DOCSLIB.ORG

The Endoplasmic Reticulum-Sarcoplasmic Reticulum Connection

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Endoplasmic Reticulum-Sarcoplasmic Reticulum Connection Proc. Natd. Acad. Sci. USA Vol. 89, pp. 6142-6146, July 1992 Cell Biology The endoplasmic reticulum-sarcoplasmic reticulum connection: Distribution of endoplasmic reticulum markers in the sarcoplasmic reticulum of skeletal muscle fibers POMPEO VOLPE*, ANTONELLO VILLAt, PAOLA PODINIt, ADELINA MARTINI*, ALESSANDRA NOIW*, MARIA CARLA PANZERIt, AND JACOPO MELDOLESIti *Consiglio Nazionale delle Ricerche, Center of Muscle Biology and Physiopathology, Institute of General Pathology, University of Padva, Padva, Italy; and tConsiglio Nazionale delle Ricerche, Cytopharmacology and B. Ceccareili Centers, Department of Pharmacology and S.Raffaele Institute, University of Milan, Milan, Italy Communicated by George E. Palade, March 27, 1992 ABSTRACT The skeletal muscle sarcoplasmic redculum cialization contrasts with the wide spectrum of activities (SR) was investigated for the presence of well-known endo- typical of the ER. plasmic reticulum (ER) markers: the lumenal protein BIP and Recently, a group of ER lumenal resident proteins, which a group of membrane proteins recognized by an antibody include at their C terminus a tetrapeptide motif, KDEL, and raised against ER membrane vesicles. Western blots of SR afew variants, has been identified. During their lifespan these fraction revealed the presence of BIP in fast- and slow-twitch proteins are transported to a pre-Golgi compartment, from muscles of the rabbit as well as in rat and chiken muscles. which, however, they are retrieved to the ER after binding to Analyses ofpurified SR sub s, together with cryosectlon a specific KDEL receptor (8). Ofthe SR lumenal proteins, CS Immunofluorescence and Immunogold labeling, revealed BIP (9) and other components-sarcalumenin (10, 11), 53-kDa evenly distributed within the ni SR and the teria glycoprotein (10, 11), histidine-rich protein (12)-were found cisternae. Within the ter l csternae BiP appeared not to be to lack the KDEL terminus. This, however, is not the case mixed with calsequestrin but to be distributed around the with two additional minor proteins, originally described as ggregates of the latter Ca+ binding protein. Of the various the high-affinity Ca2+ binding protein and the thyroid hor- membrane markers only cainexin (91 kDa) was found to be mone binding protein and now recognized as calreticulin and distributed within both SR sub ous, whereas the other protein disulfide isomerase (PDI), respectively (13, 14). Nei- markers (apparent molecular masses of64 kDa and 58 kDa and ther ofthese proteins is muscle specific; rather, they are both a doublet around 28 kDa) were concentrated in the terminal expressed by many (possibly all) nonmuscle cells (15, 16). that the SR is a s i ER The latter results appear compatible with the interpretation of cisternae. These results suggest the SR as a specialized subcompartment of the ER. The subcompartment in which general markers, such as the ones we available information is, however, still limited. In fact, we do have investigated, coexist with the major SR proteins specifi- not know whether the SR contains the entire complement of cally responsible for Ca2+ uptake, storage, and release. The ER lumenal proteins, whether these proteins are distributed dfferential distribution of the ER markers reveals new aspects to the entire SR lumen or concentrated within discrete areas, of the SR molecular structure that might be of importance for and whether expression of ER markers in the SR concerns the functioning of the endomembrane system. also the limiting membrane. These problems have now been investigated by parallel The sarcoplasmic reticulum (SR) of skeletal muscle has at- experiments of subcellular fractionation and immunocyto- tracted interest as to its biogenesis and cytological nature chemistry, using antibodies (Abs) against yet another ER during the last 35 years (1, 2). On the one hand, extensive lumenal protein, BiP, and against a group of ER membrane membrane continuities, suggestive of a direct biogenetic re- proteins. These proteins were found to be present and lationship, between the growing SR and typical rough- variously distributed in the skeletal muscle SR. Thus our surfaced endoplasmic reticulum (ER) cisternae were observed work not only provides support to the interpretation ofthe SR during differentiation (3, 4). On the other hand, protein anal- as a specialized ER subcompartment but in addition reveals yses of isolated subcellular fractions accounting for either the new aspects of the complex organization and regulatory whole system or its two major components, longitudinal SR mechanisms in this endomembrane system. and terminal cisternae (LSR and TC, respectively), revealed a high degree of specialization (2, 5), quite distinct from the MATERIALS AND METHODS heterogeneous patterns observed with ER fractions. In par- The following skeletal muscles were dissected from animals ticular, LSR was found to be massively (=90%) enriched in the ofvarious species and transferred to ice-cold saline solutions: Ca2+-ATPase and TC in a peculiar, low-affinity, high-capacity rabbit, fast-twitch adductor and slow-twitch soleus; rat, intralumenal Ca2+ binding protein, calsequestrin (CS). More- extensor digitorum longus; chicken, pectoralis major. over, a subfraction corresponding to thejunctional face mem- Subellular Fractionation. The muscles were homogenized, brane (JFM), the TC membrane associated with the transverse and the whole SR fraction was isolated by differential cen- tubules at the triads (6), was enriched in the SR Ca2+ channel, trifugation and processed according to Saito et al. (17) to yield the so-called ryanodine receptor (2, 6, 7). The identification of various subfractions. Two of these subfractions are highly these and additional minor SR components, which appear to be also involved in Ca2+ homeostasis (5), documented the key Abbreviations: Ab, antibody; CS, calsequestrin; ER, endoplasmic role of the SR in the processes of Ca2+ uptake, storage, and reticulum; SR, sarcoplasmic reticulum; JFM, junctional face mem- release underlying the relaxation-contraction cycle. This spe- brane of SR terminal cisternae; JFM-CC, junctional face- compartmental contents subfraction; LSR, longitudinal SR; PDI, protein disulfide isomerase; TC, terminal cisternae of the SR. The publication costs ofthis article were defrayed in part by page charge flTo whom reprint requests should be addressed at: Department of payment. This article must therefore be hereby marked "advertisement" Pharmacology, Scientific Institute S.Raffaele, Via Olgettina, 60, in accordance with 18 U.S.C. §1734 solely to indicate this fact. 20132 Milan, Italy. 6142 Downloaded by guest on September 27, 2021 Cell Biology: Volpe et al. Proc. Natl. Acad. Sci. USA 89 (1992) 6143 enriched of LSR and TC, respectively (17). The TC subfrac- sequence (20, 21). Extensively washed single- and dual- tion was further processed to separate its various compo- labeled cryosections were finally postfixed, stained, and nents. A preparation containing JFM with associated com- embedded as recommended by Keller et al. (22). Background partmental content (JFM-CC) was recovered by high-speed labeling was estimated by studying parallel preparations centrifugation from the TC subfraction exposed to 0.7% (processed by omitting the exposure to specific Abs) and Triton X-100; the subsequent exposure of JFM-CC to 1 mM analyzing organelles and structures (e.g., mitochondria) neg- EDTA resulted in CS extraction and recovery of JFM (6). ative for those Abs in the immunodecorated cryosections. Total TC limiting membrane and the lumenal content were Materials. The primary Abs used in this work have been separated by treatment with Tris/EDTA (pH 8.3) as de- described elsewhere: anti-BiP, a rat monoclonal Ab (23), was scribed by Duggan and Martonosi (18). Protein concentration the kind gift of D. G. Bole; anti-ER, a rabbit polyclonal Ab of the fractions was estimated by Lowry's method, using raised against rat liver rough-surfaced ER vesicles stripped of bovine serum albumin standards. SDS/PAGE was carried their ribosomes (24, 25), was the kind gift of D. Louvard; out according to Laemmli (19). In a few experiments the SR anti-CS was a rabbit polyclonal Ab (see ref. 26). Rhodamine- fractions were run in parallel with microsomes prepared from labeled goat anti-rabbit and anti-rat IgGs were purchased either the chicken or the rat cerebellum (20, 21). Electro- from Technogenetics, Milan, Italy; 5- and 15-nm gold parti- transfer of the separated protein bands to nitrocellulose cles coated with similar IgGs were from Biocell Laboratories. sheets and Western blotting were carried out as described The chemicals were reagent grade, purchased from Sigma. (20), using either alkaline phosphatase (BiP) or 125I-labeled protein A (membrane proteins) for visualization. RESULTS Immunofluorescence and Immunogold Labeling. For the The Abs herewith employed were extensively characterized in morphological studies, strips of tissue dissected from the previous studies and found to recognize either a single (anti- rabbit adductor and soleus muscles were stretched, pinned BiP and anti-CS) or various (anti-ER) proteins (23, 24, 26). down over a vax sheet, and then fixed for 2 hr at room These results have been confirmed using microsomal fractions temperature with either 4% formaldehyde/0.25% glutaralde- from various cell origins (refs. 20 and 25; unpublished results). hyde in phosphate buffer, followed by 2% OS04 in the same Subcellular Fractionation. Fig. 1A compares BiP- buffer, for conventional
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Profiling of Transcripts and Proteins Modulated by the E7 Oncogene in the Lung Tissue of E7-Tg Mice by the Omics Approach
    MOLECULAR MEDICINE REPORTS 2: 129-137, 2009 129 Profiling of transcripts and proteins modulated by the E7 oncogene in the lung tissue of E7-Tg mice by the omics approach EUNJIN KIM1*, JEONGWOO KANG1,3*, MINCHUL CHO1, SOJUNG LEE1, EUNHEE SEO1, HEESOOK CHOI1, YUMI KIM1, JUNGHEE KIM1, KUM YONG KANG2, KWANG PYO KIM2, JAEYONG HAN3, YHUNYHONG SHEEN4, YOUNG NA YUM5, SUE-NIE PARK5 and DO-YOUNG YOON1 Departments of 1Bioscience and Biotechnology, and 2Molecular Biotechnology, Konkuk University, Hwayang-dong 1, Gwangjin-gu, Seoul 143-701; 3Laboratory of Animal Genetic Engineering, Department of Food and Animal Biotechnology, Seoul National University, Seoul 151-742; 4School of Pharmacy, Ewha Womans University, Seoul 120-750; 5Korea Food and Drug Administration, #194 Tongil-ro, Eunpyung-gu, Seoul 122-704, Korea Received August 18, 2008; Accepted November 10, 2008 DOI: 10.3892/mmr_00000073 Abstract. The E6 and E7 oncoproteins of human papilloma suggest that the E7 oncogene modulates the expression levels virus (HPV) type 16 have been known to cooperatively induce of cell cycle-related (cyclin B1, cyclin E2) and cell adhesion- the immortalization and transformation of primary keratino- and migration-related (actinin ·1, CD166) factors, which may cytes. We established an E7 transgenic mouse model to play important roles in cellular transformation in cancer. In screen HPV-related biomakers using the omics approach. addition, the solubilization of the rigid intermediate filament The methods used to identify HPV-modulated factors were network by specific proteolysis mediated via up-regulating genomics analysis by microarray using the Affymetrix 430 gelsolin and down-regulating cofilin-1, as well as increased 2.0 array to screen E7-modulated genes, and proteomics levels of endoplasmic reticulum protein calnexin with chap- analysis using nano-LC-ESI-MS/MS to screen E7-modulated erone functions, might also be involved in E7-lung epithelial proteins with the lung tissue of E7 transgenic mice.
    [Show full text]
  • Calreticulin—Multifunctional Chaperone in Immunogenic Cell Death: Potential Significance As a Prognostic Biomarker in Ovarian
    cells Review Calreticulin—Multifunctional Chaperone in Immunogenic Cell Death: Potential Significance as a Prognostic Biomarker in Ovarian Cancer Patients Michal Kielbik *, Izabela Szulc-Kielbik and Magdalena Klink Institute of Medical Biology, Polish Academy of Sciences, 106 Lodowa Str., 93-232 Lodz, Poland; [email protected] (I.S.-K.); [email protected] (M.K.) * Correspondence: [email protected]; Tel.: +48-42-27-23-636 Abstract: Immunogenic cell death (ICD) is a type of death, which has the hallmarks of necroptosis and apoptosis, and is best characterized in malignant diseases. Chemotherapeutics, radiotherapy and photodynamic therapy induce intracellular stress response pathways in tumor cells, leading to a secretion of various factors belonging to a family of damage-associated molecular patterns molecules, capable of inducing the adaptive immune response. One of them is calreticulin (CRT), an endoplasmic reticulum-associated chaperone. Its presence on the surface of dying tumor cells serves as an “eat me” signal for antigen presenting cells (APC). Engulfment of tumor cells by APCs results in the presentation of tumor’s antigens to cytotoxic T-cells and production of cytokines/chemokines, which activate immune cells responsible for tumor cells killing. Thus, the development of ICD and the expression of CRT can help standard therapy to eradicate tumor cells. Here, we review the physiological functions of CRT and its involvement in the ICD appearance in malignant dis- ease. Moreover, we also focus on the ability of various anti-cancer drugs to induce expression of surface CRT on ovarian cancer cells. The second aim of this work is to discuss and summarize the prognostic/predictive value of CRT in ovarian cancer patients.
    [Show full text]
  • A Selective ER-Phagy Exerts Procollagen Quality Control Via a Calnexin-FAM134B Complex
    Article A selective ER-phagy exerts procollagen quality control via a Calnexin-FAM134B complex Alison Forrester1,†, Chiara De Leonibus1,†, Paolo Grumati2,†, Elisa Fasana3,†, Marilina Piemontese1, Leopoldo Staiano1, Ilaria Fregno3,4, Andrea Raimondi5, Alessandro Marazza3,6, Gemma Bruno1, Maria Iavazzo1, Daniela Intartaglia1, Marta Seczynska2, Eelco van Anken7, Ivan Conte1, Maria Antonietta De Matteis1,8, Ivan Dikic2,9,* , Maurizio Molinari3,10,** & Carmine Settembre1,11,*** Abstract The EMBO Journal (2019) 38:e99847 Autophagy is a cytosolic quality control process that recognizes substrates through receptor-mediated mechanisms. Procollagens, Introduction the most abundant gene products in Metazoa, are synthesized in the endoplasmic reticulum (ER), and a fraction that fails to attain Macroautophagy (hereafter referred to as autophagy) is a homeostatic the native structure is cleared by autophagy. However, how auto- catabolic process devoted to the sequestration of cytoplasmic material phagy selectively recognizes misfolded procollagens in the ER in double-membrane vesicles (autophagic vesicles, AVs) that eventu- lumen is still unknown. We performed siRNA interference, CRISPR- ally fuse with lysosomes where cargo is degraded (Mizushima, 2011). Cas9 or knockout-mediated gene deletion of candidate autophagy Autophagy is essential to maintain tissue homeostasis and counter- and ER proteins in collagen producing cells. We found that the ER- acts both the onset and progression of many disease conditions, such resident lectin chaperone Calnexin (CANX) and the ER-phagy as ageing, neurodegeneration and cancer (Levine et al, 2015). receptor FAM134B are required for autophagy-mediated quality Substrates can be selectively delivered to AVs through receptor- control of endogenous procollagens. Mechanistically, CANX acts as mediated processes. Autophagy receptors harbour a LC3 or GABARAP co-receptor that recognizes ER luminal misfolded procollagens and interaction motif (LIR or GIM, respectively) that facilitate binding of interacts with the ER-phagy receptor FAM134B.
    [Show full text]
  • FAM210A Is a Novel Determinant of Bone and Muscle Structure And
    FAM210A is a novel determinant of bone and muscle PNAS PLUS structure and strength Ken-ichiro Tanakaa, Yingben Xuea, Loan Nguyen-Yamamotoa, John A. Morrisb,c,d, Ippei Kanazawae, Toshitsugu Sugimotoe, Simon S. Winga,f, J. Brent Richardsb,c,d, and David Goltzmana,f,1 aCalcium Research Laboratory, Metabolic Disorders and Complications Program, Research Institute of the McGill University Health Centre, Montreal, QC, Canada H4A 3J1; bDepartment of Medicine, McGill University, Montreal, QC, Canada H3T 1E2; cDepartment of Human Genetics, Jewish General Hospital, McGill University, Montreal, QC, Canada H3T 1E2; dDepartment of Epidemiology and Biostatistics, Jewish General Hospital, McGill University, Montreal, QC, Canada H3T 1E2; eInternal Medicine 1, Faculty of Medicine, Shimane University, 693-8501 Shimane, Japan; and fDivision of Endocrinology, Department of Medicine, McGill University, Montreal, QC, Canada H4A 3J1 Edited by John T. Potts, Massachusetts General Hospital, Charlestown, MA, and approved March 14, 2018 (received for review November 1, 2017) Osteoporosis and sarcopenia are common comorbid diseases, yet TOM1L2/SREBF1 locus were found to exert opposing effects on their shared mechanisms are largely unknown. We found that total body lean mass and total body less head BMD (13). SREBP- genetic variation near FAM210A was associated, through large 1, and the product of the SREBF1 gene, is known to exert op- genome-wide association studies, with fracture, bone mineral posing effects on osteoblast and myoblast differentiation (14, 15). density (BMD), and appendicular and whole body lean mass, in However, more commonly, bone loss coincides with a decrease in humans. In mice, Fam210a was expressed in muscle mitochondria muscle mass and function, suggesting that there are shared bio- and cytoplasm, as well as in heart and brain, but not in bone.
    [Show full text]
  • Detection of Pro Angiogenic and Inflammatory Biomarkers in Patients With
    www.nature.com/scientificreports OPEN Detection of pro angiogenic and infammatory biomarkers in patients with CKD Diana Jalal1,2,3*, Bridget Sanford4, Brandon Renner5, Patrick Ten Eyck6, Jennifer Laskowski5, James Cooper5, Mingyao Sun1, Yousef Zakharia7, Douglas Spitz7,9, Ayotunde Dokun8, Massimo Attanasio1, Kenneth Jones10 & Joshua M. Thurman5 Cardiovascular disease (CVD) is the most common cause of death in patients with native and post-transplant chronic kidney disease (CKD). To identify new biomarkers of vascular injury and infammation, we analyzed the proteome of plasma and circulating extracellular vesicles (EVs) in native and post-transplant CKD patients utilizing an aptamer-based assay. Proteins of angiogenesis were signifcantly higher in native and post-transplant CKD patients versus healthy controls. Ingenuity pathway analysis (IPA) indicated Ephrin receptor signaling, serine biosynthesis, and transforming growth factor-β as the top pathways activated in both CKD groups. Pro-infammatory proteins were signifcantly higher only in the EVs of native CKD patients. IPA indicated acute phase response signaling, insulin-like growth factor-1, tumor necrosis factor-α, and interleukin-6 pathway activation. These data indicate that pathways of angiogenesis and infammation are activated in CKD patients’ plasma and EVs, respectively. The pathways common in both native and post-transplant CKD may signal similar mechanisms of CVD. Approximately one in 10 individuals has chronic kidney disease (CKD) rendering CKD one of the most common diseases worldwide1. CKD is associated with a high burden of morbidity in the form of end stage kidney disease (ESKD) requiring dialysis or transplantation 2. Furthermore, patients with CKD are at signifcantly increased risk of death from cardiovascular disease (CVD)3,4.
    [Show full text]
  • Genetic, Cytogenetic and Physical Refinement of the Autosomal Recessive CMT Linked to 5Q31ð Q33: Exclusion of Candidate Genes I
    European Journal of Human Genetics (1999) 7, 849–859 © 1999 Stockton Press All rights reserved 1018–4813/99 $15.00 t http://www.stockton-press.co.uk/ejhg ARTICLE Genetic, cytogenetic and physical refinement of the autosomal recessive CMT linked to 5q31–q33: exclusion of candidate genes including EGR1 Ang`ele Guilbot1, Nicole Ravis´e1, Ahmed Bouhouche6, Philippe Coullin4, Nazha Birouk6, Thierry Maisonobe3, Thierry Kuntzer7, Christophe Vial8, Djamel Grid5, Alexis Brice1,2 and Eric LeGuern1,2 1INSERM U289, 2F´ed´eration de Neurologie and 3Laboratoire de Neuropathologie R Escourolle, Hˆopital de la Salpˆetri`ere, Paris 4Laboratoire de cytog´en´etique, Villejuif 5G´en´ethon, Evry, France 6Service de Neurologie, Hˆopital des Sp´ecialit´es, Rabat, Morocco 7Service de Neurologie, Centre Hospitalier Universitaire Vaudois, Lausanne, Switzerland 8Service D’EMG et de pathologie neuromusculaire, Hˆopital neurologique Pierre Wertheimer, Lyon, France Charcot-Marie-Tooth disease is an heterogeneous group of inherited peripheral motor and sensory neuropathies with several modes of inheritance: autosomal dominant, X-linked and autosomal recessive. By homozygosity mapping, we have identified, in the 5q23–q33 region, a third locus responsible for an autosomal recessive form of demyelinating CMT. Haplotype reconstruction and determination of the minimal region of homozygosity restricted the candidate region to a 4 cM interval. A physical map of the candidate region was established by screening YACs for microsatellites used for genetic analysis. Combined genetic, cytogenetic and physical mapping restricted the locus to a less than 2 Mb interval on chromosome 5q32. Seventeen consanguineous families with demyelinating ARCMT of various origins were screened for linkage to 5q31–q33.
    [Show full text]
  • Getic Pathways Critical Issues in Contractile fibres [132]
    Journal of Neuromuscular Diseases 1 (2014) 15–40 15 DOI 10.3233/JND-140011 IOS Press Review Mass Spectrometry-Based Identification of Muscle-Associated and Muscle-Derived Proteomic Biomarkers of Dystrophinopathies Paul Dowling, Ashling Holland and Kay Ohlendieck∗ Department of Biology, National University of Ireland, Maynooth, Ireland Abstract. The optimization of large-scale screening procedures of pathological specimens by genomic, proteomic and metabolic methods has drastically increased the bioanalytical capability for swiftly identifying novel biomarkers of inherited disorders, such as neuromuscular diseases. X-linked muscular dystrophy represents the most frequently inherited muscle disease and is characterized by primary abnormalities in the membrane cytoskeletal protein dystrophin. Mass spectrometry-based proteomics has been widely employed for the systematic analysis of dystrophin-deficient muscle tissues, using patient samples and animal models of dystrophinopathy. Both, gel-based methods and label-free mass spectrometric techniques have been applied in compar- ative analyses and established a large number of altered proteins that are associated with muscle contraction, energy metabolism, ion homeostasis, cellular signaling, the cytoskeleton, the extracellular matrix and the cellular stress response. Although these new indicators of muscular dystrophy have increased our general understanding of the molecular pathogenesis of dystrophinopathy, their application as new diagnostic or prognostic biomarkers would require the undesirable usage of invasive methodology. Hence, to reduce the need for diagnostic muscle biopsy procedures, more recent efforts have focused on the proteomic screening of suitable body fluids, such as plasma, serum or urine, for the identification of changed concentration levels of muscle-derived peptides, protein fragments or intact proteins. The occurrence of muscular dystrophy-related protein species in biofluids will be extremely helpful for the future development of cost-effective and non-invasive diagnostic procedures.
    [Show full text]
  • Anoctamin 1 (Tmem16a) Ca -Activated Chloride Channel Stoichiometrically Interacts with an Ezrin–Radixin–Moesin Network
    Anoctamin 1 (Tmem16A) Ca2+-activated chloride channel stoichiometrically interacts with an ezrin–radixin–moesin network Patricia Perez-Cornejoa,1, Avanti Gokhaleb,1, Charity Duranb,1, Yuanyuan Cuib, Qinghuan Xiaob, H. Criss Hartzellb,2, and Victor Faundezb,2 aPhysiology Department, School of Medicine, Universidad Autónoma de San Luis Potosí, San Luis Potosí, SLP 78210, Mexico; and bDepartment of Cell Biology, Emory University School of Medicine, Atlanta, GA 30322 Edited by David E. Clapham, Howard Hughes Medical Institute, Children’s Hospital Boston, Boston, MA, and approved May 9, 2012 (received for review January 4, 2012) The newly discovered Ca2+-activated Cl− channel (CaCC), Anocta- approach to identify Ano1-interacting proteins. We find that min 1 (Ano1 or TMEM16A), has been implicated in vital physiolog- Ano1 forms a complex with two high stochiometry interactomes. ical functions including epithelial fluid secretion, gut motility, and One protein network is centered on the signaling/scaffolding smooth muscle tone. Overexpression of Ano1 in HEK cells or Xen- actin-binding regulatory proteins ezrin, radixin, moesin, and opus oocytes is sufficient to generate Ca2+-activated Cl− currents, RhoA. The ezrin–radixin–moesin (ERM) proteins organize the but the details of channel composition and the regulatory factors cortical cytoskeleton by linking actin to the plasma membrane that control channel biology are incompletely understood. We and coordinate cell signaling events by scaffolding signaling used a highly sensitive quantitative SILAC proteomics approach molecules (19). The other major interactome is centered on the to obtain insights into stoichiometric protein networks associated SNARE and SM proteins VAMP3, syntaxins 2 and -4, and the with the Ano1 channel.
    [Show full text]
  • Profiling of Transcripts and Proteins Modulated by the E7 Oncogene in the Lung Tissue of E7-Tg Mice by the Omics Approach
    MOLECULAR MEDICINE REPORTS 2: 129-137, 2009 129 Profiling of transcripts and proteins modulated by the E7 oncogene in the lung tissue of E7-Tg mice by the omics approach EUNJIN KIM1*, JEONGWOO KANG1,3*, MINCHUL CHO1, SOJUNG LEE1, EUNHEE SEO1, HEESOOK CHOI1, YUMI KIM1, JUNGHEE KIM1, KUM YONG KANG2, KWANG PYO KIM2, JAEYONG HAN3, YHUNYHONG SHEEN4, YOUNG NA YUM5, SUE-NIE PARK5 and DO-YOUNG YOON1 Departments of 1Bioscience and Biotechnology, and 2Molecular Biotechnology, Konkuk University, Hwayang-dong 1, Gwangjin-gu, Seoul 143-701; 3Laboratory of Animal Genetic Engineering, Department of Food and Animal Biotechnology, Seoul National University, Seoul 151-742; 4School of Pharmacy, Ewha Womans University, Seoul 120-750; 5Korea Food and Drug Administration, #194 Tongil-ro, Eunpyung-gu, Seoul 122-704, Korea Received August 18, 2008; Accepted November 10, 2008 DOI: 10.3892/mmr_00000073 Abstract. The E6 and E7 oncoproteins of human papilloma suggest that the E7 oncogene modulates the expression levels virus (HPV) type 16 have been known to cooperatively induce of cell cycle-related (cyclin B1, cyclin E2) and cell adhesion- the immortalization and transformation of primary keratino- and migration-related (actinin ·1, CD166) factors, which may cytes. We established an E7 transgenic mouse model to play important roles in cellular transformation in cancer. In screen HPV-related biomakers using the omics approach. addition, the solubilization of the rigid intermediate filament The methods used to identify HPV-modulated factors were network by specific proteolysis mediated via up-regulating genomics analysis by microarray using the Affymetrix 430 gelsolin and down-regulating cofilin-1, as well as increased 2.0 array to screen E7-modulated genes, and proteomics levels of endoplasmic reticulum protein calnexin with chap- analysis using nano-LC-ESI-MS/MS to screen E7-modulated erone functions, might also be involved in E7-lung epithelial proteins with the lung tissue of E7 transgenic mice.
    [Show full text]
  • Transcriptomic Landscape of Breast Cancers Through Mrna Sequencing Jeyanthy Eswaran George Washington University
    Himmelfarb Health Sciences Library, The George Washington University Health Sciences Research Commons Biochemistry and Molecular Medicine Faculty Biochemistry and Molecular Medicine Publications 2-14-2012 Transcriptomic landscape of breast cancers through mRNA sequencing Jeyanthy Eswaran George Washington University Dinesh Cyanam George Washington University Prakriti Mudvari George Washington University Sirigiri Divijendra Natha Reddy George Washington University Suresh Pakala George Washington University See next page for additional authors Follow this and additional works at: http://hsrc.himmelfarb.gwu.edu/smhs_biochem_facpubs Part of the Biochemistry, Biophysics, and Structural Biology Commons Recommended Citation Eswaran, J., Cyanam, D., Mudvari, P., Reddy, S., Pakala, S., Nair, S., Florea, L., & Fuqua, S. (2012). Transcriptomic landscape of breast cancers through mrna sequencing. Scientific Reports, 2, 264. This Journal Article is brought to you for free and open access by the Biochemistry and Molecular Medicine at Health Sciences Research Commons. It has been accepted for inclusion in Biochemistry and Molecular Medicine Faculty Publications by an authorized administrator of Health Sciences Research Commons. For more information, please contact [email protected]. Authors Jeyanthy Eswaran, Dinesh Cyanam, Prakriti Mudvari, Sirigiri Divijendra Natha Reddy, Suresh Pakala, Sujit S. Nair, Liliana Florea, Suzanne A.W. Fuqua, Sucheta Godbole, and Rakesh Kumar This journal article is available at Health Sciences Research Commons: http://hsrc.himmelfarb.gwu.edu/smhs_biochem_facpubs/3
    [Show full text]
  • Proteomics of Serum Extracellular Vesicles Identifies a Novel COPD Biomarker, Fibulin-3 from Elastic Fibres
    ORIGINAL ARTICLE COPD Proteomics of serum extracellular vesicles identifies a novel COPD biomarker, fibulin-3 from elastic fibres Taro Koba 1, Yoshito Takeda1, Ryohei Narumi2, Takashi Shiromizu2, Yosui Nojima 3, Mari Ito3, Muneyoshi Kuroyama1, Yu Futami1, Takayuki Takimoto4, Takanori Matsuki1, Ryuya Edahiro1, Satoshi Nojima5, Yoshitomo Hayama1, Kiyoharu Fukushima1, Haruhiko Hirata1, Shohei Koyama1, Kota Iwahori1, Izumi Nagatomo1, Mayumi Suzuki1, Yuya Shirai1, Teruaki Murakami1, Kaori Nakanishi 1, Takeshi Nakatani1, Yasuhiko Suga1, Kotaro Miyake1, Takayuki Shiroyama1, Hiroshi Kida 1, Takako Sasaki6, Koji Ueda7, Kenji Mizuguchi3, Jun Adachi2, Takeshi Tomonaga2 and Atsushi Kumanogoh1 ABSTRACT There is an unmet need for novel biomarkers in the diagnosis of multifactorial COPD. We applied next-generation proteomics to serum extracellular vesicles (EVs) to discover novel COPD biomarkers. EVs from 10 patients with COPD and six healthy controls were analysed by tandem mass tag-based non-targeted proteomics, and those from elastase-treated mouse models of emphysema were also analysed by non-targeted proteomics. For validation, EVs from 23 patients with COPD and 20 healthy controls were validated by targeted proteomics. Using non-targeted proteomics, we identified 406 proteins, 34 of which were significantly upregulated in patients with COPD. Of note, the EV protein signature from patients with COPD reflected inflammation and remodelling. We also identified 63 upregulated candidates from 1956 proteins by analysing EVs isolated from mouse models. Combining human and mouse biomarker candidates, we validated 45 proteins by targeted proteomics, selected reaction monitoring. Notably, levels of fibulin-3, tripeptidyl- peptidase 2, fibulin-1, and soluble scavenger receptor cysteine-rich domain-containing protein were significantly higher in patients with COPD.
    [Show full text]