Stages of Schistosoma Mansoni
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Bayesian Hierarchical Modeling of High-Throughput Genomic Data with Applications to Cancer Bioinformatics and Stem Cell Differentiation
BAYESIAN HIERARCHICAL MODELING OF HIGH-THROUGHPUT GENOMIC DATA WITH APPLICATIONS TO CANCER BIOINFORMATICS AND STEM CELL DIFFERENTIATION by Keegan D. Korthauer A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Statistics) at the UNIVERSITY OF WISCONSIN–MADISON 2015 Date of final oral examination: 05/04/15 The dissertation is approved by the following members of the Final Oral Committee: Christina Kendziorski, Professor, Biostatistics and Medical Informatics Michael A. Newton, Professor, Statistics Sunduz Kele¸s,Professor, Biostatistics and Medical Informatics Sijian Wang, Associate Professor, Biostatistics and Medical Informatics Michael N. Gould, Professor, Oncology © Copyright by Keegan D. Korthauer 2015 All Rights Reserved i in memory of my grandparents Ma and Pa FL Grandma and John ii ACKNOWLEDGMENTS First and foremost, I am deeply grateful to my thesis advisor Christina Kendziorski for her invaluable advice, enthusiastic support, and unending patience throughout my time at UW-Madison. She has provided sound wisdom on everything from methodological principles to the intricacies of academic research. I especially appreciate that she has always encouraged me to eke out my own path and I attribute a great deal of credit to her for the successes I have achieved thus far. I also owe special thanks to my committee member Professor Michael Newton, who guided me through one of my first collaborative research experiences and has continued to provide key advice on my thesis research. I am also indebted to the other members of my thesis committee, Professor Sunduz Kele¸s,Professor Sijian Wang, and Professor Michael Gould, whose valuable comments, questions, and suggestions have greatly improved this dissertation. -
Chromatin Dysregulation and DNA Methylation at Transcription Start Sites Associated with Transcriptional Repression in Cancers
Corrected: Publisher correction ARTICLE https://doi.org/10.1038/s41467-019-09937-w OPEN Chromatin dysregulation and DNA methylation at transcription start sites associated with transcriptional repression in cancers Mizuo Ando 1,2, Yuki Saito1,2, Guorong Xu3, Nam Q. Bui 4,5, Kate Medetgul-Ernar1, Minya Pu1, Kathleen Fisch 3, Shuling Ren1, Akihiro Sakai1, Takahito Fukusumi1, Chao Liu1, Sunny Haft1, John Pang1, Adam Mark3, Daria A. Gaykalova6, Theresa Guo6, Alexander V. Favorov 7,8, Srinivasan Yegnasubramanian7, Elana J. Fertig7, Patrick Ha 9, Pablo Tamayo 1, Tatsuya Yamasoba 2, Trey Ideker4, Karen Messer1 & Joseph A. Califano1,10 1234567890():,; Although promoter-associated CpG islands have been established as targets of DNA methylation changes in cancer, previous studies suggest that epigenetic dysregulation out- side the promoter region may be more closely associated with transcriptional changes. Here we examine DNA methylation, chromatin marks, and transcriptional alterations to define the relationship between transcriptional modulation and spatial changes in chromatin structure. Using human papillomavirus-related oropharyngeal carcinoma as a model, we show aberrant enrichment of repressive H3K9me3 at the transcriptional start site (TSS) with methylation- associated, tumor-specific gene silencing. Further analysis identifies a hypermethylated subtype which shows a functional convergence on MYC targets and association with CREBBP/EP300 mutation. The tumor-specific shift to transcriptional repression associated with DNA methylation at TSSs was confirmed in multiple tumor types. Our data may show a common underlying epigenetic dysregulation in cancer associated with broad enrichment of repressive chromatin marks and aberrant DNA hypermethylation at TSSs in combination with MYC network activation. 1 Moores Cancer Center, University of California San Diego, 3855 Health Sciences Dr, La Jolla, CA 92093, USA. -
Protein Kinase A-Mediated Septin7 Phosphorylation Disrupts Septin Filaments and Ciliogenesis
cells Article Protein Kinase A-Mediated Septin7 Phosphorylation Disrupts Septin Filaments and Ciliogenesis Han-Yu Wang 1,2, Chun-Hsiang Lin 1, Yi-Ru Shen 1, Ting-Yu Chen 2,3, Chia-Yih Wang 2,3,* and Pao-Lin Kuo 1,2,4,* 1 Department of Obstetrics and Gynecology, College of Medicine, National Cheng Kung University, Tainan 701, Taiwan; [email protected] (H.-Y.W.); [email protected] (C.-H.L.); [email protected] (Y.-R.S.) 2 Institute of Basic Medical Sciences, College of Medicine, National Cheng Kung University, Tainan 701, Taiwan; [email protected] 3 Department of Cell Biology and Anatomy, College of Medicine, National Cheng Kung University, Tainan 701, Taiwan 4 Department of Obstetrics and Gynecology, National Cheng-Kung University Hospital, Tainan 704, Taiwan * Correspondence: [email protected] (C.-Y.W.); [email protected] (P.-L.K.); Tel.: +886-6-2353535 (ext. 5338); (C.-Y.W.)+886-6-2353535 (ext. 5262) (P.-L.K.) Abstract: Septins are GTP-binding proteins that form heteromeric filaments for proper cell growth and migration. Among the septins, septin7 (SEPT7) is an important component of all septin filaments. Here we show that protein kinase A (PKA) phosphorylates SEPT7 at Thr197, thus disrupting septin filament dynamics and ciliogenesis. The Thr197 residue of SEPT7, a PKA phosphorylating site, was conserved among different species. Treatment with cAMP or overexpression of PKA catalytic subunit (PKACA2) induced SEPT7 phosphorylation, followed by disruption of septin filament formation. Constitutive phosphorylation of SEPT7 at Thr197 reduced SEPT7-SEPT7 interaction, but did not affect SEPT7-SEPT6-SEPT2 or SEPT4 interaction. -
Identification of Fusion Genes in Breast Cancer by Paired-End RNA
Edgren et al. Genome Biology 2011, 12:R6 http://genomebiology.com/2011/12/1/R6 RESEARCH Open Access Identification of fusion genes in breast cancer by paired-end RNA-sequencing Henrik Edgren1†, Astrid Murumagi1†, Sara Kangaspeska1†, Daniel Nicorici1, Vesa Hongisto2, Kristine Kleivi2,3, Inga H Rye3, Sandra Nyberg2, Maija Wolf1, Anne-Lise Borresen-Dale1,4, Olli Kallioniemi1* Abstract Background: Until recently, chromosomal translocations and fusion genes have been an underappreciated class of mutations in solid tumors. Next-generation sequencing technologies provide an opportunity for systematic characterization of cancer cell transcriptomes, including the discovery of expressed fusion genes resulting from underlying genomic rearrangements. Results: We applied paired-end RNA-seq to identify 24 novel and 3 previously known fusion genes in breast cancer cells. Supported by an improved bioinformatic approach, we had a 95% success rate of validating gene fusions initially detected by RNA-seq. Fusion partner genes were found to contribute promoters (5’ UTR), coding sequences and 3’ UTRs. Most fusion genes were associated with copy number transitions and were particularly common in high-level DNA amplifications. This suggests that fusion events may contribute to the selective advantage provided by DNA amplifications and deletions. Some of the fusion partner genes, such as GSDMB in the TATDN1-GSDMB fusion and IKZF3 in the VAPB-IKZF3 fusion, were only detected as a fusion transcript, indicating activation of a dormant gene by the fusion event. A number of fusion gene partners have either been previously observed in oncogenic gene fusions, mostly in leukemias, or otherwise reported to be oncogenic. RNA interference-mediated knock-down of the VAPB-IKZF3 fusion gene indicated that it may be necessary for cancer cell growth and survival. -
Primepcr™Assay Validation Report
PrimePCR™Assay Validation Report Gene Information Gene Name Septin-10 Gene Symbol Sept10 Organism Rat Gene Summary Description Not Available Gene Aliases Not Available RefSeq Accession No. Not Available UniGene ID Rn.27246 Ensembl Gene ID ENSRNOG00000049507 Entrez Gene ID 309891 Assay Information Unique Assay ID qRnoCID0004772 Assay Type SYBR® Green Detected Coding Transcript(s) ENSRNOT00000071663 Amplicon Context Sequence CTTATTTCCAACTTTTATCTCATCCATACTTCCAACAACAGCAAATGGTAAATGTC CATTCATCGCTCCGTTGATCTTGGCAGTTGTGTCGTCATCCGTTGGAAACTGATA TATCTGAACACCATTGATGACCAGTTCACTCATG Amplicon Length (bp) 115 Chromosome Location 20:30577380-30579713 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 100 R2 0.9995 cDNA Cq 21.14 cDNA Tm (Celsius) 81 gDNA Cq 39.33 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Sept10, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect. Details for each transcript can be found on the Ensembl website at www.ensembl.org. -
Genomic Approach in Idiopathic Intellectual Disability Maria De Fátima E Costa Torres
ESTUDOS DE 8 01 PDPGM 2 CICLO Genomic approach in idiopathic intellectual disability Maria de Fátima e Costa Torres D Autor. Maria de Fátima e Costa Torres D.ICBAS 2018 Genomic approach in idiopathic intellectual disability Genomic approach in idiopathic intellectual disability Maria de Fátima e Costa Torres SEDE ADMINISTRATIVA INSTITUTO DE CIÊNCIAS BIOMÉDICAS ABEL SALAZAR FACULDADE DE MEDICINA MARIA DE FÁTIMA E COSTA TORRES GENOMIC APPROACH IN IDIOPATHIC INTELLECTUAL DISABILITY Tese de Candidatura ao grau de Doutor em Patologia e Genética Molecular, submetida ao Instituto de Ciências Biomédicas Abel Salazar da Universidade do Porto Orientadora – Doutora Patrícia Espinheira de Sá Maciel Categoria – Professora Associada Afiliação – Escola de Medicina e Ciências da Saúde da Universidade do Minho Coorientadora – Doutora Maria da Purificação Valenzuela Sampaio Tavares Categoria – Professora Catedrática Afiliação – Faculdade de Medicina Dentária da Universidade do Porto Coorientadora – Doutora Filipa Abreu Gomes de Carvalho Categoria – Professora Auxiliar com Agregação Afiliação – Faculdade de Medicina da Universidade do Porto DECLARAÇÃO Dissertação/Tese Identificação do autor Nome completo _Maria de Fátima e Costa Torres_ N.º de identificação civil _07718822 N.º de estudante __ 198600524___ Email institucional [email protected] OU: [email protected] _ Email alternativo [email protected] _ Tlf/Tlm _918197020_ Ciclo de estudos (Mestrado/Doutoramento) _Patologia e Genética Molecular__ Faculdade/Instituto _Instituto de Ciências -
Systematic Humanization of the Yeast Cytoskeleton Discerns Functionally Replaceable from Divergent Human Genes
bioRxiv preprint doi: https://doi.org/10.1101/2019.12.16.878751; this version posted December 17, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Systematic humanization of the yeast cytoskeleton discerns functionally replaceable from divergent human genes Riddhiman K. Garge1, Jon M. Laurent1,2, Aashiq H. Kachroo3,*, Edward M. Marcotte1,* 1Center for Systems and Synthetic Biology, Department of Molecular Biosciences, The University of Texas at Austin, TX, USA 2Institute of Systems Genetics, Department of Biochemistry and Molecular Pharmacology, NYU Langone Health, NY, USA 3The Department of Biology, Centre for Applied Synthetic Biology, Concordia University, Montreal, QC, Canada *For correspondence: [email protected], [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2019.12.16.878751; this version posted December 17, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Abstract 2 3 Many gene families have been expanded by gene duplications along the human lineage, relative 4 to ancestral opisthokonts, but the extent to which the duplicated genes function similarly is 5 understudied. Here, we focused on structural cytoskeletal genes involved in critical cellular 6 processes including chromosome segregation, macromolecular transport, and cell shape 7 maintenance. To determine functional redundancy and divergence of duplicated human genes, we 8 systematically humanized the yeast actin, myosin, tubulin, and septin genes, testing ~85% of 9 human cytoskeletal genes across 7 gene families for their ability to complement a growth defect 10 induced by deletion of the corresponding yeast ortholog. -
SEPT2 Is a New Fusion Partner of MLL in Acute Myeloid Leukemia with T (2
Oncogene (2006) 25, 6147–6152 & 2006 Nature Publishing Group All rights reserved 0950-9232/06 $30.00 www.nature.com/onc ONCOGENOMICS SEPT2 is a new fusion partner of MLL in acute myeloid leukemia with t(2;11)(q37;q23) N Cerveira1, C Correia1, S Bizarro1, C Pinto1, S Lisboa1, JM Mariz2, M Marques2 and MR Teixeira1 1Department of Genetics, Portuguese Oncology Institute, Porto, Portugal and 2Department of Onco-Hematology, Portuguese Oncology Institute, Porto, Portugal We have identified a new mixed lineage leukemia (MLL) hematopoietic stem cells or progenitors (Daser and gene fusion partner in a patient with treatment-related Rabbitts, 2005; Li et al., 2005; Slany, 2005). Normally, acute myeloid leukemia (AML)presenting a HOX expression is high in hematopoietic stem cells and t(2;11)(q37;q23) as the only cytogenetic abnormality. becomes gradually extinguished during differentiation Fluorescence in situ hybridization demonstrated a re- (Grier et al., 2005). A failure to downregulate HOX arrangement of the MLL gene and molecular genetic expression inhibits hematopoietic maturation and can analyses identified a septin family gene, SEPT2, located lead to leukemia (Grier et al., 2005). on chromosome 2q37, as the fusion partner of MLL.RNA Abnormalities of 11q23 involving the MLL gene are and DNA analyses showed the existence of an in-frame found in several hematological malignancies, including fusion of MLL exon 7 with SEPT2 exon 3, with the acute lymphoblastic leukemia (ALL)and acute myeloid genomic breakpoints located in intron 7 and 2 of MLL leukemia (AML)(Huret, 2005).The overall incidence of and SEPT2, respectively. Search for DNA sequence MLL-associated leukemia is around 3 and 8–10% for motifs revealed the existence of two sequences with AML and ALL, respectively (Daser and Rabbitts, 94.4% homology with the topoisomerase II consensus 2005). -
Systematic Humanization of the Yeast Cytoskeleton Discerns Functionally Replaceable from Divergent Human Genes
HIGHLIGHTED ARTICLE | INVESTIGATION Systematic Humanization of the Yeast Cytoskeleton Discerns Functionally Replaceable from Divergent Human Genes Riddhiman K. Garge,* Jon M. Laurent,*,† Aashiq H. Kachroo,‡,1 and Edward M. Marcotte*,1 *Center for Systems and Synthetic Biology, Department of Molecular Biosciences, The University of Texas at Austin, Texas 78712, †Institute for Systems Genetics, Department of Biochemistry and Molecular Pharmacology, NYU Langone Health, New York 10016, and ‡The Department of Biology, Centre for Applied Synthetic Biology, Concordia University, Montreal, H4B 1R6 Quebec, Canada ORCID IDs: 0000-0002-6774-0172 (R.K.G.); 0000-0001-6583-4741 (J.M.L.); 0000-0001-9770-778X (A.H.K.); 0000-0001-8808-180X (E.M.M.) ABSTRACT Many gene families have been expanded by gene duplications along the human lineage, relative to ancestral opisthokonts, but the extent to which the duplicated genes function similarly is understudied. Here, we focused on structural cytoskeletal genes involved in critical cellular processes, including chromosome segregation, macromolecular transport, and cell shape maintenance. To determine functional redundancy and divergence of duplicated human genes, we systematically humanized the yeast actin, myosin, tubulin, and septin genes, testing 81% of human cytoskeletal genes across seven gene families for their ability to complement a growth defect induced by inactivation or deletion of the corresponding yeast ortholog. In five of seven families—all but a-tubulin and light myosin, we found at least one human gene capable of complementing loss of the yeast gene. Despite rescuing growth defects, we observed differential abilities of human genes to rescue cell morphology, meiosis, and mating defects. By comparing phenotypes of humanized strains with deletion phenotypes of their interaction partners, we identify instances of human genes in the actin and septin families capable of carrying out essential functions, but failing to fully complement the cytoskeletal roles of their yeast orthologs, thus leading to abnormal cell morphologies. -
Therapeutic Mir-21 Silencing Reduces Cardiac Fibrosis and Modulates Inflammatory Response in Chronic Chagas Disease
Therapeutic miR-21 silencing reduces cardiac fibrosis and modulates inflammatory response in chronic Chagas disease Carolina Kymie Vasques Nonaka1-3, Gabriela Louise Sampaio2,4, Luciana de Aragão França1,3, Bruno Raphael Ribeiro Cavalcante2, Katia Nunes Silva1-3, Ricardo Khouri2, Felipe Guimarães Torres2, Cássio Santana Meira2,4, Emanuelle de Souza Santos2,4, Carolina The Macedo2,4,5, Bruno Diaz Paredes1-3, Vinicius Pinto Costa Rocha2,4, Silvia Regina Rogatto5, Ricardo Ribeiro dos Santos2,4, Bruno Solano de Freitas Souza1-3, Milena Botelho Pereira Soares2,4* Supplementary material 1 Table S1. Predicted targets of miR-21-5p sorted by cumulative weighted context++ score by TargetScanHuman Total Ortholog of Gene name context++ target gene score C1orf143 chromosome 1 open reading frame 143 -0.85 ZNF367 zinc finger protein 367 -0.72 KHDC1L KH homology domain containing 1-like -0.71 ABHD12B abhydrolase domain containing 12B -0.69 CDR1as circular RNA CDR1as -0.68 KHDC1 KH homology domain containing 1 -0.68 HTN1 histatin 1 -0.66 KRIT1 KRIT1. ankyrin repeat containing -0.69 IL12A interleukin 12A (natural killer cell stimulatory factor 1. cytotoxic lymphocyte maturation factor 1. p35) -0.65 FASLG Fas ligand (TNF superfamily. member 6) -0.64 FGF18 fibroblast growth factor 18 -0.64 CCL1 chemokine (C-C motif) ligand 1 -0.64 CALCB calcitonin-related polypeptide beta -0.57 GPR64 G protein-coupled receptor 64 -0.55 AIM1L absent in melanoma 1-like -0.55 MTPN myotrophin -0.54 PLEKHA1 pleckstrin homology domain containing. family A (phosphoinositide binding specific) member 1 -0.54 RIOK1 RIO kinase 1 -0.52 RSAD2 radical S-adenosyl methionine domain containing 2 -0.52 TRAPPC2 trafficking protein particle complex 2 -0.53 ATXN10 ataxin 10 -0.57 LUM lumican -0.51 RPL36A ribosomal protein L36a -0.51 SCML2 sex comb on midleg-like 2 (Drosophila) -0.51 ALDH1A1 aldehyde dehydrogenase 1 family. -
Crucial Genes Associated with Diabetic Nephropathy Explored by Microarray Analysis Zhikui Wang, Zhaoxia Wang*, Zhongqi Zhou and Yueqin Ren
Wang et al. BMC Nephrology (2016) 17:128 DOI 10.1186/s12882-016-0343-2 RESEARCH ARTICLE Open Access Crucial genes associated with diabetic nephropathy explored by microarray analysis Zhikui Wang, Zhaoxia Wang*, Zhongqi Zhou and Yueqin Ren Abstract Background: This study sought to investigate crucial genes correlated with diabetic nephropathy (DN), and their potential functions, which might contribute to a better understanding of DN pathogenesis. Methods: The microarray dataset GSE1009 was downloaded from Gene Expression Omnibus, including 3 diabetic glomeruli samples and 3 healthy glomeruli samples. The differentially expressed genes (DEGs) were identified by LIMMA package. Their potential functions were then analyzed by the GO and KEGG pathway enrichment analyses using the DAVID database. Furthermore, miRNAs and transcription factors (TFs) regulating DEGs were predicted by the GeneCoDis tool, and miRNA-DEG-TF regulatory network was visualized by Cytoscape. Additionally, the expression of DEGs was validated using another microarray dataset GSE30528. Results: Totally, 14 up-regulated DEGs and 430 down-regulated ones were identified. Some DEGs (e.g. MTSS1, CALD1 and ACTN4) were markedly relative to cytoskeleton organization. Besides, some other ones were correlated with arrhythmogenic right ventricular cardiomyopathy (e.g. ACTN4, CTNNA1 and ITGB5), as well as complement and coagulation cascades (e.g. C1R and C1S). Furthermore, a series of miRNAs and TFs modulating DEGs were identified. The transcription factor LEF1 regulated the majority of DEGs, such as ITGB5, CALD1 and C1S. Hsa-miR-33a modulated 28 genes, such as C1S. Additionally, 143 DEGs (one upregulated gene and 142 downregulated genes) were also differentially expressed in another dataset GSE30528. -
Detection of Genes Influencing Chronic and Mendelian Disease Via Loss-Of-Function Variation
The Texas Medical Center Library DigitalCommons@TMC The University of Texas MD Anderson Cancer Center UTHealth Graduate School of The University of Texas MD Anderson Cancer Biomedical Sciences Dissertations and Theses Center UTHealth Graduate School of (Open Access) Biomedical Sciences 8-2015 Detection of Genes Influencing Chronic and Mendelian Disease via Loss-Of-Function Variation Alexander H. Li Follow this and additional works at: https://digitalcommons.library.tmc.edu/utgsbs_dissertations Part of the Bioinformatics Commons, Epidemiology Commons, Genetics Commons, and the Genomics Commons Recommended Citation Li, Alexander H., "Detection of Genes Influencing Chronic and Mendelian Disease via Loss-Of-Function Variation" (2015). The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Dissertations and Theses (Open Access). 622. https://digitalcommons.library.tmc.edu/utgsbs_dissertations/622 This Dissertation (PhD) is brought to you for free and open access by the The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences at DigitalCommons@TMC. It has been accepted for inclusion in The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Dissertations and Theses (Open Access) by an authorized administrator of DigitalCommons@TMC. For more information, please contact [email protected]. DETECTION OF GENES INFLUENCING CHRONIC AND MENDELIAN DISEASE VIA LOSS-OF-FUNCTION VARIATION by Alexander Hung Li, M.S. APPROVED: