS and Xrn1.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • 1 Metabolic Dysfunction Is Restricted to the Sciatic Nerve in Experimental
    Page 1 of 255 Diabetes Metabolic dysfunction is restricted to the sciatic nerve in experimental diabetic neuropathy Oliver J. Freeman1,2, Richard D. Unwin2,3, Andrew W. Dowsey2,3, Paul Begley2,3, Sumia Ali1, Katherine A. Hollywood2,3, Nitin Rustogi2,3, Rasmus S. Petersen1, Warwick B. Dunn2,3†, Garth J.S. Cooper2,3,4,5* & Natalie J. Gardiner1* 1 Faculty of Life Sciences, University of Manchester, UK 2 Centre for Advanced Discovery and Experimental Therapeutics (CADET), Central Manchester University Hospitals NHS Foundation Trust, Manchester Academic Health Sciences Centre, Manchester, UK 3 Centre for Endocrinology and Diabetes, Institute of Human Development, Faculty of Medical and Human Sciences, University of Manchester, UK 4 School of Biological Sciences, University of Auckland, New Zealand 5 Department of Pharmacology, Medical Sciences Division, University of Oxford, UK † Present address: School of Biosciences, University of Birmingham, UK *Joint corresponding authors: Natalie J. Gardiner and Garth J.S. Cooper Email: [email protected]; [email protected] Address: University of Manchester, AV Hill Building, Oxford Road, Manchester, M13 9PT, United Kingdom Telephone: +44 161 275 5768; +44 161 701 0240 Word count: 4,490 Number of tables: 1, Number of figures: 6 Running title: Metabolic dysfunction in diabetic neuropathy 1 Diabetes Publish Ahead of Print, published online October 15, 2015 Diabetes Page 2 of 255 Abstract High glucose levels in the peripheral nervous system (PNS) have been implicated in the pathogenesis of diabetic neuropathy (DN). However our understanding of the molecular mechanisms which cause the marked distal pathology is incomplete. Here we performed a comprehensive, system-wide analysis of the PNS of a rodent model of DN.
    [Show full text]
  • Differential Proteomic Analysis of the Pancreas of Diabetic Db/Db Mice Reveals the Proteins Involved in the Development of Complications of Diabetes Mellitus
    Int. J. Mol. Sci. 2014, 15, 9579-9593; doi:10.3390/ijms15069579 OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Article Differential Proteomic Analysis of the Pancreas of Diabetic db/db Mice Reveals the Proteins Involved in the Development of Complications of Diabetes Mellitus Victoriano Pérez-Vázquez 1,*, Juan M. Guzmán-Flores 1, Daniela Mares-Álvarez 1, Magdalena Hernández-Ortiz 2, Maciste H. Macías-Cervantes 1, Joel Ramírez-Emiliano 1 and Sergio Encarnación-Guevara 2 1 Depto. de Ciencias Médicas, División de Ciencias de la Salud, Campus León, Universidad de Guanajuato, León, Guanajuato 37320, Mexico; E-Mails: [email protected] (J.M.G.-F.); [email protected] (D.M.-A.); [email protected] (M.H.M.-C.); [email protected] (J.R.-E.) 2 Centro de Ciencias Genómicas, Universidad Nacional Autónoma de México, Cuernavaca, Morelos 62210, Mexico; E-Mails: [email protected] (M.H.-O.); [email protected] (S.E.-G.) * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +52-477-7143-812; Fax: +52-477-7167-623. Received: 4 April 2014; in revised form: 14 May 2014 / Accepted: 19 May 2014 / Published: 30 May 2014 Abstract: Type 2 diabetes mellitus is characterized by hyperglycemia and insulin-resistance. Diabetes results from pancreatic inability to secrete the insulin needed to overcome this resistance. We analyzed the protein profile from the pancreas of ten-week old diabetic db/db and wild type mice through proteomics. Pancreatic proteins were separated in two-dimensional polyacrylamide gel electrophoresis (2D-PAGE) and significant changes in db/db mice respect to wild type mice were observed in 27 proteins.
    [Show full text]
  • A SARS-Cov-2-Human Protein-Protein Interaction Map Reveals Drug Targets and Potential Drug-Repurposing
    A SARS-CoV-2-Human Protein-Protein Interaction Map Reveals Drug Targets and Potential Drug-Repurposing Supplementary Information Supplementary Discussion All SARS-CoV-2 protein and gene functions described in the subnetwork appendices, including the text below and the text found in the individual bait subnetworks, are based on the functions of homologous genes from other coronavirus species. These are mainly from SARS-CoV and MERS-CoV, but when available and applicable other related viruses were used to provide insight into function. The SARS-CoV-2 proteins and genes listed here were designed and researched based on the gene alignments provided by Chan et. al. 1 2020 .​ Though we are reasonably sure the genes here are well annotated, we want to note that not every ​ protein has been verified to be expressed or functional during SARS-CoV-2 infections, either in vitro or in vivo. ​ ​ In an effort to be as comprehensive and transparent as possible, we are reporting the sub-networks of these functionally unverified proteins along with the other SARS-CoV-2 proteins. In such cases, we have made notes within the text below, and on the corresponding subnetwork figures, and would advise that more caution be taken when examining these proteins and their molecular interactions. Due to practical limits in our sample preparation and data collection process, we were unable to generate data for proteins corresponding to Nsp3, Orf7b, and Nsp16. Therefore these three genes have been left out of the following literature review of the SARS-CoV-2 proteins and the protein-protein interactions (PPIs) identified in this study.
    [Show full text]
  • Cellular and Molecular Signatures in the Disease Tissue of Early
    Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of
    [Show full text]