CONSERVATION of DEER the IUCN Deer Specialist Group
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Scientists Hope to Breed Asian 'Unicorns' – If They Can Find Them
Scientists hope to breed Asian ‘unicorns’ – if they can find them Conservationists see only one hope for the saola: a risky captive breeding programme Jeremy Hance Thursday 10 August 2017 03.42 EDT n 1996, William Robichaud spent three weeks with Martha before she died. Robichaud I studied Martha – a beautiful, enigmatic, shy saola – with a scientist’s eye but also fell under the gracile animal’s spell as she ate out of his hand and allowed herself to be stroked. Captured by local hunters, Martha spent those final days in a Laotian village, doted on by Robichaud. Since losing Martha, Robichaud has become the coordinator of the Saola Working Group (SWG) at the International Union for Conservation of Nature (IUCN). He has dedicated his life to saving this critically endangered species – and believes the best chance to achieve that now is through a captive breeding programme. “We need to act while there is still time,” he said adding that “seldom, if ever” are captive breeding programs begun too soon for species on the edge. “More likely, too late.” We just found the saola – and now we’re very close to losing it forever. Discovery Hardly a household name, the saola was one of the most astounding biological discoveries of the 20th Century. In 1992, a group of scientists met a local hunter in Vietnam who gave them a skull of something no biologist had ever seen before. The animal – the saola or Pseudoryx nghetinhensis – was a large-bodied terrestrial mammal (80-100kg) that somehow eluded science, though not local people, well into the information age. -
Nam Ngiep 1 Hydropower Project
NAM NGIEP 1 HYDROPOWER PROJECT FINAL DRAFT REPORT 13 AUGUST 2016 A BIODIVERSITY RECONNAISSANCE OF A CANDIDATE OFFSET AREA FOR THE NAM NGIEP 1 HYDROPOWER PROJECT IN THE NAM MOUANE AREA, BOLIKHAMXAY PROVINCE Prepared by: Chanthavy Vongkhamheng1 and J. W. Duckworth2 1. Biodiversity Assessment Team Leader, and 2. Biodiversity Technical Advisor Presented to: The Nam Ngiep 1 Hydropower Company Limited. Vientiane, Lao PDR. 30 June 2016 0 CONTENTS ACKNOWLEDGEMENTS.................................................................................................................... 6 CONVENTIONS ................................................................................................................................... 7 NON-STANDARD ABBREVIATIONS AND ACRONYMS ............................................................... 9 INTRODUCTION ............................................................................................................................... 10 PRINCIPLES OF ASSESSMENT ........................................................................................................ 10 CONCEPTUAL BASIS FOR SELECTING A BIODIVERSITY OFFSET AREA ............................. 12 THE CANDIDATE OFFSET AREA ................................................................................................... 13 METHODS ........................................................................................................................................... 15 i. Village discussions ......................................................................................................................... -
Sexual Selection and Extinction in Deer Saloume Bazyan
Sexual selection and extinction in deer Saloume Bazyan Degree project in biology, Master of science (2 years), 2013 Examensarbete i biologi 30 hp till masterexamen, 2013 Biology Education Centre and Ecology and Genetics, Uppsala University Supervisor: Jacob Höglund External opponent: Masahito Tsuboi Content Abstract..............................................................................................................................................II Introduction..........................................................................................................................................1 Sexual selection........................................................................................................................1 − Male-male competition...................................................................................................2 − Female choice.................................................................................................................2 − Sexual conflict.................................................................................................................3 Secondary sexual trait and mating system. .............................................................................3 Intensity of sexual selection......................................................................................................5 Goal and scope.....................................................................................................................................6 Methods................................................................................................................................................8 -
Online Resources Supplemental Material Supplementary Information
Hystrix (2019) — online resources Supplemental Material Supplementary Information Phylogeny and diversity of moose (Alces alces, Cervidae, Mammalia) revealed by complete mitochondrial genomes M. Świsłocka, M. Matosiuk, M. Ratkiewicz, A. Borkowska, M. Czajkowska, P. Mackiewicz Table S1: List of primer pairs used for PCR and sequencing of mitogenomes in Alces alces. Primer Primer sequence Position Tm [℃] Product [bp] Genes Primer source 12S-FW GGTAAATCTCGTGCCAGCCA 00295 57.3 712 <12s_rRNA> Fajardo et al., 2007† 12S-REV TCCAGTATGCTTACCTTGTTACGAC 01007 56.2 00871c_F TGCTTAGTTGAATTAGGCAATG 00872 51.3 1176 <12s_rRNA...tRNA-Val...16s_rRNA> Matosiuk et al., 2014‡ 02052c_R AGAGAACAAGTGATTATGCTACC 02048 52.2 01950c_F ACCTCCAGCATAACTAGTATTGG 01945 53.7 1455 <16s_rRNA...tRNA-Leu...ND1> Matosiuk et al., 2014‡ 03402c_R AATGGTCCTGCTGCATACTCTA 03400 55.2 03140c_F CTACGAGCAGTAGCTCAAACA 03138 54.1 1025 <ND1...tRNA-Ile...tRNA-Gln...tRNA-Met...ND2> Matosiuk et al., 2014‡ 04165c_R ACAGTTCATTGGCCTGAAAATA 04163 52.5 3910a_F CCTTCCCGTACTAATAAACC 03894 50.0 1519 <tRNA-Met...ND2...tRNA-Trp...tRNA-Ala...> This study 4300a_F2 TCATCAGGCCTAATTCTACT 04279 - <tRNA-Asn...tRNA-Cys...tRNA-Tyr...COX1> 5430a_R TATGCCTGCTCARGCACCAA 05413 56.0 COX1_F TCAGCCATTTTACCTATGTTCA 05315 51.7 826 <tRNA-Tyr...COX1> GenBank§ COX1_R ATRTAGCCAAARGGTTCTTTTT 06141 48.5 06060a_F TCTTTGGACACCCCGAAGTA 06039 55.2 991 <COX1...tRNA-Ser...tRNA-Asp...COX2> This study 07050a_R ATGGGGTAAGCCATATGAGG 07030 53.8 06090a_F TCGTAACATACTACTCAGGG 06099 50.2 1503 <COX1...tRNA-Ser...tRNA-Asp...COX2> This study -
A Checklist of the Mammals of South-East Asia
A Checklist of the Mammals of South-east Asia A Checklist of the Mammals of South-east Asia PHOLIDOTA Pangolin (Manidae) 1 Sunda Pangolin (Manis javanica) 2 Chinese Pangolin (Manis pentadactyla) INSECTIVORA Gymnures (Erinaceidae) 3 Moonrat (Echinosorex gymnurus) 4 Short-tailed Gymnure (Hylomys suillus) 5 Chinese Gymnure (Hylomys sinensis) 6 Large-eared Gymnure (Hylomys megalotis) Moles (Talpidae) 7 Slender Shrew-mole (Uropsilus gracilis) 8 Kloss's Mole (Euroscaptor klossi) 9 Large Chinese Mole (Euroscaptor grandis) 10 Long-nosed Chinese Mole (Euroscaptor longirostris) 11 Small-toothed Mole (Euroscaptor parvidens) 12 Blyth's Mole (Parascaptor leucura) 13 Long-tailed Mole (Scaptonyx fuscicauda) Shrews (Soricidae) 14 Lesser Stripe-backed Shrew (Sorex bedfordiae) 15 Myanmar Short-tailed Shrew (Blarinella wardi) 16 Indochinese Short-tailed Shrew (Blarinella griselda) 17 Hodgson's Brown-toothed Shrew (Episoriculus caudatus) 18 Bailey's Brown-toothed Shrew (Episoriculus baileyi) 19 Long-taied Brown-toothed Shrew (Episoriculus macrurus) 20 Lowe's Brown-toothed Shrew (Chodsigoa parca) 21 Van Sung's Shrew (Chodsigoa caovansunga) 22 Mole Shrew (Anourosorex squamipes) 23 Himalayan Water Shrew (Chimarrogale himalayica) 24 Styan's Water Shrew (Chimarrogale styani) Page 1 of 17 Database: Gehan de Silva Wijeyeratne, www.jetwingeco.com A Checklist of the Mammals of South-east Asia 25 Malayan Water Shrew (Chimarrogale hantu) 26 Web-footed Water Shrew (Nectogale elegans) 27 House Shrew (Suncus murinus) 28 Pygmy White-toothed Shrew (Suncus etruscus) 29 South-east -
2013-Ross Et Al
JOBNAME: No Job Name PAGE: 1 SESS: 9 OUTPUT: Thu Jan 31 01:23:45 2013 /v2451/blackwell/3G_journals/jzo_v0_i0/jzo_12018 Toppan Best-set Premedia Limited Journal Code: JZO Proofreader: Mony Article No: JZO12018 Delivery date: 30 Jan 2013 Page Extent: 11 Journal of Zoology. Print ISSN 0952-8369 Activity patterns and temporal avoidance by prey in response to Sunda clouded leopard predation risk J. Ross1*,2, A. J. Hearn1*,2 P. J. Johnson1 & D. W. Macdonald1 1 Wildlife Conservation Research Unit (WildCRU), Department of Zoology, University of Oxford, Oxford, UK 2 2 Global Canopy Programme, Oxford, UK bs_bs_query Keywords Abstract activity patterns; circular statistics; overlap coefficient; Sunda clouded leopard; Little is known about the activity patterns of Bornean ungulates, or the temporal ungulate. interactions of these species with the Sunda clouded leopard Neofelis diardi. In this study, we use photographic capture data to quantify the activity patterns for the Correspondence Sunda clouded leopard and six potential prey species: bearded pig Sus barbatus, Joanna Ross, Wildlife Conservation Bornean yellow muntjac Muntiacus atherodes, red muntjac Muntiacus muntjak, Research Unit, Department of Zoology, lesser mouse deer Tragulus kanchil, greater mouse deer Tragulus napu, and sambar University of Oxford, The Recanati-Kaplan deer Rusa unicolor, and to calculate the overlap in activity patterns between these Centre, Tubney House, Abingdon Road, species. This is the first insight into the temporal interactions between the Sunda Tubney, Abingdon OX13 5QL, UK. clouded leopard and its potential prey. Sunda clouded leopards’ activity patterns Email: [email protected] overlapped most with those of sambar deer and greater mouse deer. -
Endangered Species (Import and Export) Act (Chapter 92A)
1 S 23/2005 First published in the Government Gazette, Electronic Edition, on 11th January 2005 at 5:00 pm. NO.S 23 ENDANGERED SPECIES (IMPORT AND EXPORT) ACT (CHAPTER 92A) ENDANGERED SPECIES (IMPORT AND EXPORT) ACT (AMENDMENT OF FIRST, SECOND AND THIRD SCHEDULES) NOTIFICATION 2005 In exercise of the powers conferred by section 23 of the Endangered Species (Import and Export) Act, the Minister for National Development hereby makes the following Notification: Citation and commencement 1. This Notification may be cited as the Endangered Species (Import and Export) Act (Amendment of First, Second and Third Schedules) Notification 2005 and shall come into operation on 12th January 2005. Deletion and substitution of First, Second and Third Schedules 2. The First, Second and Third Schedules to the Endangered Species (Import and Export) Act are deleted and the following Schedules substituted therefor: ‘‘FIRST SCHEDULE S 23/2005 Section 2 (1) SCHEDULED ANIMALS PART I SPECIES LISTED IN APPENDIX I AND II OF CITES In this Schedule, species of an order, family, sub-family or genus means all the species of that order, family, sub-family or genus. First column Second column Third column Common name for information only CHORDATA MAMMALIA MONOTREMATA 2 Tachyglossidae Zaglossus spp. New Guinea Long-nosed Spiny Anteaters DASYUROMORPHIA Dasyuridae Sminthopsis longicaudata Long-tailed Dunnart or Long-tailed Sminthopsis Sminthopsis psammophila Sandhill Dunnart or Sandhill Sminthopsis Thylacinidae Thylacinus cynocephalus Thylacine or Tasmanian Wolf PERAMELEMORPHIA -
Newsletter Winter14 R03 Layout 1
Wildlife & Conservation Group Winter 2014 Page 02 - A Word from the Chair - Tim Harris with a few words Page 03 - Why Trees Matter - by Tricia Moxey Page 07 - Invertebrate Report by Paul Ferris Page 11 - Cliché - a poem by Alison Chisholm Page 12 - Muntjac - an article on the little deer by Thibaud Madelin Page 16 - Gossiping Rambles. More walk and talk in 1908 Page 21 - Autumn Bird Report by Nick Croft Page 25 - ‘Brickfields’ - from bricks to bees and butterflies by Mark Gorman and Tim Harris Page 28 - What to look out for in winter - by Tricia Moxey Page 29 - Danali National Park - definitely ‘off piste’ by David Playford Page 31 - Wren Rings London - walking the Capital Ring with Peter Aylmer Page 34 - Wanstead Nature Club - Report from Gill James Page 39 - Gallery - members’ photo contributions Page 40 - Wren teasers, puzzles and more Page 41 - Events Diary Page 42 - Links Page 43 - ........... and finally http://www.wrengroup.org.uk/ 200th species of bird for the area and the 450th can’t conserve what you don’t know, so wouldn’t it species of Lepidoptera (butterflies and moths). But be great to discover more of the variety that is all A word from I thought it would be a good idea to find out the around us: the beetles, grasshoppers, fungi and – total amount of biodiversity we have locally, a task yes – even mammals that have so far gone made easier by looking at the Wanstead Wildlife unrecorded. To this aim the Wren Group is hoping website www.wansteadwildlife.org.uk run by Wren to organise several bio-blitzes during 2015, the chair Group member Paul Ferris. -
Leech Blood‑Meal Invertebrate‑Derived DNA Reveals Differences in Bornean Mammal Diversity Across Habitats
This document is downloaded from DR‑NTU (https://dr.ntu.edu.sg) Nanyang Technological University, Singapore. Leech blood‑meal invertebrate‑derived DNA reveals differences in Bornean mammal diversity across habitats Drinkwater, Rosie; Jucker, Tommaso; Potter, Joshua H. T.; Swinfield, Tom; Coomes, David A.; Slade, Eleanor M.; Gilbert, M. Thomas P.; Lewis, Owen T.; Bernard, Henry; Struebig, Matthew J.; Clare, Elizabeth L.; Rossiter, Stephen J. 2020 Drinkwater, R., Jucker, T., Potter, J. H. T., Swinfield, T., Coomes, D. A., Slade, E. M., Gilbert, M. T. P., Lewis, O. T., Bernard, H., Struebig, M. J., Clare, E. L. & Rossiter, S. J. (2020). Leech blood‑meal invertebrate‑derived DNA reveals differences in Bornean mammal diversity across habitats. Molecular Ecology, 30(13), 3299‑3312. https://dx.doi.org/10.1111/mec.15724 https://hdl.handle.net/10356/152420 https://doi.org/10.1111/mec.15724 © 2020 The Authors. Molecular Ecology published by John Wiley & Sons Ltd. This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited. Downloaded on 25 Sep 2021 14:15:17 SGT Received: 27 February 2020 | Revised: 26 October 2020 | Accepted: 2 November 2020 DOI: 10.1111/mec.15724 SPECIAL ISSUE Leech blood-meal invertebrate-derived DNA reveals differences in Bornean mammal diversity across habitats Rosie Drinkwater1 | Tommaso Jucker2 | Joshua H. T. Potter1 | Tom Swinfield3 | David A. Coomes3 | Eleanor M. Slade4,5 | M. Thomas P. Gilbert6,7 | Owen T. Lewis4 | Henry Bernard8 | Matthew J. Struebig9 | Elizabeth L. Clare1 | Stephen J. -
The Saola's Battle for Survival on the Ho Chi Minh Trail
2013 THE SAOLA’S BAttLE FOR SURVIVAL ON THE HO CHI MINH TRAIL © David Hulse / WWF-Canon WWF is one of the world’s largest and most experienced independent conservation organizations, with over 5 million supporters and a global network active in more than 100 countries. WWF’s mission is to stop the degradation of the planet’s natural environment and to build a future in which humans live in harmony with nature, by conserving the world’s biological diversity, ensuring that the use of renewable natural resources is sustainable, and promoting the reduction of pollution and wasteful consumption. Written and edited by Elizabeth Kemf, PhD. Published in August 2013 by WWF – World Wide Fund For Nature (Formerly World Wildlife Fund), Gland, Switzerland. Any reproduction in full or in part must mention the title and credit the above-mentioned publisher as the copyright owner. © Text 2013 WWF All rights reserved. CONTENTS 1. INTRODUCTION 5 2. SAOLA SPAWNS DECADES OF SPECIES DISCOVERIES 7 3. THE BIG EIGHT OF THE TWENTIETH CENTURY 9 4. THREATS: TRAPPING, ILLEGAL WILDLIFE TRADE AND HABITAT FRAGMENTATION 11 5. TUG OF WAR ON THE HO CHI MINH TRAIL 12 6. DISCOVERIES AND EXTINCTIONS 14 7. WHAT IS BEING DONE TO SAVE THE SAOLA? 15 Forest guard training and patrols 15 Expanding and linking protected areas 16 Trans-boundary protected area project 16 The Saola Working Group (SWG) 17 Biodiversity surveys 17 Landscape scale conservation planning 17 Leeches reveal rare species survival 18 8. THE SAOLA’S TIPPING POINT 19 9. TACKLING THE ISSUES: WHAT NEEDS TO BE DONE? 20 Unsustainable Hunting, Wildlife Trade And Restaurants 20 Illegal Logging And Export 22 Dams And Roads 22 10. -
Digestive Strategies in Ruminants and Nonruminants S.E. Van Wieren
DIGESTIVE STRATEGIES IN RUMINANTS AND NONRUMINANTS S.E. VANWIERE N 0000 0714 3726 Promotoren: Dr. ir. S. Tamminga, buitengewoon hoogleraar op het vakgebied van de veevoeding in het bijzonder de voeding van herkauwers Dr. H.H.T. Prins, hoogleraar in het natuurbeheer in de tropen en oecologie van vertebraten WMoPûi , ZI 9 S.E. van Wieren DIGESTIVE STRATEGIES IN RUMINANTS AND NONRUMINANTS Proefschrift ter verkrijging van de graad van doctor op gezag van de rector magnificus van de Landbouwuniversiteit Wageningen, dr. C.M. Karssen, in het openbaar te verdedigen op dinsdag 3 december 1996 des namiddags te vier uur in de Aula. aiqo?<? T CIP-DATA KONINKLIJKE BIBLIOTHEEK, DEN HAAG Van Wieren, S.E. Digestive strategies in ruminants and nonruminants / S.E. van Wieren. - Thesis Landbouw Universiteit Wageningen. - With réf. - With summary in Dutch. ISBN 90-5485-611-4 Subject headings: digestion / ruminants /nonruminants / feeding ecology cr.-::i n; . •Y.:r Cover and illustrations: Esther van Nie & Marjolein Wiersma STELLINGEN I De veelvuldig aangehangen gedachte dat paarden, wat betreft de dagelijkse opname van metaboliseerbare energie uit laagwaardig voedsel, superieur zijn aan runderen, wordt niet door alle onderzoek ondersteund en blijkt ook niet altijd uit praktijkervaringen. P. Duncan et al. (1990). Oecologia 84:411-418. R. Meydam. Evaluatie begrazing Meyendel. 1996. II Wilde zwijnen die op een dieet van uitsluitend mast leven, krijgen onherroepelijk eiwitgebrek. III Het concept van duurzame ontwikkeling leidt in de praktijk niet zozeer tot beperkingen aan de groei, maar meer tot de groei van de beperkingen. B. Willers. (1994). Conservation Biology (8):1146-1148 . IV De typisch nederlandse gedachte dat de mens verrijkend heeft gewerkt op de natuur, is een gevaarlijke misvatting. -
Trade in Endangered Species Order 2017
2017/22 Trade in Endangered Species Order 2017 Patsy Reddy, Governor-General Order in Council At Wellington this 20th day of February 2017 Present: The Right Hon Bill English presiding in Council This order is made under section 53 of the Trade in Endangered Species Act 1989 on the advice and with the consent of the Executive Council. Contents Page 1 Title 1 2 Commencement 1 3 Meaning of Act 2 4 Schedules 1, 2, and 3 of Act replaced 2 5 Schedule 2 of Act amended 2 6 Revocation 3 Schedule 4 Schedules 1, 2, and 3 of Act replaced Order 1 Title This order is the Trade in Endangered Species Order 2017. 2 Commencement (1) Clause 5(1) comes into force on 4 April 2017. 1 cl 3 Trade in Endangered Species Order 2017 2017/22 (2) Clause 5(2) comes into force on 4 October 2017. (3) The rest of this order comes into force on the day after the date of its notifica- tion in Gazette. 3 Meaning of Act In this order, Act means the Trade in Endangered Species Act 1989. 4 Schedules 1, 2, and 3 of Act replaced Replace Schedules 1, 2, and 3 of the Act with the Schedules 1, 2, and 3 set out in the Schedule of this order. 5 Schedule 2 of Act amended (1) In Schedule 2, Part 1, of the Act, in the item relating to Class—Elasmobranchii (sharks) (as replaced by clause 4), replace the item relating to Myliobatiformes with: Myliobatiformes Myliobatidae— Manta spp Manta Rays Eagle and mobulid rays Mobula spp Devil Rays (2) In Schedule 2, Part 1, of the Act, replace the item relating to Class—Elasmo- branchii (sharks) (as replaced by clause 4 and amended by subclause