Ubiquitin Ligase, Fbw7, Targets CDX2 for Degradation Via Two

Published OnlineFirst July 28, 2016; DOI: 10.1158/1541-7786.MCR-16-0138

Oncogenes and Tumor Suppressors Molecular Cancer Research Ubiquitin Ligase, Fbw7, Targets CDX2 for Degradation via Two Phosphodegron Motifs in a GSK3b-Dependent Manner Yogesh Kumar1, Nidhi Shukla1, Gatha Thacker1, Isha Kapoor1, Savita Lochab1, Madan Lal Brahma Bhatt3, Naibedya Chattopadhyay2, Sabyasachi Sanyal1, and Arun Kumar Trivedi1

Abstract

Drosophila caudal–related homeobox transcription factor 2 noprecipitation. Furthermore, overexpression of both Fbw7 or (CDX2) drives differentiation of the intestinal epithelium. GSK3b down regulated endogenous CDX2 expression and Loss of CDX2 expression has been reported in several colo- function; however, both failed to inhibit endogenous CDX2 rectal cancers and cancer cell lines with a potential inverse when either of them were depleted in colon cancer cells. correlation between CDX2 levels and tumor stage. Ubiquiti- Fbw7-mediated inhibition of CDX2 expression also led to nation of CDX2 leading to its downregulation has been reduced CDX2 transactivation and growth arrest of colon implicated in several studies; however, the E3 ubiquitin ligases cancer cells. Both GSK3b and Fbw7 degraded mutant-CDX2 involved in CDX2 ubiquitination have largely remained having either of the Cdc4-phosphodegron (CPD) motifs dis- unknown. Here, it is mechanistically determined that the rupted (CDX2-S60A or CDX-S281A), but were unable to E3 ubiquitin ligase Fbw7 promotes CDX2 ubiquitination and degrade mutant-CDX2 having both CPDs disrupted (CDX2- degradation through two phosphodegron motifs present with- S60,64,281A). in CDX2 in a GSK3b-dependent manner leading to its reduced expression and function in colon cancer cells. Fbw7, through Implications: Taken together, these ﬁndings demonstrate that its WD domain, interacted with CDX2 both in a heterologous Fbw7 negatively regulates CDX2 expression in a GSK3b-depen- HEK293T cell system and in colon cancer cells. GSK3b was dent manner through two CPDs present in CDX2. Mol Cancer Res; also present in the same complex as determined by coimmu- 14(11); 1097–109. 2016 AACR.

Introduction arrest in intestinal cells (2–4). Several lines of evidences suggest that CDX2 is a colorectal tumor suppressor (5, 6). However, there Along with the process of colon cancer progression, the molec- are several contradictory reports that indicate deregulated CDX2 ular events leading to the development and differentiation of the expression may have differential effects ranging from being tumor intestinal epithelia are of quite importance owing to the fact that suppressor to oncogenic (7, 8). A systematic review by Olsen and majority of colon tumors are undifferentiated and poorly matured colleagues very comprehensively compared various published (1). CDX2, drosophila caudal–related homeobox transcription studies reporting CDX2 expression in colon cancer patients and factor, is an intestine-specific transcription factor required for found almost equal percentage of reports showing either higher or intestinal development and differentiation. Expression of CDX2 reduced nuclear staining of CDX2 (9). Moreover, CDX2 has been is confined to the intestinal epithelia in adult mice and humans implicated in promoting tumorigenesis in LoVo and SW48 colon where it regulates expression of genes involved in differentiation cancer cells (7). Another study demonstrated CDX2 as a "lineage- and proliferation. CDX2 couples differentiation by activating survival" oncogene which supports the proliferation and survival expression of intestine-specific genes with induction of growth of colorectal cancers cells when deregulated (8). Thus, available literature suggests that CDX2 role is still controversial. Contradictory reports of CDX2 expression as shown in several 1Biochemistry Division, CSIR-Central Drug Research Institute (CSIR- 2 studies may also be attributed to the perturbed CDX2 protein CDRI), Lucknow, India. Division of Endocrinology and Center for – Research in Anabolic Skeletal Targets in Health and Illness (ASTHI), turnover in colon cancer cells due to deregulated ubiquitin CSIR-Central Drug Research Institute (CSIR-CDRI), Lucknow, India. proteasome pathway. Precisely controlled ubiquitination of the 3Department of Radiotherapy, King George's Medical University, protein substrates are needed for orchestrated progression of cell Lucknow, India. cycle and homeostasis, and any perturbation to this may lead to Note: Supplementary data for this article are available at Molecular Cancer deregulated homeostasis. F-box and WD repeats containing pro- Research Online (http://mcr.aacrjournals.org/). tein Fbw7 (cdc4) is the substrate recognition motif of SCFFbw7 E3 Corresponding Author: Arun Kumar Trivedi, CSIR-Central Drug Research Insti- ubiquitin ligase that recognizes and binds to its substrates through tute, B.S. 10/1, Sector 10, Jankipuram Extension, Sitapur Road, Lucknow 226031, a consensus Cdc4-phosphodegron (CPD) motif (T/S-P-X-X-S/T/ India. Phone: 00919839790765; Fax: 00915222771941; E-mail: D/E) present in its substrates. In majority of the cases, recognition [email protected] of CPDs by SCFFbw7 is regulated by phosphorylation of certain doi: 10.1158/1541-7786.MCR-16-0138 amino acid residues residing within CPD motifs of the substrates. 2016 American Association for Cancer Research. Several of the known Fbw7 substrates are phosphorylated by

www.aacrjournals.org 1097

Kumar et al.

GSK3b within their CPD, including c-Myc (10), MCL-1 (11), KLF- pool of three target-specific siRNA) was purchased from Santa 5 (12), NFkB2/p100 (13), cyclin E (14), and PGC-1a (15). These Cruz Biotechnology. reports indicated the involvement of Fbw7 in the development and regulation of cellular differentiation by targeting multiple qRT-PCR and Western blotting substrates for degradation. Several studies have showed inhibi- Quantitative real-time PCR was performed as previously tion of Fbw7 in colorectal cancers both at mRNA and protein described (25). Primer used are Fbw7a: Fwd 50 AGCACACTG- levels; however, recent findings also showed that Fbw7 activity CAAGGAATGGTGAAGT 30, Rev 50 CCTGTAGGTGGCTGGACA- itself is regulated by deubiquitinases such as ubiquitin-specific GATGT 30; CDX2: Fwd 50 CAGTCGCTACATCACC ATCCG 30, Rev proteases-28 (USP28) to preserve the physiologic levels of Fbw7 50 TTTCCTCTCCTTTGCTCTGCG 30; b Tubulin: Fwd 50 CTTCAA- substrates, which is potentially disrupted by loss or overexpres- CACCC CAGCCAT 30, Rev 50 TAATGTCACGCACGATTTCC 30. sion of USP28 in such colon tumors (16, 17). Western blotting was performed as previously described (23, 26– CDX2 degradation by ubiquitin–proteasome pathway has 28). Briefly, whole-cell extracts (WCE) were prepared in RIPA lysis previously been reported (2, 18). However, whether the E3 buffer (0.5% sodium deoxycholate, 1.0% NP-40, 0.1% SDS, ubiquitin ligases are involved in proteasomal degradation of 0.15 mol/L NaCl, 5 mmol/L EDTA, 1.0 mmol/L DTT containing CDX2 have largely remained unknown. We therefore surmised protease and phosphatase inhibitors), and equal amounts of that differential CDX2 expression observed in colon cancers might protein concentrations were resolved by SDS-PAGE, transferred be due to deregulation of CDX2 protein turnover by E3 ubiquitin to PVDF membrane (IPVH00010; Millipore), and blocked in ligases and thus hypothesized that E3 ubiquitin ligase SCFFbw 5% nonfat dry milk in TBST. Anti-Flag (F1804) and anti-hFbw7 (hereafter referred as Fbw7) may target CDX2 for ubiquitin- (F2055) antibodies were purchased from Sigma-Aldrich; rabbit mediated degradation based on the following evidences: (1) polyclonal anti-CDX2 (134468), anti–b-actin (47778), and There are two putative CPDs present in CDX2 that may be targeted anti-p21 (397) antibodies were purchased from Santa Cruz by Fbw7, and interestingly GSK3b consensus also coincided with Biotechnology; anti-GSK3b (610202) was purchased from BD these two CPDs (19) and, (2) levels of GSK3b expression and Transduction Laboratories; HA-tag (2367S) was purchased amounts of its active forms are higher in tumor cells and colorectal from CST. Primary antibodies were used at 1:1,000 dilutions cancer patients than in their normal counterparts (20, 21). Under in TBS containing 0.05% Tween-20. Peroxidase-conjugated this situation, we speculated that active GSK3b could phosphor- secondary antibodies were used at 1:10,000 dilution. Chemi- ylate CDX2 in its CPDs to be recognized and degraded by Fbw7. luminescent detection was performed using Chemiluminescent Therefore, the present study was designed to address whether HRP Substrate (Millipore). Fbw7 served as an E3 ubiquitin ligase for CDX2. Coimmunoprecipitation Materials and Methods It was performed as previously described (29, 30). WCEs of HCT116 treated with proteasome inhibitors MG132 or lacta- Cell culture, transfection, plasmids, and antibodies cystin (LCN) were prepared in RIPA lysis buffer supplemented HEK293T and colorectal cancer cell lines DLD1, HCT116, HT- with protease and phosphatase inhibitor (Sigma). Equal 29, and Caco-2 were obtained from the ATCC and cultured as amounts of precleared lysates were incubated with pre-equil- described (2, 19). Cell lines were tested and authenticated by ibrated protein A/G agarose beads (Millipore) conjugated with Short Tandem Repeat (STR) profiling in November 2015 (Life- anti-CDX2 antibody at 4C overnight. Coprecipitates were code Technologies Private Limited). All cell lines are tested separated on 10% SDS gel followed by immunoblotting with negative for mycoplasma contamination by the Universal myco- anti-CDX2, anti-GSK3b, and anti-Fbw7 antibodies. plasma detection Kit (ATCC-30-1012K). Transfection of plasmid DNA and siRNA was performed by Lipofectamine-2000 (Invi- Ubiquitination assay trogen) and DharmaFect (Dharmacon) as per the manufacturer's It was performed as previously described (29, 31). For in-cell protocol. Expression plasmids for Flag-Fbw7a, Flag-Fbw7b, Flag- ubiquitination assay, cells were transfected with CDX2, Fbw7, and WD Fbw7g, Flag-Fbw7aDF, and Flag-Fbw7 were kind gifts from Ubiquitin expression plasmids. Thirty-six hours after transfection, Dr. B.E. Clurman (10, 22); expression plasmids for pCB6-HA- cells were treated with 10 mmol/L MG132 for 6 hours prior CDX2, pCB6-HA-CDX2S281A, and pCB6-HA-CDX2-4S>Awere harvesting. Equal amounts of precleared WCEs were incubated kindly provided by Isabelle Gross, French Institute of Health with pre-equilibrated Protein A/G Agarose beads (Millipore) and Medical Research, Paris, France (2). Flag-CDX2, CDX2ND, conjugated with anti-CDX2 antibody at 4C overnight. Copreci- and Flag-CDX2CD were kind gifts from John P. Lynch (1), pitates were separated on 10% SDS gel followed by immuno- whereas GSK3b,GSK3bS9A, His-ubiquitin, and HA-ubiquitin blotting with anti-HA and anti-CDX2 antibodies. have been described previously (23). Flag-USP28 expression plasmid was a kind gift from Stephen J. Elledge, Harvard Medical School, Boston, MA (24). pCB6-HA-CDX2S60,64, Results 281A and pCB6-HA-CDX2S60,64 were generated by site-direct- Fbw7 negatively regulates steady-state levels of CDX2 ed mutagenesis as a pay-for-service from CHROMUS BIOTECH Figure 1A shows the two CPDs in CDX2 protein conserved in using pCB6-HA-CDX2S281A and pCB6-HA-CDX2, respective- various species are located at amino acid residues serine-60 and ly, as template DNA (www.chromous.com). p21-luc reporter serine-281 in mouse. In order to investigate if Fbw7 targets CDX2 was gifted by Bert Vogelstein, Johns Hopkins Oncology Centre, for ubiquitin-mediated proteasome degradation, we cotrans- Baltimore, MD. ON-TARGET plus Smart pool, human siGSK3b fected HEK293T cells with CDX2 and three isoforms of Fbw7 (L-003010-00-0005), and ON-TARGET plus Smart pool siFbw7 (a, b, and g individually) as indicated in Supplementary Fig. S1A. were purchased from Thermo Scientific, and siFbw7 (sc-37547; Immunoblotting with anti-CDX2 antibody showed that all the

1098 Mol Cancer Res; 14(11) November 2016 Molecular Cancer Research

Fbw7 Negatively Regulates CDX2 Stability

isoforms down regulated CDX2. Further, because Fbw7a is the ments, we showed that GSK3b is involved in the Fbw7-mediated predominant isoform of Fbw7, we next transfected HEK293T cells CDX2 degradation, we assessed the presence of GSK3b in the with CDX2 and increasing amounts of Fbw7. Substantial down- same immunocomplex. Re-probing the membrane with anti- regulation in CDX2 expression was observed with Fbw7, whereas GSK3b showed that GSK3b was also present in the same coim- treatment with proteasome inhibitors restored CDX2 even in munoprecipitate, thus suggesting GSK3b to be possibly involved Fbw7-overexpressed conditions indicating for role of the ubiqui- in Fbw7-mediated degradation of CDX2. Furthermore, to deter- tin–proteasome pathway in CDX2 downregulation (Fig. 1B). In mine the specific region of Fbw7 that interacted with CDX2, we addition, cotransfection of CDX2 with increasing amounts of cotransfected HCT116 cells with CDX2 either alone or together Fbw7 in another cell system (NIH/3T3) showed similar results with Fbw7 and its mutants. Immunoblotting the CDX2 coimmu- (Fig. 1C). We therefore next assessed if Fbw7 affected CDX2 noprecipitates with anti-CDX2 antibody followed by anti-Flag protein stability. In order to address this, we inhibited new protein antibody after stripping the same membrane showed that CDX2 synthesis and measured rate of CDX2 degradation in the presence interacted with both Fbw7 and its mutants including Fbw7WD of Fbw7 and its deletion mutant Fbw7DF. DLD1 cells transfected which contained only WD repeats, suggesting that CDX2 indeed either with Fbw7 (Fig. 1D, top) or Fbw7DF (Fig. 1D, bottom) were interacted with substrate binding domain of SCFFbw7 (Fig. 2B). treated with cycloheximide after 24-hour transfection followed by lysate preparation at indicated time points. Immunoblotting with Fbw7-mediated ubiquitination of CDX2 is GSK3b dependent anti-CDX2 antibody showed that CDX2 degraded at a faster rate in Prior phosphorylation of substrates within CPD motifs is the presence of Fbw7, indicating Fbw7 down regulated CDX2 required for recognition and subsequent degradation by Fbw7. apparently by the ubiquitin–proteasome pathway (Fig. 1D, Also, many of the previously reported Fbw7 substrates, such as graphically represented in bottom panel). We next examined if KLF5 (12), NFkB2/p100 (13), SRC-3 (32), and MCL1 (11), overexpression of Fbw7 also down regulated endogenous CDX2 containing CPDs similar to CDX2 are phosphorylated by GSK3b in physiologically relevant colon cancer cells DLD1 (Fig. 1E) and (Fig. 3A). In addition, the general GSK3b substrate consensus HCT116 (Fig. 1F). Fbw7 indeed downregulated CDX2 while its sequence (STXXXS/T) also coincided with CPD motifs (19). As non-functional mutants Fbw7DF and Fbw7WD rather stabilized we identified GSK3b to be interacting with Fbw7 and CDX2, endogenous CDX2 which demonstrated that Fbw7-mediated we hypothesized that GSK3b may phosphorylate CDX2 for proteasome degradation of CDX2 was relevant to the cell biology Fbw7-mediated degradation. In order to assess if Fbw7-mediated of colorectal cancer. Because overexpression of Fbw7 inhibited degradation of CDX2 relied on GSK3b or other known kinases endogenous CDX2 expression, we next asked if Fbw7 RNAi could such as cdk2, which is also known to promote ubiquitin-mediated restore endogenous CDX2 in colon cancer cells. To exclude the degradation of CDX2 through yet to be identified E3 Ligase (18), possible off-target effects of Fbw7 RNAi, we assessed knockdown we transfected DLD1 cells with Flag-Fbw7 and subsequently efficiency of various Fbw7-specific shRNAs as well as siRNAs from treated these cells with cdk2 and GSK3b inhibitors. Inhibition different manufacturers. These shRNA/siRNAs efficiently knocked of GSK3b restored CDX2 levels even in the presence of Fbw7, down (>80%) Fbw7 and as expected, knockdown of Fbw7 led to whereas cdk2 inhibition failed to restore CDX2, suggesting Fbw7- increase in endogenous CDX2 as well as Cyclin E, another known mediated degradation of CDX2 is GSK3b-dependent (Fig. 3B). substrate of Fbw7 (Fig. 1G). From these validated siRNAs (Fig. Furthermore, cotransfection of CDX2 either with GSK3b in 1G), we used different amounts of siFbw7-1 (Smart pool of three HEK293T (Supplementary Fig. S2A) or with constitutively active target-specific siRNA from Santa Cruz Biotechnology) to knock GSK3bS9A in DLD1 cells (Supplementary Fig. S2B) inhibited down Fbw7 in DLD1 and HCT116 cells. Knockdown of Fbw7 overexpressed as well as endogenous CDX2 expression which substantially enhanced endogenous CDX2 protein levels both in again indicated for a role of GSK3b in regulating CDX2 stability. HCT116 (Fig. 1H) and DLD1 cells (Fig. 1I); notably, there was no As our data indicated for CDX2 to be phosphomodified by GSK3b significant change in CDX2 mRNA upon Fbw7 depletion in for Fbw7-driven degradation, we next assessed if GSK3b phos- HCT116 cells which again indicated that Fbw7 affected CDX2 phorylated CDX2. In order to address this, we cotransfected protein stability (Fig. 1H, bottom). Expectedly, endogenous HCT116 cells with V5-GSK3b either alone or together with siFbw7 expression of Cyclin E also increased in Fbw7 knockdown con- and immunoblotted the WCEs with anti-CDX2, which showed dition while control siRNA had no effect. Taken together, these that GSK3b overexpression mitigated endogenous CDX2 levels data demonstrated that Fbw7 inhibited CDX2 expression by while simultaneous depletion of Fbw7 rescued CDX2. Very promoting its ubiquitin-mediated proteasome degradation. importantly, a slow migrating band (apparently phosphorylated CDX2) of CDX2 was also observed when GSK3b was overex- WD domain of Fbw7 physically associates with CDX2 pressed with simultaneous depletion of Fbw7 (Fig. 3C); obviously Because Fbw7 is the substrate binding moiety of the complex because phosphorylated CDX2 was degraded by endogenous SCFFbw7 ubiquitin ligase, we next determined if Fbw7 interacted Fbw7 and hence was not detected. On the contrary, RNAi-medi- with CDX2. In order to assess in-cell physical interaction between ated knockdown of GSK3b substantially enhanced endogenous endogenous CDX2 and Fbw7, whole-cell lysates of HCT116 cells CDX2 levels further indicating for a role of GSK3b in regulating treated with proteasome inhibitors were subjected to CDX2 CDX2 stability (Fig. 3D). In order to further establish that Fbw7- immunoprecipitation using anti-CDX2 antibody. Immunoblot- mediated downregulation of CDX2 is GSK3b dependent, we ting with anti-Fbw7 and anti-CDX2 antibodies showed clear transfected HCT116 and DLD1 cells separately with increasing interaction between the two proteins (Fig. 2A). Notably, intense amounts of Fbw7 and simultaneously silenced endogenous interaction was observed in conditions where cells were treated GSK3b. Immunoblotting with anti-CDX2 antibody showed that with MG132 or LCN which further indicated that Fbw7 physically silencing of endogenous GSK3b rescued Fbw7-mediated CDX2 interacted with CDX2 under physiologic conditions and regulated degradation (Fig. 3E and Supplementary Fig. S2C), thus suggest- its protein stability in colon cells. Because in subsequent experi- ing the role of GSK3b in the Fbw7-mediated downregulation of

www.aacrjournals.org Mol Cancer Res; 14(11) November 2016 1099

Kumar et al.

Figure 1. Fbw7 negatively regulates steady-state level of CDX2. A, Represents putative CPD sequences within CDX2 across various species; arrows indicate the location of putative CPDs. B, Lysates of HEK293T cells were transfected with 0.5 mg pCB6-HA-CDX2 and with increasing amounts (0.5, 1.0, and 2.0 mg) of Flag-tagged Fbw7 as indicated. Immunoblotting with anti–Flag-M2 and anti-CDX2 antibodies was performed. Cells were treated with proteasome inhibitors MG132 (10 mmol/L) and LCN (10 mmol/L) for 6 hour prior to lysate preparation. (Continued on the following page.)

1100 Mol Cancer Res; 14(11) November 2016 Molecular Cancer Research

Fbw7 Negatively Regulates CDX2 Stability

CDX2. Furthermore, silencing of endogenous Fbw7 with siFbw7 in a GSK3b-dependent manner. In order to confirm whether both in HCT116 (Fig. 3F) and DLD1 (Supplementary Fig. S2D) cells CPDs are required for Fbw7-mediated CDX2 degradation, we also inhibited CDX2 degradation even in the presence of increas- transfected CDX2, CDX2S60,64A (N-terminal CPD disrupted), ing amounts of GSK3b, confirming the interdependence of Fbw7 and CDX2S60,64,281A (both CPDs disrupted) expression plas- and GSK3b in targeting CDX2 for degradation. mids in HEK293T cells either alone or together with Fbw7 (Fig. 4F) or GSK3b (Fig. 4G). Immunoblotting of WCEs using Both the putative CPDs of CDX2 are involved in GSK3b- anti-CDX2 antibody showed that both Fbw7 and GSKb yet again dependent degradation of CDX2 by Fbw7 inhibited CDX2 as well as its mutants having either of the CPD As our data so far demonstrated that Fbw7 targets CDX2 for disrupted whereas were unable to target CDX2S60,64,281A, sug- ubiquitin-mediated proteasome degradation in a GSK3b-depen- gesting both CPDs to be involved in CDX2 degradation by Fbw7. dent manner, we next sought to identify CPD motif involved in this In order to further ascertain that GSK3b phosphorylated CDX2 process. To address this, we used two deletion mutants of CDX2, within both CPDs, we next cotransfected HCT116 cells with CDX2 namely, CDX2CD (C-terminal–deleted CDX2) and CDX2ND (N- and its point mutants (CDX2S281A, CDX2-S60, and S64, Fig. 4H terminal–deleted CDX2) where either of the CPD was truncated as and CDX2-S60,S64,S281A, Fig. 4I) either alone or together with depicted in the Fig. 4A. We transfected HEK293T cells with full- V5-GSK3b and siFbw7 as indicated. Immunoblotting with anti- length Flag-CDX2 and Flag-CDX2CD either alone or together with HA antibody showed a slow-migrating band (apparently phos- Flag-Fbw7. Immunoblotting of the cell lysates with anti-Flag anti- phorylated HA-CDX2) in wild-type CDX2, CDX2-S60,64A, and body showed that even Flag-CDX2CD was down regulated by CDX2-394 S281A but not in CDX2-S60,S64,S281A when GSK3b Fbw7 (Fig. 4B). Similarly, cotransfection of CDX2ND together was overexpressed with simultaneous depletion of Fbw7 sug- with Flag-Fbw7 showed that Fbw7 also down regulated CDX2ND, gested that GSK3b indeed phosphorylated CDX2 within these suggesting both the CPDs present in CDX2 to be involved in CPDs. Furthermore, in order to confirm if Fbw7 promoted ubi- degradation of CDX2 (Fig. 4C; we used Flag-CDX2CD as an quitin-mediated proteasome degradation of CDX2 in a GSK3b- internal control in Fig. 4C because anti-CDX2 antibody was against dependent manner, we performed in vivo ubiquitination assay in c-terminal of CDX2). We next assessed if Fbw7-mediated down- HEK293T cells by transfecting indicated expression plasmids. regulation of these mutants is also GSK3b-dependent by cotrans- CDX2 was coimmunoprecipitated using anti-HA antibody from fecting Flag-CDX2CD and CDX2ND either alone or together with whole-cell lysates prepared after 36-hour transfection. Immuno- GSK3b. Immunoblotting with anti-CDX2 antibody showed that blotting of immunoprecipitates after resolving on SDS-PAGE with GSK3b yet again down regulated these mutants (Fig. 4D and E), anti-his, anti-V5, and anti-Flag antibodies clearly indicated that suggesting apparent involvement of GSK3b in priming CDX2 by Fbw7 promoted polyubiquitination of wild-type CDX2 which phosphorylating it within the two putative CPDs to drive its was further intensified in the presence of ectopic GSK3b while targeting by Fbw7. This finding is in line with previous study by CDX2S60,64,281A was protected from ubiquitination (Fig. 4J). In Gross and colleagues, showing GSK3b-mediated phosphorylation order to further substantiate that Fbw7-mediated CDX2 ubiqui- of CDX2 at serine-281 (which apparently lies within the C-terminal tination and degradation is GSK3b dependent, we yet again CPD) led to its ubiquitin-dependent proteasome degradation (2). performed in vivo ubiquitination of endogenous CDX2 in DLD1 We therefore asked if Fbw7 was the underlying E3 ubiquitin ligase cells. These cells were transfected with his-ubiquitin, Flag-tagged in mediating this degradation. We cotransfected CDX2 and Fbw7a either alone or with siGSK3b as indicated. After 24-hour its mutants (CDX2-S281A: disrupts C-terminal CPD and CDX2- transfection, cells were treated with 10 mmol/L SB216763 (GSK3b 4S>A: a conserved motif of four evenly spaced serines termed the 4S inhibitor). Subsequently, WCEs prepared after 42 hours of trans- motif; CDX2S281,285,289,291A) either alone or together with fection were subjected for immunoprecipitation with anti-CDX2 Fbw7. Immunoblotting with anti-CDX2 antibody demonstrated antibody. Immunoprecipitates immunoblotted with anti-his that Fbw7 down regulated even these mutants (Supplementary antibody showed that Fbw7 abundantly polyubiquitinated Fig. S3B). Like Fbw7, GSK3b overexpression also inhibited CDX2- CDX2, whereas either depletion of GSK3b or its inhibition S281A (Supplementary Fig. S3A), suggesting N-terminal CPD substantially mitigated Fbw7-mediated CDX2 ubiquitination, (60-SPGPS) to be also involved in CDX2 degradation by Fbw7 confirming our finding that Fbw7-mediated CDX2 is GSK3b

(Continued.) C, Lysates of NIH/3T3 cells cotransfected with CDX2 (0.5 mg) and increasing doses of Fbw7a (1.0 mg and 2.0 mg) were resolved on 10% SDS-PAGE and immunoblotted with anti-CDX2 and anti-Flag antibodies; cells were treated with MG132 (10 mmol/L) for 6 hour prior to lysate preparation. D, Lysates of DLD1 cells transfected either with 0.5 mg Flag-tagged Fbw7 (top) or 0.5 mg Flag-tagged Fbw7DF and pcDNA3 (bottom) were resolved on 10% SDS-PAGE and immunoblotted with anti–Flag-M2 and anti-CDX2 antibodies. Cycloheximide (80 mg/mL) treatment was given 24 hours after transfection and subsequently harvested at indicated time points. Graph represents changes in CDX2 levels in the presence of Fbw7a or Fbw7aDF after CHX treatment after indicated time points. E, Lysates of DLD1 cells transfected with increasing amounts (0.5, 1.0, and 2.0 mg) of Flag-tagged Fbw7 and 2.0 mg of nonfunctional deletion mutants of Flag-tagged Fbw7DF (lacks the F-box domain and binds directly to the SKP1 component of SCF ubiquitin ligase) and Flag-tagged Fbw7WD (nonfunctional Fbw7 mutant possessing only WD40 repeats that binds to the substrate) as indicated were immunoblotted with anti–Flag-M2 and anti-CDX2 antibodies. F, Lysates of HCT116 cells transfected with increasing amounts (0.5, 1.0, and 2.0 mg) of Flag-tagged Fbw7 and 2.0 mg of nonfunctional deletion mutants of Fbw7 (Flag-tagged Fbw7DF and Flag-tagged Fbw7WD) as indicated were resolved on 10% SDS-PAGE and immunoblotted with anti–Flag-M2 and anti-CDX2 antibodies. G, DLD1 cells were transfected with Fbw7-targeting pool of three siRNAs from two different manufacturers as well as two different shFbw7 plasmids. Whole-cell lysates were prepared, resolved on 10% SDS-PAGE, and immunoblotted with anti-CDX2, anti-Fbw7, and anti-cyclin E antibody. H, Lysates of HCT116 cells transfected with 25 nmol/L (þ) and 50 nmol/L (þþ) siFbw7 or control siRNA (siCtrl) harvested after indicated time points were resolved and immunoblotted with anti–Flag-M2, anti-CDX2, and anti-Cyclin E antibodies. b-Actin was probed as a loading control in all the experiments (top). HCT 116 cells were transfected with siFbw7 and siControl; post 36-hour transfection, isolated RNA was ampliﬁed using real-time PCR and graph was plotted (bottom). I, Lysates of DLD1 cells transfected either with 25 nmol/L or 50 nmol/L siFbw7 and si-control harvested after indicated time points were resolved on 10% SDS-PAGE followed by immunoblotting with anti–Flag-M2 and anti-CDX2 antibodies. Data are representative of minimum three independent experiments.

www.aacrjournals.org Mol Cancer Res; 14(11) November 2016 1101

Kumar et al.

Figure 2. Interaction of CDX2 and Fbw7 in HCT116 cells. A, HCT116 cells were treated with 10 mmol/L MG132 and 10 mmol/L lactacystin (inhibitors of proteasome pathway) 6 hours before harvesting. CDX2 was immunoprecipitated using anti-CDX2 antibody as indicated. Immunoblotting was performed using anti- CDX2, anti-hFbw7, and anti-GSK3b antibodies. B, HCT116 cells were transfected with Flag-tagged Fbw7 (1.0 mg), Flag-tagged Fbw7DF (1.0 mg), and Flag-tagged Fbw7WD (1.0 mg) as indicated. Lysates were immunoprecipitated using anti-CDX2 antibody. Immunoblotting was performed using anti-CDX2 and anti–Flag-M2 antibodies. Data are representative of minimum three independent experiments.

dependent (Fig. 4K). Taken together, these data demonstrated nonfunctional mutants on CDX2 transactivation potential, we that both the CPDs of CDX2 are involved in its ubiquitin-medi- transfected expression plasmids for Fbw7 and its mutants along ated proteasome degradation by Fbw7 in a GSK3b-dependent with CDX2 and p21-luc in HEK293T and NIH/3T3 cells. We manner. observed that Fbw7 inhibited, whereas Fbw7 mutants (DF and WD) led to increase in transactivation potential of CDX2 on p21- Fbw7-mediated degradation of CDX2 negatively inﬂuences its luc (Fig. 5A and C). Western blotting for the same transfection transactivation capacity conditions as shown in Fig. 5A conﬁrmed that changes in lucif- As our data indicated that Fbw7 destabilized CDX2 by targeting erase activity were related to the changes in the expression of it for degradation, we next asked whether the Fbw7-mediated CDX2 in the presence of Fbw7 and its mutants (Fig. 5B). Similar CDX2 degradation had any effect on CDX2 transactivation ability. set of experiments when performed in DLD1 and HCT116 cells To answer this, we performed luciferase reporter assay on p21 again showed that overexpression of Fbw7 inhibited CDX2 promoter using p21-luc in heterologous systems HEK293T transactivation ability, whereas nonfunctional Fbw7 mutants (Fig. 5A) and NIH/3T3 (Fig. 5C) as well as colon cancer cell lines (Fbw7WD and Fbw7DF) enhanced CDX2 transactivation potential DLD1 (Fig. 5D) and HCT116 (Fig. 5E). Notably, p21 is a direct (Fig. 5D and E). As a proof of principle, we reprobed the mem- target gene of CDX2 (5). To determine effects of Fbw7 and its brane from previous experiment (Fig. 1H) showing that

1102 Mol Cancer Res; 14(11) November 2016 Molecular Cancer Research

Fbw7 Negatively Regulates CDX2 Stability

Figure 3. Fbw7-mediated degradation of CDX2 relies on GSK3b. A, Table indicating the position of phosphorylation sites in CPD sequences of known Fbw7 substrates and putative CPD sequences in CDX2 B, Lysates of DLD1 cells transfected with 1.0 mg Flag-Fbw7a and subsequently treated with SB216763 and roscovitine for 24 hours were resolved on SDS-PAGE and immunoblotted with anti-CDX2 and anti-flag antibodies. C, HCT116 cells transfected with 0.5 mg V5-tagged GSK3b either alone or together with siFbw7a were harvested after 42-hour transfection, resolved on 15% SDS-PAGE, and immunoblotted with anti-CDX2, anti-Fbw7, and anti-V5 antibodies. D, DLD1 cells were transfected with 2.0 mg V5-GSK3b and 25 nmol/L siGSK3b. Lysates prepared after 48-hour transfection were resolved and immunoblotted with anti-CDX2 and anti-GSK3b antibodies. E, HCT116 cells were transfected with increasing amounts of Flag-Fbw7 with or without 25 nmol/L siGSK3b as indicated. Lysates were immunoblotted with anti-CDX2, anti-Fbw7, and anti-GSK3b antibodies. F, HCT116 cells were transfected with increasing amounts of GSK3b or 25 nmol/L siFbw7 with increasing amounts of GSK3b as indicated. Immunoblotting was performed using anti-CDX2, anti-Fbw7, and anti-V5 antibodies. b-Actin was probed as a loading control. Data are representative of minimum three independent experiments. knockdown of Fbw7 and consequent increased CDX2 expression cell differentiation (Fig. 6C). These data thus suggested that led to increased expression of endogenous p21. As expected, like catalytically active Fbw7 negatively modulated CDX2 protein CDX2, enhanced p21 levels were observed in Fbw7 knockdown stability and its biological outputs. conditions (Fig. 5F). In order to further establish that Fbw7- regulated CDX2 protein levels were reflected in its functions, we CDX2 and Fbw7 expression is inversely corelated during colon first depleted Fbw7 in HCT116 cells, and in another condition cell differentiation after 24 hours of Fbw7 knockdown, CDX2 was also depleted in Based on our finding that Fbw7 inhibits CDX2 steady-state the same cells; immunoblotting with anti-CDX2 and anti-p21 levels and its transactivation potential which otherwise is required showed that Fbw7 depletion promoted CDX2 as well as p21 for intestinal development, differentiation, and maintenance of levels, whereas p21 expression regressed in Fbw7-depleted con- the intestinal phenotype, we next assessed relative expression dition when CDX2 was also depleted 24 hours later in the same levels of CDX2 and Fbw7 during colon cell differentiation. cells (Fig. 5G) This indicated that increase in p21 levels upon Immunoblotting with anti-CDX2 and anti-Fbw7 antibodies in Fbw7 depletion is due to enhanced CDX2 levels which can directly WCEs of Caco-2 cells prepared after indicated days showed activate p21 at promoter level. Another set of similar experiment decrease in Fbw7 expression with concomitant increase in CDX2 performed to assess expression of alkaline phosphatase (ALP) expression along differentiation stages, thus indicating Fbw7- expression as a measure of CDX2-induced differentiation in these regulated CDX2 functions by controlling its protein turnover (Fig. cells also showed that stabilized CDX2 promoted, whereas knock- 6A). The human intestinal Caco-2 cell line represents the best down of Fbw7 and subsequent cdx2 depletion mitigated, colon available in vitro model of colon cell differentiation which

www.aacrjournals.org Mol Cancer Res; 14(11) November 2016 1103

Kumar et al.

Figure 4. Both the CPDs of CDX2 are involved in its degradation by Fbw7. A, Depicts various domains of CDX2 and its deletion mutants. B, Lysates of HEK293T cells transfected with 0.5 mg Flag-CDX2 and 1.0 mg Flag-CDX2CD in the presence and absence of 2.0 mg Flag-tagged Fbw7 as indicated were immunoblotted with anti–Flag-M2 antibody. C, Lysates of HEK293T cells transfected with 1.0 mg Flag-CDX2CD or 2.0 mg CDX2ND in the presence and absence of 2.0 mg Fbw7a as indicated were resolved and immunoblotted with anti-CDX2 and anti-Flag antibodies. (Continued on the following page.)

1104 Mol Cancer Res; 14(11) November 2016 Molecular Cancer Research

Fbw7 Negatively Regulates CDX2 Stability

spontaneously differentiates when cultured for 2 weeks in culture presence of two putative CPD motifs within CDX2 suggested it media (Fig. 6A; ref. 33). We next asked if nondegradable to be a probable substrate for Fbw7 (Fig. 1A). As a matter of CDX2S60,64,281A could promote colon cell differentiation by fact, overexpression of Fbw7 in colon cancer cells (DLD1 and assessing the ALP activity in HT-29 cells. Notably, increased ALP HCT116) led to reduced CDX2 protein levels, whereas inactive activity upon treatment with sodium butyrate is a feature of Fbw7 mutants had no affect (Fig. 1E and F). Contrarily, Fbw7 differentiated HT-29 human colon adenocarcinoma (34). We RNAi restored endogenous CDX2 both in DLD1 and HCT116, transfected wild-type CDX2 and the nondegradable mutant indicating its physiologic relevance in colon cell biology (Fig. CDX2S60,64,281A in HT-29 cells and subsequently treated 1G–I). Furthermore, cycloheximide treatment of colon cancer these cells with 2 mmol/L sodium butyrate. Upon butyrate treat- cells transfected with Fbw7 or its deletion mutant showed that ment, modestly increased ALP activity was observed in Fbw7 promoted the rate of CDX2 degradation while Fbw7DF CDX2S60,64,281A-transfected condition than in wild-type CDX2, had barely any effect indicated that E3 ubiquitin ligase activity suggesting CDX2S60,64,281A promoted colon cell differentiation of Fbw7 is involved in downregulation of CDX2 levels (Fig. (Fig. 6B). In order to further examine if depletion of Fbw7 in colon 1D). We therefore elucidated Fbw7-mediated ubiquitin-protea- cancer cell lines affects their biological outputs in a CDX2-depen- some degradation of CDX2 through its putative CPDs and dent manner, we simultaneously depleted CDX2 in HCT116 cells subsequent functional consequences. and assessed for ALP activity. Data showed that Fbw7 depletion Fbw7 mediated degradation of its substrates is usually preceded promoted, whereas simultaneous depletion of both Fbw7 and by phosphorylation within CPDs by certain kinases (10, 15). CDX2 mitigated ALP activity, thus indicating that Fbw7-mediated Here, we demonstrated that GSK3b, a serine/threonine kinase, CDX2 regulations are reflected in its biological functions (Fig. 6C). may phosphorylate CDX2 in its CPD motifs leading to its deg- Immunoblot for respective knockdown of Fbw7 and subsequent radation by Fbw7. This assumption was based on three criteria: depletion of CDX2 in same cells are shown in Fig. 5G. Furthermore, first, several of the known Fbw7 substrates having CPDs matching recently a number of studies showed that ubiquitin-specificpro- those present in CDX2 are phosphorylated by GSK3b. Second, tease-28 (USP28) maintains physiologic levels of Fbw7 substrates Gross and colleagues reported phosphorylation of S281 within 4S in colon cells through dual regulation of Fbw7 activity in a dose- motif of CDX2 by GSK3b. Interestingly, this 4S motif is also dependent manner (16, 17). Taking this into consideration, we also involved in ubiquitin-mediated degradation of CDX2 (2). examined if USP28 antagonized Fbw7-regulated CDX2 protein Moreover, this S281 also lies within C-terminal CPD and forms turnover. In order to address this, we overexpressed increasing aGSKb substrate consensus. Third, expression as well as activity amount of USP28 either alone or together with Fbw7 in DLD1 of GSK3b is highly increased in majority of colon cancer cell colon cancer cells. Immunoblotting with anti-CDX2 antibody lines and patients (20, 21). Our findings showed that both showed that USP28 antagonized Fbw7-mediated downregulation pharmacologic inhibition of GSK3b by chemical inhibitors of CDX2 and restored endogenous CDX2 levels even in the (Fig. 3B) and GSK3b RNAi (Fig. 3D and Supplementary Fig. presence of Fbw7 (Fig. 6D). In order to further substantiate the S2C) rescued endogenous CDX2 from degradation even in the role of USP28 in stabilizing the expression of CDX2, we performed presence of overexpressed Fbw7 in colon cancer cells (HCT116 deubiquitination assay in HEK293T cells by transfecting indicated and DLD1). Moreover, the presence of slow-migrating CDX2 expression plasmids. Thirty-six hours after transfection, whole-cell (apparently phosphorylated CDX2) band in GSK3b-overex- lysates were prepared, and CDX2 was immunoprecipitated pressed condition with simultaneous Fbw7 depletion in with anti-HA. Immunoblotting of CDX2-immunoprecpitates with HCT116 cells further indicated that GSK3b indeed phosphor- indicated antibodies showed that Fbw7-mediated CDX2-ubiqui- ylated CDX2 to be recognized and targeted by Fbw7 (Fig. 3C). tination, and degradation was substantially inhibited by USP28 In addition, our data also demonstrated a physical interaction (Fig. 6E), thus suggesting that USP28 indeed deubiquitinated between Fbw7 and CDX2, which is a prerequisite for E3 CDX2 and protected from degradation by Fbw7a. Based on the ubiquitin ligases to target its substrates for ubiquitination. The data presented here, Fig. 6F depicts a hypothetical model for presence of GSK3b in the same immunocomplex further indi- regulation of CDX2 stability by Fbw7 and USP28. cated for possible involvement of GSK3b in Fbw7-regulated CDX2 ubiquitination (Fig. 2). Discussion Furthermore, downregulation of different deletion mutants Here, we identified tumor suppressor Fbw7 as a novel reg- (CDX2CD and CDX2ND) containing only either of the CPD by ulator of CDX2 stability and functions in colon cancer cells. The overexpression of either Fbw7 (Fig. 4B and C) or GSK3b (Fig. 4D

(Continued.) D, Lysates of HEK293T cells transfected with 0.5 mg Flag-CDX2CD with 1.0 mg V5-GSK3b as indicated were immunoblotted with anti–Flag-M2 and anti-GSK3b antibodies. E, Lysates of HEK293T cells transfected with 3.0 mg CDX2ND with 1.0 mg V5-GSK3b as indicated were immunoblotted with anti-CDX2 and anti-GSK3b antibodies. F, Lysates of HEK293T cells transfected with 0.5 mg HA-CDX2, 0.5 mg HA-CDX2S281A, 0.5 mg HA-CDX2S60,64A, and HA-CDX2S60,64,281A with 1.0 mg Fbw7 as indicated were immunoblotted with anti-CDX2 and anti–Flag-M2 antibodies. G, Lysates of HEK293T cells transfected with 0.5 mg HA-CDX2, 0.5 mg HA-CDX2S281A, 0.5 mg HA-CDX2S60,64A, and HA-CDX2S60,64,281A with 1.0 mg GSK3b as indicated were immunoblotted with anti-CDX2 and anti- GSK3b antibodies. b-Actin was probed as a loading control. H, HCT116 cells were cotransfected with HA-CDX2, HA-CDX2S281A, HA-CDX2S60,64A, and (I) HA-CDX2S60,64,281A either alone or together with siFbw7a and V5-GSK3b as indicated condition. Post 42-hour transfection, whole-cell lysates were prepared, resolved on 15% SDS-PAGE, and immunoblotted with anti-HA, anti-V5, and anti-Fbw7 antibodies. J, HEK293T cells were transfected with either CDX2 or CDX2S60,64,281A together with His-ubiquitin, Flag-Fbw7a, and V5-GSK3b as indicated. Whole-cell lysates prepared were subjected to immunoprecipitation with anti-HA antibody, resolved on 10% SDS-PAGE, and subsequently immunoblotted with anti-CDX2, anti-His, anti-V5, and anti-Flag antibodies. Data are representative of minimum three independent experiments. K, DLD1 cells were transfected with His-ubiquitin, Flag-Fbw7a either alone or with siGSK3b as indicated. Post 24-hour transfection, cells were treated with 10 mmol/L SB216763 (GSK3b inhibitor). Post 42-hour transfection, whole-cell lysates were prepared and immunoprecipitation was performed as previously described by anti-CDX2 antibody, and resolved on 10% SDS-PAGE followed by immunoblotting with anti-His, anti-CDX2, anti-Fbw7a, and anti-GSK3b antibodies.

www.aacrjournals.org Mol Cancer Res; 14(11) November 2016 1105

Kumar et al.

Figure 5. Degradation of CDX2 by Fbw7 affects its transactivation potential. (A) HEK293T, (C) NIH/3T3, (D) DLD1, and (E) HCT116 cells were transfected with p21-Luc reporter and expression plasmids for CDX2, Fbw7, and its mutants. Twenty-four hours after transfection, cells were lysed and relative luciferase activity was measured. Results are representative of minimum three independent experiments. Results are given as SEM; , P < 0.05; , P < 0.001; and , P < 0.0001. One-way ANOVA with the Bonferroni Multiple Comparison Test was performed using Graph Pad Prism Version 5.00. B, Representative Western blot of the luciferase assay performed in HEK293T cells. F, Lysates of HCT116 cells transfected with 25 nmol/L si-control or 25 nmol/L siFbw7 for 48 and 72 hours as indicated were immunoblotted with anti-CDX2, anti-Fbw7, and anti-p21 antibodies. b-Actin was probed as loading control. Data are representative of minimum three independent experiments. G, HCT116 cells were ﬁrst transfected with 50 nmol/L siFbw7, and subsequently these Fbw7-depleted cells transfected with siCDX2 24 hours later. WCEs prepared after 48 hours of transfection were resolved on 10% SDS-PAGE and immunoblotted with anti-CDX2, anti-Fbw7a, and anti-p21 antibodies.

1106 Mol Cancer Res; 14(11) November 2016 Molecular Cancer Research

Fbw7 Negatively Regulates CDX2 Stability

Figure 6. CDX2 and Fbw7 expression is inversely related during differentiation of colon cells. A, Representative images of Caco-2 cells showing morphologic changes during differentiation. Whole-cell lysates of Caco2 cells prepared at days 0, 7, and 13 were resolved on 10% SDS gel and probed for CDX2 and Fbw7. b-Actin was probed as loading control. B, Representative graph of ALP assay performed in HT-29 cells (CDX2 mutant refers to CDX2S60,64,281A). Results are representative of minimum three independent experiments. Results are given as SEM; , P < 0.05; , P < 0.001; and , P < 0.0001. One-way ANOVA with the Bonferroni Multiple Comparison Test was performed using Graph Pad Prism Version 5.00. C, HCT116 cells were ﬁrst transfected with 50 nmol/L siFbw7, and subsequently these Fbw7-depleted cells were transfected with siCDX2 24 hours later. Post 48 hours of transfection, cells were lysed and collected in 1.5 mL tubes. Samples were freeze-thawed and centrifuged at 16,000 rpm at 4C, and equal amounts of supernatant were incubated with PNPP buffer and readings were taken at 405 nmol/L. D, Whole-cell lysates of DLD1 cells transfected with Fbw7 alone or together with USP28 as indicated were resolved on SDS-PAGE and immunoblotted with anti-ﬂag and anti-CDX2 antibodies. Data are representative of minimum three independent experiments. Images were captured by digital camera. E, HEK293T cells were transfected with HA-CDX2, His ubiquitin, Flag-Fbw7a, and Flag-USP28 as indicated. Whole-cell lysates prepared were subjected to immunoprecipitation with anti-HA antibody, resolved on 10%SDS-PAGE, and immunoblotted with anti-CDX2, anti-His, and anti-Flag antibodies. F, Hypothetical model shows regulation of CDX2 protein stability by Fbw7 in a GSK3b-dependent manner.

www.aacrjournals.org Mol Cancer Res; 14(11) November 2016 1107

Kumar et al.

and E) separately also confirmed that both CPDs within CDX2 in a USP28-dependent manner during normal intestinal cell lying either at N- or C-terminal are involved in Fbw7-mediated development which is disrupted during colon cancer progression. degradation of CDX2. Expectedly, Fbw7 also down regulated However, detailed study is needed to further understand this CDX2-S281A and CDX2-4S>A indicating other CPD to be equally aspect. In addition, Fbw7-mediated CDX2 degradation in colon important (Supplementary Fig. S3A and S3B). This finding was in cancer cells may also be driven by active GSK3b, which has tumor- line with previous report by Gross and colleagues showing involve- promoting effects in colon cells (21). Shakoori and colleagues ment of phospho-S281 (falls within C-terminal CPD) within 4S showed that levels of GSK3b expression and amounts of its active motif of CDX2 to be involved in its ubiquitination (2). Our data form were higher in tumor cells and colorectal cancer patients further demonstrated that a CDX2 mutant (CDX2-S60,64A) having than in their normal counterparts (20). Their findings were C-terminal CPD mutated was still degraded by Fbw7, whereas independent of nuclear accumulation of b-catenin oncoprotein triple-point mutant CDX2-S60,64,281A having GSK3b phosphor- in the tumor cells. Moreover, authors showed that inhibition of ylable serines replaced with alanine within both CPDs was resistant GSK3b activity by chemical inhibitors and its expression by to degradation either by Fbw7 or GSK3b (Fig. 4F and G). In GSK3b RNAi promoted apoptosis and strongly mitigated prolif- addition, a slow-migrating CDX2 band (apparently phosphorylat- eration of colon cancer cells in vitro (20, 21). Our finding dem- ed CDX2) was observed with wild-type CDX2, CDX2-S60,64, and onstrating enhanced stability of CDX2 owing to inhibition of CDX2-S281 but not with CDX2S60,64,281A upon GSK3b over- GSK3b-dependent Fbw7-mediated degradation of CDX2 may expression, and simultaneous depletion of Fbw7 suggested that account for induction of apoptosis and inhibition of proliferation GSK3b phosphorylated CDX2 (Fig. 4H and I). These data thus in these colon cancer cells. demonstrated that GSK3b seemed to prime CDX2 to be recognized and degraded via Fbw7 apparently by phosphorylating CDX2 Conclusion within the two putative CPDs, although C-terminal CPD seemed Taken together, these findings demonstrate that Fbw7 targets to contribute more in Fbw7-mediated CDX2 degradation. Inciden- CDX2 for ubiquitin-mediated proteasome degradation in a tally, our data demonstrating that phosphorylation of CDX2 at GSK3b-dependent manner where GSK3b presumably phosphor- serine-60 promotes its Fbw7-mediated ubiquitination also pro- ylates CDX2 within the two potential CPDs to be recognized by vides a plausible explanation for reduced CDX2 transactivation Fbw7. Consequently, CDX2-regulated functions such as transac- potential as reported by Ring and colleagues (35). tivation of target genes and colon cell differentiation are affected. fi Our nding indicated that overexpression of CDX2 or non- More importantly, like with other substrates of Fbw7 in colon functional Fbw7 mutants (DF and WD) enhanced CDX2 trans- cancer, our finding also demonstrates that CDX2 expression is activation potential on p21-luc reporter, whereas inhibition by regulated by Fbw7 in a USP28-dependent manner. Collectively, Fbw7 further indicated that Fbw7-mediated proteasome deg- our data provide detailed molecular insights into the deregulated radation of CDX2 attenuated its functions in colon cancer cells expression of CDX2 often observed in colon cancers and indicate (Fig. 5C and D). Notably, p21 is a known direct target of CDX2 that therapeutic targeting of Fbw7 in such patients either alone or in colon cancer cells (5). In line with luciferase assay, knock- together with GSK3b may be a possible treatment option for colon down of Fbw7 led to substantial increase in both CDX2 and cancer. p21 protein levels, whereas subsequent depletion of CDX2 in these Fbw7-depleted cells regressed p21 levels, thus confirming Disclosure of Potential Conflicts of Interest that Fbw7-mediated CDX2 regulations are reflected in its No potential conflicts of interest were disclosed. biological functions (Figs. 5F and G and 6C). Furthermore, increase in endogenous CDX2 expression with concomitant Authors' Contributions decrease in Fbw7 in spontaneously differentiating Caco-2 cells Conception and design: S. Lochab, M.L.B. Bhatt, A.K. Trivedi further indicated the functional relevance of Fbw7-mediated Development of methodology: I. Kapoor, M.L.B. Bhatt CDX2 degradation (Fig. 6A). Acquisition of data (provided animals, acquired and managed patients, Although general notion is that Fbw7 is a tumor suppressor and provided facilities, etc.): Y. Kumar, N. Shukla, G. Thacker regulates ubiquitin-mediated degradation of several oncopro- Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): N. Shukla, I. Kapoor, M.L.B. Bhatt, A.K. Trivedi teins (10, 12, 14), Fbw7 can either suppress or promote tumor Writing, review, and/or revision of the manuscript: Y. Kumar, N. Shukla, development in mouse models (36). Like CDX2 in the present I. Kapoor, M.L.B. Bhatt, N. Chattopadhyay, S. Sanyal, A.K. Trivedi study, Fbw7 has been reported to regulate stability of transcription Administrative, technical, or material support (i.e., reporting or organizing factors such as C/EBPa (37) and SREBP1 (38) that are well known data, constructing databases): N. Shukla, I. Kapoor, M.L.B. Bhatt to couple differentiation with growth arrest in various cell types. Study supervision: S. Sanyal, A.K. Trivedi Although relatively little is known about regulators of Fbw7 that Other (clinical interpretation): M.L.B. Bhatt may regulate its expression and functions, recent studies indicate Acknowledgments that Fbw7 activity is controlled at different levels, resulting in Funding from the Council of Scientific and Industrial Research (YSA0002, fi speci c and tunable regulation of the abundance and activity of its MLP750, BSC0103, and BSC0111) and Science and Research Engineering substrates in colon cancer (36). Very recently, Popov and collea- Board, Department of Science and Technology, Government of India gues showed that USP28 acts as a safeguard mechanism for (GAP0185) to A.K. Trivedi is acknowledged. Institutional communication maintaining physiologic levels of Fbw7 substrates in colon cells number for this article is 9275. via dual regulation of Fbw7 activity (17). In fact, we also observed The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in increased CDX2 expression upon USP28 overexpression in DLD1 accordance with 18 U.S.C. Section 1734 solely to indicate this fact. cells even in Fbw7-cotransfected conditions, which obviously is due to deubiquitination of CDX2 by USP28 (Fig. 6D and E). Thus, Received April 21, 2016; revised July 18, 2016; accepted July 18, 2016; it is very likely that Fbw7 keeps a check on CDX2 protein turnover published OnlineFirst July 28, 2016.

1108 Mol Cancer Res; 14(11) November 2016 Molecular Cancer Research

Fbw7 Negatively Regulates CDX2 Stability

References 1. Guo RJ, Funakoshi S, Lee HH, Kong J, Lynch JP. The intestine-specific 20. Shakoori A, Ougolkov A, Yu ZW, Zhang B, Modarressi MH, Billadeau DD, transcription factor Cdx2 inhibits beta-catenin/TCF transcriptional activity et al. Deregulated GSK3beta activity in colorectal cancer: Its association by disrupting the beta-catenin-TCF protein complex. Carcinogenesis with tumor cell survival and proliferation. Biochem Biophys Res Commun 2010;31:159–66. 2005;334:1365–73. 2. Gross I, Lhermitte B, Domon-Dell C, Duluc I, Martin E, Gaiddon C, et al. 21. Shakoori A, Mai W, Miyashita K, Yasumoto K, Takahashi Y, Ooi A, et al. Phosphorylation of the homeotic tumor suppressor Cdx2 mediates its Inhibition of GSK-3 beta activity attenuates proliferation of human colon ubiquitin-dependent proteasome degradation. Oncogene 2005;24: cancer cells in rodents. Cancer Sci 2007;98:1388–93. 7955–63. 22. Welcker M, Orian A, Grim JE, Eisenman RN, Clurman BE. A nucleolar 3. Hinoi T, Loda M, Fearon ER. Silencing of CDX2 expression in colon cancer isoform of the Fbw7 ubiquitin ligase regulates c-Myc and cell size. Curr Biol via a dominant repression pathway. J Biol Chem 2003;278:44608–16. 2004;14:1852–7. 4. Hinoi T, Lucas PC, Kuick R, Hanash S, Cho KR, Fearon ER. CDX2 23. Pal P, Lochab S, Kanaujiya JK, Kapoor I, Sanyal S, Behre G, et al. E3 regulates liver intestine-cadherin expression in normal and malignant ubiquitin ligase E6AP negatively regulates adipogenesis by down- colon epithelium and intestinal metaplasia. Gastroenterology 2002; regulating proadipogenic factor C/EBPalpha. PLoS One 2013;8: 123:1565–77. e65330. 5. Bai YQ, Miyake S, Iwai T, Yuasa Y. CDX2, a homeobox transcription factor, 24. Zhang D, Zaugg K, Mak TW, Elledge SJ. A role for the deubiquitinating upregulates transcription of the p21/WAF1/CIP1 gene. Oncogene enzyme USP28 in control of the DNA-damage response. Cell 2006;126: 2003;22:7942–9. 529–42. 6. Bonhomme C, Duluc I, Martin E, Chawengsaksophak K, Chenard MP, 25. Pal P, Lochab S, Kanaujiya J, Sanyal S, Trivedi AK. Ectopic expression of hC/ Kedinger M, et al. The Cdx2 homeobox gene has a tumour suppressor EBPs in breast tumor cells induces apoptosis. Mol Cell Biochem 2010;337: function in the distal colon in addition to a homeotic role during gut 111–8. development. Gut 2003;52:1465–71. 26. Kanaujiya JK, Lochab S, Kapoor I, Pal P, Datta D, Bhatt ML, et al. Proteomic 7. Dang LH, Chen F, Ying C, Chun SY, Knock SA, Appelman HD, et al. CDX2 identification of Profilin1 as a corepressor of estrogen receptor alpha in has tumorigenic potential in the human colon cancer cell lines LOVO and MCF7 breast cancer cells. Proteomics 2013;13:2100–12. SW48. Oncogene 2006;25:2264–72. 27. Pal P, Kanaujiya JK, Lochab S, Tripathi SB, Bhatt ML, Singh PK, et al. 2-D gel 8. Salari K, Spulak ME, Cuff J, Forster AD, Giacomini CP, Huang S, et al. CDX2 electrophoresis-based proteomic analysis reveals that ormeloxifen induces is an amplified lineage-survival oncogene in colorectal cancer. Proc Natl G0-G1 growth arrest and ERK-mediated apoptosis in chronic myeloid Acad Sci U S A 2012;109:E3196–205. leukemia cells K562. Proteomics 2011;11:1517–29. 9. Olsen J, Espersen ML, Jess P, Kirkeby LT, Troelsen JT. The clinical perspec- 28. Trivedi AK, Bararia D, Christopeit M, Peerzada AA, Singh SM, Kieser A, et al. tives of CDX2 expression in colorectal cancer: A qualitative systematic Proteomic identification of C/EBP-DBD multiprotein complex: JNK1 review. Surg Oncol 2014;23:167–76. activates stem cell regulator C/EBPalpha by inhibiting its ubiquitination. 10. Welcker M, Orian A, Jin J, Grim JE, Harper JW, Eisenman RN, et al. The Oncogene 2007;26:1789–801. Fbw7 tumor suppressor regulates glycogen synthase kinase 3 phosphor- 29. Kumar Y, Kapoor I, Khan K, Thacker G, Khan MP, Shukla N, et al. E3 ylation-dependent c-Myc protein degradation. Proc Natl Acad Sci U S A ubiquitin ligase Fbw7 negatively regulates osteoblast differentiation by 2004;101:9085–90. targeting Runx2 for degradation. J Biol Chem 2015;290:30975–87. 11. Inuzuka H, Shaik S, Onoyama I, Gao D, Tseng A, Maser RS, et al. SCF 30. Pal P, Lochab S, Kanaujiya JK, Kapoor I, Sanyal S, Behre G, et al. E6AP, an E3 (FBW7) regulates cellular apoptosis by targeting MCL1 for ubiquitylation ubiquitin ligase negatively regulates granulopoiesis by targeting transcrip- and destruction. Nature 2011;471:104–9. tion factor C/EBPalpha for ubiquitin-mediated proteasome degradation. 12. Liu N, Li H, Li S, Shen M, Xiao N, Chen Y, et al. The Fbw7/human CDC4 Cell Death Dis 2013;4:e590. tumor suppressor targets proproliferative factor KLF5 for ubiquitination 31. Lochab S, Pal P, Kanaujiya JK, Tripathi SB, Kapoor I, Bhatt ML, et al. and degradation through multiple phosphodegron motifs. J Biol Chem Proteomic identification of E6AP as a molecular target of tamoxifen in 2010;285:18858–67. MCF7 cells. Proteomics 2012;12:1363–77. 13. Fukushima H, Matsumoto A, Inuzuka H, Zhai B, Lau AW, Wan L, et al. SCF 32. Wu RC, Feng Q, Lonard DM, O'Malley BW. SRC-3 coactivator functional (Fbw7) modulates the NFkB signaling pathway by targeting NFkB2 for lifetime is regulated by a phospho-dependent ubiquitin time clock. Cell ubiquitination and destruction. Cell Rep 2012;1:434–43. 2007;129:1125–40. 14. Koepp DM, Schaefer LK, Ye X, Keyomarsi K, Chu C, Harper JW, et al. 33. Ferruzza S, Rossi C, Scarino ML, Sambuy Y. A protocol for differentiation of Phosphorylation-dependent ubiquitination of cyclin E by the SCFFbw7 human intestinal Caco-2 cells in asymmetric serum-containing medium. ubiquitin ligase. Science 2001;294:173–7. Toxicol In Vitro 2012;26:1252–5. 15. Davis R, Welcker M, Clurman B. Tumor suppression by the Fbw7 34. Domon-Dell C, Wang Q, Kim S, Kedinger M, Evers BM, Freund JN. ubiquitin ligase: Mechanisms and opportunities. Cancer Cell 2014;26: Stimulation of the intestinal Cdx2 homeobox gene by butyrate in colon 455–564. cancer cells. Gut 2002;50:525–9. 16. Diefenbacher ME, Popov N, Blake SM, Schulein-Volk C, Nye E, Spencer- 35. Rings EH, Boudreau F, Taylor JK, Moffett J, Suh ER, Traber PG. Phosphor- Dene B, et al. The deubiquitinase USP28 controls intestinal homeostasis ylation of the serine 60 residue within the Cdx2 activation domain mediates and promotes colorectal cancer. J Clin Invest 2014;124:3407–18. its transactivation capacity. Gastroenterology 2001;121:1437–50. 17. Schulein-Volk C, Wolf E, Zhu J, Xu W, Taranets L, Hellmann A, et al. Dual 36. Xu W, Taranets L, Popov N. Regulating Fbw7 on the road to cancer. Semin regulation of Fbw7 function and oncogenic transformation by Usp28. Cell Cancer Biol 2016;36:62–70. Rep 2014;9:1099–109. 37. Bengoechea-Alonso MT, Ericsson J. The ubiquitin ligase Fbxw7 controls 18. Boulanger J, Vezina A, Mongrain S, Boudreau F, Perreault N, Auclair BA, et al. adipocyte differentiation by targeting C/EBPalpha for degradation. Proc Cdk2-dependent phosphorylation of homeobox transcription factor CDX2 Natl Acad Sci U S A 2010;107:11817–22. regulates its nuclear translocation and proteasome-mediated degradation in 38. Sundqvist A, Bengoechea-Alonso MT, Ye X, Lukiyanchuk V, Jin J, Harper human intestinal epithelial cells. J Biol Chem 2005;280:18095–107. JW, et al. Control of lipid metabolism by phosphorylation-dependent 19. Doble BW, Woodgett JR. GSK-3: Tricks of the trade for a multi-tasking degradation of the SREBP family of transcription factors by SCF(Fbw7). kinase. J Cell Sci 2003;116:1175–86. Cell Metab 2005;1:379–91.

www.aacrjournals.org Mol Cancer Res; 14(11) November 2016 1109

Ubiquitin Ligase, Fbw7, Targets CDX2 for Degradation via Two Phosphodegron Motifs in a GSK3 β-Dependent Manner

Yogesh Kumar, Nidhi Shukla, Gatha Thacker, et al.

Mol Cancer Res 2016;14:1097-1109. Published OnlineFirst July 28, 2016.

Updated version Access the most recent version of this article at: doi:10.1158/1541-7786.MCR-16-0138

Supplementary Access the most recent supplemental material at: Material http://mcr.aacrjournals.org/content/suppl/2016/08/31/1541-7786.MCR-16-0138.DC1

Cited articles This article cites 38 articles, 11 of which you can access for free at: http://mcr.aacrjournals.org/content/14/11/1097.full#ref-list-1

Citing articles This article has been cited by 2 HighWire-hosted articles. Access the articles at: http://mcr.aacrjournals.org/content/14/11/1097.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at Subscriptions [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://mcr.aacrjournals.org/content/14/11/1097. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.