Vibrio Vulnificus

Evolution of cps Loci in Vibrio vulnificus

Jana Neiman

A thesis submitted in conformity with the requirements for the degree of Master of Science Laboratory Medicine and Pathobiology University of Toronto

Evolution of cps Loci in V. vulnificus

Jana Neiman

Master of Science

Laboratory Medicine and Pathobiology University of Toronto

2011 Abstract

Vibrio vulnificus is an opportunistic human and animal pathogen with the highest death rate of any foodborne disease agent. The capsular polysaccharide (CPS) is essential for virulence.

Over 100 CPS types (carbotypes) have been identified among natural isolates, yet little is known about the genetic mechanisms that drive such diversity. Chitin, the second most abundant polysaccharide in nature, induces competence in Vibrio species. We found that transformation frequency varies by strain and (GlcNAc)2 was the shortest chitin-derived polymer capable of inducing competence. We confirmed that V. vulnificus can undergo chitin-dependent carbotype conversion following the uptake and recombination of complete cps loci from exogenous genomic DNA. The acquisition of a partial locus was also demonstrated when internal regions of homology between the endogenous and exogenous loci existed. Thus, the same mechanism governing the transfer of complete cps loci also contributes to their evolution by generating novel combinations of CPS biosynthesis genes.

Acknowledgments

Firstly, I would like to express my gratitude to my supervisor, Dr. Dean Rowe-Magnus, for his encouragement, guidance, patience and kindness. I’m very grateful to you for giving me the opportunity to work in your lab. Your expertise and direction have motivated and encouraged me to complete this thesis.

I would also like to thank all the current and past members of Dr. Rowe-Magnus’ lab for their help and friendship: Dr. Patrick Duriez, Lucy Duan, Jongbok Lee, Bobby Yu, Bella Kuchuk, Brad Wiggers and Linda Guo.

I would like to acknowledge members of my committee, Dr. Jeremy Mogridge and Dr. William Navarre, for their guidance and valuable suggestions.

Thank you to my parents, Felix and Ella and my brother, Daniel, for their constant love and support. Thank you for supporting and encouraging my aspiration for pursuing graduate studies.

Most importantly, I would like to thank my husband and my best friend, Yura Zenevich, for his love, support, patience and wisdom throughout this whole process. Thank you for putting up with me all this time.

iii

Table of Content Acknowledgments ...... iii

List of Tables ...... vii

List of Figures ...... viii

List of Appendices ...... ix

List of Abbreviations ...... x

CHAPTER 1 ...... 1

1 Literature review ...... 1 1.1 Capsular Polysaccharides (CPS) ...... 1 1.2 CPS Biosynthesis ...... 1 1.2.1 Group I and IV Wzy-dependent biosynthesis (Figure 1.1) ...... 1 1.2.2 Group II and III ABC transporter-dependent biosynthesis (Figure 1.2) ...... 3 1.3 LPS ...... 4 1.4 Polysaccharide diversity ...... 4 1.5 Horizontal gene transfer ...... 5 1.5.1 Modes of horizontal gene transfer ...... 5 1.5.2 Transduction ...... 6 1.5.3 Conjugation ...... 6 1.5.4 Transformation ...... 6 1.6 Natural competence ...... 6 1.6.1 DNA uptake in Gram-positive bacteria (Figure 1.3) ...... 7 1.6.2 DNA uptake in Gram-negative bacteria (Figure 1.4) ...... 8 1.6.3 Competence regulation ...... 10 1.6.4 Chitin-induced natural competence ...... 11 1.6.5 Regulation of chitin-induced natural competence ...... 11 1.6.6 Regulation of tfoX expression and translation ...... 13 1.7 Biofilm formation ...... 13 1.8 c-di-GMP ...... 14 1.8.1 c-di-GMP binding motifs ...... 15 1.8.2 The PilZ domain ...... 15 1.8.3 The I-site ...... 16 1.8.4 The FleQ protein ...... 16

1.8.5 The VpsT protein ...... 16 1.8.6 c-di-GMP riboswitches ...... 16 1.9 Vibrio vulnificus ...... 17 1.9.1 V. vulnificus virulence factors ...... 18 1.9.2 Iron-acquisition ...... 18 1.9.3 Hemolysin/cytolysin and metalloprotease ...... 19 1.9.4 Flagella ...... 19 1.9.5 LPS ...... 19 1.9.6 CPS ...... 20 1.9.7 CPS diversity in V. vulnificus ...... 20 1.9.8 Evidence for the horizontal transfer of cps loci in V. vulnificus ...... 21 1.9.9 Novel cps locus in V. vulnificus ...... 23 1.9.10 Chitin-induced natural transformation in V. vulnificus ...... 25 1.9.11 c-di-GMP regulated biofilm formation in V. vulnificus ...... 25

CHAPTER 2 ...... 26

2 Hypotheses and objectives ...... 26

CHAPTER 3 ...... 27

3 Chitin-induced carbotype conversion in Vibrio vulnificus ...... 27 3.1 Abstract ...... 27 3.2 Introduction ...... 28 3.3 Materials and Methods ...... 29 3.4 Results ...... 36 3.5 Discussion ...... 47 3.6 Conclusion and future directions ...... 49

APPENDIX ...... 51

A Carbotype conversion and pathogenicity in V. vulnificus ...... 51 A.1 Background ...... 51 A.2 Hypothesis and Objective ...... 51 A.3 Methods and Materials ...... 52 A.4 Results ...... 52 A.5 Discussion and future direction ...... 54

B c-di-GMP regulates chitin-dependent competence in V. vulnificus ...... 55

B.1 Background ...... 55 B.2 Hypothesis and objective ...... 55 B.3 Materials and Methods ...... 56 B.4 Results ...... 59 B.5 Discussion ...... 64 B.6 Future work ...... 65

C Characterization of novel CPS biosynthesis enzymes from V. vulnificus strain 27562 . 66 C.1 Background ...... 66 C.2 Hypothesis and objective ...... 66 C.3 Materials and methods ...... 67 C.4 Results ...... 69 C.5 Discussion ...... 74 C.6 Future work ...... 75

References ...... 77

List of Tables

Table 3.1 Bacterial strains used in this study 29 Table 3.2 All primers sequences used in this study 31 Table 3.3 Transformation frequencies of V. vulnificus strains on crab shells 39 Table B.1 Bacterial strains used in this study 56 Table B.2 All primers sequences used in this study 57 Table C.1 Bacterial strains used in this study 67 Table C.2 All primers sequences used in this study 67

vii

List of Figures

Figure 1.1 Model for the biosynthesis and assembly of group I and IV capsules 2 Figure 1.2 Model for the biosynthesis and assembly of group II and III capsules 3 Figure 1.3 DNA uptake machinery required for transformation in Bacillus 8 subtilis Figure 1.4 Machinery required for type IV pilus formation and transformation in 9 Neiserria gonorrhoeae Figure 1.5 c-di-GMP synthesis and hydrolysis 15 Figure 1.6 A c-di-GMP riboswitch from Vibrio cholerae 17 Figure 1.7 Comparative analysis of the cps loci of V. vulnificus strains 22 Figure 1.8 The cps locus of V. vulnificus 27562 is conserved in S. putrafaciens 23 200 Figure 1.9 Structure of capsular polysaccharide of V. vulnificus strain 27562 24 Figure 1.10 Genetic organization of the cps locus of V. vulnificus strain 27562 24 Figure 3.1 Chitin-induces natural transformation in V. vulnificus 38 Figure 3.2 Composition of V. vulnificus biofilms grown on crab shells 39 Figure 3.3 Changes in V. vulnificus biofilm composition in response to lytic 41 phage Figure 3.4 Tracking the transfer of complete and partial cps loci 44 Figure 3.5 Chitin-induced transfer of the 27562 cps locus to CMCP6 45 Figure 3.6 Generation of hybrid cps loci by chitin-induced natural 46 transformation Figure 3.7 Model of the proposed regulatory networks controlling natural 50 competence in V. vulnificus Figure A.1 Survival in human serum of CMCP6 strains producing different 53 carbotypes Figure B.1 Biofilm formation by the wild type and brpF mutant 61 Figure B.2 Decreased c-di-GMP levels inhibit biofilm formation by V. vulnificus 62 Figure C.1 Protein expression vector pC2XTHIS 70 Figure C.2 Western blot following over-expression of CppA (40kDa) 71 Figure C.3 Purification of WcvD (31kDa) 72 Figure C.4 TLC analysis of oligosaccharide formed in vitro by the action of 73 WcvD and WcvE

viii

List of Appendices

Appendix A Carbotype conversion and pathogenicity in V. vulnificus 51 Appendix B c-di-GMP regulates chitin-dependent competence in V. vulnificus 55 Appendix C Characterization of novel polysaccharide biosynthesis enzymes 66 from V. vulnificus strain 27562

List of Abbreviations

ABC ATP-binding-cassette ATP adenosine tri-phosphate BSA bovine serum albumin cAMP cyclic adenosine monophosphate c-di-GMP cyclic di-GMP CFU colony forming units CPS capsular polysaccharide CRP catabolic activator protein CSP competence stimulating peptide dNTP deoxynucleotide triphosphate GalA galacturonic acid DGC diguanylate cyclase EDTA ethylene diaminetetraacetic acid EPS exopolysaccharide gDNA genomic DNA GlcNAc N-acetylglucosamine GT glycosyltransferase GTP guanosine triphosphate HGT horizontal gene transfer I domain inhibitory domain IO Instant Ocean IP intraperitoneal IPTG isopropyl-D-1-thiogalactopyranoside IS insertion sequence GEMM genes for environment, membranes and mobility HPLC High-Pressure Liquid Chromatography JUMPStart just upstream of many polysaccharide-associated gene starts LB Luria Betrani LD lethal dose LPS lipopolysaccharide MurNAc n-acetylmuramic acid OD optical density OMA outer membrane auxiliary protein family PBMC primary human peripheral blood mononuclear cells PCR polymerase chain reaction PDE phosphodiesterase pGpG 5’-phosphoguanylyl-(3’-5’)-guanosine PMN polymorphonuclear leukocytes PVDF polyvinylidene difluoride Rha rhamnose SDS-PAGE sodium deodecyl sulphate polyacrylamine gel electrophoresis TCE transcriptional control element TF transformation frequency TLE translational control element Tn Transposon x

Und-PP undecaprenyl phosphate UDP uridine diphosphate Wt wild type

Domain acronyms EAL Glu-Ala-Leu GGDEF Gly-Gly-Asp-Glu-Phe RXXD Arg-X-X-Asp

Antibiotics Ap ampicillin Cm chloramphenicol Km kanamycin Rif rifampicin

xi 1

CHAPTER 1

1 Literature review 1.1 Capsular Polysaccharides (CPS)

Capsular polysaccharide (CPS) is associated with the outer membrane of bacteria and is thought to provide a barrier between the bacteria and the environment [1]. CPS also mediates adhesion to a variety of surfaces, including living tissues. CPS promotes resistance to phagocytosis and complement-mediated lysis and is thus important in host colonization and virulence, as it allows the bacteria to evade the immune system during infection [2]. CPS is composed of repeating monosaccharide units linked together by glycosidic bonds, and an incredibly diverse range of branched and modified CPS molecules is possible. The CPS is synthesized and assembled by a series of proteins that are encoded by genes clustered in specific biosynthesis loci. CPS can be classified into four groups based on sugar composition, genetic organization and assembly pathway [1].

1.2 CPS Biosynthesis

1.2.1 Group I and IV Wzy-dependent biosynthesis (Figure 1.1)

Group I CPS, is mainly composed of hexuronic acids and neutral sugars, and utilizes the wzy- dependent biosynthesis pathway. Group IV CPS, is mainly composed of hexauronic acids and N- acetylated hexoamines and also involves wzy-dependent biosynthesis pathway. The biosynthesis of the Group I and IV parallels O-antigen biosynthesis of lipopolysaccharide (LPS). Synthesis begins at the cytoplasm near the inner membrane where a sugar repeat unit is synthesized from activated sugar precursors (UDP-sugars) by glycosyltransferases [3]. The inner membrane- spanning initiating glycosyltransferase (WbaP in group I CPS biosynthesis and WecA in group IV biosynthesis) catalyzes the transfer of the first sugar in the repeat unit to a lipid carrier, undecaprenyl diphosphate (und-PP). The remaining sugar subunits are added by monofunctional glycosyltransferase that are specific for each CPS type. The lipid-linked sugar repeat subunit is then flipped across the inner membrane by a flippase, Wzx. Polymerization of CPS is catalyzed

2 by a polymerase, Wzy, and is exported through an outer membrane-spanning channel that is formed by the Wza protein. Transphosphorylated Wzc and its phosphatase Wzb, also participate in the export of the growing CPS chain. In Group I CPS biosynthesis, an additional outer C. Whitfield, A. Paiment / Carbohydrate Research 338 (2003) 2491Á/2502 2495 membrane protein, Wzi regulates the length of the CPS chain. The genetic organization of Group I and Group IV capsule biosynthesis systems also differs [1]. Group I biosynthesis loci are comprised of two regions separated by a putative stem-loop transcription attenuator and the 5’ part of the loci contain the conserved wzi, wza, wzb and wzc genes. In Group IV biosynthesis loci, the genes wza, wzb, and wzc are found in a separate region on the chromosome from the rest of the cps locus.

Fig. 2. Biosynthesis of the Group 1 CPS in E. coli K30. Panel A shows the proposed pathway for synthesis of lipid-linked K30 repeat units. The assignment of glycosyltransferases catalyzing individual steps is the product of sequence data and preliminary biochemical investigations.30 Glycosyltransferases and enzymes involved in the synthesis of sugar nucleotide precursors are identified in boxes. GalE is UDP-galactose-4-epimerase; ManBC are phosphomannomutase©2003 and Pergamon GDP-mannose pyropho- sphorylase, respectively; and Ugd is UDP-glucose dehydrogenase. The carrier lipid is presumed to be undecaprenyl phosphate (und-P), consistent with the many other systems that have been investigated. Panel B shows a cartoon depicting a hypothetical biosynthetic complex carrying out a coordinated sequence of reactions. (1) The glycosyltransferase (WbaP, WbaZ, WcaO and Figure 1.1 ModelWcaN) reactions for gi vtheen in panelbiosynthesis A synthesize lipid-linked and repeat assembly units at the cytoplasmic of G faceroup of the innerI and membrane. IV (2) capsules. The und- Beginning PP-linked repeat units are flipped across the inner membrane by a process involving Wzx. (3) The repeat units are polymerized through a reaction requiring Wzy. (4) Wzc function is essential for high-level polymerization. (5) Wzc function is mediated by at the left, autophosphorylation und-PP-linked followed repeat by transphosphorylation units are between assembled proteins in an oligomeric by form. glycosyltra (6) Dephosphorylationnsferases of Wzc by (GTs) at the the Wzb phosphatase is also crucial for CPS synthesis. (7) Export of polymer to the surface requires the outer membrane Wza complex, perhaps playing the role of an export channel. (8) The nascent CPS is assembled on the cell surface and Wzi is required for interface betweenefficient encapsulation. the cytoplasm Details of each and biosynthetic the stepinner are described membrane in the text. It(1) is uncertain. Newly whether synthesized other housekeeping und-PP-linked functions also participate in the overall process. repeats are then flipped across the inner membrane in a process requiring Wzx (2). This provides the substrates for Wzy-dependent polymerization wherein the polymer grows by transfer of the growing chain to the incoming und-PP-linked repeat unit (3). Continued polymerization requires transphosphorylation of C-terminal tyrosine residues in the Wzc oligomer and dephosphorylation by the Wzb phosphatase (4 – 6). The polymer is exported by Wza (7), which likely acts as a channel. Wzi is unique to Group 1 capsules and appears to be involved in modulating surface association (8). Adapted from “Biosynthesis and assembly of group I capsular polysaccharides in

Escherichia coli and related extracellular polysaccharides in other bacteria” by Whitfield, C and Paliment A, 2003, Carbohydrate Research, 338, p. 2491-2502. Copyright 2003 by Pergamon. Reprinted with permission [3]

1.2.2 Group II and III ABC transporter-dependent biosynthesis (Figure 1.2)

Group II CPS is mainly composed of hexuronic acids, sialic acids, and neutral or amino sugars. Group II biosynthesis is thermo-regulated and requires an ABC transporter-dependent pathway to be assembled. Group III CPS shares common sugar composition with Group II and also requires the ABC transporter-dependent biosynthesis pathway. Biosynthesis of Group II and III capsules in E. coli10 is performedDavid Corbett by and Ianproteins S. Roberts encoded by the kps locus [1]. Biosynthesis begins at the cytoplasm near the inner membrane. The CPS polymer is synthesized by monofunctional 2 message is produced by read-through transcription from PR3, generat- glycosyltransferasesing a that polycistronic use activated transcript sugarcontaining precursors both the regions (UDP 3 and-sugars). 2 genes The polymer is first (Stevens et al., 1997). linked to an unknown endogenous acceptor but later transferred to diacylglycerophosphate that is B. Biosynthesis of E. coli Group 2 capsular polysaccharides embedded in the inner membrane. The growing polymer is then exported across the inner Synthesis of Group 2 capsular polysaccharides occurs on the inner face of membrane by the ABCthe cytoplasmic transporter membrane system (Roberts, that 1996 is ).composed The current modelof, KpsM for capsule and KpsT. The export also synthesis is one that is linked to polysaccharide export via a hetero- involves the accessoryoligomeric proteins, synthesis-export KpsS, complexKpsC, ofKpsF the regionand KpsU. 2 proteins The KfiABC precise functions of these and D bound to the bacterial inner membrane together with the Kps proteins are unknown.export proteins Translocation which span of CPSthe periplasm across andthe outerperiplasm membrane and the outer membrane (Fig. 1.2)(McNulty et al., 2006; Rigg et al., 1998; Whitfield, 2006). In serotype K1, the polysialic acid capsule is synthesized from activated requires the membraneUDP-NeuNAc-spanning acid proteins, produced KpsE from N -acetylmannosamineand KpsD. (ManNAc)

KpsF KpsU KfiD KfiC KfiB KfiA Outer UDP-Glc UDP-GlcA/GlcA membrane UDP-GlcNAc/GlcNAc Membrane acceptor Periplasm KpsC D KpsS Inner Kdo membrane KpsT

KpsM B ATP ATP ADP ADP C KpsE A

Ru5P A5P KpsD

FIGURE 1.2 Synthesis and export of the K5 capsular polysaccharide. Synthesis© of2008 the K5 Elsevier polysaccharide occurs on the inner face of the cytoplasmic membrane (A) by successive transfer of GlcA and GlcNAc residues at the nonreducing end of the nascent polysaccharide by KfiC and KfiA. KpsF converts ribulose 5-phosphate (Ru5P) to arabinose Figure 1.2 Model5-phosphate for the (A5P), biosynthesis which is an intermediate and assembly in the production of of G CMP-Kdoroup byII KpsU and (B) III capsules. Example KpsS and KpsC are believed to play a role in the transfer of Kdo to the reducing terminus of synthesis and exportof the finished of the polysaccharide, K5 capsular and initiation polysaccharide of polymer export. Transportin E. coli across Group the II. Synthesis of the cytoplasmic membrane is achieved by KpsM and KpsT (C), whilst transport to the cell K5 polysaccharidesurface occurs requires on KpsE the and KpsD inner (D). (See face Color of Plate the Section cytoplasmic in the back of the membrane book.) (A) by successive

4 transfer of GlcA and GlcNAc residues at the nonreducing end of the nascent polysaccharide by KfiC and KfiA. KpsF converts ribulose 5-phosphate (Ru5P) to arabinose 5-phosphate (A5P), which is an intermediate in the production of CMP-Kdo by KpsU (B) KpsS and KpsC are believed to play a role in the transfer of Kdo to the reducing terminus of the finished polysaccharide, and initiation of polymer export. Transport across the cytoplasmic membrane is achieved by KpsM and KpsT (C), whilst transport to the cell surface requires KpsE and KpsD (D). Adapted from “Capsular polysaccharides in Escherichia coli” by Corbett, D. and Roberts I.S., 2008, Advances in Applied Microbiology, 65, p. 1-26. Copyright 2008 by Elsevier Limited. Reprinted with permission [4].

1.3 LPS

LPS is another type of polysaccharide that is associated with the surface of bacteria [5]. LPS is the major component of Gram-negative cell wall. It is composed of a conserved lipid A moiety, a core polysaccharide and a diverse O- antigen. Lipid A is the bioactive component of LPS. It is the main mediator of endotoxic shock in humans and animals. Lipid A can lead to over- production of cytokines, extensive tissue damage, multiple organ failure and loss of circulation [6]. The core and O-antigens are composed of monosaccharides [5]. In most species the core polysaccharide is conserved while the O-antigen can be incredibly diverse.

The biosynthesis of the LPS begins with the synthesis of lipid A at the cytoplasmic face of the inner membrane [7]. The core is a short oligosaccharide that is synthesized by glycosyltransferases and is attached to lipid A [8]. The structure is then delivered to the periplasmic side of the inner membrane by an ATP transporter system [5]. Two systems exist for the synthesis of the O-antigen: the Wzy dependent pathway and the ABC transporter-dependent pathway.

1.4 Polysaccharide diversity

The diverse genetic variation of polysaccharide loci that exist between the same bacterial species has been speculated to be due to the transfer of genetic material between species, in the process called horizontal gene transfer (HTG). Perhaps the best-known example is that of V. cholerae. Until 1992, V. cholerae serotype O1 strains were responsible for the global epidemic and endemic cholera outbreaks [9]. However, in 1992 a new strain (O139) began causing lethal

5 infections in Asia. The V. cholerae O139 serotype emerged from the O1 serotype through the replacement of a 22 kb O-antigen region by a 40 kb O139-specific O-antigen DNA fragment [9, 10]. Capsular diversity in Streptococcus pneumoniae and Campylobacter jejuni is also suspected to be due to HGT [11, 12], and variation in LPS loci has also been documented in Pseudomonas aeruginosa, and Xanthomonas oryzae [13, 14].

1.5 Horizontal gene transfer

In 1928, Frederick Griffith was one of the first scientists to demonstrate that bacteria can undergo transformation and acquire new traits by HGT [15]. His experiment with Streptococcus pneumoneae demonstrated that when a heat-killed virulent smooth (S) capsule type was pre- incubated with a viable but non-virulent rough (R) capsule type prior to injection in mice, the non-virulent R variant became pathogenic and acquired the smooth phenotype of its donor. He called this phenomenon the ‘transformation principle’ or ‘transformation factor’. However, it was not until the 1950s, when multi-drug resistant pathogens began to emerge, that scientist started to truly recognize the impact of HGT [16]. Comparative genomics analyses of many prokaryotic species demonstrated that HGT can play a major role in the evolution of their genomes [16, 17].

There are several methods that can be used to monitor horizontal gene transfer between species. Two of these methods are phylogenetic distribution analysis and assessment of GC genome content [16-18]. Phylogenetic distribution analysis is an approach that examines the evolutionary relationship of different members based on their DNA genome sequences. The tree can be constructed to illustrate the evolutionary relationships of lineage members. GC assessment studies involve the evaluation of GC content of specific gene(s) versus the average GC content of the genome. The GC content varies between each bacterial species and its variation within genes, compared to the whole genome, may be attributable to HGT.

1.5.1 Modes of horizontal gene transfer

In order to transfer genetic material from species to species three conditions must be encountered: 1) donor material must be successfully delivered into the recipient cell, 2) the genetic material must replicate autonomously or be incorporated into recipient’s genome and 3)

6 effective expression of acquired genetic material [16, 18]. There are three known mechanisms involved in horizontal gene transfer: transduction, conjugation and transformation.

1.5.2 Transduction

Transduction is the transfer of genetic material between bacterial species that is mediated by bacteriophages [19, 20]. Phages are able to propagate bacterial DNA between species by packaging random donor DNA (generalized transduction) or DNA adjacent to the phage attachment sites (specialized transduction). This process does not require the bacterial species to be present in the same place or time and can involve the transfer of genetic material of up to 100 kilobases in length [16].

1.5.3 Conjugation

Conjugation is the transfer of genetic material from donor to recipient that is mediated by a plasmid [21]. The plasmid involved in this process is either a self-transmissible plasmid, mobilizable plasmid or a plasmid that has been integrated into a chromosome (e.g. Hfr strains). During conjugation the donor cell produces a pilus that attaches to the recipient and brings the two cells together. The plasmid is then nicked and one strand of the DNA is transferred to the recipient. The single-stranded DNA of the plasmid is reconstituted in the donor and the recipient to regenerate the double-stranded plasmid.

1.5.4 Transformation

Transformation is the uptake of naked DNA from the environment and its incorporation into the genome by homologous recombination [22, 23]. This process usually involves the transfer of genetic material between similar species. Not all bacterial species are able to undergo natural transformation and some even require the presence of specific recognition sequences on the donor DNA (see below).

1.6 Natural competence

As stated above, natural competence is the ability of prokaryotes to take up exogenous DNA and undergo genetic transformation [24]. Numerous Gram-negative and Gram-positive bacterial species are known to be naturally transformable. The transformation process involves: 1) the binding of DNA to the membrane, 2) translocation of DNA across the membrane and 3)

7 homologous recombination of DNA into the chromosome. The process of DNA uptake differs between Gram-positive and Gram-negative species.

1.6.1 DNA uptake in Gram-positive bacteria (Figure 1.3)

The best-known models for studying DNA uptake in Gram-positive organisms are Bacillius subtilis and Streptococcus pneumoniae [22, 23]. The first step in DNA uptake is the binding of DNA to the membrane of the organism. The uptake of DNA between Gram-positive and Gram- negative bacteria differs because of the extra outer membrane present in Gram-negative species. In Gram-positive organisms, DNA must surpass the thick layer of peptidoglycan and bind to the cytoplasmic membrane. Both B. subtilis and S. pneumoniae bind DNA without base sequence preferences. The proteins involved in the initial DNA binding step resemble the sequence and structure of the proteins associated with the biosynthesis and assembly of type IV pili and type II secretion systems. These include, the major pseudopilin protein ComGC and minor pilins, ComGD, ComGE and ComGG. The prepilins are processed into mature pilins by the prepilin peptidase, ComC. The assembly of the pilus also involves the membrane protein ComGB and the traffic NTPase, ComGA. It is postulated that pseudopilus assembly allows the incoming DNA to access the membrane bound DNA receptor protein ComEA. Once bound, the DNA is cleaved by the NucA nuclease, which introduces double stranded breaks. The permease/channel protein, ComEC, and the ATP binding protein, ComFA, mediate translocation of the DNA across the inner membrane. ComEC forms a pore that allows the cleaved DNA to pass through. This process is driven by ATP-hydrolysis performed by ComFA. The incoming DNA is then separated into single strands by the endonuclease, EndA. The translocated single stranded DNA can then be integrated by homologous recombination into the chromosome in a RecA-dependent process. Self-replicating plasmids are reconstituted and maintained.

REVIEWS

a Type II secretion b Type IV pilus c Competence d Competence Klebsiella oxytoca Neisseria Neisseria gonorrhoeae Bacillus subtilis gonorrhoeae

PilC DR PulD PilQ Outer membrane PulS PilP

Periplasm Assembly Disassembly ComE

ComEA Inner membrane Com PulF Sec PilG ComA ComEC PulO PilD Com GB C PulE PilF PilT ComFA ComGA Pullulanase

Figure 1 | Comparison of machinery required for type II secretion, type IV pilus formation and transformation in Gram-negative and Gram-po©2004sitive Nature Publishing Group bacteria. a | A schematic model for type II secretion, based on the pullulanase secretion system (Pul) from Klebsiella oxytoca. Not all components are represented. The pseudopilins, both major (PulG; orange) and minor (PulH,-I,-J and -K; red), are processedFigure by 1.3the prepilinDNA uptakepeptidase machinery (PulO), and assembled required forinto the transformation pseudopilus. in Bacillus subtilis. The The polytopic membrane protein (PulF) and the traffic NTPase (PulE) participate in the process.major pseudopilinPullulanase (brown) (orange) is secreted and minor into pseudopilins the periplasm (blue)by the Secare processedsystem, by the prepilin peptidase and crosses the outer membrane through a channel that is formed by the secretin (PulD), with the assistance of its pilot protein (PulS). b | A schematic model for type IV pilus formation, based on the Neisseria gonorrhoeae pilus. The major pilin (PilE; orange)(ComC) and minor and pilin assemble (PilV; magenta)d into the are pseudopilus. processed by The the prepilinpolytopic peptidase membrane (PilD), protein (ComGB) and the and assembled into the pilus fibre. The polytopic membrane protein (PilG) and the traffic NTPase (PilF) participate in this process. The outer-membrane/tip-located traffic NTPase (ComGA) participate in this process. The pseudopilus allows the exogenous DNA protein (PilC) stabilizes the assembled filament. The pilus crosses the outer membrane through a channel that is formed by the secretin (PilQ), with the assistance of its pilot protein (PilP). A second traffic NTPase (PilT) mediates the depolymerization of the pilusto access into pilin its monomers membrane and-bound consequ receptorent retraction (ComEA), of the which pilus. cdelivers| A schematic the bound DNA to the channel model for the competence pseudopilus and DNA translocase in N. gonorrhoeae. Assembly of the pseudopilus requires the same components as the type IV pilus at the cytoplasmic membrane (ComEC). An ATP-binding protein (ComFA) is involved in DNA (shown in part b). The major pilin (PilE; orange) and minor pilin (ComP; blue) are processed by the prepilin peptidase (PilD), and assembled into the pseudopilus. The polytopic membrane protein (PilG) and the traffic NTPase (PilF) participate in this process,transport as well as across PilC (not the shown). membrane. The specific Adapted sequence from in Adaptedthe exogenous from DNA “DNA uptake during bacterial that is required for efficient uptake is recognized by its postulated, but as-yet-unidentified, receptor (DR). The incoming DNA is transported across the outer membrane through a channel that is formed by the secretin (PilQ), with the assistance of its pilot proteintransformation (PilP). The periplasmic” by Chen DNA-b I. andinding Dubnau protein D., (ComE) 2004, is Nature involved Reviews in uptake, in Microbiology, 2, p. 241- and delivers the DNA to the channel at the cytoplasmic membrane (ComA). One strand 249.enters Copyr the cytosol;ight 2004 the otherby Nature is degraded Publishing and the G roup.degradation Reprinted products with are permission [23]. released into the periplasmic space. d | A schematic model for the competence pseudopilus and DNA translocase in Bacillus subtilis. The major pseudopilin (ComGC; orange) and minor pseudopilins (ComGD, -GE and -GG; blue) are processed by the prepilin peptidase (ComC), and assembled into the pseudopilus. The polytopic membrane protein (ComGB) and the traffic NTPase (ComGA) participate in this process.1.6.2 The pseudopilus DNA allows uptake the exogenousin Gram- DNAnegative to access bacteria its membrane-bound (Figure 1.4) receptor (ComEA), which delivers the bound DNA to the channel at the cytoplasmic membrane (ComEC). An ATP-binding protein (ComFA) is involved in DNA transport across the membrane. One strand enters the cytosol, while the other is degradedHaemophilus and the degradation influenzae products and Neisseria are released gonorrhoeae into the extracellular are the milieu.two model organisms for studying DNA uptake in Gram-negative species [22, 23]. The uptake of DNA in H. influenzae requires the presence of specific uptake sequences. These sequences are located throughout the bacterial DNA53. In fact, there is considerable evidence that pili competence and piliation. In N. gonorrhoeae (FIG. 1; genome and are often found as inverted repeats between genes. Type IV pilus biosynthesis and are not necessary for transformation in N. gonorrhoeae, TABLE 1), these would include: the major pilin (PilE), although the expression of pilin is abassemblysolutely proteinsthe arepre alsopili ninvolved peptid ains ethe (P DNAilD) ,uptakethe tr machineryaffic NTP inas Grame -negative organisms. required54–56. Other competent organisms,Thesuc h major as PilE(P andilF) , minorthe p o ComPlytop prepic mielinsmb areran processede protein by(P i thelG) , prepilinthe peptidase, PilD, into H. influenzae or the Gram-positive bacteria B. subtilis secretin (PilQ) with its pilot protein (PilP), and the mature pilins that form the psuedopilus. The assembly also involves the traffic NTPase, PilF, a and S. pneumoniae, require similar genes for DNA pilus-stabilizing protein (PilC). We favour the existence uptake, but do not possess filamentous structupolytopicres that membraneof a co protein,mpeten PilG,ce ps ae usecretin,dopilu sPilQ, as a sat rpilotuct uprotein,re that PilPis and a pilus stabilizing extend from the cell surface. distinct from the T4P, albeit closely related, for several It has been proposed that a competence pseu dopilus reasons. Various observations indicate that the presence — a structure similar to T4P — participates in the trans- of functional T4P and the ability to take up DNA have port of DNA during transformation57. This putative different requirements — for example, the existence of structure would be present in both Gram-negative and pilin variants that cannot assemble efficiently into a Gram-positive bacteria. The proposed function of the pilus fibre, but can still support transformation, and competence pseudopilus is to bring exogenous DNA to the requirement for the presence of minor pilins for the transport machinery that is located at the cytoplasmic competence but not for T4P formation58–60. The major membrane. In organisms with T4P, the pseudopilus pilin should be a structural component of both T4P and would be assembled using the same components as the the competence pseudopilus; the minor pilins could be pilus, thereby accounting for the correlation between important in determining which structure is formed.

2 4 4 | MARCH 2004 | VOLUME 2 www.nature.com/reviews/micro 9

protein, PilC. It is postulated that DNA uptake starts with exogenous DNA being recognized by as of yet-unidentified protein receptor. This receptor directs the DNA to a secretin pore formed by PilQ. PilQ permits the DNA to be translocated across the outer membrane. The pilot protein, PilP, facilitates the translocation process. Once in the periplasm, the DNA binds to the periplasmic DNA binding receptor, ComE. The receptor propagates the DNA to the cytoplasmic pore membrane protein, ComA. One strand of the DNA is degraded by an unidentified endonuclease. The single stranded DNA is then translocated across the inner membrane. The

REVIEWSnewly acquired strand is then integrated into the chromosome by RecA-mediated recombination.

a Type II secretion b Type IV pilus c Competence d Competence Klebsiella oxytoca Neisseria Neisseria gonorrhoeae Bacillus subtilis gonorrhoeae

PilC DR PulD PilQ

Outer membrane PulS PilP

Periplasm Assembly Disassembly ComE

ComEA Inner membrane Com PulF Sec PilG ComA ComEC PulO PilD Com GB C PulE PilF PilT ComFA ComGA Pullulanase

Figure 1 | Comparison of machinery required for type II secretion, type IV pilus formation and transformation in Gram-negative and Gram-positive bacteria. a | A schematic model for type II secretion, based on the pullulanase secretion system (Pul)©2004 from Klebsiella Nature oxytoca Publishing. Not all components Group are represented. The pseudopilins, both major (PulG; orange) and minor (PulH,-I,-J and -K; red), are processed by the prepilin peptidase (PulO), and assembled into the pseudopilus. The polytopic membrane protein (PulF) and the traffic NTPase (PulE) participate in the process. Pullulanase (brown) is secreted into the periplasm by the Sec system, andFigure crosses the 1.4 outer Machinerymembrane through a requiredchannel that is formed for byT theype secretin IV (PulD), pilus with the assistance formation of its pilot andprotein (PulS). transformation b | A schematic model for in type IV pilus formation, based on the Neisseria gonorrhoeae pilus. The major pilin (PilE; orange) and minor pilin (PilV; magenta) are processed by the prepilin peptidase (PilD), andNeiserria assembled into gonorrhoeae. the pilus fibre. The polytopic The membrane major protein pilin (PilG) (orange) and the traffic and NTPase minor (PilF) participate pilin in (blue) this process. are The processed outer-membrane/tip-located by the protein (PilC) stabilizes the assembled filament. The pilus crosses the outer membrane through a channel that is formed by the secretin (PilQ), with the assistance of its pilot protein (PilP). A second traffic NTPase (PilT) mediates the depolymerization of the pilus into pilin monomers and consequent retraction of the pilus. c | A schematic modelprepilin for the competencepeptidase pseudopilus (PilD) and and DNA translocaseassembled in N. gonorrhoeae into the. Assembly pseudopilus. of the pseudopilus The requires polytopic the same componentsmembrane as the protein type IV pilus (shown in part b). The major pilin (PilE; orange) and minor pilin (ComP; blue) are processed by the prepilin peptidase (PilD), and assembled into the pseudopilus. The polytopic(PilG) membrane and the protein traffic (PilG) and NTPase the traffic NTPase (PilF) (PilF) participate participate in this process, in this as well process, as PilC (not shown). as well The s pecific as PilC.sequence The in the exogenous specific DNA that is required for efficient uptake is recognized by its postulated, but as-yet-unidentified, receptor (DR). The incoming DNA is transported across the outer membrane throughsequence a channel in that theis formed exogenous by the secretin (PilQ), DNA with the that assistance is required of its pilot protein for (PilP). efficient The periplasmic uptake DNA-binding is protein recognized (ComE) is involved by in itsuptake, and delivers the DNA to the channel at the cytoplasmic membrane (ComA). One strand enters the cytosol; the other is degraded and the degradation products are released into the periplasmic space. d | A schematic model for the competence pseudopilus and DNA translocase in Bacillus subtilis. The major pseudopilin (ComGC; orange)postulated, and minor pseudopilinsbut as yet (ComGD, unidentified, -GE and -GG; blue) receptor. are processed The by the incoming prepilin peptidase DNA (ComC), is and transported assembled into th eacross pseudopilus. the The outer polytopic membrane protein (ComGB) and the traffic NTPase (ComGA) participate in this process. The pseudopilus allows the exogenous DNA to access its membrane-bound rmembraneeceptor (ComEA), through which delivers a the channel bound DNA that to the channelis formed at the cytoplasmic by the membranesecretin (ComEC). (PilQ), An ATP-binding with the protein assistance (ComFA) is involved of its in DNApilot transport across the membrane. One strand enters the cytosol, while the other is degraded and the degradation products are released into the extracellular milieu. protein (PilP). The periplasmic DNA-binding protein (ComE) is involved in uptake, and delivers

the DNA to the channelDNA at53. Ithen fac tcytoplasmic, there is conside rmembraneable evidence t h(ComA).at pili c oOnempet estrandnce and pentersiliation .theIn N cytosol,. gonorrho etheae (F IG. 1; are not necessary for transformation in N. gonorrhoeae, TABLE 1), these would include: the major pilin (PilE), although the expression of pilin is absolutely the prepilin peptidase (PilD), the traffic NTPase required54–56. Other competent organisms, such as (PilF), the polytopic membrane protein (PilG), the H. influenzae or the Gram-positive bacteria B. subtilis secretin (PilQ) with its pilot protein (PilP), and the and S. pneumoniae, require similar genes for DNA pilus-stabilizing protein (PilC). We favour the existence uptake, but do not possess filamentous structures that of a competence pseudopilus as a structure that is extend from the cell surface. distinct from the T4P, albeit closely related, for several It has been proposed that a competence pseudopilus reasons. Various observations indicate that the presence — a structure similar to T4P — participates in the trans- of functional T4P and the ability to take up DNA have port of DNA during transformation57. This putative different requirements — for example, the existence of structure would be present in both Gram-negative and pilin variants that cannot assemble efficiently into a Gram-positive bacteria. The proposed function of the pilus fibre, but can still support transformation, and competence pseudopilus is to bring exogenous DNA to the requirement for the presence of minor pilins for the transport machinery that is located at the cytoplasmic competence but not for T4P formation58–60. The major membrane. In organisms with T4P, the pseudopilus pilin should be a structural component of both T4P and would be assembled using the same components as the the competence pseudopilus; the minor pilins could be pilus, thereby accounting for the correlation between important in determining which structure is formed.

2 4 4 | MARCH 2004 | VOLUME 2 www.nature.com/reviews/micro 10 other is degraded and the degradation products are released into the periplasmic space. DR- DNA receptor. Adapted from “DNA uptake during bacterial transformation” by Chen I. and Dubnau D., 2004, Nature Reviews in Microbiology, 2, p. 241-249. Copyright 2004 by Nature Publishing Group. Reprinted with permission [23].

1.6.3 Competence regulation

The process of uptake and recombination of DNA is a highly regulated process and much attention has been devoted to this topic. Initiation of competence results in the increased expression and biosynthesis of proteins involved in DNA binding, uptake and recombination [17, 25]. What triggers cells to develop competence? B. subtilus develops competence at the end of the exponential growth phase when nutrients become limiting [26]. This prolonged nutritional stress and increased cell density results in the up-regulation of competence regulators that induce the transcription of competence genes. The expression of the DNA-binding, uptake and recombination genes is controlled by the competence transcription factor, ComK. The expression of this regulatory factor is tightly regulated and multiple regulatory pathways exist. The expression of comK depends on the presence of ComS, a quorum sensing peptide that appears when cell density increases, SinR a regulatory protein involved in the repression of degradative enzymes, phosphorylated DegU, another protein involved in the production of degradative enzymes, and minimal amounts of AbrB, a transition state regulator that is involved in stationary-growth-phase processes.

In S. pneumoniae the development of competence is also dependent on quorum sensing [27, 28]. Secretion of competence stimulating peptide (CSP) stimulates the expression of competence- specific genes when the cell density of the population increases. CSP is produced in a precursor form from the comC gene. The precursor CSP is processed and then secreted by the ComAB transporter. As cell density increases, the extracellular accumulation of mature CSP grows. CSP binds to the CSP receptor, ComD. Binding of CSP leads to ComD autophosphorylation and subsequent activation of the response regulator, ComE. ComE activates the expression of early competence genes (involved in DNA binding) as well as increases the production of CSP. ComE also induces the expression of the alternative σ factor, ComX. ComX production stimulates the expression of late competence genes involved in DNA uptake and recombination.

In H. influenza, competence develops when log-phase cells are transferred to a defined starvation medium [29] . Starvation stress results in increased intracellular cAMP levels. This secondary messenger binds its catabolic activator protein (CRP) and the cAMP-CRP complex activates the transcription of competence gene as well as an additional competence regulator, TfoX. Ultimately the expression of competence genes involved in DNA uptake and recombination is controlled by the expression of both CRP and TfoX.

1.6.4 Chitin-induced natural competence

Recently, Vibrio cholerae, a marine pathogen and the causative agent of cholera, was found to be naturally transformable on chitin [30], a polymer composed of repeating N-acetylglucosamine monomers. In marine environments, chitin is found in the exoskeletons of copepods that V. cholerae is known to colonize. Chitin was found to induce a 41-gene regulon involved in chitin colonization, digestion and transport, and the assembly of a Type IV pilus complex [31]. The induction of the genes involved in the biosynthesis and assembly of Type IV pilus led the scientists to believe that chitin can induce natural competence in V. cholereae. V. cholereae cells, grown in the presence of either (GlcNAc)6 or sterilized crab shells, were able to take up genomic DNA that was added to the medium [30]. The transformation efficiency for this process was determined to be 2.7 x 10-4. Recent studies confirmed that V. cholerae is able to exchange O- antigen loci (serotype conversion) in a process that is induced by chitin [10]. Serotype conversion was shown to occur in a single-transformation. Recombination was localized to the conserved regions flanking the genetically diverse O-antigen loci. This process was proposed to be responsible for the emergence of the V. cholerae O139 serotype from the O1 serotype.

Vibrio fischeri specifically colonizes the light-emitting organ of the squid Euprymna scolopes and this symbiotic relationship is a model for the study of bacterial-animal association [32]. V. fischeri was also shown to be competent in the presence of shorter chitin oligosaccharides such as (GlcNAc)6 [33], but transformation was not detected in the presence of sterilized crab pieces.

1.6.5 Regulation of chitin-induced natural competence

Among the 41-gene regulon induced by chitin in V. cholerae [30] was a homolog of tfox, a gene previously shown to be involved in competence regulation in H. influenzae and Aggregatibacter actinomycetemcomitans [34, 35]. The disruption of tfox in V. cholerae resulted in the loss of

12 chitin-induced competence. Over-expression of tfoX from a high copy plasmid induced competence in V. cholerae in the absence of chitin. TfoX was found to induce the expression of 28 Type IV pili assembly genes that were also up-regulated by chitin. TfoX was also found to induce the expression of vc1917, a homolog of the Bacillus subtilis ComEA protein that is required for DNA uptake. Further study into the regulation of chitin-induced competence revealed that the expression of hapR, a gene associated with virulence and biofilm formation, was also required for the development of competence. The expression of hapR is positively regulated by the alternative sigma factor, RpoS. The expression of rpoS increases during conditions of nutrient limitation, growth deceleration and stress. Thus, RpoS, is also required for chitin-induced competence. The effect of cell density and quorum sensing was also examined. Lesions in LuxO, a quorum-sensing regulator that represses hapR at low cell densities, resulted in substantial increase in competence at low cell density on chitin. It was postulated that high cell density is needed to relieve the repression of LuxO on HapR and to induce competence development in the presence of chitin. Furthermore, HapR negatively regulates the extracellular nuclease gene, dns [36]. A lesion in dns resulted in hyper-competence of V. cholerae on chitin. It was hypothesized that at low cell density, LuxO represses the transcription of hapR, which in turn attenuates repression of dns and exogenous DNA is degraded. At high cell density hapR is no longer repressed by LuxO and dns transcription ceases. As a consequence DNA is no longer degraded and competence genes are transcribed. Thus, based on these results it was concluded that the presence of chitin, increasing cell density, nutrient limitation, growth deceleration or stress are needed to promote natural competence development in V. cholerae [30].

Two tfoX-like paralogs (tfoX and tfoY) were identified in the genomes of all members of the Vibrionaceae family [33]. The role of TfoX as transcriptional competence regulator has been verified in V. cholerae and V. fischeri [30, 33, 37]. The function of the second tfox-like paralog, TfoY has only been examined in V. fischeri [33]. V. fischeri tfoX and tfoY mutants failed to become competent in the presence of (GlcNAc)6. While complementation with wild-type tfoX fully restored transformation to both the tfoX and tfoY mutants, expression of wild-type tfoY could not complement the tfoX mutant and only partially restored competence to the tfoY mutant. Thus, the function of tfoX and tfoY appears to be distinct.

1.6.6 Regulation of tfoX expression and translation

Recently, transcriptional and translation regulation mechanisms of tfoX were examined in V. cholerae [38]. Chitobiose (GlcNAc)2 was identified to be the shortest chitin derivative that was capable of inducing competence in V. cholerae. The effect of (GlcNAc)2 on the expression and translation of tfoX was examined using transcriptional and translation fusion reporters.

(GlcNAc)2 was found to activate tfoX expression at the transcriptional and, to a much greater extent, at the translation level. Two regulatory regions, TCE (-38 to -1) and TLE (+43 to +84) were found to control the transcription and translation, respectively, of tfoX. An additional translational element (DSE) was found in the tfoX promoter (from +107 to +133). Deletion of this sequence decreased translational efficiency both in the presence and absence of (GlcNAc)2.

The following translation regulatory model was proposed; in the absence of chitin or (GlcNAc)2, the TLE represses tfoX translation through base pairing with the DSE of the RNA. In the presence of (GlcNAc)2 , formation of this structure is inhibited and the ribosome is able to bind to the DSE and enhance translation.

Further investigation into the translational regulation of tfoX expression led to the identification of a novel small regulatory RNA termed tfoR that was required for natural competence and was able to activate translation of tfoX RNA in vitro and in vivo [39]. Transcription of this sRNA was significantly induced by (GlcNAc)2. On the basis of these results, it was proposed that the presence of both (GlcNAc)2 and TfoR was needed to activate translation of tfoX, which lead to the induction of natural competence in V. cholerae.

1.7 Biofilm formation

The majority of single-celled microorganisms are naturally found to grow as biofilms [40-42]. Biofilms provide protection against various antimicrobial agents, immune defense responses and other environmental stresses. Biofilm formation involves the switch from the free swimming to sessile lifestyle. Biofilms are composed of multiple layers of bacterial cells that are attached to each other and to a surface. The initial adherence stage involves bacterial attachment to a specific surface followed by the generation of multiple bacterial layers due to intercellular adhesion. These cells are enrobed in a complex matrix that is produced by the resident microorganisms. This matrix is composed of water, extracellular polysaccharides (EPS), proteins, DNA and RNA.

1.8 c-di-GMP

Bis (3’-5’)- cyclic dimeric guanosine monophosphate (c-di-GMP) was first identified 24 years ago [43]. This small molecule was found to allosterically activate the membrane bound cellulose synthase involved in the biosynthesis of cellulose in Gluconacetobacter xylinus. Since then, c-di- GMP has been found to regulate multiple cellular processes, including biofilm formation, motility and virulence (Figure 1.5) [44-46]. High intracellular levels of c-di-GMP promote the production of EPS and biofilm formation. Low intracellular levels of c-di-GMP promote virulence and motility. c-di-GMP is produced from two molecules of GTP by diguanylate cyclases (DGCs) and is broken down into 2 GMP by phosphodiesterase (PDEs). A conserved GGDEF domain was found to be associated with DGC activity and is the active site of the enzyme. The EAL and HD-GYP domains were found to be associated with PDE activity and are the active sites of the enzymes. The degradation of c-di-GMP occurs via two steps. First c-di- GMP is degraded to a linear pGpG intermediate. Finally pGpG is converted to 2 GMP. The EAL domain have been demonstrated to catalyze the first step in degradation and HD-GYP domain catalyzes both steps [47].

c-di-GMP

DGC PDE

2GTP 2GMP

Virulence gene expression Sessility

Motility Biofilm formation Expression of adhesion factors

Figure 1.5. c-di-GMP synthesis and hydrolysis. c-di-GMP is synthesized from two molecules of GTP by diguanylate cyclase proteins (DGC) and hydrolyzed by phosphodiesterase proteins (PDE). Increases in c-di-GMP lead to sessility, adhesion factor expression and biofilm formation, whereas decreases lead to motility and virulence gene expression.

1.8.1 c-di-GMP binding motifs

To date, four types of c-di-GMP binding domains/proteins have been identified, the PilZ domain, the I-site, FleQ and VpsT [44] [48, 49].

1.8.2 The PilZ domain

The PilZ domain was originally identified in the P. aeruginosa protein PilZ that is required for the assembly of the Type IV pilus [50]. This domain was found to bind c-di-GMP in vitro. More than 600 PilZ domains have been identified in multiple proteins involved in c-di-GMP signaling pathways. Conserved, QRRN, residues in the PilZ domains have been shown to directly participate in c-di-GMP binding [51].

1.8.3 The I-site c-di-GMP has been demonstrated to bind with high affinity to a site (I-site) distant from the catalytic pocket in DGCs [52]. A highly conserved RXXD core motif was found to bind c-di- GMP in the I-site. Data from mutation and enzymatic assay experiments suggests that the I-site is required for feedback inhibition of DGC activity of c-di-GMP, helping the cells to maintain a precise threshold concentration of the signaling molecule. This RXXD motif is found in several c-di-GMP binding proteins such as the Caulobacter crescentus protein PleD and PelD of Pseudomonas aeruginosa.

1.8.4 The FleQ protein

FleQ is a c-di-GMP binding transcriptional regulator from Pseudomonas aeruginosa that regulates flagella and EPS biosynthesis. [53]. FleQ does not contain any regions or domains that resembles the PilZ domain or the I-site of either known c-di-GMP binding proteins such as PelD or PleD. Thus, it is expected that FleQ harbors a novel c-di-GMP binding determinant.

1.8.5 The VpsT protein

VpsT is a transcriptional regulator that is involved in the expression of V. cholerae polysaccharide (vps) genes and genes encoding matrix proteins. This protein was recently demonstrated to inversely regulate biofilm formation and motility by directly integrating c-di- GMP signaling [49]. c-di-GMP mediates dimerization of the VpsT protein through the canonical receiver domains. The binding motif for c-di-GMP in VpsT consists of a four-residue long, conserved W(F/L/M)(T/S)R sequence. Dimerization induces a change in the orientation of the DNA biding domain in VpsT that impacts its binding to the vps promoter region.

1.8.6 c-di-GMP riboswitches

Riboswitches are mRNAs that control gene expression in response to changing concentrations of their target ligand [54]. Recently, c-di-GMP was found to be a ligand for riboswitches that contained a conserved genes for the environment, membranes and motility (GEMM) domain in their 5’ untranslated regions (Figure 1.6) [55] [56]. In V. cholerae GEMM riboswitches were found upstream of two genes: gbpA, which codes for a putative chitin binding protein, and tfoY, which codes for a homolog of the competence regulator, TfoX. Biochemical and genetic analysis determined that c-di-GMP has high affinity and specificity for these two GEMM riboswitches

[56]. The affinity of these riboswitches for c-di-GMP was around 1000 times higher than that of the PilZ domain.648 Fusion Biochemical Society reporter Transactions (2011) analyses Volume 39, part 2 with GEMM riboswitches from V. cholerae, B. cereus, and C. difficile demonstrated that c-di-GMP can either positively or negatively regulate Figure 1 c-di-GMP riboswitch from V. cholerae the expression of the downstre(a) Secondaryam gene structure(s of). the riboswitch upstream of the tfoX-like gene in V. cholerae. The P1 helix is shown in dark blue, P2 in light blue and P3 in green. The asterisks next to C44 and G83 indicate that these residues are base-paired. Nucleotides that directly contact the bases of c-di-GMP are shown in yellow. c-di-GMP is shown in orange. (b) Crystal structure. The U1A protein used for co-crystallization has been removed for clarity. Colouring is the same as in (a).

Figure 2 Riboswitch interactions with c-di-GMP ©2010 American Chemical Society (a) Contacts made to Gα.c-di-GMPiscolouredbyatomwithnitrogencolouredblue,oxygencolouredred,phosphorus Figure 1.6. A c-di-GMP riboswitchcoloured orange and carbon from coloured V. white. cholerae Riboswitch nucleotides. Secondary are coloured by structure atom with nitrogen of coloured the blue,GEMM oxygen coloured red, phosphorus coloured orange and carbon coloured yellow. A water molecule is shown as a red sphere. riboswitch upstream of the tfoYHydrogen gene bonds are in denoted V. bycholerae. broken lines. (b) Contacts The made P1 to Ghelixβ . Colouring is is theshown same as inin (a). dark blue, P2 is light blue and P3 is green. The asterisks next to C44 and G83 indicate that these residues are base-paired. Nucleotides that directly contact the bases of c-di-GMP are shown in yellow. c-di- GMP is shown in orange. Adapted from “Structural and biochemical determinants of ligand binding by the c-di-GMP riboswitch” by Smith, K. et al., 2010, Biochemistry, 49, p. 7351-7359. Copyright 2010 by American Chemical Society. Reprinted with permission [57].

1.9 Vibrio vulnificusRecognition of c-di-GMP by GEMM nucleotides but the number and types of interactions are quite These structural studies revealed the details of molecular different. Gα is primarily recognized on its Hoogsteen face recognition of c-di-GMP by the riboswitch [20,21]. The two by the conserved nucleotide G20. Additional contacts are Vibrio vulnificus is a guanine Gram bases,-negative Gα and G β , opportunistic are recognized asymmetrically human provided and animal by backbone pathogen atoms of C46 and[58 A48,-61 as]. well This as a by the RNA. Both are contacted by multiple riboswitch water molecule present in the binding pocket (Figure 2a). bacterium is primarily found in the estuarine environment either in a free-living form or C C !The Authors Journal compilation !2011 Biochemical Society associated with filter-feeding mollusks such as oysters, clams, mussels and scallops. It has the ability to cause severe septicemia and very serious wound infections. Wound infections can develop after exposure to contaminated marine waters and treatment often includes surgical

18 debridement or amputation. Severe septicemia can develop after the consumption of raw or poorly cooked shellfish [62, 63] and death often occurs within hours of hospital admission. Individuals, who are immune-compromised, including those with elevated iron-serum levels and chronic liver disease such as cirrhosis and hepatitis, are more susceptible to septicemia. Currently, V. vulnificus is divided into 3 different biotypes based on the LPS antigen [58-61]. Biotype I is primary associated with human infections. V. vulnificus biotype 1 can be divided into at least five antigenic subgroups, one of which (LPS type 1/5) is more prevalent among clinical strains [64]. This suggests either that the presence of this LPS type itself causes increased virulence, or that this LPS type is a marker of more virulent strains. Biotype II is an eel pathogen and possesses a single LPS type. Biotype III has only been recently categorized. This biotype is able to cause infection in both eels and humans and also posses a single LPS type similar to biotype II.

V vulnificus is responsible for 95% of all seafood related fatalities in the United States [65]. It has the highest fatality rate among the Vibrios. V. vulnificus infection is challenging to treat since the bacterium can rapidly multiply in the blood and cause extensive tissue damage [62, 66, 67]. Antibiotic treatment can be effective, however it must be administrated fairly early in the infection.

1.9.1 V. vulnificus virulence factors

V. vulnificus produces several virulence factors that contribute to its pathogenicity. Some of the recognized virulence factors include the ability to acquire iron from transferrin, hemolysis/cytolysins, metalloproteases, flagella, LPS and the CPS [58-61].

1.9.2 Iron-acquisition

Individuals with elevated iron serum levels as a result of chronic liver and blood diseases are more susceptible to V. vulnificus infections [58, 59, 61]. Intraperitoneal injection of V. vulnificus in in mice treated with ferric ammonium resulted in a much lower LD50 compared to untreated mice [68]. Ferric ammonium treatment was found to lead to liver damage and an increase in serum iron. In humans, iron is bound to various proteins and is not readily available for bacterial acquisition [69]. The majority of iron in the serum is bound to transferrin. V. vulnificus possesses several iron-scavenging siderophores that are able to acquire iron from transferrin [70]. Catechol

19 siderophore (vulnibactin) is the major system by which V. vulnificus can release iron from transferrin. Mutations in the genes associated with vulnibactin biosynthesis (vvuA, venB, vvsA and vvsB) in V. vulnificus were found to diminish virulence in mice [71-73].

1.9.3 Hemolysin/cytolysin and metalloprotease

The first hemolysin protein characterized in V. vulnificus was found to form pores in host cell membranes and stimulate guanylate cyclase activity [74-78]. Stimulation of guanylate cyclase leads to vasodilation and edema, conditions typically seen during V vulnificus infection. Injection of purified hemolysin protein in mice resulted in extensive tissue damage, resembling the damage caused during V. vulnificus infection. However, mutation in the gene encoding the hemolysin protein failed to diminish virulence in V. vulnificus. Subsequently, two other cytolysin proteins (VllY and HlyIII) were identified in V. vulnificus based on their ability to induce hemolysis in human cell lines [79, 80]. However, only mutation of the hlyIII gene resulted in diminished virulence in mice.

The first metalloprotease was identified in 1982 [81]. Injection of the purified protein into mice caused dermal necrosis, increased vascular permeability and edema, symptoms consistent with V. vulnificus infection in humans [82, 83]. However, a vvp mutant did not abolish virulence in orally or i.p.-inoculated mice.

1.9.4 Flagella

Recently, a V vulnificus transposon mutant with decreased cytotoxicity against HeLa cells was identified [84]. The transposon insertion was localized to flgC, which codes for a flagellar basal body protein. The mutant had reduced mobility and decreased adherence to HeLa cells. The mutant also had an increased LD50 in mice. Furthermore, disruption of the gene coding for the flagellar hook protein (FlgE) caused a 10-fold increase in LD50 compared to wild-type [85].

1.9.5 LPS

The precise role of LPS in pathogenesis is unclear. While the injection of purified V. vulnificus LPS from strain MO6-24/O (biotype I) into mice caused the release of TNF-α and resulted in substantial drop in arterial pressure [86, 87], the injection of LPS from V. vulnificus strain C7184

20 had no effect on mice but was lethal in rats [86]. Furthermore, LPS elicited less of a cytokine response from primary human peripheral blood mononuclear cells than purified CPS [88].

1.9.6 CPS

CPS is a major virulence factor of V. vulnificus. This “antiphagocytic surface antigen” was first characterized in 1981 [89]. The production of CPS by V. vulnificus was found to provide resistance to phagocytosis of human polymorphonuclear leukocytes (PMN). It was found that V. vulnificus strains that produce a CPS appear opaque and those that do not appear translucent. All virulent strains of V. vulnificus appear opaque and produce CPS [90-92]. Survival in human serum assays demonstrated that the survival rate of opaque (encapsulated) isolates was much higher than translucent (unencapsulated) V. vulnificus variants [93-95]. Interaction studies with macrophages also demonstrated that encapsulated V. vulnificus isolates were more resistant to phagocytosis by mouse peritoneal macrophages than unencapsulated isolates [96]. CPS was thus concluded to facilitate resistance to phagocytosis and bactericidal effects of both human and mouse serum.

CPS production has also been demonstrated to contribute to the development of septic shock due to induction of inflammation associated-cytokines [88]. Purified CPS injected in mice stimulated the production of TNF-α. CPS was also able to induce expression of TNF-α and increase transcription of mRNA of interleukin-6 from primary human peripheral blood mononuclear cells (PBMCs).

1.9.7 CPS diversity in V. vulnificus

Carbohydrate composition analysis by high performance anion exchange chromatography has shown that V. vulnificus strains produce multiple capsular types [97]. 94 distinct types of CPS were characterized in V. vulnificus. The most prevalent monosaccharides found in the CPS are rhamnose, galactosamine urinate, galactose, glucosamine and galactosamine. The complete structure of the CPS of 4 V. vulnificus strains have been determined [98-101].

Wright et al. (1990) was the first to identify the cps locus from V. vulnificus strain M0-6/24. The cps locus was found to resemble Group I CPS biosynthesis locus of E. coli. Subsequently, the cps loci of two other V. vulnificus strains, CMCP6 and YJ016, were identified. These loci were also found to resemble Group I CPS biosynthesis loci of E. coli. Recently, we identified the cps

21 locus of V. vulnificus strain 27562 [102] and its organization resembles group IV CPS biosynthesis loci of E. coli.

1.9.8 Evidence for the horizontal transfer of cps loci in V. vulnificus

Multiple capsular types have been identified in V. vulnificus suggesting that the elaboration of CPS diversity in V. vulnificus is an active process. However, little is known about the genetic mechanisms that drive this CPS diversity. Comparative genomic analysis of the cps regions of V. vulnificus strains 27562, M06-24, YJ016 and CMCP6 (Figure 1.7) revealed that conserved chromosomal regions flanked the genetically variable CPS biosynthesis genes [102]. The analysis also revealed that cps locus V. vulnificus strain 27562 was highly conserved over most of its length in another estuarine species, Shewanella putrefaciens strain 200 (Figure 1.8). Furthermore, the GC content of the cps loci in V. vulnificus and S. putrefaciens was significantly lower than the average GC content of the respective genomes. The conservation of amino acid identity and GC content between the two clusters supported the notion that this cps locus was acquired by HGT.

22 VOL. 78, 2010 AN UNUSUAL CPS LOCUS IN V. VULNIFICUS 5221

FIG. 3. Comparative analysis of the CPS loci of V. vulnificus strains. The nucleotide sequences of the CPS loci of V. vulnificus strains YJ016, CMCP6, MO6-24/O, and ATCC 27562 were aligned using Mauve. The alignment©2010 display isAmerican organized as Society described for in the Microbiology Fig. 2 legend. Strain designations appear below the organization of the genes within the locus (white boxes). The long dark-gray arrows highlight carbotype-specific genes of theFigure respective 1.7 loci. Comparative genomic analysis of the cps loci of V. vulnificus strains. The nucleotide sequences of the cps loci of V. vulnificus strains YJ016, CMCP6, MO6-24/O, and exogenous27562 CPS lociwere following aligned their using uptake Mauve. by chitin-induced The alignment display is organizedREFERENCES into one horizontal panel horizontalper gene input transfer. sequence. A JUMPstart Each element, panel first contains identified the strain1. Ali, A., designation, M. H. Rashid, and the D. organization K. Karaolis. 2002. High-frequency of the genes rugose in Escherichia, Salmonella, Yersinia, and Vibrio strains (27), was exopolysaccharide production by Vibrio cholerae. Appl. Environ. Microbiol. 68:5773–5778. identifiedwithin upstream the of locuswza. Within(white this boxes; element genes is a 9-bpin the se- forward2. Altschul, orientation S. F., T. L. Madden,are shown A. A. Schaffer, on a J.single Zhang, Z.level Zhang, while W. Miller, quence (AAGGGCGGT) that is almost identical to the uptake and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389–3402. signal sequencethose in (USS) the ofreverseHaemophilus orientation influenzae are (23).offset The below),3. Amor, a scale P. A.,J. showing A. Yethon, M. the A. Monteiro, sequence and C. Whitfield.coordinates1999. Assembly in USS sequences are required for the efficient uptake of DNA in of the K40 antigen in Escherichia coli: identification of a novel enzyme some naturallybase transformable pairs, and a bacteria single (19), horizontal making it tempting centerline. Connectedresponsible for addition colored of L-serine segments residues to (lo thecally glycan backbone colinear and its requirement for K40 polymerization. J. Bacteriol. 181:772–780. to speculate that the HGT of polysaccharide loci in the Vibri- 4. Bailey, M. J., C. Hughes, and V. Koronakis. 1997. RfaH and the ops element, onaceae blocksmay involve [LCBs]) the preferential indicate regions uptake of of USS-tagged a sequence thatcomponents align with of a novelthat system of another controlling bacterialsequence, transcription and elongation.these DNA by chitin-induced natural transformation. Mol. Microbiol. 26:845–851. regions are considered homologous. Within each5. Banoub,colored J. H., segment D. H. Shaw, H.is Pang,a similarity J. J. Krepinsky, profile N. A. Nakhla, of the and T. We previously showed that mutations in genes within the Patel. 1990. Structural elucidation of the O-specific antigen of Yersinia CPS locus also affected the production of LPS in strain 27562 ruckerii by fast atom bombardment mass spectrometry (FAB-MS). Biomed. sequence. The height of the similarity profile correspondsEnviron. Mass to Spectrom. the average19:787–790. level of conservation in (39). Furthermore, comparative genomics suggests that the 6. Blake, K. L., A. J. O’Neill, D. Mengin-Lecreulx, P. J. Henderson, J. M. putative LPSthat biosynthesisregion of locusthe issequence. adjacent to Areas the CPS within locus in the coloredBostock, segments C. J. Dunsmore, that K. J. Simmons,are completely C. W. Fishwick, white J. A. Leeds, and and the genomes of CMCP6, YJ016, and 27562. This organization I. Chopra. 2009. The nature of Staphylococcus aureus MurA and MurZ and approaches for detection of peptidoglycan biosynthesis inhibitors. Mol. Mi- is reminiscentregions of the outside situation the in LCBsV. cholerae lackNRT36S, detectable where homologycrobiol. among72:335–343. the input sequences and were not both CPS and LPS genes occupy the same locus (10). It was 7. Blokesch, M., and G. K. Schoolnik. 2007. Serogroup conversion of Vibrio proposedaligned; that the embedding they contain of CPS se andquence LPS genes elements within thespecific choleraeto a particular in aquatic reservoirs. locus. PLoS Blocks Pathog. 3: e81.lying above the 8. Bush, C. A., P. Patel, S. Gunawardena, J. Powell, A. Joseph, J. A. Johnson, same locus could provide a mechanism for the rapid emer- and J. G. Morris. 1997. Classification of Vibrio vulnificus strains by the gence ofcenterline new pathogenic indicate and bacteriophage-resistant regions that align strains in the forwardcarbohydrate orientation, composition and of their those capsular below polysaccharides. align Anal. in Biochem. the via the generation of novel capsular and O antigens by hori- 250:186–195. reverse orientation. The relevant genes of each9. locusCarver, T. are J., K. labeled M. Rutherford,. The M. long Berriman, dark M.-A.-gray Rajandream, arrows B. G. zontal transfer. The exchange of LPS and CPS loci by chitin- Barrell, and J. Parkhill. 2005. ACT: the Artemis comparison tool. Bioinfor- induced natural transformation in V. vulnificus would provide matics 21:3422–3423. highlight carbotype-specific genes of the respective10. Chen, Y., loci. P. Bystricky, Adapted J. Adeyeye, from P. Panigrahi, “Evidence A. Ali, J. A. Johnson, for the C. A. a mechanistic basis for generating the large number of CPS Bush, J. G. Morris, Jr., and O. C. Stine. 2007. The capsule polysaccharide types observed,horizontal and this transfer phenomenon of an may unusual simultaneously capsular pro- polysaccharidestructure and biosynthesis biogenesis for non-O1 locus Vibrio in choleraemarine NRT36S: bacteria genes” are mote the emergence of new pathogenic strains through the embedded in the LPS region. BMC Microbiol. 7:20. 11. Comstock, L. E., and D. L. Kasper. 2006. Bacterial glycans: key mediators of acquisitionby ofNakhamchik chromosomally A. linked et al. LPS, 2010, biosynthesis Infection genes. and Immunity,diverse host immune78, p. responses. 5214- Cell5222.126: 847–850.Copyright 2010 by 12. Comstock, L. E., D. Maneval, Jr., P. Panigrahi, A. Joseph, M. M. Levine, J. B. Kaper, J. G. Morris, Jr., and J. A. Johnson. 1995. The capsule and O American Society for Microbiology. Reprinted withantigen permission in Vibrio cholerae [102 O139]. Bengal are associated with a genetic region ACKNOWLEDGMENT not present in Vibrio cholerae O1. Infect. Immun. 63:317–323. 13. Darling, A. E., T. J. Treangen, X. Messeguer, and N. T. Perna. 2007. Ana- This work was supported by funding from the Canadian Institutes of lyzing patterns of microbial evolution using the Mauve genome alignment Health Research (CIHR) to D.A.R.-M. system. Methods Mol. Biol. 396:135–152.

©2010 American Society for Microbiology Figure 1.8 The cps locus of V. vulnificus 27562 is conserved in S. putrefaciens 200. The CPS loci of the two strains were aligned using Mauve as described in Figure 1.7. Adapted from “Evidence for the horizontal transfer of an unusual capsular polysaccharide biosynthesis locus in marine bacteria” by Nakhamchik A. et al., 2010, Infection and Immunity, 78, p. 5214-5222. Copyright 2010 by American Society for Microbiology. Reprinted with permission [102].

1.9.9 Novel cps locus in V. vulnificus

The CPS structure of strain 27562 is unusual [98]. It is a serine-linked polymer composed of N- acetylglucosamine (GlcNAc), galacturonic acid (GalA), rhamnose and, surprisingly, N- acetylmuramic acid (MurNAc) (Figure 1.9). N-acetylmuramic acid is unique to bacterial peptidoglycan [103] and its presence in other polysaccharides is rare. There is only one other example of muramic acid being incorporated outside peptidoglycan, in the LPS of Yersinia ruckerii [104]. Furthermore, the linkage for the MurNAc sugar in the CPS of strain 27562 is α, 1’ - 3’, whereas its linkage in peptidoglycan is β, 1’ – 4’ [105]. Amino acid modification in the CPS is also unusual. Thus, the genome of V. vulnificus strain 27562 codes for novel CPS biosynthesis enzymes.

The novel 25 Kb cps locus of V. vulnificus strain 27562 contains 21 open reading frames (Figure 1.10) [102, 106]. A putative function could be assigned to majority of the genes identified in the locus: wza, wzb and wzc, code for export proteins; rmlB, rmlA, rmlD, rmlC, murBcps, murAcps, wcvB, wcvA, and wcvC code for nucleotide sugar biosynthesis enzymes; wzx codes for a flippase that translocates the polysaccharide polymer across bacterial inner membrane; wzy codes for a

24 A polysaccharide polymerase; wcvD, wcvE, wcvF and wecA code for the glycosyltransferases. WecA is the initiating glycosyltransferase that transfers the first sugar, GlcNAc, to the lipid carrier. WcvF is the rhamnosyltransferas. WcvD and WcvE are likely to participate in the transfer of MurNAc and GalA. The lone CPS modification for which a gene function was not readily assignable was the serine linkage to the glycan backbone. We hypothesize that this function is performed by cppA, a gene with no apparent homology to any other known gene.

Figure 1. Model for biosynthesis and assembly of group 1 and ©19984 capsules. Pergamon A, From the left, und-PP is the starting point forFigure linkage 1.9 of Structure activated of sugars capsular by glycosyltransferases polysaccharide of (GTs) V. vulnificus at the interface strain 27562. between Adapted the cytoplasm from and the inner membrane. WbaP is the initiating GT in group 1 assembly and WecA performs this function in group IV assembly. Newly synthesized“Structure und-PP-linkedof a muramic repeats acid containingare then flipped capsular across polysaccharide the inner membrane from by the Wzx. pathogenic Wzy catalyses strain polymerization of of the polymer by transferring the growing chain to the incoming und-PP-linked repeat unit. Continued polymerization is Vibrio vulnificus ATCC 27562” by Gunawardena, S. et al., 2010, Carbohydrate Research, 309, dependent upon transphosphorylation of Wzc and its dephosphorylation by the Wzb phosphatase. Wza forms a channel that translocatesp. 65-76. Copyright the polymer 1998 to the by outer Pergamon. surface. Reprinted Wzi is unique with to permission group I capsules [98]. and appears to modulate association of the caspule with the cell surface. Adapted from Whitfield, C. Annu. Rev. Biochem. (2006) 75:39-68. B, Structure of capsular polysaccharide of Vibrio vulnificus ATCC 27562 adapted from Gunawardena et al. Carbohydrate Research. (1998) 309:65-76.

©2010 American Society for Microbiology Figure 1.10. Genetic organization of the cps locus of V. vulnificus strain 27562. Arrows represent the locations and direction of transcription of the respective genes. Black, white, checkered, horizontally striped, light gray, and vertically striped arrows denote transferase, transport, insertion sequence, processing, nucleotide sugar biosynthesis, and unknown genes. The JUMPstart and terminator sequences are also indicated. Adapted from “Evidence for the horizontal transfer of an unusual capsular polysaccharide biosynthesis locus in marine bacteria” by Nakhamchik A. et al., 2010, Infection and Immunity, 78, p. 5214-5222. Copyright 2010 by American Society for Microbiology. Reprinted with permission [102].

1.9.10 Chitin-induced natural transformation in V. vulnificus

Similar to V. cholerea, chitin induces natural competence in V. vulnificus [107]. Gulig et al 2009, demonstrated that V. vulnificus strain CMCP6 can become naturally transformable upon growth in the presence of seawater and sterilized pieces of crab shell. Transformants were detected when linear DNA was added and transformation frequencies were calculated on the order of 1.2x 10-7. Intact plasmid and short DNA fragments generated by PCR could not be taken up and/or maintained by the recipient V. vulnificus. However, if the PCR fragment was first introduced into a plasmid and then linearized by digestion, transformation and recombination were efficient. Chitin-induced natural transformation was found to be useful in creating antibiotic resistance- marked deletions in two loci, flaCDE and flaFBA, which encode flagellins. Similarly, the transfer of an antibiotic-marked wza deletion, which abolished capsular polysaccharide transport, was also monitored by chitin-based natural transformation. However, the uptake of large contiguous DNA fragments typical of polysaccharide loci was not investigated.

1.9.11 c-di-GMP regulated biofilm formation in V. vulnificus

V. vulnificus is able to form a biofilm on a variety of marine surfaces, including plankton, algae, fish and eels [108-111]. We characterized a DGC, DcpA, from V. vulnificus strain 27562 that increased biofilm formation when overexpressed [112]. Further investigation led to the identification of a c-di-GMP regulated EPS locus, which we termed brp (biofilm and rugose polysaccharide), that participated in biofilm formation [113]. The brp locus was found to be comprised of nine genes organized into two operons. This locus was found to code for a number of glycosyltransferases, polysaccharide biosynthesis, and export proteins homologs. RT-PCR analysis revealed that increased c-di-GMP levels resulted in increased expression of the brp locus. We also found that decreasing c-di-GMP levels, through the over-expression of the phosphodiesterase yhjH, reduced EPS production and attenuated biofilm formation.

CHAPTER 2

2 Hypotheses and objectives

Hypotheses 1. I hypothesize that V. vulnificus undergoes carbotype conversion via chitin-induced natural transformation. (covered in Chapter 3) 2. I hypothesize that different carbotypes are equally effective at promoting the survival of V. vulnificus in human sera (covered in Appendix A) 3. I hypothesize that c-di-GMP regulates competence development in V. vulnificus in a biofilm dependent (brp EPS) and/or independent (tfoY and gbpA) manner (covered in Appendix B) 4. I hypothesize that wcvD or wcvE codes for a novel muramic acid glycosyltransferase and that cppA codes for a novel serine transferase (covered in Appendix C)

Objectives 1. To demonstrate chitin-induced carbotype conversion in V. vulnificus. 2. To express different carbotypes in an otherwise isogenic background and test their survival in human serum. 3. To determine the role of the brp locus, tfoY and gbpA in chitin-induced competence in V. vulnificus. 4. To characterize the activity of WcvD, WcvE and CppA.

CHAPTER 3 3 Chitin-induced carbotype conversion in Vibrio vulnificus

Chapter 3 of this thesis is presented as a manuscript adapted from “Chitin-induced carbotype conversion in Vibrio vulnificus” by Neiman J., Guo, Y., and Rowe-Magnus, D., 2011, Infection and Immunity, 78(8), p. 3195- 3203. Copyright 2011 by American Society for Microbiology. Reprinted with permission [114].

3.1 Abstract

As an etiological agent of bacterial sepsis and wound infections, V. vulnificus is unique among the Vibrionacea. The most intensely studied of its virulence factors is the capsular polysaccharide (CPS). Over 100 CPS types have been identified, yet little is known about the genetic mechanisms that drive such diversity. Chitin, the second most abundant polysaccharide in nature, is known to induce competence in Vibrio species. Here, we show that the frequency of chitin-induced transformation in V. vulnificus varies by strain and that (GlcNAc)2 was the shortest chitin-derived polymer capable of inducing competence. Transformation frequencies increased eight fold when mixed-culture biofilms were exposed to a strain-specific lytic phage, suggesting that the lysis of dead cells during lytic infection increased the amount of extracellular DNA within the biofilm that was available for transfer. Furthermore, we show that V. vulnificus can undergo chitin-dependent carbotype conversion following the uptake and recombination of complete cps loci from exogenous genomic DNA (gDNA). The acquisition of a partial locus was also demonstrated when internal regions of homology between the endogenous and exogenous loci existed. This suggested that the same mechanism governing the transfer of complete cps loci also contributed to their evolution by generating novel combinations of CPS biosynthesis genes. Since no evidence exists that cps loci were preferentially acquired during natural transformation (random transposon-tagged DNA was readily taken up in chitin transformation assays), the phenomenon of chitin-induced transformation likely plays an important but general role in the evolution of this genetically promiscuous genus.

3.2 Introduction After 3.8 billion years of evolution [115], bacteria, whether commensal or pathogenic, have evolved numerous ways to cope with the sophisticated defensive strategies of the host's immune system. A simple but very effective strategy is the production and variation of surface polysaccharides that can alter proper host immune function [2, 116]. This type of antigenic variation is an important mechanism used by pathogenic microorganisms for escaping the neutralizing activities of antibodies and phagocytes. Antigenic variation may occur during the course of an infection, or an organism can exist in nature as multiple antigenic types (antigenic variety). The colonized host often provides the ideal selective environment for the emergence of new antigenic variants of bacteria, providing the organism's other virulence determinants remain intact.

V. vulnificus is a estuarine bacterium that is pathogenic to humans and animals [59]. Its continued environmental persistence and transmission is bolstered by its ability to colonise shellfish and form biofilms on various marine biotic surfaces such as plankton, algae, fish and eels [111, 117, 118]. Primary septicemia and wound infections can arise following the consumption or handling of contaminated food or water, and the fatality rate of septicemic patients is greater than 50% (for review see [59]. It alone is responsible for 95% of all seafood related deaths in the United States and it carries the highest death rate of any food-borne disease agent [65]. The most intensely studied of its virulence factors is the capsular polysaccharide (CPS), which mediates resistance to complement-mediated bacteriolysis and phagocytosis [92, 96, 119, 120]. All virulent strains produce copious amounts of CPS; acapsulated strains produce little or no CPS and are attenuated [106, 121]. CPS is composed of monosaccharides joined by glycosidic linkages and an incredibly diverse range of branched and modified CPS molecules is possible. More than 100 capsular types (carbotypes) have been identified among natural V. vulnificus isolates [97, 122] and completely different CPS biosynthesis loci are found in the same chromosomal region in different V. vulnificus strains [102]. This suggests that the elaboration of CPS structures is an important survival strategy for V. vulnificus and likely allows the organism to stave off elimination by the host’s immune system, yet little is known about the genetic mechanisms that elaborate such a degree of CPS diversity.

Chitin, the second most abundant polysaccharide in nature after cellulose, is an insoluble polymer of N-acetylglucosamine (GlcNAc). It is found in the exoskeleton of marine invertebrates such as crustaceans, cephalopods, diatoms and sponges [123, 124]. The epidemic V. cholerae O139 serovar emerged from the pandemic El Tor O1 serovar through the replacement of a 22 Kb O1 lipopolysaccharide (lps) locus with a 40 kb O139 lps locus [125- 127]. It has been proposed that this may have occurred in a process of natural transformation that was induced by chitin [10]. Chitin-induced competence was also reported to occur in V. vulnificus [30, 107], however, the uptake of large contiguous DNA fragments was not investigated. Hence, we determined the role of chitin-induced transformation in carbotype conversion in V. vulnificus. We show that the frequency of chitin-induced transformation in V. vulnificus varies by strain and that (GlcNAc)2 was the shortest chitin-derived polymer capable of inducing competence. Transformation frequencies increased when mixed-culture biofilms were exposed to a strain-specific lytic phage, which effectively augmented the amount of DNA within the biofilm that was available for transfer. We also show that V. vulnificus can undergo chitin- dependent carbotype conversion following the uptake and recombination of complete cps loci from exogenous genomic DNA (gDNA). The incorporation of partial cps loci led to the generation of novel combinations of cps biosynthesis genes.

3.3 Materials and Methods Bacterial strains and media Bacterial strains and recombinant plasmids used in this study are listed in Table 3.1 Strains were grown in LB (Sigma) or Instant Ocean® at 25 ppt (IO-25). Antibiotics were used at the following concentrations: ampicillin (Ap), 100 µg/ml; (Rf), 100 µg/ml; kanamycin (Km), 160 µg/ml for V. vulnificus and 10 µg/ml for E. coli; chloramphenicol (Cm), 3 µg/ml for V. vulnificus and 10 µg/ml for E. coli. IPTG and L- arabinose were added to 1 mM and 0.2%, respectively.

Table 3.1 Bacterial strains used in this study Strains Description Source V. vulnificus 27562 Type Strain; clinical isolate from Collection de Florida; RfR l’Institut Pasteur

27562wzc::pSW23T Acapsular mutant of 27562 with a [106] disruption of the wzc tyrosine autokinase required for CPS transport; RfR, CmR

27562-Tn Mutant transposon library; RfR, KmR This study

YJ016 Clinical isolate from Taiwan; RfR [128]

YJ016-Tn Mutant transposon library; RfR, KmR This study

YJ016vv0343::pSW23T YJ016 variant tagged at vv0343 with This study pSW23T; RfR, CmR YJ016wbfY::pSW23T YJ016 variant tagged at wbfY with This study pSW23T; RfR, CmR MO-6/24 Clinical isolate from United States; RfR [129]

MO-6/24-Tn Mutant transposon library; RfR, KmR This study

MO-6/24wbfT::pSW23T MO-6/24 variant tagged at wbfT with This study pSW23T; RfR, CmR CMCP6 Clinical isolate from Korea; RfR [128]

CMCP6wzc::pSW23T Acapsular mutant of CMCP6 with a This study disruption of the wzc tyrosine autokinase required for CPS transport; RfR, CmR

CMCP6-cps27562 Acapsular mutant of CMCP6 that This study acquired the cps locus of 27562wzcpSW23T; RfR, CmR CMCP6cps27562/pBAD24T::wzc Acapsular mutant of CMCP6 that This study acquired the cps locus of 27562wzc::psw23Tand complemented with wild type wzc; RfR, CmR CMCP6-wcvCYJ016 CMCP6 that acquired the 3’ end of the This study YJ016wbfY::pSW23T cps locus; RfR, CmR CMCP6-cpsMO-6/24 CMCP6 that acquired the entire cps This study locus of MO-6/24wbfT::pSW23T; RfR, CmR

E. coli S17.1λpir Donor strain for conjugation [130]

Plasmids pNKTXI-SceI Mini-Tn10 mutagenesis plasmid; KmR, [106] ApR

31 pBAD24T Mobilizable derivative of pBAD24; ApR [106] pBAD24T::wzc pBAD24T containing wzc under the [106] R control of PBAD; Ap pSW23T Suicide vector; CmR [131] pSW23T::vv0343 pSW23T containing vv0343; CmR This study pSW23T::wbfY pSW23T containing wbfY; CmR This study pSW23T::wbfT pSW23T containing wbfT; CmR This study pGFPTAT GFP-producing plasmid containing the [132] RP4 origin of conjugative transfer; ApR

PCR and DNA manipulation

Genomic DNA (gDNA) was extracted with DNAZOL (Invitrogen). Plasmid DNA was purified using the Sigma Plasmid Miniprep kit. PCR was performed in 50µl volumes using Tax (Bio Tools) or Platinum Pfx (Invitrogen) DNA polymerase following the manufacturer’s instructions. When necessary, PCR products were cloned into pCR2.1 (Invitrogen) and sequenced at the Hospital for Sick Children (Toronto) using the M13F and M13R primers. All other primers are listed in Table 3.2

Table 3.2 All primers sequences used in the study Primer Name Sequence Gene doubling vv0343-1 GGATCCTATTTGCACCTATATTGTGTGTT vv0343-2 GGATCCCCAAAGTATAAGCACACAAAAG vv0364-1 GGATCCCTACCAAGTGAAAGGGTTTATTGA vv0364-2 GGATCCACGTTGTTGCGAACCCCTTC wbfT-1 GGATCCGCAGGTGTAAAGCGCTTCGTC wbfT-2 GGATCCCAGCCAAATGGTAGCACCA

Screening transformants vv12532Xba GCCTCTAGACTACCAGCCGCCACATAACT vv12532Eri CCGGAATTCGATGAAAGGGAAGATTCTTCGCT vvuinIANco CATGCCATGGAAATGAAAAATCAGTTTCTCTTAAGT vvuinIAKpn CGGGGTACCTTAAAGGTTCGATAATGGGCTT pNKBORkanFwd ATGAGCCATATTCAACGGGAA PNKBORkanRev TTAGAAAAACTCATCGAGCATC DSIYJ016-1 GGTACCCTAAAGCTTAGATAGAGGGCT DSIYJ016-2 ATCTATACCTTATGTTCGAAATAG

32 pSW23 GTCGACGGTATCGATAAGCT wcvBBegRev CTCAATATCCGCATCTACGAT wcvBFor A TGAAAA TCGCAGTTGCAGGT wcvCBHIRev GGCGGCGGATCCCTATTTATAAAGATTCTCGAAGC

Tracking transfer of the 27562 cps locus wzcSeq2 AAAACACGGTGAAAGAGA TCG rmlAseq TTCAGCGAGCCATCATTGAG rmlBSeq2 CATAAATTAATCACTCTCGGTC rmlCBHI CCGGATCCTCATAACAATTCAGATTCCAAAAA rmlCBspHI GGGTTTTCTCATGAATGAAAGTTATTGATACAAACATAC murBxr TTCTCCGACTTCTACGCC murBxf ATTAAATGGGATGACGAAACTT ΔmurAxr GGGGTACCCCCCATCTGCAATACAGTTC ΔmurAxf GGGGTACCCTTTACCAGGAGGTTGTGCC wzxR CCTAGAAAGCATTAATTTTAGTG wzxF ATGTACAGCCCTGAAGAATT wzyFBsphI GGGTTTTCTCATGAATGATTACATACAACGTTAGATTAA wzyBHI CGGGATCCTCATAAGGGTATGCGTTTGTTA cppABHI AAGCTTGGATCCATGATAGGCTTTATCATTGGTAC cppABHI-2 GGGATCCGAATTCCTAAACTCGACCTTTAAATATCA wcvDSalI ACTAGTGTCGACCTAACGTTGTATGTAATCATCC cppAERI GAATTCATGATAGGCTTTATCATTGGTAC wcvEMfeI CAATTGATGACTAAGGAAGCTGATATAAT wcvESalI GTCGACTTAAAGCAAAGAATATAAATTTTTGC wcvDMfeI CAATTGATGATTTATTTAATTGGGTTAAATAT wcvDSalI GTCGACCTAACGTTGTATGTAATCATCC wecAMfeI CAATTGATGTTTTTAGAACTCTCCTTTATC wecASalI GTCGACTTATGCTTTTTGCTCGGCACC wcvFF ATGTTGTGGATGGTAAAAGTAG wcvFR TTTAGTAGGTCATCTCATACAAT VvuIS1358F ATGAGCGAGTTAATCAACCCA VvuIS1358R GTCACGTAAGGCTTTCAAGAA

Tracking transfer of the CMCP6 cps locus CMCP6orfCFor ATGTTAATAAGGACTCCTTCTC CMCP6orfCRev CTAAGGATTTTTTTTGCTATTGAA CMCP6orfEFor ATGAAGTTGGCATATGTTTTAGC CMCP6orfERev TTATTTAACATCACTACCCAAGT

Tracking transfer of the YJ016 cps locus wzcFk-0 GGGGGGAA TTCCGCA TCGCTGGAAAGGTGA vv0341Rev TTACTTGCACAGAGAATCGAG vv0341For TTGTTGGTTAGTTGTATGTCAAA vv0345Rev TTATTCGAAGCTATTAAATTTACTA vv0345For GTGATTTTAATCACTAATAAGGTA vv0348RevMid CTAAGATCTTCTTATATGAACTTG

33 vv0348For ATGAATAAGTTATTAATAAACTTTTTT vv0350Rev CTATTTTCTAAAATTATCTTGGTTT vv0350For ATGATAACCCAGCTTATGCTG vv0352Rev TTAATCTTTTACCCTTCCATAGC vv0352ForMid AACGCTTTTGTCGGCGACG vv0354Rev TCATCGTTTAATAGACCTCTCA vv0354For ATGATTATTATGACTAAAAATAGAG vv0357RevMid AACGGATTCCTTGCAATCCAA vv0357For ATGAAACAAATATTACAAGACATG vv0358RevMid CTCCATAGCTCCGCCATTG vv0358For ATGAGTCTCAAATTAAAAGCGC vv0360Rev TCAATTAGCCTTTTCATCATTTTC vv0360For ATGAATATTCTTTATTTTCACCAG vv0363For ATGTTAAATACCCCATTTTCTCC vv0363RevMid TAACGGCTTTGGTTTTTTCTGT

Tracking transfer of the MO-6/24 cps locus M06wbjB-1 ACGGGTTCTTTTGGTAATGCGGT M06wbjB-2 GGTTGTCGGCAGGAACGCGA M06wbpP-1 GCTTGATCAAACCGTGGTGGGGT M06wbpP-2 TGCGACGGCGCATAGCCTAA wbuBendFor CTCTAGGGCGCATGAGGTA wbfUBegRev TAACGGTAACCACGACCAGT

Generation of transposon (Tn) library

The pNKTXI-SceI plasmid [106] was conjugated from S17.1λpir to V. vulnificus RfR- derivatives of strains 27562, YJ016, CMCP6 and MO-6/24. KmR Tn mutants were selected on LB Rf Km plates. Mutants from each library (designated 27562-Tn, YJ016-Tn, CMCP6-Tn and MO-6/24-Tn) were pooled and used in mixed culture transformation assays. Where indicated, gDNA was extracted and used as donor in transformation experiments.

Constructing YJ016vv0343::pSW23T, YJ016wbfY::pSW23T and MO-6/24wbfT::pSW23T

The vv0343, wbfY and wbfT genes were amplified from the respective strains with primers vv0343-1/vv0343-2, vv0364-1/vv0364-2 and wbfT-1/wbfT-2. Each was digested with BamHI and EcorI and separately cloned into the BamHI and EcorI sites of pSW23T. The resulting plasmids were conjugated from S17.1λpir to the appropriate V. vulnificus strain. Correct integration was verified by PCR using a primer targeting the cat gene of pSW23T and a second primer that annealed to chromosomal DNA flanking the target gene (vv0341For, vv0363For or wbuBendF).

Constructing pGFPTAT (performed by Linda Guo)

The RP4 origin of transfer was amplified from pSW23T [131] with primers oriT1ERI and oriT2ERI, digested with EcoRI and cloned into the EcoRI site of pGFPTA [132] to create pGFPTAT.

Colloidal chitin preparation

Colloidal chitin was prepared essentially as described [133]. Briefly, 3 grams of chitin flakes (Sigma) was mixed with 50 ml of concentrated HCl and the mixture was incubated with shaking at 4°C overnight. To precipitate the colloidal chitin, 250ml of 50% ethanol was added to the HCl-chitin flake mixture and the solution was incubated with shaking at RT overnight. The mixture was centrifuged at 10,000 RPM for 20 min to pellet the colloidal chitin. The pellet was washed with distilled water until pH 7 was reached and was then re-suspended in 20 ml of distilled water.

Antisera production

Rabbit antisera to whole formalin killed wild type V. vulnificus cells was prepared as described in [106].

Slide agglutination tests

Overnight cultures of V. vulnificus strains CMCP6 wild type, 27562 wild type, and CMCP6- cps27562/pBAD24T::wzc diluted to an OD600 of 1. Twenty µl aliquots of each were applied in duplicate onto microscope slides. One aliquot was mixed with 20µl of rabbit antisera raised against formalin killed whole cells of the V. vulnificus parent strain. The other aliquot was mixed with sera obtained from the baseline bleed and served as the negative control. Agglutination results were scored after incubation of the mixtures at room temperature for 5 min. A distinct and immediately occurring agglutination was registered as positive while weak or no agglutination after 5 min. was considered a negative test.

Chitin transformation

Chitin transformation assay were performed as described in [30, 107] with some minor modifications. Briefly, overnight cultures were diluted 1:20 into 5 ml of fresh LB and grown

with shaking at 30°C to an OD600 of 0.5-0.6. The cells were washed with 1 ml of IO-25 and re- suspended in 10 ml of IO-25. Two ml of this was added to sterile crab shell pieces in 12-well plates and incubated for 24 h at 30°C. The supernatant was removed and replaced by 2 ml of fresh IO-25. Two µg of donor gDNA was immediately added to each well and the plates were incubated for an additional 24 h. The crab shells were removed and vortexed vigorously in 4 ml of LB for 30 seconds to detach the bacteria. Dilutions were plated on LB with and without antibiotic. Transformation frequency was calculated as the number of resistant colony forming units (CFUs) divided by total viable CFUs. gDNA was extracted from selected transformants and analyzed by PCR with the primers that targeted genes specific for the donor, recipient and transformant in each experiment. The CMCP6-specific target was vv12532 [134] The 27562 and YJ016-specific targets were the respective integron-integrase (intIA) genes [135]. The miniTn10 specific target was its Km resistance marker. Carbotype-specific genes served as targets for tracking the movement of cps loci. In mixed culture assays, only one of the strains was RfR. To test the competence inducing effects of GlcNAc or (GlcNAc)2, the procedure described above was followed except that the IO-25 media contained 5 mM of the mono or disaccharide and the bacterial suspension was added to sterile glass cover slips.

Phage infection

V. vulnificus-specific phages (Dr. Paul Gulig, University of Florida) were propagated on strain M06-24/O. Phage supernatants were sterilized by filtration through 0.22 µm filters (Millipore) and aliquots were plated on LB agar to confirm that the filtrates did not contain bacteria. To test phage sensitivity, overnight cultures of the V. vulnificus strains were diluted 1:100 in fresh LB Rf and grown to an OD600 of 0.4 at 30°C. Aliquots of the filtrates were added to 100 µl of each strain at an MOI of 10 in glass culture tubes and the sample was incubated at 30°C for 20 min. Three ml of pre-warmed top agar was added to the tube and the mixture was gently swirled before overlaying on a LB Rf plate. Plates were incubated at 30°C overnight and plaques were counted the next day. Phage 152-A10 caused near complete lysis of M06-24/O, while 27562, YJ016 and CMCP6 were resistant to infection.

Confocal laser scanning microscopy (CLSM) (performed by Linda Guo) pGFPTA was transferred to V. vulnificus by conjugation from S17.1λpir. Strains were grown in HMM with the appropriate antibiotics at 30oC. Expression of gfp was induced with IPTG when the OD600 reached 0.4 and growth was continued overnight. The next day, cultures were adjusted to an OD600 of 1.0 and diluted 1:3 in fresh media containing IPTG. Three ml was then added to sterile crab shells or glass cover slips in 12-well plates and incubated statically at 30oC for 24 or 72 h as indicated. Where indicated, phage 152-A10 (1x109 pfu) was then added and the incubation was continued for an additional 16 or 24 h. Biofilms were rinsed in Vibrio- specific PBS (VPBS; NaCl [130 mM], Na2HPO4 [5 mM], KH2PO4 [1.5 mM], pH 7.4) [136] and stained with 10 µM propidium iodide (PI) for 15 min at room temperature. Strains lacking pGFPTA were also stained with a 1:100 dilution of NanoOrange (Molecular Probes) for 1 h at room temperature. Biofilms were washed three times with 3 ml of VPBS and image stacks were captured with a Zeiss LSM 510 Axioplan 2 CLSM fitted with a W-plan APOCHROMAT 40X objective. 3-D biofilm images were visualized with Volocity (PerkinElmer). For GFP-PI stained images, green areas indicate live intact cells and red areas indicate dead cells. For NO-PI stained images, green areas indicate live cells, red areas indicate lysed cells and yellow areas indicate signal overlap and denote intact cells that are dead or dying. The 3-D axis indicator (x- axis, green arrow; y-axis, red arrow; z-axis, blue arrow) is shown for each image. COMSTAT was used to calculate Bio-volume (total number of biomass pixels multiplied by voxel size and divided by the substratum area). The percentage of dead cells was calculated as the number of PI-stained pixels divided by the total number of biomass pixels. Stack 3-D surface plots were generated with ImageJ 10.2 (National Institutes of Health, USA). Where indicated, biofilms formed by pGFPTA-carrying cells were treated with 2 U RNase-free DNase (NEB) at 0, 24, and 48 hours post-inoculation. Control samples were not treated. The biofilms were rinsed 3 times for 5 minutes in VPBS and imaged as described above.

3.4 Results

Chitin induces competence in V. vulnificus

To verify that chitin induces competence in V. vulnificus, we monitored the uptake by CMCP6 of gDNA isolated from Kanamycin resistant (KmR) transposon (Tn) libraries of strains 27562 and

YJ016. The transformation frequency (TF) in the absence of donor gDNA was used as a control. Crab shells were used as the source of chitin in transformation assays. The donor, recipient and transformants were analyzed by PCR with gene-specific primers. KmR transformants were readily obtained (TF = 1.2x10-6 ± 4.7x10-7) when the recipient was incubated in the presence of crab shells (Table 3.3). No transformants were detected in the absence of donor gDNA. As expected, the TFs were slightly higher when the recipient strain also served as the source of the donor gDNA. CMCP6 was the most competent of the strains tested (p < 0.005) and similar TFs were obtained when it was grown in the presence of shrimp shells (1.3x10-5 ± 3.8x10-6) or colloidal chitin (3.7x10-6 ± 6.8x10-7). The TFs for MO-6/24, 27562 and YJ016 were similar to one another (p > 0.3) but at least 25-fold lower than that for CMCP6 (p < 0.001). When glass cover slips, mussel or oyster shells were used as the colonization surface, no transformants were recovered for any of the strains (TF < 10-9). These results confirm that chitin induces competence in V. vulnificus. To determine the shortest oligosaccharide capable of inducing competence, RfR CMCP6 was grown on glass cover slips in media containing GlcNAc or

(GlcNAc)2 and the uptake of gDNA isolated from the MO-6/24-Tn library was monitored. R R -6 -7 Rf /Km transformants were obtained at a frequency of 1.4x10 ± 5.9x10 when (GlcNAc)2 was added to the media. No transformants were recovered with GlcNAc. This suggested that

(GlcNAc)2 was the smallest chitin-derived polymer capable of inducing competence.

KmR Tn libraries of strains 27562, YJ016 or MO-6/24 were also grown in mixed culture with a Rifampicin resistant (RfR) derivative of CMCP6 on crab shells. Transformants were selected on plates containing Km and Rf. PCR analysis with strain-specific primers indicated that CMCP6 transformants were obtained with a TF of 1.6x10-5 ± 3.7x10-6, 6.9x10-5± 6.7x10-6 and 2.9x10-5 ± 5.6x10-6 respectively (Figure 3.1). This suggested that DNA was available within the biofilm for uptake and recombination, and supported previous reports in V. cholerae and V. vulnificus [30, 36, 38, 107]. This was verified by CLSM. Cells expressing gfp were grown in the presence of crab shells for 24 h. A substantial biofilm formed on the crab shell surface (Figure 3.2A). The biofilms were then stained with propidium iodide (PI), which stains nucleic acid of dead or dying cells but is excluded from live bacteria. GFP-PI staining revealed pockets of dead/dying cells (red staining) within the biofilm (Figure 3.2B). To ascertain if extracellular nucleic acid was present, biofilms were stained with Nano-Orange (NO) and PI. NO is a general protein stain that is virtually non-fluorescent in aqueous solution, but undergoes a dramatic fluorescence

enhancement upon interaction with proteins [137]. As such, it has proven extremely useful in the staining of bacterial cell bodies and flagella [107, 138-140]. Thus, NO-PI staining was anticipated to reveal a mixture of live (green staining due to NO), intact dead or dying (yellow staining due to signal overlap of NO and PI) and dead lysed (red staining due to PI) bacteria within the biofilm. We observed areas of live, intact dead and dead lysed bacteria at the surface of the biofilm, with the latter two dominating the biofilm’s interior (Figure 3.3C). The presence of dead lysed bacteria (red staining) throughout the biofilm suggested that extracellular nucleic acid was present in the biofilm and available for transfer. In support of this notion, treatment of the biofilm with DNAse resulted in a 20-fold decrease in bio-volume relative to the control sample (Fig. 3.2D). These results supported previous studies suggesting that DNA is freely available within biofilms for uptake by the biofilm consortium [141-144].

!!!!!!"!!!!!!!!!!!!!!!!!!!!!!!!!!!!#!!!!!!!!!!!!!!!!!!!!!!!!!!!!$! !!%!!!!!!!&!!!!!!!!'!!!!!!!!!(!!!!!!!&!!!!!!!!'!!!!!!!!(!!!!!!!&!!!!!!!!!'!!!!!!!!!(!

Figure 3.1 Chitin-induces natural transformation in V. vulnificus. gDNA from the 27562-Tn donor (D), the CMCP6 recipient (R) and a representative CMCP6 transformant (T) were used as template in PCR. Lane 1, PCR using primers targeting a CMCP6-specific gene (vv12532); lane 2, PCR using primers targeting a 27562-specific gene (vvuintIA). The CMCP6 vv12532 and 27562 vvuintIA genes are elsewhere on the chromosome and are not associated with the cps loci )*+,!&! of these strains; lane 3, PCR using primers targeting the Km resistance gene of mini-Tn10.

Table 3.3 Transformation frequencies of V. vulnificus strains on crab shells

Source of donor gDNA

27562-Tn YJ016-Tn

Recipient strain

27562 8.0x10-7 ± 2.1x10-7 5.6x10-8 ± 2.7x10-8

YJ016

CMCP6 1.2x10-6 ± 4.7x10-7 1.5x10-6 ± 5.6x10-7

MO-6/24 ND 5.2X10-8 ± 3.1x10-8

Figure 3.2. Composition of V. vulnificus biofilms grown on crab shells. The 27562 and CMCP6 strains were grown in mixed culture and on crab shells in 12-well plates for 24 hours. The structure and composition of the biofilms was examined by CSLM. A, GFP-tagged cells; B, GFP-tagged cells stained with PI; C, staining with Nano-orange and PI; D, Plot of the bio- volume for DNAse treated (T) and untreated (U) biofilms of GFP-tagged cells. Results are representative of at least three independent experiments. Error bars represent standard deviations (P < 0.005).

Lytic phage facilitate natural transformation in mixed culture biofilms

To better mimic environmental conditions in which competence develops, mixed culture biofilms of gfp-tagged MO-6/24-Tn and CMCP6 were grown on crab shells and exposed for various lengths of time to a lytic phage (152-A10) that specifically infects MO-6/24. The biofilms were stained with PI and analyzed by CLSM (Figure 3.3). The relative amount of PI staining within the biofilm increased with increasing phage exposure times (from 22.7±1% of the total signal initially to 57.7±5.6% of the total signal after 16 hr). Interestingly, this level decreased thereafter (19±1.2% of the total signal at 24 hr), hinting at the lysis of dead cells during lytic infection and a potential increase in the amount of extracellular DNA. At the 16 hr time point, CMCP6 transformants were obtained at a frequency of 2.3x10-4 ± 4.1x10-5. This was an increase of 8 times over samples in which the phage was omitted. These results support the notion that lytic phages could facilitate the exchange of DNA within biofilms during chitin- induced transformation [145].

Figure 3.3. Changes in V. vulnificus biofilm composition in response to a lytic phage. The MO-6/24-Tn and CMCP6 strains were grown in mixed culture on crab shells in 12-well plates for 24 hours. The biofilms were then exposed to the MO-6/24-specific lytic phage 152-A10 for 0 (top row), 16 (middle row) and 24 hrs (bottom row). The structure and composition of the !"#$%&% biofilms was examined by CSLM. The image on the left of each row is GFP-tagged cells stained with PI. To the right are representative plots showing the relative signal intensity and distribution in the separate GFP and PI channels for the same volumetric horizontal section near the surface of the corresponding biofilm.

Chitin-induced competence mediates carbotype conversion in V. vulnificus

To determine if V. vulnificus could exchange complete or partial cps loci by natural transformation, gDNA from a chloramphenicol resistant (CmR) derivative of strain 27562 that contained a lesion in a gene (wzc::pSW23T) that is part of its 24 Kb cps locus (Fig. 3) [112] was used as donor in transformation experiments with strain CMCP6 that was grown in the presence of crab shells. CmR CMCP6 transformants were obtained at a frequency of 2.2x10-7 ± 3.7x10-6. The clones had a translucent phenotype, which suggested that they had acquired the wzc::pSW23T mutation. To confirm this, pBAD24T::wzc [112] was conjugated to 10 random transformants, and the strains were grown in the absence or presence of arabinose. The same transformants carrying the empty vector served as controls. Control strains remained translucent whether arabinose was present in the media or not. All of the transformants carrying pBAD24T::wzc remained translucent on media lacking arabinose, but had an opaque phenotype when arabinose was added to the media. gDNA from each transformant was analyzed by PCR with 15 primer pairs that spanned the 24 Kb 27562 cps locus (Figure 3.4). The results indicated that 9 of the transformants had acquired only the wzc::pSW23T mutation. However, one transformant acquired the entire cps locus in a single transformation event (Figure 3.5). This was confirmed in slide agglutination assays with antisera to wild type 27562 cells. Antisera reacted strongly with the 27562 parental strain and with the CMCP6 transformant when it was grown under inducing conditions, while no agglutination was observed with the CMCP6 parental strain or with the CMCP6 transformant that was grown under non-inducing conditions. Thus, the CMCP6 transformant that acquired the complete cps locus of strain 27562 (CMCP6- cps27562) began producing the 27562 CPS (carbotype conversion) when the wild type wzc gene was supplied in trans. Since there was no internal region of homology between the cps loci of the wzc::pSW23T donor and CMCP6 recipient strains [106], and wcvA was also acquired, this suggested that the exchange was mediated by recombination between the homologous wzabc regions at the 5’ end of the 27562 and CMCP6 cps loci and homologous regions at the 3’ end beyond wcvC in 27562 and vv1_0771 in CMCP6.

We also tagged the 24 Kb cps locus of strain MO-6/24 and the 34 Kb cps locus of strain YJ016 with the cat gene of pSW23T by targeted duplication of the wbfT and vv0343 genes, respectively (Figure 3.4). This allowed us to tag the loci with a CmR marker without disrupting cps expression. gDNA from the MO-6/24wbfT::pSW23T or YJ016vv0343::pSW23T strains was used

43 as donor in chitin transformation experiments with strain CMCP6 as the recipient. PCR with primers targeting genes at the beginning, middle and end of the respective cps loci was used to determine how much of the locus was transferred. CmR CMCP6 transformants were obtained at a frequency of 1.3x10-8 ± 0.7x10-8 when gDNA from the MO-6/24wbfT::pSW23T strain was used as donor. This TF was similar to that for the 27562-tagged cps locus and PCR analysis indicated that the entire MO-6/24 cps locus was incorporated in this strain (CMCP6-cpsMO- 6/24). No transformants were recovered using the vv0343-tagged gDNA of strain YJ016 as donor (TF < 10-9). However, when the cps locus was similarly tagged at wbfY (YJ016wbfY::pSW23T), CMCP6 transformants were obtained at a TF of 6.7x10-7 ± 4.1x10-6. PCR analysis revealed that the CMCP6 transformants had acquired the wbfY, wcvB and wcvC genes near the 3’ end of the donor YJ016 cps locus, but the genes upstream of wbfY were not transferred (Fig. 3.6). The net affect of this recombination event was the incorporation of an additional polysaccharide biosynthesis gene (wcvC) into the parental CMCP6 locus (CMCP6-wcvCYJ016). Thus, novel combinations of CPS biosynthesis genes can be generated via chitin-induced natural transformation. Although these results suggested that there might be a limitation with respect to the length of gDNA that could be successfully transferred via chitin-induced transformation (i.e. the 24 Kb cps loci of strains 276562 and MO-6/24 were acquired by CMCP6 but the 34 Kb cps locus of YJ016 was not), our inability to detect the transfer of the larger YJ016 cps locus may have been due to limitations associated with obtaining sufficient quantities of high molecular weight gDNA that would encompass the entire 34 Kb cps locus. Even under the gentlest conditions, the bulk of the gDNA isolated from the various V. vulnificus strains was typically < 35 KB (data not shown).

#%()%

!"#-% !&'(% '')*+,,)% !/1% !/&% !"#$% 0+0/$%&!!%()*%

!/0% !/"% 0<=)>?@7A-B7ACDC%EAFAB% !"#.% !/1% !/&% !"#$% !"#$% !&'9% 4562$%&3'%()*% 789% 789% !/0% !/"% 0<=)>?@7A-B7ACDC%EAFAB% !&'(%''+2;,% ''+232% ''+232% /01%2% /01%!% %%/01%3% !/1% !/&% +,-$.!'%&!!%()*% !"#-% 789% !/0%!/"% 0<=)>?@7A-B7ACDC%EAFAB% !"#8% !"#8% !"#$% !&'(% /01%2% %%%%%/01%!% %%/01%3%

!/1% !/&445.6728%

789% !"#$!%&!'%()*% !&'9% !/0% !/"% 0<=)>?@7A-B7ACDC%EAFAB% !&'(% !&':% /01%2% %%/01%#%%%%%%/01%"%%%/01%:% %%/01%!%%%%/01%'%%%%%%/01%$%%%/01%22%%%/01%23% %%/01%3% %%/01%;% %%/01%2!% %%/01%2"% %%/01%26% %%/01%2'%

Figure 3.4 Tracking the transfer of complete and partial cps loci. The loci are aligned via the GHEI%'% conserved wza-wzc genes at the 5’ end and wcvB at the 3’ end of each locus (white arrows). These regions flank carbotype-specific genes (light grey arrows). Dotted lines join regions that are otherwise contiguous on the chromosome of the respective strains. The cps locus of donor strains was tagged via targeted disruption of wzc in 27562, vv0343 or wbfY in YJ016, and wbfT in MO-6/24 using the pSW23T suicide vector (indicated as pSW), which includes a cat gene that confers chloramphenicol resistance. The black lines below the cps loci represent PCR products from primer pairs that target the region . The boxed areas that are joined by connecting lines denote regions where homologous recombination could occur in chitin-induced transformation experiments with CMCP6 as the recipient. The dark grey arrow denotes the wcvC gene within the 3’ conserved region of the YJ016 cps locus that is absent from the same region of the CMCP6 cps locus. A scale bar (in Kb) is shown at the top left.

#!!!!!!!!!%!!!!!!!!'!!!!!!!!)!!!!!!!";!!!!!!"#!!!!!!"%!!!!!!!"'! 9!!"!!!!!!!!$!!!!!!!!!&!!!!!!!!!(!!!!!!!!:!!!!!!!""!!!!!"$!!!!!!"&!!!!!!!"(!

12/23! !"!!!!!!!#!!!!!!$!!!!!!

*+,-.-+/0! %!!!!!!!&!!!!!!'!!!!! (!!!!!!)!!!!!!!

435/672385/0!

Figure 3.5 Chitin-induced transfer of the 27562 cps locus to CMCP6. gDNA from the donor wzc strain, the recipient CMCP6 strain and a representative CMCP6 transformant were used as template in PCR reactions. Lanes 1 to 14 and 17 contain the corresponding PCR fragments that span the CPS region of strain 27562 depicted in Fig. 3.4. Lane 15, PCR using primers targeting vv12532 of CMCP6; lane16, PCR using primers targeting intIA of 27562.

<-=>!&!

**./011.$ ($(*;" !&*2$ #" !"'$ !"&$ !%(,$ 3<=" !"#$ !"%$ (-./012345634787"94:46" !%(-$ !%()$ !%()$ !&*+$ *(%"+" *(%"," !" $""""""""%"""""""""""""&""""""""""""""'" $"""""%""""&"""""'""""""%""""""&"""""'"

""""""("""""")"""""("""")"""""""(""""""")" *(%"+" *(%","

Figure 3.6 Generation of hybrid cps loci by chitin-induced natural transformation. A, illustration of the hybrid cps locus of a CMCP6 transformant obtained following transformation with gDNA from YJ016::wbfT::pSW23T. B, PCR analysis on gDNA from the CMCP6 recipient (R), YJ016::wbfT::pSW23T donor (D) and a representative CMCP6 transformant (T) strains. Left panel, PCR reactions with recipient and donor-specific primers. Lanes marked C, PCR for the CMCP6 specific vv12532 gene; lanes marked Y, PCR for the YJ016 specific intIA gene. >?9@";" Right panel, PCR on the same samples to detect products PCR1 and PCR 2 as indicated in A.

3.5 Discussion

CPS is one of the few known virulence factors of V. vulnificus that is recognized to be absolutely required for pathogenicity [59]. Strains that produce a CPS are cleared from the bloodstream more slowly and are more invasive in subcutaneous tissue than acapsular cells [92]. Our genomic comparison of the CPS regions from V. vulnificus strains with different CPS carbotypes revealed that the genetically variable cps loci were flanked by conserved chromosomal regions, which suggested that they were acquired by horizontal gene transfer [102]. Here, we demonstrate that V. vulnificus can undergo carbotype conversion following the uptake and expression of complete cps loci from exogenous DNA and the conserved regions flanking the carbotype-specific cps loci served as targets for homologous recombination. The acquisition of a partial locus was also demonstrated when internal regions of homology between the endogenous and exogenous loci existed. This suggested that the same mechanism governing the transfer of complete cps loci also contributed to their evolution by generating novel combinations of CPS biosynthesis genes. Furthermore, phase variation, in which the bacteria switch from the opaque (CPS+) to translucent (CPS-) phenotype, has been widely observed among V. vulnificus isolates and even within cells of a single colony [91, 146-148]. In some cases, this switch is due to the site-specific deletion of the wzb gene [128] [147], which encodes a phosphatase required for CPS expression [1]. These wzb deletion mutants were “locked” in the translucent phase [128]. Chitin-induced transformation could provide a mechanism for these strains to revert to an opaque phenotype. Finally, the putative lps locus is adjacent to the cps locus in the genomes of CMCP6, YJ016 and 27562. The separate or simultaneous exchange of these cps and lps loci in the Vibrionaceae could provide a mechanistic basis for promoting the emergence of new pathogenic strains.

Carbotype conversion in V. vulnificus was induced by chitin and surfaces lacking chitin or with low chitin bioavailability were unable to support natural transformation in wild type cells. Since the majority of chitin in marine environments is incorporated into the exoskeletons of invertebrates, the induction of competence in V. vulnificus would necessitate sustained contact with a chitin-containing surface. Biofilm formation promotes the establishment of stable surface-associated communities. The stability of bacterial biofilms and the physical proximity of bacteria within them provide optimal environments for gene transfer to occur. The cells are sheathed in a hydrated matrix composed of polysaccharides, nucleic acids and proteins that are produced by the resident microorganisms [149]. The nucleic acid component is derived from

DNA that is released by the biofilm consortia and functions as a cell-to-cell inter-connecting component that provides stability to the structure [141-144, 150]. It also provides genetic material for exchange by natural transformation. DNA release may occur naturally with cell aging, or through the action of bacteriocins [151] or phages [152]. Biofilms can concentrate phage-sized particles over 100-fold relative to that in the surrounding water column [153] and lysis of susceptible cells can lead to the accumulation of extensive amounts of DNA within the biofilm, as we have shown. This DNA is available for uptake by species that may be or become naturally competent. When mixed culture biofilms of strains MO-6/24 and CMCP6 were exposed to a MO-6/24 specific lytic phage, there was an increase the number of CMCP6 transformants obtained. This was in agreement with previous reports demonstrating the role of lytic phages and chitin-induced competence in the emergence of new variants of pathogenic V. cholerae [145], and suggests that phage-induced lysis of susceptible strains can augment natural transformation in marine biofilm environments.

In nature, V. vulnificus exists as hundreds of different carbotypes [97, 122]. The diversity of genes involved in capsule production underscores the complexity and importance of this surface structure for the V. vulnificus. It also implies that carbotype conversion provides a selective advantage, otherwise a single or small number of carbotypes would be expected to be dominant amongst clinical and environmental isolates. The exchange of CPS loci by chitin-induced transformation is unlikely to occur during the course of human infection since there is no chitin in the human body. Carbotype conversion most likely occurs in marine environments, however, the rationale for this remains nebulous. Despite competition studies demonstrating that encapsulated strains of V. vulnificus were better adapted than acapsular strains for survival in oysters and in oyster haemocytes [154, 155], there is no indication that the type of capsule produced is important. And although many marine invertebrates are known to produce antibacterial compounds [67, 134, 135, 156-160], it is generally accepted that they only possess an innate immune response [161, 162]. This, in theory, should not drive the need for carbotype conversion, since this would better benefit bacteria confronting an acquired immune response. However, recent studies suggest the existence of specific or “primed” immunity in invertebrates (for review see [163]). If this proves to the case, then the colonization of these hosts by V. vulnificus could drive carbotype conversion and promote bacterial survival. In this scenario, the use of chitin, which is abundant in the exoskeletons of crustaceans that V. vulnificus is known to

49 colonize [109, 164-166], as an inducer of natural competence is an ingenious evolutionary development. Since no evidence exists that polysaccharide loci are preferentially acquired during natural transformation (random transposon-tagged DNA was readily taken up in chitin transformation assays), the phenomenon of chitin-induced transformation likely plays an important but general role in the evolution of this genetically promiscuous genus [30, 33, 107, 167, 168].

3.6 Conclusion and future directions

We have confirmed that chitin can induce natural competence in V. vulnificus and similar TF resulted when different source of chitin were used (crab, shrimp and colloidal chitin). [GlcNAc]2 was the smallest chitin-derived polymer able to induce natural competence in V. vulnificus. We have also demonstrated that naked DNA is readily available for exchange during growth of mixed culture biofilms on chitin. The addition of specific lytic phage to the mixed-culture biofilms facilitated greater release of DNA for genetic transformation on chitin. We have also demonstrated that chitin-induced natural competence can facilitate the exchange of entire and partial cps loci in V. vulnificus. Since V. vulnificus can colonize various chitinous surfaces, it is likely that chitin-induced competence is one of the mechanisms that is responsible for cps diversity in this species.

This study provided insight into the evolution of V. vulnificus polysaccharides by chitin-induced competence. However, there are still many questions to be answered regarding the development of competence in V. vulnificus.

The role of c-di-GMP in competence development

V. vulnificus can colonize various chitin rich marine surfaces [109, 169] It does so by forming surface-attached biofilm. The secondary messenger c-di-GMP has been shown to regulate biofilm formation in various species, including V. vulnificus [44, 52, 112, 113, 170]. In V. vulnificus c-di-GMP regulates the expression of brp locus, which encodes for proteins involved in EPS formation and biofilm development [113]. My preliminary results suggest that intracellular c-di-GMP levels can impact competence in a biofilm dependent manner but this needs to be investigated further (Figure 3.7). It may also control competence development independent of biofilm formation. c-di-GMP may control the expression/activity of unknown

50 genes/proteins (X) by binding to RNA or peptide motifs in downstream targets. Two GEMM riboswitches were found upstream of tfoY (codes for a homolog of the competence regulator TfoX) and gbpA (codes for a chitin binding protein) [56, 171]. These genes may be involved in competence and may be regulated by c-di-GMP. The roles of these proteins in competence have not been investigated (Figure 3.7). The role of c-di-GMP and competence development is addressed in Appendix B of this thesis.

Chi$n&Surface&

c.di.GMP&

Bioﬁlm& Bioﬁlm& Dependent& Independent& brp$?$$ X&?&

$EPS&?$ $%oY$gpbA$?$

Competence&

Figure 3.7 Model of the proposed regulatory networks controlling natural competence in V. vulnificus.

APPENDIX

The appendix is organized into three sections

Appendix A. Carbotype conversion and pathogenicity in V. vulnificus.

Appendix B. c-di-GMP regulates chitin-dependent competence in V. vulnificus.

Appendix C. Characterization of novel polysaccharide biosynthesis enzymes from V. vulnificus strain 27562.

A Carbotype conversion and pathogenicity in V. vulnificus

A.1 Background

V. vulnificus can undergo chitin-dependent carbotype conversion following the uptake and recombination of complete cps loci from exogenous genomic DNA (gDNA)[114]. The CPS is essential for survival in human serum, as it facilitates resistance to complement-mediated bacteriolysis and phagocytosis [90, 92, 95]. Hundreds of carbotypes have been identified among natural V. vulnificus isolates and there does not appear to be any correlation between the carbotype and pathogenic potential, as observed for V. cholerae serotypes for example. However, the role of CPS exchange and pathogenicity has not been investigated.

A.2 Hypothesis and Objective

Hypothesis

I hypothesize that different carbotypes are equally effective at promoting the survival of V. vulnificus in human sera.

Objective

To express different carbotypes in an otherwise isogenic background and test their survival in human serum.

A.3 Methods and Materials

Human Serum Survival Studies

The indicated strains were grown overnight in LB containing the appropriate antibiotics (Rf for CMCP6 and MO6/24, Rf and Cm for CMCP6-cpsMO6/24 and CMCP6-wcvCYJ016). The cells 6 were diluted 1/100 in fresh media and grown at 37°C until OD600 = 0.6. An aliquot of 100 µl (10 cells) was added to 900 µl of male human serum that was diluted to 65% with Vibrio-specific PBS and the sample was incubated at 37°C for 60 min. Viable cell counts before and after treatment were determined by serial plating on LB. The percent survival was calculated as

[CFUserum/CFUVPBS] x 100 and p values were calculated using the student’s t-test [172].

A.4 Results

Different carbotypes appear to be equally protective for survival in human serum

To ascertain if different carbotypes are equally immunoprotective, we monitored the survival of CMCP6, CMCP6wzc::pSW23T, CMCP6-cpsMO6/24 and CMCP6-wcvCYJ016 following their exposure to human serum. Since the different loci are being expressed in an otherwise isogenic background, this allowed us to specifically gauge the contribution of each carbotype to bacteria survival. Following their exposure to human serum, the percent survival was 4.6±1.9% for CMCP6 and 5±1.4% for MO6/24 (Figure A.1). A lesion in wzc of the CMCP6 cps locus resulted in a drop to less than 0.005% survival (p < 0.0005), confirming that the CPS is required for bacterial survival in human serum. The resistance to killing by human serum for the CMCP6- cpsMO6/24 (5.1±1.9%) and CMCP6-wcvCYJ016 (5.1±1.4%) strains was essentially the same as the parental CMCP6 strain (p > 0.2). These results suggested that the different carbotypes were equally immunoprotective.

3.%

0% '%()*+"+,-% /%

Figure A.1 Survival in human serum of CMCP6 strains producing different carbotypes. Strains were exposed to human serum and the number of CFU relative to untreated samples was determined. Each symbol represents the data from a single trial, and solid lines are the median percent survival. Open circles, CMCP6; closed circles, MO6/24; open diamonds, CMCP6wzc::pSW23T; open triangles, CMCP6cpsMO6/24; closed triangles, CMCP6wcvYJ016.

!"#$%&%

A.5 Discussion and future direction

Our serum survival studies suggested that different carbotypes are equally immunoprotective and may explain why no one carbotype predominates in human cases. The exchange of cps loci by chitin-induced transformation is unlikely to occur during the course of human infection since there is no chitin in the human body. Carbotype conversion most likely occurs in marine environments.

Our serum survival results are relevant, however, the studies were performed using serum from healthy individuals. The survival of the V. vulnificus strains was observed to be approximately 5%. These conditions may not completely mimic the environment experienced by V. vulnificus in individuals with elevated serum-iron levels. Survival studies can be set up with serum from immune-compromised individuals, with either chronic liver disease or with elevated serum iron.

Furthermore, human serum survival study is only one of the methods to demonstrate pathogenicity and may not depict the entire picture. To make our conclusion significant, further investigation into the role of carbotype conversion and pathogenicity is needed. Strains that have undergone carbotype conversion can be tested for their ability to evade phagocytosis by macrophages [96]. Additionally, the change in virulence after carbotype conversion can also be monitored using the iron-overloaded septicemic mouse model, which closely parallels the human disease [173]. The effect of carbotype conversion on virulence can be examined based on LD50 studies in mice.

Since only limited numbers of strains were tested, the study can be expanded to include the cps loci of various environmental and clinical isolates. The capsule region from a serum-resistant strain could also be transformed into a serum-sensitive strain and serum resistance should be conferred.

B c-di-GMP regulates chitin-dependent competence in V. vulnificus

B.1 Background

We and others have demonstrated that chitinous surfaces can induce natural competence in V. vulnificus [107, 114]. Since the majority of chitin in marine environments is incorporated into the exoskeletons of invertebrates, V. vulnificus must attach to and colonize such surfaces for competence to be induced. The second messenger c-di-GMP has been shown to regulate biofilm formation in numerous bacterial species [45, 46]. We have shown that increased c-di-GMP levels, achieved through the expression of a DGC, enhanced biofilm formation and stress resistance in V. vulnificus through the production of a cell surface EPS encoded by the brp locus [112, 113]. However, the role of the brp-encoded EPS or c-di-GMP in the development of competence is unknown. c-di-GMP has also been implicated in the regulation of gene expression and translation by directly binding to riboswitches containing the GEMM motif [55]. Putative GEMM-riboswitches were identified upstream of only two genes in V. vulnificus strains CMCP6 and YJ016 - tfoYvv and gpbAvv. TfoYvv shares homology with TfoX, a protein that regulates competence in both H. influenzae and V. cholerae [30, 34]. GpbA is a putative chitin binding protein. The potential functions of these proteins suggested that they could play a role in competence and that competence might be regulated by c-di-GMP. However, the role of these genes in competence and their regulation by c-di-GMP has not been investigated.

B.2 Hypothesis and objective

Hypothesis

I hypothesize that c-di-GMP regulates competence development in V. vulnificus in a biofilm dependent (brp EPS) and/or independent (tfoY and gbpA) manner.

Objective

To determine the role of the brp locus, tfoY and gbpA in chitin-induced competence in V. vulnificus.

B.3 Materials and Methods

Bacterial strains and media

A rifampicin resistant (RfR) derivative of CMCP6 (Anita Wright, University of Florida) was used as the recipient in chitin transformation assays. Strains were grown in LB or IO-25. All strains and plasmids used are listed in Table B.1 Antibiotics were used at the following concentrations: ampicillin (Ap), 100 µg/ml; (Rf), 100 µg/ml; kanamycin (Km), 160 µg/ml for V. vulnificus and 10 µg/ml for E. coli; chloramphenicol (Cm), 3 µg/ml for V. vulnificus and 10 µg/ml for E. coli. IPTG and L- arabinose were added to 1 mM and 0.2%, respectively.

Table B.1 Bacterial strains and plasmids used in this study. Strains Description Source V. vulnificus

CMCP6 Clinical isolate from Korea; RfR [128] CMCP6brpF::pSW23T Mutant of CMCP6 with a disruption of the brpF This glycosyltransferase; RifR, CmR study CMCP6ΔtfoYvv Mutant of CMCP6 where tfoYvv is replaced with a CmR This marker; RfR, CmR study CMCP6gbpAvv::pSW23T Mutant of CMCP6 with a disruption of the gbpAvv ; RifR, This CmR study CMCP6ΔtfoXvv Mutant of CMCP6 where tfoXvv is replaced with a CmR This marker; RfR, CmR study

E. coli TOP10 Host strain for construction of recombinant plasmids Invitrogen S17.1λpir Donor strain for conjugation [130]

Plasmids pCR2.1 TOPO cloning vector for capturing PCR producs using Invitrogen TA cloning pME6041TC Mobilizable CmR derivative of pME604; CmR This study pME6041TC::yhjH pME6041TC containing yhjH under the control of PBAD; This CmR study

57 pBAD24T Mobilizable derivative of pBAD24; ApR [174] pBAD24T::dcpA pBAD24T containing dcpA under the control of PBAD; [112] ApR vv vv pBAD24T::tfoY pBAD24T containing tfoY under the control of PBAD; This ApR study vv vv pBAD24T::tfoX pBAD24T containing tfoX under the control of PBAD; This ApR study

DNA manipulation gDNA extraction, plasmid purification, PCR and sequencing were done as described in Chapter 3 in the Materials and Methods section (3.3). All primers used in this study are listed in Table B.2.

Table B.2 Primers used in this study. Primer Name Sequence Primers used for pME6041TC construction orit1ERI GCGAATTCCTTTTCCGCTGCATAACCCTG orit2ERI GCGAATTCCGGCCAGCCTCGCAGAGC pcatF TGGTGTCCCTGTTGATACCG catEcorVRev GATATCTTACGCCCCGCCCTGCCA

Primers used for knockouts 5’vv1_2136F CAATTTTGATGTGCGACTTGC 5’vv1_2136R CGGTATCAACAGGGACACCAGCAAGCACGTTTATTATTTCTTA 3’vv1_2136F GATGTGTTATCTCGGTGTAATT 3’vv1_2136R TTCGTATGCTTGCGGAAAAGC 5’vv1_2820F AATCGACTCACATTAAATGGCA 5’vv1_2820R CGGTATCAACAGGGACACCAATCATTTTGCTCTCGAACTAAAC 3’vv1_2820F ACTCCTAATTCAAAGATTAACCC 3’vv1_2820R AGATAAGTCACTTCCTGACGC pcatF TGGTGTCCCTGTTGATACCG pcatRvv1_2136 AATTACACCGAGATAACACATCTTACGCCCCGCCCTGCC pcatRvv1_2820 GGGTTAATCTTTGAATTAGGAGTTTACGCCCCGCCCTGCC Δvv2_0044F GGCGCGGCGAATTCAGATTGGAAATATTACATCACCA Δvv2_0044R GCGGCGGCGGATCCCTCACCGTCTGTCATTGCAA

Primers used for gene amplification vv1_2136NcoIF GCCGGCCGCCATGGATGGATAAACCGATACTCAAAG vv1_2136XbaIR GGCGCGGCTCTAGACTACAAAGACAATTTATTCACTAA vv1_2820NcoIF GGCGGCCCCATGGATGGATATGACAGAACAAGCTT vv1_2820XbaIR GGGCGGCCTCTAGACTAGCAGCATGCTGCCAAA

Constructing pME6041TC::yhjH

The RP4 origin of transfer was amplified from pSW23T [131] with primers oriT1ERI and oriT2ERI, digested with EcoRI and cloned into the EcoRI site of pME6041::yhjH [175] to create pME6041T::yhjH. pME6041T::yhjH was digested with StuI to release the aph gene. The vector backbone was purified by gel extraction (BioBasic). Primers PcatFor and catEcoRVRev were used to amplify the cat gene and its promoter from pSW23T. The fragment was treated with T4 kinase and ligated to the pME6041T::yhjH StuI fragment to create pME6041TC::yhjH.

Construction of CMCP6brpF::pSW23T

Previously, pSW23T::ΔbrpF [113] was constructed by amplifying an internal 400bp fragment of brpF and cloning it into suicide plasmid pSW23T [131]. pSW23T::ΔbrpF was conjugated to V. vulnificus CMCP6. Cointegrants were selected on LB containing Rf and Cm and correct integration was confirmed by PCR.

Construction of CMCP6ΔtfoYvv, CMCP6ΔtfoXvv, CMCP6gpbAvv::pSW23T

To construct CMCP6ΔtfoYvv and CMCP6ΔtfoXvv, 1 Kb 5’ and 3’ of tfoyYvv and tfoXvv were amplified with primers 5’vv1_2136F/R , 3’vv1_2136F/R, 5’vv1_2820F/R, and 3’vv1_2820F/R using gDNA from strain CMCP6 as template. The cat gene was amplified from pSW23T with primers pcatF/pcatR-vv1_2136 and pcatF/pcatR-vv1_2820. The products contained regions that were homologous to the 5’ and 3’ ends of the tofYvv and tofXvv PCR products. The PCR products were purified and used as templates in a super-primer PCR reaction. The resulting PCR fragments were TA cloned into plasmid pCR2.1 (Invitrogen). The plasmids were linearized by digestion with PciI and were used as donor DNA in chitin-induced transformation assays with CMCP6 as the recipient. Transformants were selected on plates containing Cm and the deletion of tfoYvv and tfoXvv was confirmed by PCR.

To disrupt gpbAvv, an internal 700bp fragment of the gene was amplified with primers Δvv2_0044F/R from the gDNA of CMCP6. The fragment was cut with BamHI and EcorI and cloned into the BamHI and EcorI sites of pSW23T suicide plasmid to create pSW23T::ΔgpbAvv. The resulting plasmid was then conjugated across to strain CMCP6 and transconjugates were selected on plates containing Cm. Correct integration was confirmed by PCR.

Construction of CMCP6/pBAD24T and CMCP6/pBAD24T::dcpA

The plasmids pBAD24T and pBAD24T::dcpA [112] were conjugated across to V. vulnificus strain CMCP6. Transconjugants were selected on LB Rif Ap plates and expression was induced with L-arabinose.

Construction of CMCP6/pBAD24T::tofYvv and CMCP6/pBAD24T::tfoXvv tfoYvv and tfoXvv were amplified from gDNA of V. vulnificus strain CMCP6 with primers vv1_2136NcoIF/vv1_2136XbaIR and vv1_2820NcoIF/vv1_2820XbaIR, respectively. The products were cut with NcoI and XbaI and cloned into the NcoI and XbaI sites of pBAD24T [112]. The plasmids containing the insert were identified, transformed into S17.1 and then conjugated to CMCP6. Transconjugants were selected on LB Rf Ap plates and expression of tfoYvv and tfoXvv was induced with L-arabinose.

Chitin and Mussel Transformations

Chitin and mussel transformation was done as described in Chapter 3 in the Materials and Methods section (3.3).

Confocal laser scanning microscopy (CLSM) (performed by Linda Guo)

CLSM was done as described in Chapter 3, in the Materials and Methods section (3.3).

B.4 Results c-di-GMP regulates chitin-induced competence in a biofilm-dependent and independent manner

Since natural chitin sources are insoluble composite materials, competence development should be contingent upon colonization of a chitin-containing surface. We previously showed that biofilm formation in V. vulnificus was dependent on the expression of the brp locus, which codes for an extracellular polysaccharide (EPS) [113]. We also demonstrated that brp expression was regulated by the second messenger, c-di-GMP [112]. We hypothesized that the brp-encoded EPS and c-di-GMP might affect chitin-induced competence via their effects on biofilm formation. To investigate this, we conducted chitin transformation assays with a CMCP6 strain that harbored a

60 lesion in brpF, which codes for a glycosyltransferase required for biosynthesis of the EPS. The parental and CMCP6brpF::pSW23T strains were grown on crab shells and gDNA from the YJ016-Tn library was used as donor. The TF for the CMCP6::pSW23T strain (7.3x10-7) was 3- fold lower than that for the control strain (2.2x10-6). The same strains were tested for their ability to form biofilms on crab shells. CLSM analysis revealed that the biomass formed by the CMCP6::pSW23T strain was also 3-fold lower relative to the wild type strain (Figure B.1). This suggested that the decrease in TF for the CMCP6::pSW23T mutant relative to the wild type strain was related to a diminished ability of the mutant to form a biofilm on crab shells.

We then depleted the intracellular c-di-GMP level in CMCP6 and monitored its affect on chitin- induced competence. The phosphodiesterase gene yhjH [175] was cloned into the arabinose- inducible pME6041TC vector and transferred to CMCP6 by conjugation. CMCP6 carrying the empty vector was used as a control. Both strains were grown on crab shells under inducing conditions and gDNA from the YJ016-Tn library was used as donor. Transformants were

-6 selected on LB plates containing Km. A TF of 2.2x10 was obtained for the control strain, whereas no transformants (TF <1x10-9) were recovered for cells over-expressing yhjH. This suggested that depleting the intracellular c-di-GMP level suppressed chitin-induced transformation in V. vulnificus.

CLSM analysis revealed that the biomass formed by the CMCP6/pME6041::yhjH strain was 4- fold and 12-fold lower than the control strain on crab shells and glass cover slips, respectively (Figure B.2). However, the 4-fold decrease in biomass for the CMCP6/pME6041::yhjH strain on crab shells could not account for the 3-order magnitude drop in TF. Thus, the effect of c-di-GMP on chitin transformation was likely mitigated, at least in part, through its regulated expression of the brp locus and biofilm formation in general. However, it appears that c-di-GMP also regulates competence in a biofilm-independent manner.

We then sought to increase the intracellular c-di-GMP levels by over-expressing the DGC gene, dcpA [112]. We placed the dcpA gene under the control of an arabinose-inducible promoter in a multi-copy plasmid, pBAD24T. Overexpression of dcpA on chitin surfaces resulted in TF of 4.96x10-6, which was similar to the TF (3.21x10-6) for wild type CMCP6 carrying the empty pBAD24T plasmid. This suggested that, while depletion of intracellular c-di-GMP levels

61 inhibited competence on chitin, increasing intracellular c-di-GMP did not increase competence in V. vulnificus strains growing on chitin.

Figure B.1 Biofilm formation by the wild type and brpF mutant. The GFP-tagged CMCP6 and CMCP6ΔbrpF strains were grown on crab shells for 24 hours or glass cover slips for 72 hours in 12-well plates and stained with PI. The structure and composition of the biofilms was examined by CSLM. The image on the left of each panel is an angled view and on the right is the top-down view of the same sample. Corresponding plots of the bio-volume for each strain are also shown. Results are representative of at least three independent experiments. Error bars represent standard deviations (p<0.005).

Figure B.2 Decreased c-di-GMP levels inhibit biofilm formation by V. vulnificus. The GFP- tagged CMCP6 strain that expressed the yhjH phosphodiesterase (+PDE) or that carried the empty vector (-PDE) was grown on crab shells for 24 hours or glass cover slips for 72 hours in 12-well plates and stained with PI. The structure and composition of the biofilms was examined by CSLM. Corresponding plots of the bio-volume for each strain are also shown. Results are representative of at least three independent experiments. Error bars represent standard deviations (p<0.005).

TfoXvv is required for chitin-induced competence but tfoYvv and gpbAvv are not

Our data suggested that c-di-GMP regulates competence in a biofilm-independent manner. c-di- GMP is known to regulate gene expression through mRNA-based riboswitch effectors containing the GEMM motif [56]. Two GEMM riboswitches were identified in V. vulnificus upstream of tfoYvv and gpbAvv. The tfoYvv gene codes for protein homologue of TfoX that is required for competence in V. cholerae [30] and gbpAvv codes for a putative chitin-binding protein (GbpA) [176]. To determine if tfoYvv and gbpAvv are required for competence, the genes were disrupted in V. vulnificus strain CMCP6 and the mutants were tested for competence on chitin. The V. vulnificus tfoXvv gene was also disrupted in V. vulnificus strain CMCP6 and the knockout (ΔtfoXvv) was used as the control in transformation experiments. As expected, no transformants were obtained when the CMCP6ΔtfoXvv strain was grown in the presence of chitin. However, the TF for the CMCP6ΔtfoYvv and CMCP6gpbAvv::pSW23T strains were similar to that of the wild type strain (6.9x10-6 and 3.8x10-6, respectively). These results suggested that while TfoXvv was required for chitin-induced competence, tfoYvv and gpbAvv were dispensable under the conditions tested.

To determine if tfoYvv over-expression promoted competence in the absence of chitin or hyper- competence in its presence, the corresponding gene was amplified and cloned into pBAD24T vv and expressed from the arabinose-inducible Pbad promoter. The tfoX gene was similarly cloned into pBAD24T and served as control. While no transformants were obtained for the CMCP6/pBAD24T strain on chitin-limited surfaces (mussel shells), the TF following overexpression of tfoXvv was 1.40x10-6, confirming that the TfoXvv is required for competence. In contrast, the CMCP6/pBAD24T::tfoYvv strain did not yield any transformants under the same inducing conditions. Overexpression of tfoYvv and tfoXvv on chitin surfaces resulted in TF (2.60x10-6 and 6.95x10-6, respectively), similar to wild type CMCP6. This suggested that only TfoXvv participated in chitin-induced competence and the development of competence in the absence of chitin under the conditions tested. However, overexpression of this gene in the presence of chitin did not increase competence any further.

B.5 Discussion

The majority of chitin in marine environments is incorporated into the exoskeletons of invertebrates. As a consequence, the induction of competence in V. vulnificus would require sustained contact with a chitin surface. Biofilm formation promotes the establishment of stable surface-associated communities. The brp encoded EPS of V. vulnificus participates in biofilm formation and its production is regulated by the second messenger, c-di-GMP [113]. Disruption of the brpF glycosyltransferase caused a decrease in chitin-induced competence. This suggested that competence and biofilm formation are indeed linked, and if the ability to form a biofilm on a chitin surface is compromised, then so too is the ability to become competent. Furthermore, the drop in transformation frequency (3-fold) mirrored the drop in biofilm formation by the brp mutant (3-fold). However, c-di-GMP may also regulate competence in biofilm-independent way. Expression of the YhjH phosphodiesterase, which breaks down c-di-GMP [45], caused a 4-fold drop in biofilm biomass on crab shells. A similar drop of 4-fold in the TF was anticipated but a drop of greater than 3-orders of magnitude in TF was observed. This raises the possibility that c- di-GMP impacts competence by directly regulating the activity of enzymes or the expression genes in the competence pathway. c-di-GMP is recognized by a growing number of effectors apart from c-di-GMP metabolic enzymes. These include regulatory proteins such as PelD [177], FleQ [53] and VpsT [49]. c-di-GMP can also regulate gene expression and translation by binding to mRNA-based riboswitch effectors via GEMM motifs [56]. Two GEMM riboswitches were identified in V. vulnificus and V. cholerae [55]. One is upstream of a tfoX homologue, designated tfoYvv, and a second one is upstream of gbpAvv, a putative chitin binding protein [30].

Expression of tfoY is turned on in V. cholerae when c-di-GMP levels are elevated [56]. If tfoY is required for competence development, then low c-di-GMP levels would result in decreased competence independent of the effects of c-di-GMP on biofilm formation. GbpA is a putative chitin-binding protein and its potential role as a key determinant in chitin-induced competence is self-evident. However, when we knocked out tfoY and gpbA in V. vulnificus strain CMCP6, we did not observe a significant reduction in competence, suggesting that these genes do not participate in chitin-induced competence under the conditions tested. When TfoY was overexpressed in the presence and absence of chitin the TF were indistinguishable from the wild-type CMCP6 strain expressing the empty plasmid, further confirming that the expression of this protein maybe not be associated with the development of competence. Conversely, the disruption

65 of tfoX in V. vulnificus resulted in the loss of competence on chitin and its overexpression resulted in the induction of competence in the absence of chitin. Similar results were previously reported in V. cholerae [30, 36].

B.6 Future work

Determining the role of c-di-GMP in regulating chitin-induced competence in V. vulnificus.

Transcriptome analysis

Our data suggests that c-di-GMP participates in the regulation of competence in V. vulnificus. In order to identify members of the c-di-GMP-regulated competence pathway, microarray expression profiling will be used. The aim is to identify competence genes that are regulated by both chitin and c-di-GMP. Total RNAs will be isolated using RNeasy mini kit (Qiagen) from CMCP6 grown to mid log phase in the absence or presence of chitin and also from cells over- expressing the YhjH PDE [175]. RNA will be sent to MYcroarray (University of Michigan) for labeling and hybridization.

Raw data will be collected and normalized. Differentially regulated genes will be determined using two fold differences in gene expression and 1% false discovery rate. It is known in V. cholerae that chitin induces the expression of 41-gene regulon involved in chitin colonization, digestion, transport and assimilation [30]. Chitin has also been shown to induce genes predicted to encode a Type IV pilus assembly complex and these genes have been implicated in competence. We also expect these genes to be up-regulated in V. vulnificus during growth on chitin. c-di-GMP has been shown to regulate biofilm formation, virulence and motility [178]. Increases in intracellular c-di-GMP levels results in the induction of biofilm specific genes while decreases in intracellular levels results in the induction of virulence and motility. We suspect that the depletion of c-di-GMP in V. vulnificus will result in the induction of virulence and motility specific genes and repression of biofilm biosynthesis genes. Depletion of c-di-GMP should also repress competence specific genes. Our first task will be to find genes that are up regulated by chitin and down regulated in c-di-GMP depleted V. vulnificus in order to find competence genes that are co-regulated by chitin and c-di-GMP. Potential targets will be analyzed by BLAST to identify homologs in other species or motifs that may give an indication as to their function.

C Characterization of novel CPS biosynthesis enzymes from V. vulnificus strain 27562

C.1 Background

The CPS of V. vulnificus is unusual as it contains muramic acid and a serine amino acid modification (Figure 1.9). The genome of V. vulnificus strain 27562 clearly codes for novel CPS biosynthesis enzymes, such as a MurNAc-glycosyltransferase (GT) and a serine transferase. We sequenced the cps locus of V. vulnicifus strain 27562 (Figure 1.10) [102] and suspect that wcvD or wcvE codes for a novel MurNAc-glycosyltransferase, and that cppA codes for a novel serine transferase that modifies the CPS in a manner similar to the serine transferase reported to modify the CPS of E. coli K40 [179].

C.2 Hypothesis and objective

Hypothesis

I hypothesize that wcvD or wcvE codes for a novel muramic acid glycosyltransferase and that cppA codes for a novel serine transferase.

.Objective

To characterize the activity of WcvD, WcvE and CppA.

C.3 Materials and methods

Bacterial strains, plasmids, and media.

All bacterial strains, plasmids and primers used in this study are listed in Table C.1 and C.2. Bacteria were grown in Luria-Bertani (LB) broth at 37°C. Antibiotics when required were added to final concentration as indicated: ampicillin (Ap), 100 µg/ml; and kanamycin (Km), 10 µg/ml. IPTG were added to 1 mM final concentration.

Table C.1 Bacterial strains and plasmids used in this study Strains Description Source

E.coli TOP10 Host strain for construction of recombinant plasmids Invitrogen DH5α fhuA2 Δ(argF-lacZ)U169 phoA glnV44 Φ80 Δ(lacZ)M15 [180] gyrA96 recA1 relA1 endA1 thi-1 hsdR17 - - - BL21(DE3) F ompT hsdSB (rB mB ) gal dcm (DE3) New England Biolabs

Plasmids pCR2.1 TOPO cloning vector for capturing PCR products using Invitrogen TA cloning; ApR, KnR pMALC2X Expression vector designed to produce maltose-binding New England R protein (MBP) fusions, contains the Ptac promoter; Ap Biolabs pC2XTHIS pMALC2X derivative designed to produce 6 His N- This study terminal fusions, contains the Ptac promoter, ApR R pC2XTHIS::cppA pC2XTHIS containing cppA under the control of Ptac ;Ap This study pC2XTHIS::wcvD pC2XTHIS containing wcvD under the control of Ptac This study ;ApR R pC2XTHIS::wcvE pC2XTHIS containing wcvE under the control of Ptac ;Ap This study

Table C.2 Primers used in the study Primer Name Sequence cppA-NdeI-1 GCGGCCGCCATATGCATCATCACCATCACCACGAATTCATGA TAGGCTTTATCATTGGTAC cppA-BaHI-2 GGGATCCGAATTCCTAAACTCGACCTTTAAATATCA OriT1-pciI GCGGCCGCACATGTCTTTTCCGCTGCATAACCCT OriT2-pciI GCGGCCGCACATGTCGGCCAGCCTCGCAGAG wcvDMfeI CAATTGATGATTTATTTAATTGGGTTAAATAT wcvDSalI ACTAGTGTCGACCTAACGTTGTATGTAATCATCC wcvEMfeI CAATTGATGACTAAGGAAGCTGATATAAT wcvESalI ACTAGTGTCGACTTAAAGCAAAGAATATAAATTTTTGC

Construction of pC2XTHIS::cppA and pC2XTHIS

The cppA gene was amplified from genomic DNA of V. vulnificus strain ATCC27562 with primers, cppA-NdeI-1 and cppA-BamHI-2 to generate a 6-HIS-EcorI-cppA fragment. The fragment was digested with NdeI and BamHI. The malE gene of pMALC2X was excised by digestion with NdeI and BamHI and replaced with the 6-HIS-cppA fragment. The RP4 origin of transfer was amplified from pSW23T with primers OriT1-pciI and OriT2-pciI, digested with PciI and cloned into the PciI site in pC2XHIS::cppA to create pC2XTHIS::cppA. To generate pC2XTHIS, pC2XTHIS::cppA was digested with EcoRI to excise the cppA gene and the plasmid backbone was re-ligated.

Construction of pC2XTHIS::wcvD and pC2XTHIS::wcvE

The genes wcvD and wcvE were amplified from genomic DNA of V. vulnificus strain ATCC27562 with primers wcvDMfeI/wcvDSalI and wcvEMfeI/wcvESalI, respectively. The fragments were digested with MfeI and SalI and cloned into the EcorI and SalI sites of pC2XTHIS to generate, pC2XTHIS::wcvD and pC2XTHIS::wcvE.

Expression of CppA, WcvD, and WcvE

E. coli DH5α cells were transformed with pC2XTHIS::cppA, pC2XTHIS::wcvD, pC2XTHIS::wcvE and pC2XTHIS as control. Cultures (50 to 300 ml) were inoculated with 0.5 to 2.0 ml of an overnight pre-culture. Optimal expression was obtained by induction with 1mM IPTG for 3 hours when cultures had reach an optical density at 600nm of 0.6. Expression of 6- HIS-tagged CppA, WcvD, and WcvE was monitored by sodium dodecyl sulfate (SDS) – 10% polyacrylamide gel electrophoresis (PAGE), followed by staining with Coomassie brilliant blue R250. For Western blotting the SDS-10% PAGE gel was transferred to an Immobilon-P transfer membrane (Millipore). The membrane was blocked in TBST (TBS with 0.5% Tween-20) with 5% non-fat milk powder for 1 h at room temperature. The membrane was then incubated with primary rabbit anti-His antibody and the N-terminal His-tag was detected with a goat-anti-rabbit alkaline phosphatase conjugate.

Purification of CppA, WcvD, and WcvE

For protein production, cells were harvested 3 hours after induction and re-suspended in 25 mM Tris-HCl pH 7.4, 300 mM NaCl and 20mM imidazole. The cells were lysed by sonication on ice and the resulting suspension was centrifuged at 4°C for 60 min at 14,000 RPM. The resulting supernatant was loaded onto a HisTrap HP column (GE Healthcare). The proteins were eluted with a linear gradient of 25 mM Tris-HCl pH 7.4, 300 mM NaCl and 500 mM imidazole generated by FPLC. Fractions containing the target proteins were identified by SDS-10%-PAGE followed by staining in Coomassie brilliant blue R250 and Western blotting as previously described.

Glycosyltransferase Assay

Assays were performed in a reaction mixture (10 µl) containing, in final concentration, 25 mM 14 Tris-HCl buffer, pH 7.4, 10 mM MgCl2, 0.17mM UDP-GalA and 0.2 µCi UDP-[ C]-GlcNAc [181-183]. The reaction was initiated by the addition of 200 µg of cell extract and the mixture was incubated for 45 min at 37°C. The reactions were stopped by boiling for 1 min. Reaction components were analyzed by Thin Layer Chromatography (TLC).

TLC analysis

The glycosyltransferase assay reaction components (10µl per reaction) were applied on a TLC plate (silica gel 60, 0.25 mm-think layer of silica gel; UDP-[14C]-GlcNAc was run in an adjacent lane as standard. Plates were developed twice in 6:3:1 2-propanol-ammonium hydroxide-water or three times in 50:20:20 1-propanol:nitromethane:H2O). The TLC plates were then exposed to photographic film (Sigma) for 24h and developed (Kodak X-Mat 2000A processor).

C.4 Results

Construction of pC2XTHIS for the expression of HIS-tagged protein fusions.

To facilitate the expression of glycosyltransferase as His-tag fusion proteins, we created the expression plasmid pC2XTHIS (Figure C.1). The vector was generated by replacing the malE gene in pMALC2X with an N-terminal 6-HIS tag. pC2XTHIS carries a AmpR marker, lacZα

70 gene for blue white selection, and IPTG inducible Ptac promoter and an RP4 origin of conjugative transfer for conjugation of the plasmid to a wide range of bacteria.

Figure 5. Protein expression vector pC2XTHIS. The vector contains and IPTG inducible promoter (Ptac). RP4Orit- origin of transfer. bla Figure C.1 Proteingene- expressionAmpicillin resistance vector gene pC2XTHIS . The vector contains and IPTG inducible promoter (Ptac), an RP4 origin of transfer and a bla gene conferring ampicillin resistance.

Expression of WcvD, WcvE and CppA

The wcvD, wcvE, and cppA genes were amplified by PCR from genomic DNA of V. vulnificus strain 27562 and separately cloned into the expression vector pC2XTHIS. Expression of WcvD, WcvE, and CppA was induced with the addition of IPTG. Different concentrations of IPTG, temperature and duration of induction were analyzed to facilitate optimal expression of the proteins. At the end of each induction the bacteria were sonicated, and both the supernatant (the crude soluble extract) and insoluble pellet were analyzed for the expression of each protein using 10% SDS-PAGE gel electophoresis. Optimized expression conditions were determined to be 3 hours of induction with an IPTG concentration of 1 mM at 37 °C (an example for CppA is shown in Figure C.2). Over-expression of these glycosyltransferase resulted in the majority of the proteins precipitating with the insoluble pellet due to their association with the inner membrane.

!!!!!!!!!!6!!!!!!!!!!!!!!!7!!!!!!!!!!!!!!!8!!!!!!!!!!!!!!9!!!!!!!!!!!!!!!:!!!!!!!!!!!!!!!!!!;!!!!!!!!!!!!!!!!!"!

6<:=*.!

>8=*.!

;7=*.!

87?:=*.!

7:=*.!

Figure 8. Western blot of overexpression of CppA protein. The His- tagged CppA protein was overproduced in E.coli cells. Lane 1, uninduced cells; Lane 2, cells induced for 1 h; Lane 3, cells induced for Figure C.22 Western h; Lane 4, cells blot induced following for 3h; Lane overexpression 5, crude soluble extract; of Lane CppA 6, (40kDA). The His-tagged CppA protein wasinsoluble overproduced pellet.! in E.coli cells. Lane 1, uninduced cells; Lane 2, cells induced for 1 h; Lane 3, cells induced for 2 h; Lane 4, cells induced for 3h; Lane 5, crude soluble extract; Lane 6, insoluble pellet.

Purification of WcvD, WcvE and CppA using a Ni2+-column

Soluble extracts containing the overexpressed glycosyltransferases were purified on a HisTrap HP Ni2-column. Washing and elution steps were carried out with a continuous gradient of imidazole (from 25 mM to 500 mM), and fractions were analyzed for protein content by 10% SDS-PAGE followed by Coomassie blue staining and Western blotting. Partial purification (50%) of proteins was observed (an example for WcvD is shown in Figure C.3) however, the proteins tended to elute over a large number of fractions. The factions containing the desired proteins were collected, concentrated and re-applied to the HisTrap column. This time purification resulted in higher purity of 85% but with a lower yield of proteins. An example for WcvD is shown in Figure C.3BII

A B

M 1 2 3 4 5 6 7 8 9 M 1 2 3 4 5 6 7 8 9

1 75kDa A 1 75kDa I AI 83kDa 83kDa

62kDa Figure 8. SDS-PAGE of purified WcvD protein . The 62kDa His-tagged WcvD protein was 47.5kDa overproduced 47.5kDa in E.coli . The purification was performed with binding buffer A: 20 mM Sodium phosphate, 300 mM NaCl, and 20 32.5kDa 32.5kDa mM Imidazole. Fractions were collected with increasing concentrations 25kDa of buffer B: 20 mM 25kDa Sodium phosphate, 300 mM NaCl, and 500 mM Imidazole. Fractions were analyzed by Figure 9. SDS-PAGE of second step in 10% SDS-PAGE. A, Staining performed with purification of WcvD protein. Fractions were Coomassie briliant blue R250. B, Western analyzed by 10% SDS-PAGE. A, Staining B 1 75kDa 1 75kDa Bwith anti-His antibody. Lanes 1, Unbound performed with Coomassie briliant blue R250. B, proteins; Lane 2, Fraction 5; Lane 3, Fraction 83kDa 83kDa II 6;II Lane 4, Fraction 7; Lane 5, Fraction 8; Western with anti-His antibody. Lanes 1, 62kDa Lane 6, Fraction 62kDa 9; Lane 7, Fraction 10; Lane Unbound proteins; Lane 2, Fraction 6; Lane 3, 47.5kDa 8, Fraction 12; Lane 9, Fraction 14. 47.5kDa Fraction 7; Lane 4, Fraction 8; Lane 5, Fraction 9; Lane 6, Fraction 10; Lane 7, Fraction 11; Lane 32.5kDa 32.5kDa 8, Fraction 12; Lane 9, Fraction 13. 25kDa 25kDa

Figure C.3 Purification of WcvD (31kDA). Fractions were analyzed by 10% SDS-PAGE. A,

first-step purification. B, second-step purification. I, staining performed with Coomassie brilliant blue R250. II, Western with anti- His antibody. Lanes 1, unbound proteins; Lane 2, Fraction 6; II II Lane 3, Fraction 7; Lane 4, Fraction 8; Lane 5, Fraction 9; Lane 6, Fraction 10; Lane 7, Fraction 11; Lane 8, Fraction 12; Lane 9, Fraction 13.

In-vitro activity of WcvD and WcvE

The enzymatic activity of WcvD and WcvE was investigated in vitro by incubating the soluble extracts of E.coli overexpressing WcvD or WcvE with UDP-GalA and UDP-[14C]-GlcNAc. The reactions components were then separated by TLC on silica gel plates using different developing buffers. Radioactive spots corresponding to the nucleotide substrate were visualized by autoradiography (Figures C.4). The formation of the disaccharide GlcNAc-GalA was not observed after incubation with extracts of either BL21/pC2XTHIS::wcvD or BL21/pC2XTHIS::wcvE. The components from reactions with extracts of BL21/pC2XTHIS, BL21/pC2XTHIS::wcvD and BL21/pC2XTHIS::wcvE appeared the same.

GlcNAc

Control Control A B C 1 2 Figure. TLC analysis of oligosaccharide formed in vitro by the action of WcvD and WcvE. Control 1, [14C]-UDP- GlcNAc. Control 2, [14C]-UDP-GlucNAc and UDP-GalA. A. The supernatants from BL21/pC2XTHIS, B. BL21/ pC2XTHIS::wcvD, C. BL21/pC2XTHIS::wcvE cellswere incubated in the presence of [14C]-UDP-GlcNAc and unlabeled UDP-GalA. The TLC was developed twice times 2-propnaol-ammonium hydroxide- water (6:3:1)

GlcNAc

Control A B C 1 Figure. TLC analysis of oligosaccharide formed in vitro by the action of WcvD and WcvE. A. The supernatants from BL21/pC2XTHIS, B. BL21/pC2XTHIS::wcvD, C. BL21/pC2XTHIS::wcvE cellswere incubated in the presence of Figure C.4 TLC[14C]-UDP-GlcNAc analysis and unlabeled of oligosaccharide UDP-GalA. The TLC was developeds formed three times in in 1-propanol-nitromethan-water vitro by the action of WcvD and (50:20:20) WcvE. Control 1,[14C]-UDP- GlcNAc. Control 2, [14C]-UDP-GlucNAc and UDP-GalA. The soluble fractions from BL21/pC2XTHIS (A), BL21/pC2XTHIS::wcvD (B), and

BL21/pC2XTHIS::wcvE (C) cells were incubated in the presence of [14C]-UDP-GlcNAc and unlabeled UDP-GalA. Top, the TLC was developed twice in 2-propnaol-ammonium hydroxide- water (6:3:1). Bottom, the TLC was developed three times in 1-propanol-nitromethane-water (50:20:20).

C.5 Discussion

CPS is an essential virulence factor of V. vulnificus. Carbohydrate composition analysis revealed that the most common monosaccharides present in the CPS of V. vulnificus are rhamnose, galactosamine urinate, galactose, glucosamine and galactosamine. However, the CPS of V. vulnificus strain 27562 is unusual in two aspects; it contains muramic acid, which is rarely found outside of peptidoglycan, and it contains a serine amino acid modification, which is also uncommon. We previously identified the CPS biosynthesis locus in V. vulnificus strain 27562 [102, 106, 112]. We were able to assign a putative function to a majority of its genes with the exception of those required for the addition of GalA, MurNAc and serine. We suspected that WcvD and WcvE are the GalA and MurNAc glycosyltransferases. CppA, which shares no homology to any other known protein, is likely to be the serine transferase. To characterize the function of these genes we have constructed an expression vector, pC2XTHIS, to express the proteins as HIS-tag fusions. Over-expression of WcvD, WcvE and CppA resulted in their localization in the insoluble cell pellet. Although these proteins do not posses predicted trans- membrane regions, membrane-bound multi-protein polysaccharide biosynthesis complexes have been previously postulated [184]. A small amount of WcvD, WcvE, and CppA was found in the soluble supernatant. The soluble cell extract containing WcvD, WcvE and CppA were subjected to affinity purification by passing the extracts over a Ni+2 resin twice. This resulted in the recovery of low quantities of each protein with 85% purity based on Coomassie brilliant blue staining.

To determine glycosyltransferase activity, cell extracts of E. coli BL21(DE3) harboring pC2XTHIS::wcvD and pC2XTHIS::wcvE were incubated in the presence of radiolabeled GlcNAC and unlabeled GalA. The reaction products were separated on silica gel plates by TLC. Two separate developing buffers were used to determine the optimal separation conditions. The formation of the disaccharide GlcNAc-GalA was not observed after incubation with extracts of either BL21/pC2XTHIS::wcvD and BL21/pC2XTHIS::wcvE. The components from reactions with extracts of BL21/pC2XTHIS, BL21/pC2XTHIS::wcvD and BL21/pC2XTHIS::wcvE appeared the same. Thus, we do not yet know whether WcvD or WcvE is the MurNAc transferase or GalA transferase.

An alternative developing buffer may be needed to optimally separate all reactions components in order to detect the formation of the desired disaccharide GlcNAc-GalA. Alternatively, 2- dimension TLC assays may be used to further separate the reactions components. Conversely, using cell extracts rather than purified proteins may interfere with protein activity as the extracts may contain other glycosyltransferases that use GlcNAc or GalA as a substrate. This phenomenon is observed on the TLC, where multiple spots other than GlcNAc are detected with extracts from cells harboring just the empty pC2XTHIS plasmid. It may also be possible that the extracts contain an inactive form of the enzymes and therefore no activity is detected. Finally, although WcvD and WcvE are required for CPS production [102], it is possible that they may not be the glycosyltransferases involved in the catalysis of GlcNAc-GalA. However, the most plausible explanation for the negative results is that a lipid-anchored und-PP substrate is required for glycosyltransferase activity. This was the case for ExoM, a glycosyltransferase required for the formation of EPS in Sinorhizobium meliloti [185].

C.6 Future work

Detection of glycosyltransferase activity using a lipid-anchored substrate

The activity of WcvD and WcvE will be assayed as previously described in the materials and methods section but the reaction will contain the und-PP carrier, radiolabeled UDP-GlcNAc and E. coli extracts harboring pC2XTHIS::wecA. WecA is the first glycosyltransferases that catalyzes the transfer of GlcNAc to the lipid carrier, und-pp. The reactions components will be analyzed by TLC and the presence of und-PP-GlcNAc will be monitored as previously described in the materials and methods section. If this reaction is successful, the next set of reactions will also contain unlabled GalA and E. coli extracts harboring pC2XTHIS::wcvD or pC2XTHIS::wcvE to determine which is the GalA transferase. The presence of the und-PP- GlcNAc-GalA will be moniterd by TLC. Once the GalA transferase activity is assigned, reactions containing extracts from E. coli harboring pC2XTHIS::wcvD or pC2XTHIS::wcvE will be analyzed for MurNAc transferase activity. To determine CppA activity, similar in vitro reactions will be set up that also contain unlabeled L-serine.

Detection of glycosyltransferase activity using purified WcvD, WcvE, and CppA

Alternatively purified His-tagged WcvD, WcvE and CppA will be used in the in-vitro assays in place of the E. coli extracts. Similar reactions conditions will be set up as described above. The use of purified proteins will eliminate any contaminating products that are observed when using E. coli extracts.

Characterization of carbohydrate processing enzymes for industrial applications, bioremediation, the development of new GT-based chemo-enzymatic strategies and for the synthesis of a variety of potential therapeutics for infectious

Scientists at the National Research Centre Institute of Biological Sciences (NRC-IBS) Glycobiology division in Ottawa have long had an interest in examining the structure/function activity of various GTs and serine/threonine transferases, and developing them for the chemo- enzymatic synthesis of bioactive glycoconjugates. They have made major contributions to the understanding of GT enzymes that are involved in complex carbohydrate precursor biosynthetic pathways. Scientists at the NRC have expertise in the cloning and characterization of GT and related accessory enzymes, and in the production, engineering and application of carbohydrate active enzymes for chemo-enzymatic synthesis. They are interested in collaborating with us to characterize novel GT from V. vulnificus for their potential usefulness in industrial or medical applications.

References

1. Whitfield, C., Biosynthesis and assembly of capsular polysaccharides in Escherichia coli. Annual Review of Biochemistry, 2006. 75: p. 39-68.

2. Comstock, L.E. and D.L. Kasper, Bacterial glycans: key mediators of diverse host immune responses. Cell, 2006. 126(5): p. 847-50.

3. Whitfield, C. and A. Paiment, Biosynthesis and assembly of Group 1 capsular polysaccharides in Escherichia coli and related extracellular polysaccharides in other bacteria. Carbohydrate Research, 2003. 338(23): p. 2491-502.

4. Corbett, D. and I.S. Roberts, Capsular polysaccharides in Escherichia coli. Advances in applied microbiology, 2008. 65: p. 1-26.

5. Raetz, C.R. and C. Whitfield, Lipopolysaccharide endotoxins. Annual Review of Biochemistry, 2002. 71: p. 635-700.

6. Jean-Baptiste, E., Cellular mechanisms in sepsis. Journal of intensive care medicine, 2007. 22(2): p. 63-72.

7. Trent, M.S., Biosynthesis, transport, and modification of lipid A. Biochemistry and cell biology = Biochimie et biologie cellulaire, 2004. 82(1): p. 71-86.

8. Heinrichs, D.E., J.A. Yethon, and C. Whitfield, Molecular basis for structural diversity in the core regions of the lipopolysaccharides of Escherichia coli and Salmonella enterica. Molecular Microbiology, 1998. 30(2): p. 221-32.

9. Ramamurthy, T., et al., Emergence of novel strain of Vibrio cholerae with epidemic potential in southern and eastern India. Lancet, 1993. 341(8846): p. 703-4.

10. Blokesch, M. and G.K. Schoolnik, Serogroup conversion of Vibrio cholerae in aquatic reservoirs. PLoS Pathog. 3, e81, 2007.

11. Karlyshev, A.V., et al., Analysis of Campylobacter jejuni capsular loci reveals multiple mechanisms for the generation of structural diversity and the ability to form complex heptoses. Molecular Microbiology, 2005. 55(1): p. 90-103.

12. Mavroidi, A., et al., Evolutionary genetics of the capsular locus of serogroup 6 pneumococci. Journal of bacteriology, 2004. 186(24): p. 8181-92.

13. Patil, P.B. and R.V. Sonti, Variation suggestive of horizontal gene transfer at a lipopolysaccharide (lps) biosynthetic locus in Xanthomonas oryzae pv. oryzae, the bacterial leaf blight pathogen of rice. BMC microbiology, 2004. 4: p. 40.

14. Raymond, C.K., et al., Genetic variation at the O-antigen biosynthetic locus in Pseudomonas aeruginosa. Journal of bacteriology, 2002. 184(13): p. 3614-22.

15. Griffifths AJF, M.J., Suzuki DT, Lewontin, RC, and Gelbart, WM, An introduction to genetic analysis, 7th edition2000, New York: W.H. Freeman.

16. Ochman, H., J.G. Lawrence, and E.a. Groisman, Lateral gene transfer and the nature of bacterial innovation. Nature, 2000. 405: p. 299-304.

17. Johnsborg, O., V. Eldholm, and L.S. Håvarstein, Natural genetic transformation: prevalence, mechanisms and function. Research in microbiology, 2007. 158: p. 767-78.

18. Dutta, C. and A. Pan, Horizontal gene transfer and bacterial diversity. Journal of biosciences, 2002. 27: p. 27-33.

19. Jiang, S.C. and J.H. Paul, Gene transfer by transduction in the marine environment. Applied and Environmental Microbiology, 1998. 64(8): p. 2780-7.

20. Schicklmaier, P. and H. Schmieger, Frequency of generalized transducing phages in natural isolates of the Salmonella typhimurium complex. Applied and Environmental Microbiology, 1995. 61(4): p. 1637-40.

21. Heinemann, J.A. and G.F. Sprague, Jr., Bacterial conjugative plasmids mobilize DNA transfer between bacteria and yeast. Nature, 1989. 340(6230): p. 205-9.

22. Dubnau, D., DNA Uptake in Bacteria. Annual Review in Microbiology, 1999. 53: p. 217- 244.

23. Chen, I. and D. Dubnau, DNA uptake during bacterial transformation. Nature reviews. Microbiology, 2004. 2: p. 241-9.

24. Lorenz, M.G. and W. Wackernagel, Bacterial gene transfer by natural genetic transformation in the environment. Microbiological reviews, 1994. 58: p. 563-602.

25. Solomon, J.M. and a.D. Grossman, Who's competent and when: regulation of natural genetic competence in bacteria. Trends in genetics : TIG, 1996. 12: p. 150-5.

26. Hamoen, L.W., G. Venema, and O.P. Kuipers, Controlling competence in Bacillus subtilis: shared use of regulators. Microbiology, 2003. 149(Pt 1): p. 9-17.

27. Johnsborg, O. and L.S. Havarstein, Regulation of natural genetic transformation and acquisition of transforming DNA in Streptococcus pneumoniae. FEMS Microbiology Reviews, 2009. 33(3): p. 627-42.

28. Morrison, D.A. and M.S. Lee, Regulation of competence for genetic transformation in Streptococcus pneumoniae: a link between quorum sensing and DNA processing genes. Research in Microbiology, 2000. 151(6): p. 445-51.

29. Macfadyen, L.P., Regulation of competence development in Haemophilus influenzae. Journal of theoretical biology, 2000. 207: p. 349-59.

30. Meibom, K.L., et al., Chitin induces natural competence in Vibrio cholerae. Science (New York, N.Y.), 2005. 310: p. 1824-7.

31. Meibom, K.L., et al., The Vibrio cholerae chitin utilization program. Proceedings of the National Academy of Sciences of the United States of America, 2004. 101: p. 2524-9.

32. Ruby, E.G. and K.H. Lee, The Vibrio fischeri-Euprymna scolopes Light Organ Association: Current Ecological Paradigms. Applied and Environmental Microbiology, 1998. 64(3): p. 805-12.

33. Pollack-Berti, A., M.S. Wollenberg, and E.G. Ruby, Natural transformation of Vibrio fischeri requires tfoX and tfoY. Environmental microbiology, 2010.

34. Zulty, J.J. and G.J. Barcak, Identification of a DNA transformation gene required for com101A+ expression and supertransformer phenotype in Haemophilus influenzae. Proceedings of the National Academy of Sciences of the United States of America, 1995. 92: p. 3616-20.

35. Bhattacharjee, M.K., D.H. Fine, and D.H. Figurski, tfoX (sxy)-dependent transformation of Aggregatibacter (Actinobacillus) actinomycetemcomitans. Gene, 2007. 399(1): p. 53- 64.

36. Blokesch, M. and G.K. Schoolnik, The extracellular nuclease Dns and its role in natural transformation of Vibrio cholerae. Journal of Bacteriology, 2008. 190: p. 7232-40.

37. Sinha, S., A.D.S. Cameron, and R.J. Redfield, Sxy induces a CRP-S regulon in Escherichia coli. Journal of bacteriology, 2009. 191: p. 5180-95.

38. Yamamoto, S., et al., Chitin disaccharide (GlcNAc)(2) induces natural competence in Vibrio cholerae through transcriptional and translational activation of a positive regulatory gene tfoX(VC). Gene, 2010. 457: p. 42-49.

39. Yamamoto, S., et al., Identification of a Chitin-Induced Small RNA That Regulates Translation of the tfoX Gene, Encoding a Positive Regulator of Natural Competence in Vibrio cholerae. Journal of bacteriology, 2011. 193(8): p. 1953-65.

40. Sutherland, I.W., The biofilm matrix--an immobilized but dynamic microbial environment. Trends in microbiology, 2001. 9: p. 222-7.

41. Stanley, N.R. and B.A. Lazazzera, Environmental signals and regulatory pathways that influence biofilm formation. Molecular Microbiology, 2004. 52(4): p. 917-924.

42. Smirnova, T.A., et al., Structural and functional characteristics of bacterial biofilms. Microbiology, 2010. 79(4): p. 413-423.

43. Ross, P., et al., Regulation of cellulose synthesis in Acetobacter xylinum by cyclic diguanylic acid. Nature, 1987. 325: p. 279-281.

44. Hengge, R., Principles of c-di-GMP signalling in bacteria. Nature reviews. Microbiology, 2009. 7: p. 263-73.

45. Römling, U. and D. Amikam, Cyclic di-GMP as a second messenger. Current opinion in microbiology, 2006. 9: p. 218-28.

46. Camilli, A. and B.L. Bassler, Bacterial small-molecule signaling pathways. Science (New York, N.Y.), 2006. 311: p. 1113-6.

47. Fouhy, Y., et al., Cell-cell signaling, cyclic di-GMP turnover and regulation of virulence in Xanthomonas campestris. Research in Microbiology, 2006. 157(10): p. 899-904.

48. Jenal, U. and J. Malone, Mechanisms of cyclic-di-GMP signaling in bacteria. Annual review of genetics, 2006. 40: p. 385-407.

49. Krasteva, P.V., et al., Vibrio cholerae VpsT regulates matrix production and motility by directly sensing cyclic di-GMP. Science, 2010. 327(5967): p. 866-8.

50. Amikam, D. and M.Y. Galperin, PilZ domain is part of the bacterial c-di-GMP binding protein. Bioinformatics, 2006. 22(1): p. 3-6.

51. Ko, J., et al., Structure of PP4397 reveals the molecular basis for different c-di-GMP binding modes by Pilz domain proteins. Journal of molecular biology, 2010. 398(1): p. 97-110.

52. Christen, B., et al., Allosteric control of cyclic di-GMP signaling. The Journal of biological chemistry, 2006. 281(42): p. 32015-24.

53. Hickman, J.W. and C.S. Harwood, Identification of FleQ from Pseudomonas aeruginosa as a c-di-GMP-responsive transcription factor. Molecular Microbiology, 2008. 69(2): p. 376-89.

54. Winkler, W.C. and R.R. Breaker, Regulation of Bacterial Gene Expression by Riboswitches. Annual Review of Microbiology, 2005. 59: p. 487-517.

55. Weinberg, Z., et al., Identification of 22 candidate structured RNAs in bacteria using the CMfinder comparative genomics pipeline. Nucleic Acids Research, 2007. 35: p. 4809- 4819.

56. Sudarsan, N., et al., Riboswitches in eubacteria sense the second messenger cyclic di- GMP. Science (New York, N.Y.), 2008. 321: p. 411-3.

57. Smith, K.D., et al., Structural and biochemical determinants of ligand binding by the c- di-GMP riboswitch. Biochemistry, 2010. 49(34): p. 7351-9.

58. Gulig, P.A., K.L. Bourdage, and A.M. Starks, Molecular pathogenesis of Vibrio vulnificus. The Journal of Microbiology, 2005. 43: p. 118-131.

59. Jones, M.K. and J.D. Oliver, Vibrio vulnificus: disease and pathogenesis. Infection and immunity, 2009. 77: p. 1723-33.

60. Linkous, D.A. and J.D. Oliver, Pathogenesis of Vibrio vulnificus. FEMS Microbiology Letters, 1999. 174: p. 207-214.

61. Strom, M.S. and R.N. Paranjpye, Epidemiology and pathogenesis of Vibrio vulnificus. Microbes and Infection, 2000. 2: p. 177-188.

62. Chan, W.L., C.H. Chan, and T.Y. Chan, Vibrio vulnificus septicaemia and necrotizing fasciitis after a prick from the dorsal fin of a tilapia. Transactions of the Royal Society of Tropical Medicine and Hygiene, 1999. 93: p. 174.

63. Wise, K.A. and P.J. Newton, A fatal case of Vibrio vulnificus septicemia. Pathology, 1992. 24: p. 121-122.

64. Zuppardo, A.B., et al., Heterogeneity of environmental, retail, and clinical isolates of Vibrio vulnificus as determined by lipopolysaccharide-specific monoclonal antibodies. Journal of food protection, 2001. 64(8): p. 1172-7.

65. Todd, E.C., Costs of acute bacterial foodborne disease in Canada and the United States. International journal of food microbiology, 1989. 9: p. 313-26.

66. Warnock, E.W.I. and T.L. MacMath, Primary Vibrio vulnificus septicemia. Journal of Emergency Medicine, 1993. 11: p. 153-156.

67. Wei, O.Y., R. Xavier, and K. Marimuthu, Screening of antibacterial activity of mucus extracts of snake head fish, Channa striatus (Bloch). European Review Medical Pharmacology Sciences, 2010. 14: p. 675-681.

68. Wright, A.C., L.M. Simpson, and J.D. Oliver, Role of iron in the pathogenesis of Vibrio vulnificus infections. Infection and Immunity, 1981. 34: p. 503-7.

69. Weinberg, E.D., Iron and infection. Microbiological reviews, 1978. 42(1): p. 45-66.

70. Simpson, L.M. and J.D. Oliver, Siderophore production by Vibrio vulnificus. Infection and immunity, 1983. 41(2): p. 644-9.

71. Kim, I.H., et al., Nonribosomal peptide synthase is responsible for the biosynthesis of siderophore in Vibrio vulnificus MO6-24/O. Journal of Microbiology and Biotechnology, 2008. 18(1): p. 35-42.

72. Liu, M., et al., The HlyU protein is a positive regulator of rtxA1, a gene responsible for cytotoxicity and virulence in the human pathogen Vibrio vulnificus. Infection and immunity, 2007. 75(7): p. 3282-9.

73. Webster, A.C. and C.M. Litwin, Cloning and characterization of vuuA, a gene encoding the Vibrio vulnificus ferric vulnibactin receptor. Infection and immunity, 2000. 68(2): p. 526-34.

74. Gray, L.D. and A.S. Kreger, Mouse skin damage caused by cytolysin from Vibrio vulnificus and by V. vulnificus infection. The Journal of infectious diseases, 1987. 155(2): p. 236-41.

75. Kim, H.R., et al., Hemolytic mechanism of cytolysin produced from V. vulnificus. Life sciences, 1993. 53(7): p. 571-7.

76. Kook, H., et al., Vibrio vulnificus hemolysin dilates rat thoracic aorta by activating guanylate cyclase. Life sciences, 1996. 59(3): p. PL41-7.

77. Kreger, A. and D. Lockwood, Detection of extracellular toxin(s) produced by Vibrio vulnificus. Infection and immunity, 1981. 33(2): p. 583-90.

78. Wright, A.C., et al., Cloning of the cytotoxin-hemolysin gene of Vibrio vulnificus. Infection and immunity, 1985. 50(3): p. 922-4.

79. Chang, T.M., et al., Cloning and sequence analysis of a novel hemolysin gene (vllY) from Vibrio vulnificus. Applied and Environmental Microbiology, 1997. 63(10): p. 3851-7.

80. Chen, Y.C., et al., Characterization and virulence of hemolysin III from Vibrio vulnificus. Current microbiology, 2004. 49(3): p. 175-9.

81. Smith, G.C. and J.R. Merkel, Collagenolytic activity of Vibrio vulnificus: potential contribution to its invasiveness. Infection and immunity, 1982. 35(3): p. 1155-6.

82. Kothary, M.H. and A.S. Kreger, Purification and characterization of an elastolytic protease of Vibrio vulnificus. Journal of general microbiology, 1987. 133(7): p. 1783-91.

83. Molla, A., et al., Activation of hageman factor and prekallikrein and generation of kinin by various microbial proteinases. The Journal of biological chemistry, 1989. 264(18): p. 10589-94.

84. Kim, Y.R. and J.H. Rhee, Flagellar basal body flg operon as a virulence determinant of Vibrio vulnificus. Biochemical and biophysical research communications, 2003. 304(405- 410).

85. Lee, J.H., et al., Role of flagellum and motility in pathogenesis of Vibrio vulnificus. Infection and immunity, 2004. 72(8): p. 4905-10.

86. McPherson, V.L., et al., Physiological effects of the lipopolysaccharide of Vibrio vulnificus on mice and rats. Microbios, 1991. 67(272-273): p. 141-9.

87. Park, K.H., et al., Low-density lipoprotein protects Vibrio vulnificus-induced lethality through blocking lipopolysaccharide action. Experimental & molecular medicine, 2007. 39(5): p. 673-8.

88. Powell, J.L., et al., Release of tumor necrosis factor alpha in response to Vibrio vulnificus capsular polysaccharide in In Vivo and In Vitro models. Infection and Immunity, 1997. 65: p. 3713-3718.

89. Kreger, A., L. DeChatelet, and P. Shirley, Interaction of Vibrio vulnificus with human polymorphonuclear leukocytes: association of virulence with resistance to phagocytosis. The Journal of infectious diseases, 1981. 144(3): p. 244-8.

90. Simpson, L.M., et al., Correlation between virulence and colony morphology in Vibrio vulnificus. Infection and Immunity, 1987. 55: p. 269-272.

91. Wright, a.C., et al., Phenotypic evaluation of acapsular transposon mutants of Vibrio vulnificus. Infection and immunity, 1990. 58: p. 1769-73.

92. Yoshida, S.I., M. Ogawa, and Y. Mizuguchi, Relation of capsular materials and colony opacity to virulence of Vibrio vulnificus. Infect. Immun, 1985. 47: p. 446-451.

93. Johnson, D.E., et al., Resistance of Vibrio vulnificus to serum bactericidal and opsonizing factors: relation to virulence in suckling mice and humans. The Journal of infectious diseases, 1984. 150(3): p. 413-8.

94. Shinoda, S., et al., Inhibitory effect of capsular antigen of Vibrio vulnificus on bactericidal activity of human serum. Microbiology and Immunology, 1987. 31: p. 393- 401.

95. Tamplin, M.L., et al., Differential complement activation and susceptibility to human serum bactericidal action by Vibrio species. Infection and Immunity, 1983. 42: p. 1187- 90.

96. Tamplin, M.L., et al., Vibrio vulnificus resists phagocytosis in the absence of serum opsonins. Infection and Immunity, 1985. 49: p. 715-718.

97. Bush, C.A., et al., Classifation of Vibrio vulnificus strains by the carbohydrated composition of their capsular polysaccharides. Analytical Biochemistry, 1997. 195: p. 186-195.

98. Gunawardena, S., et al., Structure of a muramic acid containing capsular polysaccharide from the pathogenic strain of Vibrio vulnificus ATCC 27562. Carbohydrate Research, 1998. 309: p. 65-76.

99. Reddy, G.P., et al., Purification and determination of the structure of capsular polysaccharide of Vibrio vulnificus M06-24. Journal of bacteriology, 1992. 174: p. 2620- 30.

100. Reddy, G.P., et al., Capsular polysaccharide structure of a clinical isolate of Vibrio vulnificus strain BO62316 determined by heteronuclear NMR spectroscopy and high- performance anion-exchange chromatography., in Analytical biochemistry1993. p. 106- 15.

101. Reddy, G.P., et al., Structure determination of the capsular polysaccharide from Vibrio vulnificus strain 6353. European Journal of Biochemistry, 1998. 255: p. 279-288.

102. Nakhamchik, A., et al., Evidence for the horizontal transfer of an unusual capsular polysaccharide biosynthesis locus in marine bacteria. Infection and immunity, 2010. 78: p. 5214-22.

103. Vollmer, W., D. Blanot, and M.A. de Pedro, Peptidoglycan structure and architecture. FEMS Microbiology Reviews, 2008. 32: p. 149-67.

104. Banoub, J.H., et al., Structural elucidation of the O-specific antigen of Yersinia ruckerii by fast atom bombardment mass spectrometry (FAB-MS), in Biomedial and Environmental Mass Spectrometry1990. p. 787-790.

105. Heijenoort, J.V., Formation of the glycan chains in the synthesis of bacterial peptidoglycan. Glycobiology, 2001. 11: p. 25R-36.

106. Nakhamchik, A., C. Wilde, and D.A. Rowe-magnus, Identification of a Wzy polymerase required for group IV capsular polysaccharide and lipopolysaccharide biosynthesis in Vibrio vulnificus. Infection and Immunity, 2007. 75: p. 5550-5558.

107. Gulig, P.A., et al., USER friendly cloning coupled with chitin-based natural transformation enables rapid mutagenesis of Vibrio vulnificus. Applied and Environmental Microbiology, 2009. 75: p. 4936-4949.

108. Bisharat, N., et al., The evolution of genetic structure in the marine pathogen, Vibrio vulnificus. Infection, genetics and evolution : journal of molecular epidemiology and evolutionary genetics in infectious diseases, 2007. 7: p. 685-93.

109. Davis, J.W. and R.K. Sizemore, Incidence of Vibrio species associated with blue crabs (Callinectes sapidus) collected from Galveston Bay, Texas. Applied and environmental microbiology, 1982. 43: p. 1092-7.

110. Fouz, N., et al., Transmission to Eels , Portals of Entry , and Putative Reservoirs of Vibrio vulnificus Serovar E ( Biotype 2 ). Society, 2001. 67: p. 4717-4725.

111. Morris, J.G., Cholera and other types of vibriosis: a story of human pandemics and oysters on the half shell. Clinical Infectious Diseases, 2003. 37: p. 272-280.

112. Nakhamchik, A., C. Wilde, and D.A. Rowe-Magnus, Cyclic-di-GMP regulates extracellular polysaccharide production, biofilm formation, and rugose colony development by Vibrio vulnificus. Applied and Environmental Microbiology, 2008. 74: p. 4199-209.

113. Guo, Y. and D.a. Rowe-Magnus, Identification of a c-di-GMP-regulated polysaccharide locus governing stress resistance and biofilm and rugose colony formation in Vibrio vulnificus. Infection and immunity, 2010. 78: p. 1390-402.

114. Neiman, J., Y. Guo, and A.D. Rowe-Magnus, Chitin-induced carbotype conversion in Vibrio vulnificus. Infection and Immunity, 2011. 79(8): p. 3195-203.

115. Marais, D.J., Earth's Early Biosphere1983, New Jersey: Princeton University Press.

116. Finlay, B.B. and S. Falkow, Common themes in microbial pathogenicity revisited. Microbioliology and Molecular Biology Review, 1997. 61(2): p. 136-69.

117. Marco-Noales, E., et al., Transmission to eels, portals of entry, and putative reservoirs of Vibrio vulnificus serovar E (biotype 2). Applied and Environmental Microbiology, 2001. 67(10): p. 4717-25.

118. Bisharat, N., et al., Clinical, epidemiological, and microbiological features of Vibrio vulnificus biogroup 3 causing outbreaks of wound infection and bacteraemia in Israel. Lancet, 1999. 354(9188): p. 1421-4.

119. Hor, L.I., T.T. Chang, and S.T. Wang, Survival of Vibrio vulnificus in whole blood from patients with chronic liver diseases: association with phagocytosis by neutrophils and serum ferritin levels. Journal of Infectious Diseases, 1999. 179(1): p. 275-8.

120. Kashimoto, T., et al., Vibrio vulnificus Induces Macrophage Apoptosis In Vitro and In Vivo. Infection and Immunity, 2003. 71(1): p. 533-535.

121. Wright, A.C., et al., Identification of a Group 1-Like Capsular Polysaccharide Operon for Vibrio vulnificus. Infection and Immunity, 2001. 69(11): p. 6893-6901.

122. Hayat, U., et al., Capsular types of Vibrio vulnificus: an analysis of strains from clinical and environmental sources. J Infect Dis, 1993. 168(3): p. 758-62.

123. Falini, G. and S. Fermani, Chitin mineralization. Tissue Engineering, 2004. 10(1-2): p. 1- 6.

124. Kurita, K., Chitin and chitosan: functional biopolymers from marine crustaceans. Mar Biotechnol (NY), 2006. 8(3): p. 203-26.

125. Bik, E.M., et al., Genesis of the novel epidemic Vibrio cholerae O139 strain: evidence for horizontal transfer of genes involved in polysaccharide synthesis. Embo Journal, 1995. 14(2): p. 209-16.

126. Comstock, L.E., et al., Cloning and sequence of a region encoding a surface polysaccharide of Vibrio cholerae O139 and characterization of the insertion site in the chromosome of Vibrio cholerae O1. Molecular Microbiology, 1996. 19(4): p. 815-26.

127. Comstock, L.E., et al., The capsule and O antigen in Vibrio cholerae O139 Bengal are associated with a genetic region not present in Vibrio cholerae O1. Infection and Immunity, 1995. 63(1): p. 317-23.

128. Chatzidaki-Livanis, M., M.K. Jones, and A.C. Wright, Genetic variation in the Vibrio vulnificus group 1 capsular polysaccharide operon. Journal of bacteriology, 2006. 188(5): p. 1987-98.

129. Wright, A.C., et al., Identication of a group 1-like Capsular polysaccharide operon for Vibrio vulnificus. Infection and Immunity, 2001. 69: p. 6893-6901.

130. Simon, R., U.B. Priefer, and A. Puhler, A broad host range mobilization system for in vitro genetic engineering: transposon mutagenesis in Gram negative bacteria. Nature Biotechnology, 1983. 1: p. 784-791.

131. Demarre, G., et al., A new family of mobilizable suicide plasmids based on broad host range R388 plasmid (IncW) and RP4 plasmid (IncPalpha) conjugative machineries and their cognate Escherichia coli host strains. Research in microbiology, 2005. 156: p. 245- 55.

132. Ito, Y., M. Suzuki, and Y. Husimi, A T-extended vector using a green fluorescent protein as an indicator. Gene, 2000. 245(1): p. 59-63.

133. Shimahara, K. and Y. Takiguchi, Preparation of crustacean chitin. Methods in Enzymology 1988. 161: p. 417-423.

134. Smith, V.J., A.P. Desbois, and E.a. Dyrynda, Conventional and unconventional antimicrobials from fish, marine invertebrates and micro-algae. Marine drugs, 2010. 8: p. 1213-62.

135. Subramanian, S., N.W. Ross, and S.L. MacKinnon, Comparison of antimicrobial activity in the epidermal mucus extracts of fish. Comparative biochemistry and physiology. Part B, Biochemistry & molecular biology, 2008. 150: p. 85-92.

136. CFSAN, Bacteriological Analytical Manual. 8th ed1998, Silver Spring, MD: Centre for Food Safety and Applied Nutrition, U.S. Food and Drug Administration.

137. Jones, L.J., R.P. Haugland, and V.L. Singer, Development and characterization of the NanoOrange protein quantitation assay: a fluorescence-based assay of proteins in solution. BioTechniques, 2003. 34(4): p. 850-4, 856, 858 passim.

138. Grossart, H.P., et al., A simple, rapid method for demonstrating bacterial flagella. Applied and environmental microbiology, 2000. 66(8): p. 3632-6.

139. Alonso, J.L., et al., Double-staining method for differentiation of morphological changes and membrane integrity of Campylobacter coli cells. Applied and environmental microbiology, 2002. 68(10): p. 5151-4.

140. Tsang, P.H., et al., Adhesion of single bacterial cells in the micronewton range. Proceedings of the National Academy of Sciences of the United States of America, 2006. 103(15): p. 5764-8.

141. Mann, E.E., et al., Modulation of eDNA release and degradation affects Staphylococcus aureus biofilm maturation. PloS one, 2009. 4(6): p. e5822.

142. Mulcahy, H., L. Charron-Mazenod, and S. Lewenza, Extracellular DNA chelates cations and induces antibiotic resistance in Pseudomonas aeruginosa biofilms. PLoS Pathog, 2008. 4(11): p. e1000213.

143. Svensson, S.L., et al., The CprS sensor kinase of the zoonotic pathogen Campylobacter jejuni influences biofilm formation and is required for optimal chick colonization. Molecular microbiology, 2009. 71(1): p. 253-72.

144. Dominiak, D.M., J.L. Nielsen, and P.H. Nielsen, Extracellular DNA is abundant and important for microcolony strength in mixed microbial biofilms. Environmental microbiology, 2011. 13(3): p. 710-21.

145. Udden, S.M., et al., Acquisition of classical CTX prophage from Vibrio cholerae O141 by El Tor strains aided by lytic phages and chitin-induced competence. Proc Natl Acad Sci U S A, 2008. 105(33): p. 11951-6.

146. Hilton, T., et al., Capsular polysaccharide phase variation in Vibrio vulnificus. Applied and Environmental Microbiology, 2006.

147. Rosche, T.M., B. Smith, and J.D. Oliver, Evidence for an intermediate colony morphology of Vibrio vulnificus. Applied and Environmental Microbiology, 2006. 72(6): p. 4356-9.

148. Grau, B.L., M.C. Henk, and G.S. Pettis, High-Frequency Phase Variation of Vibrio vulnificus 1003: Isolation and Characterization of a Rugose Phenotypic Variant. Journal of Bacteriology, 2005. 187(7): p. 2519-2525.

149. Stoodley, P., et al., Biofilms as complex differentiated communities. Annual Review of Microbiology, 2002. 56: p. 187-209.

150. Allesen-Holm, M., et al., A characterization of DNA release in Pseudomonas aeruginosa cultures and biofilms. Mol Microbiol, 2006. 59(4): p. 1114-28.

151. Riley, M.A. and J.E. Wertz, BACTERIOCINS: Evolution, Ecology, and Application. Annual Review of Microbiology, 2002. 56(1): p. 117-137.

152. Sutherland, I.W., et al., The interaction of phage and biofilms. FEMS Microbiology Letters, 2004. 232: p. 1-6.

153. Flood, J.A. and N.J. Ashbolt, Virus-sized particles can be entrapped and concentrated one hundred fold within wetland biofilms. Advances in Environmental Research, 2000. 3: p. 403-411.

154. Srivastava, M., et al., Phase variation, capsular polysaccharide, pilus and flagella contribute to uptake of Vibrio vulnificus by the Eastern oyster (Crassostrea virginica). Environ Microbiol, 2009. 11(8): p. 1934-44.

155. Harris-Young, L., et al., Viability of Vibrio vulnificus in Association with Hemocytes of the American Oyster (Crassostrea virginica). Applied and Environmental Microbiology, 1995. 61(1): p. 52-57.

156. Dorrington, T., L. Villamil, and M. Gomez-chiarri, Upregulation in response to infection and antibacterial activity of oyster histone H4. Fish Shellfish Immunol, 2011. 30(1): p. 94-101.

157. Gueguen, Y., et al., Oyster hemocytes express a proline-rich peptide displaying synergistic antimicrobial activity with a defensin. Molecular Immunology, 2009. 46(4): p. 516-22.

158. Bragadeeswaran, S. and S. Thangaraj, Hemolytic and antibacterial studies on skin mucus of eel fish, Anguilla anguilla Linnaues, 1758. Asian Journal of Biological Sciences, 2011. 4: p. 272-276.

159. Tasumi, S., et al., Primary structure and characteristics of a lectin from skin mucus of the Japanese eel Anguilla japonica. J Biol Chem, 2002. 277(30): p. 27305-11.

160. Pelon, W., R.B. Luftig, and K.H. Johnston, Vibrio vulnificus load reduction in oysters after combined exposure to Vibrio vulnificus--specific bacteriophage and to an oyster extract component. J Food Prot, 2005. 68(6): p. 1188-91.

161. Chen, F.Y., et al., Identification of genes differentially expressed in hemocytes of Scylla paramamosain in response to lipopolysaccharide. Fish & shellfish immunology, 2010. 28(1): p. 167-77.

162. Iwanaga, S. and B.L. Lee, Recent advances in the innate immunity of invertebrate animals. Journal of biochemistry and molecular biology, 2005. 38(2): p. 128-50.

163. Rowley, A.F. and A. Powell, Invertebrate immune systems specific, quasi-specific, or nonspecific? Journal of immunology, 2007. 179(11): p. 7209-14.

164. d'Ayala, G.G., M. Malinconico, and P. Laurienzo, Marine derived polysaccharides for biomedical applications: chemical modification approaches. Molecules, 2008. 13(9): p. 2069-106.

165. Peters, W., Occurrence of chitin in mollusca. Comparative Biochemistry and Physiology Part B: Comparative Biochemistry, 1972. 41(3): p. 541-544, IN15-IN20, 545-550.

166. Suzuki, M., S. Sakuda, and H. Nagasawa, Identification of Chitin in the Prismatic Layer of the Shell and a Chitin Synthase Gene from the Japanese Pearl Oyster, Pinctada fucata. Bioscience, Biotechnology, and Biochemistry, 2007. 71(1735-1744).

167. Paul, J.H., et al., Intergeneric natural plasmid transformation between E. coli and a marine Vibrio species. Mol Ecol, 1992. 1(1): p. 37-46.

168. Frischer, M.E., J.M. Thurmond, and J.H. Paul, Natural plasmid transformation in a high- frequency-of-transformation marine Vibrio strain. Applied and Environmental Microbiology, 1990. 56(11): p. 3439-44.

169. Yalcinkaya, F., et al., The presence and antimicrobial susceptibilities of human-pathogen Vibrio spp. isolated from blue crab (Callinectes sapidus) in Belek tourism coast, Turkey. International journal of environmental health research, 2003. 13: p. 95-8.

170. Lee, V.T., et al., A cyclic-di-GMP receptor required for bacterial exopolysaccharide production. Molecular Microbiology, 2007. 65(6): p. 1474-84.

171. Kulshina, N., N.J. Baird, and A.R.F.-d. Amaré, Recognition of the bacterial second messenger cyclic diguanylate by its cognate riboswitch. Nature Structural & Molecular Biology, 2009. 16: p. 1212-1217.

172. Welch, B.L., The generalization of Student's problem when several different population variances are invovled. Biometrika, 1947. 34: p. 28-35.

173. Johnson, D.E., et al., Resistance of Vibrio vulnificus to serum bactericidal and opsonizing factors: relation to virulence in suckling mice and humans. The journal of Infectious diseases, 1984. 150(3): p. 413- 418.

174. Guzman, L.M., et al., Tight regulation, modulation, and high-level expression by vectors containing the rabinos PBAD promoter. Journal of bacteriology, 1995. 177: p. 4121- 4130.

175. Thormann, K.M., et al., Control of Formation and Cellular Detachment from Shewanella oneidensis MR-1 Biofilms by Cyclic di-GMP. Society, 2006. 188: p. 2681-2691.

176. Bhowmick, R., et al., Intestinal adherence of Vibrio cholerae involves a coordinated interaction between colonization factor GbpA and mucin. Infection and immunity, 2008. 76: p. 4968-77.

177. Lee, V.T., et al., A cyclic-di-GMP receptor required for bacterial exopolysaccharide production. Molecular Microbiology, 2007. 65(6): p. 1474-1484.

178. Beyhan, S., et al., Transcriptome and Phenotypic Responses of Vibrio cholerae to Increased Cyclic di-GMP Level †. Society, 2006. 188: p. 3600-3613.

179. Amor, P.A., et al., Assembly of the K40 antigen in Escherichia coli: identification of a novel enzyme responsible for addition of L-serine residues to the glycan backbone and its requirement for K40 polymerization. Journal of Bacteriology, 1999. 181: p. 772-780.

180. Taylor, R.G., D.C. Walker, and R.R. McInnes, E. coli host strains significantly affect the quality of small scale plasmid DNA preparations used for sequencing. Nucleic acids research, 1993. 21(7): p. 1677-8.

181. Al-Dabbagh, B., D. Mengin-Lecreulx, and A. Bouhss, Purification and characterization of the bacterial UDP-GlcNAc:undecaprenyl-phosphate GlcNAc-1-phosphate transferase WecA. Journal of Bacteriology, 2008. 190: p. 7141-6.

182. Geremia, R.a., et al., Expression and biochemical characterisation of recombinant AceA, a bacterial alpha-mannosyltransferase. Molecular & general genetics : MGG, 1999. 261: p. 933-40.

183. Lellouch, A.C. and R.A. Geremia, Expression and Study of Recombinant ExoM , a beta 1-4 Glucosyltransferase Involved in Succinoglycan Biosynthesis in Sinorhizobium meliloti Expression and Study of Recombinant ExoM , a ␤ 1-4 Glucosyltransferase Involved in Succinoglycan Biosynthesis in Sin. 1999.

184. Whitfield, C. and M.A. Valvano, Biosynthesis and expression of cell-surface polysaccharides in gram-negative bacteria. Advances in microbial physiology, 1993. 35: p. 135-246.

185. Lellouch, A.C. and R.A. Geremia, Expression and Study of Recombinant ExoM , a beta 1-4 Glucosyltransferase Involved in Succinoglycan Biosynthesis in Sinorhizobium meliloti Expression and Study of Recombinant ExoM , a ␤ 1-4 Glucosyltransferase Involved in Succinoglycan Biosynthesis in Sin. Journal of Bacteriology, 1999. 181: p. 1141-1148.