Genetic Analysis of the Hsm3 Protein Function in Yeast Saccharomyces Cerevisiae Nub4 Complex

G C A T T A C G G C A T genes

Article Genetic Analysis of the Hsm3 Protein Function in Yeast Saccharomyces cerevisiae NuB4 Complex

Tatiyana A. Evstyukhina 1,2, Elena A. Alekseeva 1,2,* , Dmitriy V. Fedorov 1, Vyacheslav T. Peshekhonov 1,2 and Vladimir G. Korolev 1,2

1 Laboratory of Eukaryotic Genetics, Department of Molecular and Radiation Biophysics, Petersburg Nuclear Physics Institute Named by B.P. Konstantinov of National Research Centre “Kurchatov Institute”, 188300 Gatchina, Russia; [email protected] (T.A.E.); [email protected] (D.V.F.); [email protected] (V.T.P.); [email protected] (V.G.K.) 2 Laboratory of Molecular Genetic and Recombination Technologies, Kurchatov Genome Center— Petersburg Nuclear Physics Institute, mkr. Orlova Roscha 1, Leningrad District, 188300 Gatchina, Russia * Correspondence: [email protected]

Abstract: In the nuclear compartment of yeast, NuB4 core complex consists of three proteins, Hat1, Hat2, and Hif1, and interacts with a number of other factors. In particular, it was shown that NuB4 complex physically interacts with Hsm3p. Early we demonstrated that the gene HSM3 participates in the control of replicative and reparative spontaneous mutagenesis, and that hsm3∆ mutants increase the frequency of mutations induced by different mutagens. It was previously believed that the HSM3 gene controlled only some minor repair processes in the cell, but later it was suggested that it had a chaperone function with its participation in proteasome assembly. In this work, we analyzed the properties of three hsm3∆, hif1∆, and hat1∆ mutants. The results obtained showed that the Citation: Evstyukhina, T.A.; Hsm3 protein may be a functional subunit of NuB4 complex. It has been shown that hsm3- and hif1- Alekseeva, E.A.; Fedorov, D.V.; dependent UV-induced mutagenesis is completely suppressed by inactivation of the Polη polymerase. Peshekhonov, V.T.; Korolev, V.G. η Genetic Analysis of the Hsm3 Protein We showed a significant role of Pol for hsm3-dependent mutagenesis at non-bipyrimidine sites (NBP Function in Yeast Saccharomyces sites). The efficiency of expression of RNR (RiboNucleotid Reducase) genes after UV irradiation in cerevisiae NuB4 Complex. Genes 2021, hsm3∆ and hif1∆ mutants was several times lower than in wild-type cells. Thus, we have presented 12, 1083. https://doi.org/10.3390/ evidence that significant increase in the dNTP levels suppress hsm3- and hif1-dependent mutagenesis genes12071083 and Polη is responsible for hsm3- and hif1-dependent mutagenesis.

Academic Editors: Martin Kupiec and Keywords: yeast; Saccharomyces cerevisiae; NuB4 complex; HSM3 gene; HIF1 gene; UV-induced muta- Maciej Wnuk genesis

Received: 15 June 2021 Accepted: 15 July 2021 Published: 17 July 2021 1. Introduction The chromatin of eukaryotic cells consists of nucleosome core particles containing a Publisher’s Note: MDPI stays neutral histone octamer core wrapped approximately two times with 147 bp of DNA. The histone with regard to jurisdictional claims in published maps and institutional affil- core comprises a heterotetramer of two copies each of the histones H3 and H4 and two iations. heterodimers of H2A and H2B [1]. Histones are highly charged basic proteins, which bind with chaperones that prevent them from interacting nonspecifically with other proteins and DNA and help regulate their proper deposition into nucleosomes [2]. The chromatin assembly of a genome imposes limitations on many cellular processes that require accessibility to chromosomal DNA. The posttranslational acetylation of the Copyright: © 2021 by the authors. histone N-terminal tails has been shown to be an important mechanism by which cells Licensee MDPI, Basel, Switzerland. regulate accessibility to chromatin [3]. The tail acetylation of newly synthesized H3 and This article is an open access article distributed under the terms and H4 molecules is a transient modification. This modification changes both the charge and conditions of the Creative Commons structure of lysine residues and is catalyzed by histone acetyltransferases. Attribution (CC BY) license (https:// Hat1 is the founding member of the class of enzymes known as type B histone creativecommons.org/licenses/by/ acetyltransferases (HATs) [4]. Hat1p and Hat2p make up the core HAT1 complex [4]. 4.0/). Hat1p specifically acetylates lysine residues at positions 5 and 12 of the free histone

Genes 2021, 12, 1083. https://doi.org/10.3390/genes12071083 https://www.mdpi.com/journal/genes Genes 2021, 12, 1083 2 of 17

H4 [5–11]. Genetic studies in yeast showed that the absence of histone H4 lysines 5 and 12 acetylation pattern had no effect on chromatin assembly and cell proliferation or viability [10–14]. Subsequent analyses indicated that Hat1 is actually a predominantly nuclear enzyme [15–17]. When in the nuclear compartment, Hat1 core complex interacts with a number of other factors. These interactions provide important clues to the functional role of Hat1. Hat1 is most often represented in the nucleus of a yeast cell as a NuB4 complex that contains Hat1p, Hat2p, and Hif1p [16,17]. Hat2p possess histone chaperone activity and, therefore, are thought to mediate the interactions of these varied NuB4 complexes with histones [17–21]. Hif1p is a member of the N1 family of histone chaperones and specifically interacts with histones H3 and H4. Hif1p can participate in the deposition of histones onto DNA, suggesting that Hat1p may be directly involved in the chromatin assembly process [16]. It was shown that NuB4 complex physically interacts with Hsm3p [22–24]. It was shown earlier that the gene HSM3 participates in the control of replicative and reparative spontaneous mutagenesis, and that hsm3∆ mutants increase the frequency of mutations induced by different mutagens [25–31]. It was previously believed that the HSM3 gene controlled only some minor repair processes in the cell, but later it was suggested that it had a chaperone function with its participation in proteasome assembly [32–34]. This was confirmed quite recently: Takagi et al., 2012 [35] succeeded in establishing the spatial structure of the Hsm3 protein, as well as showing the interaction of this protein with the subunits of the proteasome complex. It means that that the product of this gene may have more than one functional domain. Analysis of various mutant alleles of the HSM3 gene revealed that the C-terminal domain of the Hsm3 protein is responsible only for controlling induced and spontaneous mutagenesis and does not affect proteasome assembly [36]. To determine possible role of the HSM3 and HIF1 genes in HAT1 complex function, we conducted genetic analysis of properties of three hsm3∆, hif1∆, and hat1∆ mutants. Besides, our findings show that Polη is responsible for hsm3- and hif1-dependent mutagenesis.

2. Materials and Methods Strains: S. cerevisiae strains used in this work are described in Table1. The hat1∆ (CAY-2) and hif1∆ (CAY-3) mutants were obtained from the previously described LMG-3031 (MATα ade2∆-248 leu2-3,112 ura3-160,188 trp1) strain [30] by gene replacement. A PCR-generated natMX6 module and a PCR module containing the ura4+ gene from Schizosaccharomyces pombe were ampliﬁed from pFLA6A-natMX6 and pFLA6a-ura4+ plasmids (Latypov) using HAT1_DelL: 50-cgaatttattagatttctatgtatttctacttgaagttaggaatagatctttctgg aattgttttcagcaaaattatgcttcgtacgctgcaggtcg-30; HAT1_DelR: 50-atatcatcgatgaattcgagcgacaacata acggcttcaacctttgcataagcttatattaactatagagacactttgatgatcatctcgatgatg-30; and HIF1_DelL: 50-atggggttacgtagtcgaaggatatagcagtgtctaaaaacttgcaagagcactcgtagcttcgtacgctgcaggtcg-30; HIF1_DelR: 50-atatcatcgatgaattcgagctccttatgaatagagaaaaatg actttttttagatgtgtaagtatgtcatttcag ggatggtctgcttgctctttaaatattt-30 deoxyoligonucleotides, respectively. The LMG-3031 strain was transformed with those modules, and the transformants were selected on plates with YEPD containing 30 mg/L nourseothricin and on plates with selective media without uracil respectively. The double hif1∆ hsm3∆ (CAY-9) and hsm3∆ hat1∆ (CAY-15) mutants were constructed from previously described 5-LMG-3031 (MATα ade2∆-248 leu2-3,112 ura3- 160,188 trp1 hsm3::Kan R) strain [30], as described above. The double hif1∆ hat1∆ (CAY-11) and the triple hif1∆ hsm3∆ hat1∆ (CAY-10) mutants were obtained by replacement of HAT1 gene in hif1∆ (CAY-3) and hif1∆ hsm3∆ (CAY-9) strains, according to the same procedure. All mutants were PCR-veriﬁed. Genes 2021, 12, 1083 3 of 17

Table 1. Strains’ genotypes.

Strain Genotype 11D-LMG-3031 MATa ade2∆-248 leu2-3.112 ura3-160.188 trp1∆ 5-LMG-3031 MATa ade2∆-248 ura3-160,188 leu2-3,112 trp1 hsm3::KanR LMG-351 MATa ade2∆-248 leu2-3.112 ura3-160.188 trp1∆ rad1::LEU2 LMG-352 MAT a ade2∆-248 ura3-160,188 leu2-3,112 trp1 rad2::TRP1 10-CAY-3031 MAT α ade2∆-248 ura3-160,188 leu2-3,112 trp1 rad52::URA3 CAY-2 MAT a ade2∆-248 ura3-160,188 leu2-3,112 trp1 hat1::NAT CAY-3 MAT a ade2∆-248 ura3-160,188 leu2-3,112 trp1 hif1::ura4+(S. pombe) CAY-4 MAT a ade2∆-248 ura3-160,188 leu2-3,112 trp1 hat1::NAT rad52::URA3 CAY-6 MAT a ade2∆-248 ura3-160,188 leu2-3,112 trp1hat1::NAT rad1::LEU2 CAY-7 MAT a ade2∆-248 ura3-160,188 leu2-3,112 trp1 hat1::NAT rad2::TRP1 13-CAY-5-3031 MAT α ade2∆-248 ura3-160,188 leu2-3,112 trp1 hsm3::Kan R rad52::URA3 CAY-9 MAT α ade2∆-248 ura3-160,188 leu2-3,112 trp1 hif1::ura4+(S. pombe) hsm3::Kan R CAY-10 MAT α ade2∆-248 ura3-160,188 leu2-3,112 trp1 hat1::NAT hif1::ura4+(S. pombe) hsm3::Kan R CAY-11 MAT α ade2∆-248 ura3-160,188 leu2-3,112 trp1 hif1::ura4+(S. pombe) hat1::NAT CAY-12 MAT α ade2∆-248 ura3-160,188 leu2-3,112 trp1 hif1::ura4+(S. pombe) rad2::TRP1 CAY-13 MAT α ade2∆-248 ura3-160,188 leu2-3,112 trp1 hif1::ura4+(S. pombe) rad52::LEU2 CAY-15 MAT α ade2∆-248 ura3-160,188 leu2-3,112 trp1 hsm3::Kan R hat1::NAT TAE-151 MAT α ade2∆-248 ura3-160,188 leu2-3,112 trp1 hsm3::Kan R sml1::NAT TAE-152 MAT α ade2∆-248 ura3-160,188 leu2-3,112 trp1 rad30::NAT hsm3::Kan R TAE-153 MAT α ade2∆-248 ura3-160,188 leu2-3,112 trp1 rad30::NAT TAE-154 MAT α ade2∆-248 ura3-160,188 leu2-3,112 trp1 hif1::ura4+(S. pombe) dun1::NAT DVF-15 MAT α ade2∆-248 ura3-160,188 leu2-3,112 trp1 dun1::NAT hsm3::Kan R DVF-16 MAT α ade2∆-248 ura3-160,188 leu2-3,112 trp1 dun1::NAT TAE-155 MAT a ade2∆-248 ura3-160,188 leu2-3,112 trp1 hsm3-1 hif1::ura4+(S. pombe) 6-DVF-3031 MATα ade2∆-248 ura3-160,188 leu2-3,112 trp1 sml1::kanMX

The double hat1∆ rad1∆ (CAY-6) mutant was constructed by transforming the hat1∆ (CAY-2) strain with pJH552 (R. Keil) plasmid digested by SalI. The double hat1∆ rad2∆ (CAY-7) and hif1∆ rad2∆ (CAY-12) mutants were obtained by transforming hat1∆ (CAY-2) and hif1∆ (CAY-3) strains with pWS521 (W. Siede) plasmid digested by SalI. The double hat1 ∆rad52∆ and hif1∆ rad52∆were produced by transforming hat1∆ and hif1∆ strains with pJH183 and pJH181 plasmids, respectively, digested by BamHI. All transformants were selected on plates with proper selective media. In comparative experiments previously described, LMG-351 (MATα ade2∆-248 leu2- 3,112 ura3-160,188 trp1 rad1::LEU2)[29], LMG-352 (MATα ade2∆-248 leu2-3,112 ura3-160,188 trp1 rad2::TRP1)[37], 10-CAY-3031 (MATα ade2∆-248 leu2-3,112 ura3-160,188 trp1 rad52::URA3)[38], and 13-CAY-5-3031 (MATα ade2∆-248 leu2-3,112 ura3-160,188 trp1 hsm3::KanR rad52::URA3)[38] strains were used. Media: Standard yeast media of complete and minimal composition were used in the work [39]. In some experiments, a liquid YPD was used without the addition of agar. When working with auxotrophic mutants, metabolites required for growth were added to the minimal medium at a rate of 20 mg/L for amino acids and 3 mg/L for nitrogen bases. As a selective medium for accounting for the frequency of canavanine resistance mutations, a minimal medium was used with the addition of a liquid YPD in an amount of 10 mL/L and required for the growth of amino acids and nitrogenous bases. Depending on the strains used, canavanine concentrations were up to 80 mg/L. Taking into account the frequency of induced mutations at ﬁve loci, YPD with an alcohol instead of glucose was used, the composition of which was described earlier [37]. Sensitivity against UV irradiation: Cell killing tests were performed on plates by growing overnight a culture of the respective strain in liquid YPD at 30 ◦C. Cells were washed and resuspended in water at a density of 1 × 107 cell/mL. Cells were irradiated with a UV lamp BUV-30 (UV-C range). Aliquots were withdrawn at different times, diluted, and plated onto YPD plates to determine the number of survivors. Genes 2021, 12, 1083 4 of 17

Mutation frequency: Mutation tests were performed on plates by growing overnight a culture of the respective strain in liquid YPD at 30 ◦C. Cells were washed and resuspended in water at a density of 1 × 107 cell/mL. Cells were irradiated with a UV lamp BUF-30. Aliquots were withdrawn at different times, diluted, and plated onto YPD plates to determine the number of survivors. To determine the mutation frequency, undiluted aliquots were plated onto a medium YPD with an alcohol instead of glucose, the composition of which was described earlier [37]. Mutation rates: Mutation rates were determined according to the methods: fluctuation test [40] and ordered seeding [41]. The first method allows the determination of the rate of spontaneous yeast cell mutations in the process of fast growth on complete medium. After incubation for three days, 12 separate colonies were scored, and each colony was suspended in 1 mL of water and plated on selective medium with canavanine, at a concentration that rules out the possibility of growth of canavanine-sensitive cells. When estimating the number of plated cells, we diluted suspensions and plated them on complete medium. After incubation for three or four days, the number of canavanine-resistant colonies and the total number of cells on the plate were counted. The occurrence frequency of spontaneous mutations was estimated using the special formula [32]. Using the method of perfect order plating, one can register the frequency of spontaneous mutations arising in the process of slow growth on selective medium containing lower concentrations of canavanine in which cells are grown over 8 to 10 divisions. Cells were incubated in 2 mL of complete liquid medium for 2 days; next, 1 mL of grown culture was diluted in 5 mL of water. A special replicator having 150 appliances was embedded into the suspension, and drops were placed onto plates with selective medium. After a14-day incubation, the number of canavanine-resistant colonies and the total number of cells grown in 150 spots was counted. The number of grown non-mutant cells was determined after washing away cells from individual reprints on which no canavanine-resistant colony was visualized. The rate of mutation was determined by dividing the number of canavanine-resistant colonies by the number of cells in all reprints [33]. In total, five replicates of the experiment are shown on the graphs and in the tables, and the mean values with 95% confidence intervals are given. Real-time PCR: For conducting Real-time PCR was used on a CFX96 RT-PCR Detec- tion system (Bio-Rad, Watford, UK). The reactions were carried out in 25 µL volumes con- sisting of 10 µL 2,5-fold reaction mixture for RT-PCR in the presence SYBR Green I dye and Rox reference dye (Syntol, Moscow, Russia), 14.1 µL water, 0.7 µL of cDNA and 0.1 (2 mM) respective primers (primers for gene RNR3: ForRNR3 50-ACACCTTTCATGGTTTATAAG- 30 and RevRNR3 50-CGACGATTTCACAACATAA-30; for gene ACT1: ForACT1 50- GAAGGTCAAGATCATTGC-30 and RevACT1 50- GTTGGAAGGTAGTCAAAG-30). PCR cycling conditions were as follows: 1 cycle of 5 min at 95 ◦C, followed by 39 cycles of 15 s at 95 ◦C and 20 s at 52 ◦C. Melting curve analysis was 5 s incremental increases of 1 ◦C from 55 ◦C to 95 ◦C. Control reactions with primer and template free reaction mixtures were included. Two biological and three technical replicates were performed for each sample. The results were processed using the CFX Manager program (Bio-Rad, Watford, UK). Statistical analysis: Experimental data are shown as the means standard deviations from at least three biological replicates, and statistical differences were determined by the Student’s t-test. Significance was determined at the level of p < 0.05.

3. Results The physical interaction between the products of the genes HAT1, HIF1, and HSM3 has been demonstrated in previous studies [22–24]. We suppose that this interaction plays a functional role and Hsm3 protein is a subunit of NuB4 complex. In this work, we conducted a comparative study of the genetic properties of hif1∆ and hsm3∆ mutations and their interaction with a deletion mutation in the HAT1 gene, which codes for the catalytic subunit of the complex. Genes 2021, 12, 1083 5 of 17

HSM3 and HIF1: It has been shown that the mutants for the HAT1 gene affect the repair processes in yeast [42]. Therefore, we first tested spontaneous mortality of the single hif1∆ and hsm3∆ mutants. The percentage of lethal clones was assessed after a day of incubation in solid complete medium. Clones with fewer than 16 cells were considered to be lethal. In the test for spontaneous mortality, both mutants showed the same pattern. These mutants did not change significantly the rate of spontaneous death of cells compared to the wild-type strain (Table2). According to our research and the data presented in work [38], in the double hif1∆ rad52∆ and hsm3∆ rad52∆ mutants, hif1∆ and hsm3∆ mutants were equally epistatized to recombination-deficient mutants. These data support the hypothesis advanced earlier that hsm3∆ mutation (maybe hif1∆) leads to the destabilization of the D-loop during the post-replicative repair [38,43] and thus reduces the load on the path of the recombination repair, which is blocked in rad52∆ mutant.

Table 2. Rate of spontaneous lethal clones after 1 day of incubation on a dense nutrient medium.

Rate of Spontaneous Strains Lethal Clones (%) WT 3.8 ± 1.39 rad52∆ 10.1 ± 3.15 hif1∆ 5.0 ± 1.71 hif1∆ rad52∆ 5.3 ± 2.04 hat1∆ 11.4 ± 3.97 hat1∆ rad52∆ 10.1 ± 1.36

To further test the survival of hsm3∆ and hif1∆ mutants, we performed experiments with UV light. We found that both single mutants showed the same sensitivity to UV as a wild-type strain (Figure1A). The double hsm3∆ hif1∆ mutant practically did not differ in this parameter from single mutants (Figure2A). Thus, mutations in the HIF1 and HSM3 genes have no significant effect on the survival of yeast cells after UV irradiation. In order to study the role hsm3∆ and hif1∆ mutants in the DNA damage response, we were constructed double mutant strains with genes from the major DNA repair pathways. Nucleotide excision repair-deficient strain, rad2∆, was used for RAD3 epistasis group, while rad52∆ was chosen for the recombination repair epistasis group. The hif1∆ mutation, like the hsm3∆ mutation, in combination with rad2∆ did not lead to a change in the UV resistance of the double mutant hif1∆ rad2∆ cells compared to the cells of a single rad2∆ mutant (Figure1C,D). Based on the data obtained, it can be concluded that hsm3∆ and hif1∆ mutations do not affect NER. rad54∆ and rad52∆ mutants are weakly sensitive to UV, which corresponds to the previously obtained data [38]. Earlier, we have shown that hsm3∆ mutation does not change the UV sensitivity of rad52∆ mutant [38]. Double hif1∆ rad52∆ mutant had the same sensitivity as single radiosensitive mutant (Figure1B). Taken together, hsm3∆ and hif1∆ mutations did not affect the radiosensitivity of yeast cells. It has been shown that the HSM3 gene participates in the control of replicative and reparative spontaneous mutagenesis [29]. Therefore, we set out to compare the spontaneous mutagenesis of the hif1∆ mutant to that of the hsm3∆ mutant. When studying the rate of occurrence of spontaneous mutations, we used two different methods: the fluctuation test (the “Coulson-Lee median” method), which that allows to determine level of spontaneous replication mutagenesis, and the method of ordered seeding, which can be judged on the level of reparative mutagenesis. In both cases, the frequency of mutations in the CAN1 gene was calculated. From the data in Table3 it is seen that that the presence of hsm3∆ and hif1∆ mutations in cells leads to a slight change in the rate of replicative spontaneous mutations compared to wild-type cells. In the ordered seeding test, both mutations led to a sharp increase in the rate of spontaneous mutagenesis. hsm3∆ and hif1∆ mutations increased the rate of spontaneous reparative mutagenesis in this test by approximately 18 times. These results support the notion that hsm3∆ and hif1∆ have the same phenotype. Genes 2021Genes, 12 2021, 1083, 12, x FOR PEER REVIEW 6 of 18 6 of 17

FigureFigure 1. Sensitivity 1. Sensitivity and and mutagenesis mutagenesis in in various various mutantmutant strains at at di differentfferent UV UV doses. doses. Cells Cells were were irradiated irradiated at the atindicated the indicated dose,dose, the viable the viable titer titer was was determined, determined, and and the the percentage percentage of survivals survivals was was calculated. calculated. The Themutation mutation frequencies frequencies were were determined, as a ratio of the number of white colonies to the number of all colonies grown in a cup with complete medium. determined, as a ratio of the number of white colonies to the number of all colonies grown in a cup with complete medium. The mean ± SEM values obtained from four independent experiments are plotted. (A) UV-induced sensitivity in strain The meanwild-type± SEM (LMG-3031) values obtained and mutant from strains four hsm3 independentΔ (5-LGM-3031), experiments hif1Δ (CAY-3); are plotted. (B) UV-induced (A) UV-induced sensitivity sensitivity in mutant in strain wild-typestrains (LMG-3031) rad52Δ hif1Δand (CAY-13) mutant, rad52 strainsΔ (10-CAY-3031);hsm3∆ (5-LGM-3031), (C) UV-inducedhif1 ∆sensitivity(CAY-3); mutagenesis (B) UV-induced in mutant sensitivity strains hif1 inΔ mutant strainsrad2rad52Δ (CAY-12),∆ hif1∆ (CAY-13) rad2Δ (LGM-352),, rad52∆ (10-CAY-3031); hsm3Δ (5-LGM-3031); (C) UV-induced (D) UV-induced sensitivity mutagenesis mutagenesis in mutant in mutant strains strains hif1Δ rad2hif1Δ∆ rad2∆ Genes 2021(CAY-12),, 12, x FOR rad2 PEERΔ (LGM-352). REVIEW 7 of 18 (CAY-12), rad2∆ (LGM-352), hsm3∆ (5-LGM-3031); (D) UV-induced mutagenesis in mutant strains hif1∆ rad2∆ (CAY-12), rad2∆ (LGM-352).

FigureFigure 2. Dependence 2. Dependence of theof the frequency frequency of of induced induced mutagenesis on on the the dose dose of ofUV UV rays. rays. The Themean mean ± SEM± valuesSEMvalues obtained obtained fromfrom 4 independent 4 independent experiments experiments are are plotted. plotted. ((A) Frequencies of of UV-induc UV-induceded mutations mutations in strain in strain wild-type wild-type (LMG-3031) (LMG-3031) and mutant strains hsm3Δ (5-LGM-3031), hif1Δ (CAY-3), hsm3Δ hif1Δ (CAY-9), hsm3-1 hif1Δ (TAE155); (B) Frequencies of hsm3 hif1 hsm3 hif1 hsm3-1 hif1 B and mutantUV-induced strains mutations∆ in(5-LGM-3031), wild-type (LMG-3031)∆ (CAY-3),and mutant strains∆ rad52∆ (CAY-9),Δ (10-CAY-3031), rad52∆Δ (TAE155);hif1Δ (CAY-13), ( ) Frequencieshif1Δ of UV-induced(CAY-3). mutations in wild-type (LMG-3031) and mutant strains rad52∆ (10-CAY-3031), rad52∆ hif1∆ (CAY-13), hif1∆ (CAY-3). In order to study the role hsm3Δ and hif1Δ mutants in the DNA damage response, we were constructed double mutant strains with genes from the major DNA repair pathways. Nucleotide excision repair-deficient strain, rad2Δ, was used for RAD3 epistasis group, while rad52Δ was chosen for the recombination repair epistasis group. The hif1Δ mutation, like the hsm3Δ mutation, in combination with rad2Δ did not lead to a change in the UV resistance of the double mutant hif1Δ rad2Δ cells compared to the cells of a single rad2Δ mutant (Figure 1C, D). Based on the data obtained, it can be concluded that hsm3Δ and hif1Δ mutations do not affect NER. rad54Δ and rad52Δ mutants are weakly sensitive to UV, which corresponds to the previously obtained data [38]. Earlier, we have shown that hsm3Δ mutation does not change the UV sensitivity of rad52Δ mutant [38]. Double hif1Δ rad52Δ mutant had the same sensitivity as single radiosensitive mutant (Figure 1B). Taken together, hsm3Δ and hif1Δ mutations did not affect the radiosensitivity of yeast cells. It has been shown that the HSM3 gene participates in the control of replicative and reparative spontaneous mutagenesis [29]. Therefore, we set out to compare the spontaneous mutagenesis of the hif1Δ mutant to that of the hsm3Δ mutant. When studying the rate of occurrence of spontaneous mutations, we used two different methods: the fluctuation test (the “Coulson-Lee median” method), which that allows to determine level of spontaneous replication mutagenesis, and the method of ordered seeding, which can be judged on the level of reparative mutagenesis. In both cases, the frequency of mutations in the CAN1 gene was calculated. From the data in Table 3 it is seen that that the presence of hsm3Δ and hif1Δ mutations in cells leads to a slight change in the rate of replicative spontaneous mutations compared to wild-type cells. In the ordered seeding test, both mutations led to a sharp increase in the rate of spontaneous mutagenesis. hsm3Δ and hif1Δ mutations increased the rate of spontaneous reparative mutagenesis in this test by approximately 18 times. These results support the notion that hsm3Δ and hif1Δ have the same phenotype.

Genes 2021, 12, 1083 7 of 17

Table 3. Spontaneous mutagenesis of resistance to canavanine.

Strain Ordered Seeding, ×10−7 Fluctuation Test, ×10−7 WT 3.0 ± 0.24 3.0 ± 0.16 hsm3∆ 56.6 ± 3.44 3.6 ± 0.89 hif1∆ 52.1 ± 5.17 3.9 ± 0.63 hat1∆ 27.1 ± 4.12 4.1 ± 0.54 hat1∆ hif1∆ 26.9 ± 3.61 4.1 ± 0.33 hat1∆ hsm3∆ 23.3 ± 5.70 4.1 ± 0.40

Earlier, we studied in detail the effect of hsm3∆ mutation on UV-induced mutagenesis [29]. As shown previously, hsm3∆ mutation significantly increased the induced mutagenesis when exposed to various mutagenic factors. As shown in Figure2A, the hif1∆ mutation, like hsm3∆ mutation, significantly increased the frequency of UV-induced mutagenesis. Unexpectedly, the double hsm3∆ hif1∆ mutant showed the level of UV-induced mutagenesis peculiar to wild-type strain, as well as a double mutant hsm3-1 hif1∆ mutant with a point mutation of the C-terminal domain of the Hsm3p. (Figure2A). Hence the loss of both the Hif1p and Hsm3p results in increased UV-induced mutagenesis; inactivation of both proteins leads to a phenotype corresponding to the wild-type cells. In all previous experiments, we used an unsynchronized cell culture. As it is known, in such a culture there is a mixture of cells in the G1, S, and G2 phases. The repair of UV-induced damage occurs by the mechanism of the nucleotide excision repair (NER) at all three stages of the cell cycle. In NER-defective strains, damage repair will be performed in the S and G2 phases by the process of postreplicative and recombination repairs. To assess the effect of mutations in the genes encoding the subunits of the HAT1 complex, we have disrupted the key gene that provides NER in the single mutants mentioned above. hsm3∆ mutation significantly increases the mutagenesis of rad2∆ mutant with broken nucleotide excision repair [37]. We tested how the mutation in the HIF1 gene, which codes for another subunit of the NuB4 complex, affects UV mutagenesis. As shown in Figure1B, the interaction of rad2∆ and hif1∆ mutations has a synergistic character, as in the case of the interaction of hsm3∆ and rad2∆ mutations. Earlier, we had shown that rad52∆ mutation suppressed UV-induced mutagenesis in hsm3∆ significantly [38]. Therefore, we wished now to compare the UV-induced mutagenesis of hif1∆ mutant with that of rad52∆ mutant. rad52∆ mutation suppressed the UV-induced mutagenesis of hif1∆ mutant to wild-type strain level (Figure2B). In summary, hsm3∆ mutation may be considered a phenocopy of hif1∆ mutation. However, the rad52∆ mutation suppresses hsm3- and hif1-dependent UV-induced mutagenesis in different ways. In the hif1∆ mutant, the rad52∆ mutation suppresses the frequency of UV-induced mutations to the wild-type level, while in the hsm3∆ mutant the rad52∆ mutation slightly reduces the frequency of UV-induced mutations [38]. There was also a difference in the frequency of UV-induced mutagenesis in single mutants hsm3∆ and hif1∆ (Figure2A). HAT1: Hat1p is the catalytic subunit of HAT complex. Therefore, we first tested for the genetic properties of hat1∆ mutant. The spontaneous mortality of single hat1∆ and double hat1∆ rad52∆ mutants compared to that of the wild-type strain. rad52∆ and hat1∆ single mutations increased the percentage of lethal clones to 10.1 ± 3.15 and 11.4 ± 3.97% respectively (Table2). Double mutants hat1∆ rad52∆ did not change the frequency of spontaneous cell death compared to single mutants (Table2). Thus, there is an epistatic interaction of hat1∆ mutation with mutations that block the recombination repair. This conclusion is supported by data comparing the UV sensitivity of a single mutant hat1∆ with the UV sensitivity of double mutants hat1∆ rad52∆. Both strains, studied, showed the same UV sensitivity (Figure3A). Thus, in hat1∆ mutant, the recombination repair pathway of spontaneous and UV-induced lesions is destroyed. Genes 2021, 12, x FOR PEER REVIEW 9 of 18

Next, we tested the UV sensitivity of wild-type strain versus a single hat1Δ mutant. A single mutant showed a sensitivity to UV comparable to the sensitivity of a wild-type strain (Figure 3B). Therefore, mutant hat1Δ does not affect NER. This conclusion is confirmed by the results obtained for the interaction of hat1Δ mutation and rad1Δ, which Genes 2021, 12, 1083 blocks NER. The double rad1Δ hat1Δ mutant showed UV sensitivity equal to a single8 of 17 rad1Δ mutant (Figure 3C).

FigureFigure 3.3. SensitivitySensitivity andand mutagenesismutagenesis inin differentdifferent strainsstrains afterafter UVUV irradiationirradiation atat differentdifferent doses.doses. TheThe viableviable titertiter waswas determined,determined, andand thethe percentagepercentage ofof survivalssurvivals waswas calculated.calculated. TheThe meanmean ±± SEM valuesvalues obtainedobtained fromfrom 44 independentindependent experimentsexperiments areare plotted. plotted. ( A(A) UV-sensitivity) UV-sensitivity and and mutation mutation frequency frequency in mutantin mutant strains strainshat1 ∆hat1(CAY-2),Δ (CAY-2),rad52 rad52∆ (10-CAY-3031),Δ (10-CAY- hat13031),∆ rad52 hat1Δ∆ rad52(CAY-4);Δ (CAY-4); (B) UV-sensitivity (B) UV-sensitivity and mutation and mutation frequency frequency in strain in wild-type strain wild-type (LMG-3031) (LMG-3031) and mutant and mutant strain hat1strain∆ (CAY-2);hat1Δ (CAY-2); (C) UV-sensitivity (C) UV-sensitivity and mutation and mutation frequency frequency in mutant in mutant strains rad1strains∆ (LMG-351), rad1Δ (LMG-351),rad1∆ hat1 rad1∆Δ(CAY-6). hat1Δ (CAY-6).

Next,Early wethe tested genetic the effects UV sensitivity of mutations of wild-type in HAT1 strain gene versus have a single not beenhat1∆ adequatelymutant. A singlestudied. mutant That showedis why we a sensitivity studied the to effect UV comparable of the hat1 toΔ mutation the sensitivity on the of mutation a wild-type process. strain (FigureFrom the3B). data Therefore, of Table mutant 3, it cahat1n be∆ seendoes that not affectthe presence NER. This of hat1 conclusionΔ mutation is conﬁrmed results in by a theslight results change obtained in the forrate the of interaction replicative of spontaneoushat1∆ mutation mutations and rad1 compared∆, which to blocks wild-type NER. The double rad1∆ hat1∆ mutant showed UV sensitivity equal to a single rad1∆ mutant (Figure3C). Early the genetic effects of mutations in HAT1 gene have not been adequately studied. That is why we studied the effect of the hat1∆ mutation on the mutation process. From the data of Table3, it can be seen that the presence of hat1∆ mutation results in a slight change in the rate of replicative spontaneous mutations compared to wild-type cells. However, in Genes 2021, 12, x FOR PEER REVIEW 10 of 18

cells. However, in the ordered seeding test, hat1Δ mutation leads to a sharp increase in the rate of spontaneous mutagenesis (Table 3). The frequency of direct mutations, in the loci of ADE4-ADE8, induced by UV rays in Genes 2021, 12, 1083 9 of 17 a wild-type strain and a single hat1Δ mutant was measured. The data presented in Figure 3B suggests that hat1Δ mutation does not affect the frequency of UV-induced mutagenesis. the ordered seeding test, hat1∆ mutation leads to a sharp increase in the rate of spontaneous mutagenesisAs can (Tablebe seen3). from Figure 3C single rad1Δ mutant and the double hat1Δ rad1Δ mutantThe have frequency approximately of direct mutations, the same in the level loci of ofADE4-ADE mutagenesis.8, induced Single by UV rad52 raysΔ in mutant a shows greaterwild-type UV-mutability strain and a single comparedhat1∆ mutant to wild-type was measured. strain The [38]. data presentedDouble hat1 in FigureΔ rad523B Δ mutant at lowsuggests doses that showedhat1∆ mutation the level does of mutagenesis not affect the frequency characteristic of UV-induced of a single mutagenesis. hat1Δ mutant (Figure 3A). Thus,As can in be this seen test, from Figurehat1Δ3 Cmutation single rad1 at∆ lowmutant doses and theepistatizes double hat1 to∆ rad1rad52∆ mutantΔ mutation. have approximately the same level of mutagenesis. Single rad52∆ mutant shows greater UV-mutabilityIt is known compared that the to Hat1 wild-type subunit strain is [cataly38]. Doubletic inhat1 the∆ HAT1rad52∆ complex.mutant at lowIn connection to this,doses we showed studied the levelthe ofepistatic mutagenesis interaction characteristic of ofhat1 a singleΔ mutationhat1∆ mutant with (Figure mutations3A). in genes, codingThus, infor this other test, hat1subunits∆ mutation of the at lowcomplex. doses epistatizes As shown to rad52in Table∆ mutation. 3, the spontaneous mutation rates inIt isdouble known hat1 that theΔ hsm3 Hat1Δ subunit and hat1 is catalyticΔ hif1Δ in mutants the HAT1 do complex. not differ In connection from the to spontaneous this, we studied the epistatic interaction of hat1∆ mutation with mutations in genes, coding mutationfor other subunitsrate in single of the complex. hat1Δ mutant. As shown These in Table data3, the corrobor spontaneousate mutation previous rates results in that hat1Δ epistatizeddouble hat1 ∆tohsm3 both∆ andsinglehat1 hsm3∆ hif1∆Δmutants and hif1 doΔ not mutants. differ from the spontaneous mutation rateFigure in single 4 hat1shows∆ mutant. the dependence These data corroborate of the mutagenesis previous results frequency that hat1∆ onepistatized the dose of UV rays forto single both single hat1hsm3Δ, hsm3∆ andΔhif1 and∆ mutants.hif1Δ mutants, double hat1Δ hif1Δ, hat1Δ hsm3Δ, hsm3Δ hif1Δ Figure4 shows the dependence of the mutagenesis frequency on the dose of UV rays mutants and triple hat1Δ hsm3Δ hif1Δ mutant. As can be seen from this figure, hat1Δ for single hat1∆, hsm3∆ and hif1∆ mutants, double hat1∆ hif1∆, hat1∆ hsm3∆, hsm3∆ hif1∆ mutationmutants andepistatizes triple hat1 to∆ allhsm3 studied∆ hif1∆ mutations.mutant. As can be seen from this ﬁgure, hat1∆ mutation epistatizes to all studied mutations.

Figure 4. UV-induced mutagenesis in mutant strains hsm3∆ (5-LGM-3031), hif1 ∆ (CAY-3), hat1∆ hat1 hif1 hat1 hsm3 hat1 hif1 hsm3 Figure(CAY-2), 4. UV-induced∆ ∆ (CAY-11), mutagenesi∆ s in∆ (CAY-15),mutant andstrains ∆hsm3∆Δ (5-LGM-3031),∆ (CAY-10) at differenthif1Δ (CAY-3), hat1Δ UV doses. (CAY-2), hat1Δ hif1Δ (CAY-11), hat1Δ hsm3Δ (CAY-15), and hat1Δ hif1Δ hsm3Δ (CAY-10) at different UV doses.Taken together, our results argue that hsm3∆ and hif1∆ mutants have the same phenotypes, and that hat1∆ mutation epistatizes to these mutations in all the used tests. Thus, Hsm3Taken protein together, may be a newour subunitresults of argue NuB4 complex.that hsm3Δ and hif1Δ mutants have the same phenotypes,Interaction and between that hat1RAD30Δ mutationand HSM3: epistatizesEvidencehas to beenthese obtained mutations showing in all that the used tests. HSM3 and HIM1 genes play a role in stabilizing the D-loops [42,44]. Earlier, we showed

Thus,that afterHsm3 the protein destruction may of be the a D-loop new subunit in the him1 ofmutant, NuB4 complex. Polη ﬁlls the remaining gap (44).Interaction Based on these between data, we RAD30 hypothesized and thatHSM3: the cause Evidence of hsm3 -mediatedhas been UV-inducedobtained showing that HSM3mutagenesis and HIM1 as well genes as him1 play-dependent a role UV-mutagenesisin stabilizing the is the D-loops replacement [42,44]. of Pol Earlier,δ with we showed thathighly after erroneous the destruction Polη. To test of this the assumption, D-loop in we the have him1 studied mutant, UV-induced Polη mutagenesisfills the remaining gap in rad30 and rad30 hsm3 mutants. rad30∆ single mutant showed UV-induced mutagenesis (44).as the Based wild-type on these strain data, (Figure we5). Athypothesized low doses, double that mutantthe cause showed of hsm3 the same-mediated level of UV-induced mutagenesis as well as him1-dependent UV-mutagenesis is the replacement of Polδ with highly erroneous Polη. To test this assumption, we have studied UV-induced mutagenesis in rad30 and rad30 hsm3 mutants. rad30Δ single mutant showed UV-induced mutagenesis as the wild-type strain (Figure 5). At low doses, double mutant showed the same level of

Genes 2021, 12, x FOR PEER REVIEW 11 of 18

Genes 2021, 12, 1083 10 of 17

UV-induced mutagenesis as single rad30Δ mutant. However, at high doses, UV-induced mutagenesis in the double mutant was noticeably lower than in the single rad30Δ. At the UV-induced mutagenesis as single rad30∆ mutant. However, at high doses, UV-induced same time, double mutant showed high UV resistance than the single rad30Δ. We mutagenesis in the double mutant was noticeably lower than in the single rad30∆. At the observed the same tendency in the case of him1Δ rad30Δ mutant [44]. Thus, we can same time, double mutant showed high UV resistance than the single rad30∆. We observed concludethe same that, tendency in during in the PRR case the of Polhim1η ∆inrad30 hsm3∆Δmutant mutant [carries44]. Thus, out wereparative can conclude synthesis that, in in unfilledduring PRRgaps. the Polη in hsm3∆ mutant carries out reparative synthesis in unﬁlled gaps.

Figure 5. Sensitivity and mutagenesis in different strains after UV irradiation at different doses. The viable titer was Figure 5. Sensitivity and mutagenesis in different strains after UV irradiation at different doses. The viable titer was determined,determined, and and the the percentage percentage of of survivals survivals was was calculated calculated.. The The mean mean ±± SEMSEM values values obtained obtained from from four four independent independent experimentsexperiments are are plotted. plotted. (A (A) )UV-induced UV-induced sensitivity sensitivity in in strain strain w wild-typeild-type (LMG-3031) (LMG-3031) and and mutant mutant strains strains rad30rad30Δ∆ (TAE-153),(TAE-153), rad30rad30Δ∆ hsm3hsm3Δ∆ (TAE-152);(TAE-152); ( (BB)) Frequencies Frequencies of of UV-induced UV-induced mutations mutations in in wild-type wild-type (LMG-3031) (LMG-3031) and and mutant mutant strains strains r rad30ad30Δ∆ (TAE-153),(TAE-153), rad30rad30Δ∆ hsm3hsm3Δ∆ (TAE-152).(TAE-152).

UV-inducedUV-induced mutations atat bipyrimidinebipyrimidine sites sites during during TLS TLS (TransLesion (TransLesion Synthesis) Synthesis) arise ariseas a resultas a ofresult bypassing of bypassing DNA damage. DNA Mutations damage. at Mutations non-bipyrimidine at non- sitesbipyrimidine frequently occursites frequentlyon an intact occur template on an during intact polymerase template during Polη repair polymerase synthesis. Pol Itη is repair known synthesis. that the CAN1 It is knowngene sequence that the contains CAN1 gene 77% bipyrimidinesequence contains sites and 77% 23% bipyrimidine non-bipyrimidine sites and sites 23% (NBP) non- [45]. bipyrimidineIn order to find sites out (NBP) the ratio [45]. ofIn UV-induced order to find mutations out the ratio in non- of UV-induced and bipyrimidine mutations sites in in non-mutant andrad30 bipyrimidine, mutation sites spectra in mutant were determined rad30, mutation at the spectraCAN1 locus were in determinedhsm3∆ strain. at the We CAN1used thelocus same in hsm3 schemeΔ strain. and experimental We used the conditionssame scheme as in and the experimental work with him1 conditions∆ mutant as [ 44in]. R 2 the100 workcan withmutants him1 wereΔ mutant isolated [44]. after 100 UVcan irradiationR mutants were at adose isolated 84 J/m after. UV irradiation at a doseThe 84 J/m spectrum2. of mutations obtained by us in hsm3∆ mutant practically obtained in the workThe spectrum [44]. The of UV-induced mutations obtained spectra generated by us in hsm3 in hsm3Δ mutant∆ background practically does obtained not differ in thefrom work the [44]. mutation The UV-induced spectra in him1 spectra∆ mutant generated and was in characterizedhsm3Δ background by a predominance does not differ of fromsingle the base mutation substitutions spectra (Table in him14).Δ mutant and was characterized by a predominance of single base substitutions (Table 4). Table 4. Types of mutations in the CAN1 locus after UV irradiation of hsm3∆ mutant. Table 4. Types of mutations in the CAN1 locus after UV irradiation of hsm3Δ mutant Mutation Type n (%) f × 10−5 BaseMutation substitutions Type 27 (73)n (%) f 23 × 10−5 FrameshiftsBase substitutions 5 (14)27 (73) 3.423 TandemFrameshifts double 3 (13)5 (14) 3.13.4 f, mutation frequency;Tandem ndouble, mutation number. 3 (13) 3.1 f, mutation frequency; n, mutation number. In NBP sites, the frequency of UV-induction mutations also practically does not differ betweenIn NBPhsm3 sites,∆ (21 the ×frequency10−5) and of him1UV-induction∆ (19 × 10 mutations−5) and was also significantly practically does different not differ from betweenhim1∆ rad30 hsm3∆Δstrains (21 × 10 (1−5×) and10− him15). TakenΔ (19 together,× 10−5) and data was obtained significantly suggests different a key from role for him1 PolΔη rad30in hsm3Δ strains-dependent (1 × 10 mutagenesis,−5). Taken together, especially data at NBPobtained sites. suggests a key role for Polη in hsm3-dependentRNR3 expression mutagenesis, in hsm3, especially hif1, and athat1 NBPmutants: sites. Earlier, we showed that the reason for the change of polymerases in him1∆ mutant is a significant decrease in the level of

Genes 2021, 12, x FOR PEER REVIEW 12 of 18

RNR3 expression in hsm3, hif1, and hat1 mutants: Earlier, we showed that the reason for the change of polymerases in him1Δ mutant is a significant decrease in the level of dNTPs in mutant cells [44]. dNTP levels show a three- to five-fold increase in response to DNA damage relative to a normal S-phase, through the check-point-dependent Genes 2021, 12, 1083 11 of 17 induction of RNR genes, the allosteric regulation of RNR activity and the degradation of the Rnr1 inhibitor Sml1 [46–48]. To determine the role of the dNTPs pool in hsm3Δ- dependent mutagenesis,dNTPs in mutant we cellsdeleted [44]. dNTP the levelsSML1 show gene a three- in towild-type ﬁve-fold increase and inhsm3 responseΔ mutant to strains. SML1 geneDNA encodes damage relative a specific to a normal suppressor S-phase, through of the the RNR1 check-point-dependent gene (RNR3 homologue). induction Deletion of the ofSML1RNR genes,gene thelowers allosteric the regulation level of of UV-induced RNR activity and mutagenesis the degradation in of comparison the Rnr1 inhibitor Sml1 [46–48]. To determine the role of the dNTPs pool in hsm3∆-dependent with the wild-typemutagenesis, strain we(Figure deleted 6). the SML1Thus,gene high in wild-typelevel of and dNTPhsm3 ∆poolmutant suppresses strains. SML1 hsm3- dependent mutagenesis.gene encodes a speciﬁc suppressor of the RNR1 gene (RNR3 homologue). Deletion of the SML1 gene lowers the level of UV-induced mutagenesis in comparison with the wild-type strain (Figure6). Thus, high level of dNTP pool suppresses hsm3-dependent mutagenesis.

Figure 6. UV-induced mutagenesis in strain wild-type (LMG-3031) and mutant strains hsm3∆ (5-LGM-3031), hsm3∆ sml1∆ (TAE-151), sml1∆ (6- DVF-3031) at different UV doses. The mutation Figure 6. UV-inducedfrequencies mutagenesis were determined, in strain as a ratio wi ofld-type the number (LMG-3031) of white colonies and to mutant the number strains of all colonies hsm3Δ (5- LGM-3031), hsm3grownΔ sml1 inΔ a cup(TAE-151), with complete sml1 medium.Δ (6- DVF-3031) The mean ± SEMat different values obtained UV fromdoses. 4 independent The mutation frequencies were determined,experiments are as plotted. a ratio of the number of white colonies to the number of all colonies grown in a cup with complete medium. The mean ± SEM values obtained from 4 independent To test these results that dNTP concentration regulates UV-induced mutagenesis, experiments are plotted.we studied the expression of RNR3 gene in the hsm3∆ mutant after UV irradiation. We measured the mRNA RNR3 gene levels in the wild type, hsm3∆, hif1∆, hsm3∆ hif1∆, hsm3∆ To test thesehat1 results∆, hif1∆ thathat1∆ dNTP, and hat1 concentrat∆ mutant cellsion 2 hregulates after irradiated UV-induc with UVed light. mutagenesis, The mRNA we studied the expressionlevel in wild-type of RNR3 cells increasedgene in almost the hsm3 three times,Δ mutant while inafter mutant UV cells irradiation. the increase We did not reach 30% (Figure7). Thus, hsm3∆ and hif1∆ mutations suppress the efficiency measured the mRNAof the induction RNR3 gene expression levels of inRNR thegenes wild after type, UV hsm3 irradiation.Δ, hif1 TheΔ, consequencehsm3Δ hif1 ofΔ, the hsm3Δ hat1Δ, hif1Δ hat1suppressionΔ, and hat1 of theΔ mutant expression cells of RNR 2 hgenes after will irradiated be a decrease with in the UV dNTP light. concentration. The mRNA level in wild-typeTaken cells together, increased the results almost confirm three the hypothesistimes, while that that in mutant suppression cells of UV-induced the increase ex- did pression of RNR genes stimulate Polη recruitment to fill the gaps. Polη is highly erroneous not reach 30% (Figurepolymerase 7). andThus, this ishsm3 the causeΔ and of thehif1 increasedΔ mutations UV-induced suppress mutagenesis the efficiency in hsm3∆ and of the induction expressionhif1∆ mutants. of RNR genes after UV irradiation. The consequence of the suppression of the expression of RNR genes will be a decrease in the dNTP concentration. Taken together, the results confirm the hypothesis that that suppression of UV-induced expression of RNR genes stimulate Polη recruitment to fill the gaps. Polη is highly erroneous polymerase and this is the cause of the increased UV-induced mutagenesis in hsm3Δ and hif1Δ mutants. As can be seen in Figure 7A, the level of expression of the RNR3 gene in hif1Δ hsm3Δ double mutant drops below the level of expression of this gene in wild type cells without irradiating. This result allows us to conclude that inactivation of both accessory subunits NuB4 complex Hsm3 and Hif1 completely suppresses UV-induced expression of RNR complex genes. It is possible that such a sharp decrease in the expression of the RNR genes

Genes 2021, 12, x FOR PEER REVIEW 13 of 18

Genes 2021, 12, 1083 12 of 17 was the cause of the suppression of mutagenesis in the double mutant. To test this assumption, we decided to use the dun1Δ mutant.

FigureFigure 7. 7. RelativeRelative normalized normalized expression expression of of the the RNR3RNR3 gene,gene, before before and and after after irradiation irradiation with with UV UV light light of of the the corresponding corresponding 2 strainsstrains (after (after UV UV irradiation, irradiation, the cells we werere kept for two hours at 30 ◦°CC in a thermostat for induction), UV dose at 252 J/m 2; ; ** pp << 0.05, 0.05, Student’s Student’s tt test.test. (A (A) )Relative Relative normalized normalized expression expression of of the the RNR3RNR3 gene,gene, before before and and after after irradiation irradiation with with UV UV light; light; (B) Relative normalized expression of the RNR3 gene, after irradiation with UV light (B) Relative normalized expression of the RNR3 gene, after irradiation with UV light.

InAs dun1 can bemutant seen incells, Figure there7A, is the no levelincrease of expression in the expression of the RNR3 of RNRgene genes in hif1 after∆ hsm3 DNA∆ damagedouble mutant[45,49]. dropsWe deleted below thethe levelDUN1 of expressiongene in strains of this of gene wild-type, in wild typehif1Δ cells and withouthsm3Δ mutants.irradiating. dun1 ThisΔ resultmutation allows significantly us to conclude increases that inactivationthe sensitivity of both of accessoryyeast cells subunits to UV radiationNuB4 complex (Figure Hsm3 8). At andthe same Hif1 time, completely the double suppresses dun1Δ hsm3 UV-inducedΔ and dun1 expressionΔ hif1Δ mutants of RNR didcomplex not differ genes. from It the is possiblesingle dun1 thatΔ suchmutant asharp under decrease these conditions. in the expression Single dun1 ofΔ the mutantRNR decreasesgenes was the the frequency cause of the of suppression UV-induced of muta mutagenesisgenesis compared in the double to mutant.a wild-type To test strain this (Figureassumption, 8). Simultaneously, we decided to usethe double the dun1 dun1∆ mutant.Δ hsm3Δ and dun1Δ hif1Δ mutants does not differIn practicallydun1 mutant from cells, the single there dun1 is noΔ increase mutant inaccording the expression to the frequency of RNR genes of UV-induced after DNA mutagenesis.damage [45,49 Taken]. We deletedtogether, the theseDUN1 resultsgene inshow strains that of a wild-type, sharp decreasehif1∆ and in hsm3the dNTP∆ mu- concentrationtants. dun1∆ mutation suppress significantlyhsm3- and hif1 increases-dependent the sensitivitymutagenesis. of yeast cells to UV radiation (Figure8). At the same time, the double dun1∆ hsm3∆ and dun1∆ hif1∆ mutants did not differ from the single dun1∆ mutant under these conditions. Single dun1∆ mutant decreases the frequency of UV-induced mutagenesis compared to a wild-type strain (Figure8) . Si- multaneously, the double dun1∆ hsm3∆ and dun1∆ hif1∆ mutants does not differ practically from the single dun1∆ mutant according to the frequency of UV-induced mutagenesis. Taken together, these results show that a sharp decrease in the dNTP concentration suppress hsm3- and hif1-dependent mutagenesis. As seen from Figure3B, hat1∆ mutation does not significantly affect the frequency of UV-induced mutagenesis. This is surprising, since mutations in the genes encoding the two subunits of the NuB4 complex increase the frequency of UV-induced mutagenesis. To examine the role hat1∆ mutation in RNR3 regulation, we measured the expression level of the RNR3 gene in hat1 mutant before and after UV irradiation and the double hsm3∆ hat1∆, hif1∆, hat1∆ mutants after UV irradiation. Figure7A shows that hat1∆ mutation significantly increases the expression of the RNR complex genes both before and after irradiation. We have shown that hat1∆ mutation epistats to hsm3∆ and hif1∆ mutations, also increases the expression of the RNR complex genes after UV irradiation, as in the single hat1∆ mutant (Figure7B). This result explains the absence of increased mutagenesis in hat1∆ mutant and once again proves the key role of a decreased level of dNTP concentration in hsm3- and hif1-specific mutagenesis. Figure 8. UV-induced mutagenesis in mutant strains hif1Δ (CAY-3), hsm3Δ dun1Δ (DVF-15), hif1Δ dun1Δ (TAE-154), dun1Δ (DVF-16), hsm3Δ (5-LGM-3031), and strain wild-type (LMG-3031) at different UV doses. The mutation frequencies were determined, as a ratio of the number of white colonies to the number of all colonies grown in a cup with complete medium. The mean ± SEM values obtained from four independent experiments are plotted.

Genes 2021, 12, x FOR PEER REVIEW 13 of 18

was the cause of the suppression of mutagenesis in the double mutant. To test this assumption, we decided to use the dun1Δ mutant.

Figure 7. Relative normalized expression of the RNR3 gene, before and after irradiation with UV light of the corresponding strains (after UV irradiation, the cells were kept for two hours at 30 °C in a thermostat for induction), UV dose at 252 J/m2; * p < 0.05, Student’s t test. (A) Relative normalized expression of the RNR3 gene, before and after irradiation with UV light; (B) Relative normalized expression of the RNR3 gene, after irradiation with UV light

In dun1 mutant cells, there is no increase in the expression of RNR genes after DNA damage [45,49]. We deleted the DUN1 gene in strains of wild-type, hif1Δ and hsm3Δ mutants. dun1Δ mutation significantly increases the sensitivity of yeast cells to UV radiation (Figure 8). At the same time, the double dun1Δ hsm3Δ and dun1Δ hif1Δ mutants did not differ from the single dun1Δ mutant under these conditions. Single dun1Δ mutant decreases the frequency of UV-induced mutagenesis compared to a wild-type strain (Figure 8). Simultaneously, the double dun1Δ hsm3Δ and dun1Δ hif1Δ mutants does not differ practically from the single dun1Δ mutant according to the frequency of UV-induced mutagenesis. Taken together, these results show that a sharp decrease in the dNTP Genes 2021, 12,concentration 1083 suppress hsm3- and hif1-dependent mutagenesis. 13 of 17

Figure 8. UV-induced mutagenesis in mutant strains hif1∆ (CAY-3), hsm3∆ dun1∆ (DVF-15), hif1∆ Figure 8. UV-induceddun1∆ mutagenesis(TAE-154), dun1 ∆in(DVF-16) mutant, hsm3 strains∆ (5-LGM-3031), hif1Δ (CAY-3and strain), hsm3 wild-typeΔ dun1(LMG-3031)Δ (DVF-15)at different, hif1Δ UV doses. The mutation frequencies were determined, as a ratio of the number of white colonies to dun1Δ (TAE-154), dun1Δ (DVF-16), hsm3Δ (5-LGM-3031), and strain wild-type (LMG-3031) at the number of all colonies grown in a cup with complete medium. The mean ± SEM values obtained different UV doses. The mutation frequencies were determined, as a ratio of the number of white from four independent experiments are plotted. colonies to the number of all colonies grown in a cup with complete medium. The mean ± SEM values obtained from4. Discussion four independent experiments are plotted. Histone chaperone proteins have key roles in eukaryotic chromatin dynamics [50,51]. These proteins have been implicated in a wide range of processes including buffering of soluble H3-H4-complex [52], mediating H4 acetylation in the context of HAT1-complex [16,17]. In spite of these roles, histone chaperone proteins in various chromatin related processes, underlying mechanistic details are unclear. Here, we have shown that Hsm3 protein may be a new subunit of NuB4 complex. Earlier in our laboratory, extensive research was carried out on the genetic properties of hsm3∆ mutation [25–31]. We have shown that proteins Mms2, Xrs2, Srs2, Mph1, Mms4, involved in the error-free branch of the PRR, have a crucial function in hsm3-dependent UV mutagenesis [38,43]. These results strongly suggest that the HSM3 gene is involved in the error-free branch of damage bypass. Several studies previously established that Hsm3 physically interacts with Hat2, Hif1, and histone H4 [22]. In this regard, we carried out a comparative study of the genetic properties of hsm3∆ and hif1∆ mutations. In all tests carried out, both mutations showed the same properties. hsm3∆ and hif1∆ mutations did not affect the radiosensitivity of yeast cells, equally increased the frequency of UV-induced mutagenesis and the rate of spontaneous reparative mutagenesis. Both mutations do not affect spontaneous cell death, but they suppress spontaneous death of recombination-deficient mutants lowering the level of spontaneous death in double mutants to the level characteristic of single hsm3∆ and hif1∆ mutants (Table2). In the same time rad52∆ mutation suppressed the hif1- and hsm3- specific UV-induced mutagenesis. The interaction of rad2∆ and hif1∆ and hsm3∆ mutations in UV-induced mutagenesis has a synergistic character. The data obtained allowed us to conclude that hsm3∆ mutation may be considered a phenocopy of hif1∆ mutation. To date, there is no genetic evidence for the participation of Hsm3 protein in the NuB4 complex in the literature. The data obtained during the experiments on the study of UV- induced mutagenesis in hat1∆, hif1∆, and hsm3∆ mutants showed that such participation is possible (Figure4). It can be seen from Figure4 that the level of mutagenesis in hif1∆ and hsm3∆ mutants is the same and significantly exceeds that of hat1∆ mutant. In the double mutants, the mutation of hat1∆ epistatizes to both hif1∆ and hsm3∆ mutations. This Genes 2021, 12, 1083 14 of 17

conclusion is supported by the data of the epistatic analysis of hat1∆, hsm3∆, hif1∆, and rad2∆ mutations, as well as the data on the rate of spontaneous mutagenesis (Table3). In all tests, hat1∆ mutation epistatized to hif1∆ and hsm3∆ mutations, thus confirming the same result. When using the Coulson method, the cells were grown on a rich medium; the generation time for such growth was short and the amount of spontaneous damage that generated mutations during replication was relatively small. That is, the frequency of spontaneous errors of DNA polymerases on an intact template made the most contribution to the total frequency of spontaneous mutagenesis. When using the ordered seeding test, the cells were plated on a medium containing an antibiotic at a sublethal dose, which greatly increased the time of one generation (~10 divisions over 14 days) and, as a consequence, the amount of spontaneous damage. In wild-type cells, normally functioning repair systems can effectively do with this relatively small amount of spontaneous damage. However, in cells with faulty repair systems, the amount of spontaneous damage that turn out in the replication fork will be higher compared to the amount in wild-type cells. As a result, the proportion of spontaneous mutations arising in the repair process of lesions will prevail over the proportion of mutations arising from the replication of an intact template. hat1∆ mutation troubles the repair process and we observed the growth of spontaneous mutagenesis in the ordered seeding test and a slight change in the level of mutagenesis in the Coulson test. In the ordered seeding test, hsm3∆ and hif1∆, mutants showed a much higher frequency of spontaneous mutations than the mutant hat1∆, which epistatized to hsm3∆ and hif1∆ mutations in the double hat1∆ hsm3∆ and hat1∆ hif1∆ mutants. Taken together, the results obtained allow us to conclude that the HSM3 gene product is a new subunit of NuB4 complex. The inactivation of two anti-recombination helicases Srs2 and Mph1 and Mms4 subunit of endonuclease terminating DNA synthesis in the D-loop suppresses hsm3-specific mutagenesis [38,43]. Both of these helicases and Mus81/Mms4 endonuclease decrease the average length of the synthesized DNA region [53–58]. Consequently, their inactivation will lead to an increase in the length of the newly synthesized DNA in the D-loop, and this event is the reason for the suppression of hsm3- and hif1-specific mutagenesis. From this, it follows that the change of polymerases occurs after the destruction of the D-loop and the gap is filled with an erroneous polymerase. We observed the same events in him1∆ mutant [44]. Earlier, we have shown that mismatch repair plays a role in hsm3-dependent mutagenesis [30]. The mutation frequency in hsm3∆ pms1∆ double mutant was significantly higher than in both single mutants. This data shows that mismatch repair substrates arose in the cells of hsm3∆ mutant as a result of the attraction of erroneous DNA polymerases. Consistent with this conclusion, we found that Polη inactivation completely blocks hsm3- dependent UV mutagenesis. This conclusion is also supported by data showed that Polη-dependent mutagenesis in NBP sites occurs significantly more frequently in hsm3∆ mutant than in the double him1∆ rad30∆ mutant. We showed that mutations in HSM3 gene suppresses UV-induced expression of RNR genes. Genetic data we obtained are consistent with the results of a study of physical interactions subunits of NuB4 complex with Hsm3p [22,24], indicating that the product of HSM3 gene can function as part of a NuB4 complex (Figure9). Genes 2021, 12, x FOR PEER REVIEW 15 of 18

dose, which greatly increased the time of one generation (~10 divisions over 14 days) and, as a consequence, the amount of spontaneous damage. In wild-type cells, normally functioning repair systems can effectively do with this relatively small amount of spontaneous damage. However, in cells with faulty repair systems, the amount of spontaneous damage that turn out in the replication fork will be higher compared to the amount in wild-type cells. As a result, the proportion of spontaneous mutations arising in the repair process of lesions will prevail over the proportion of mutations arising from the replication of an intact template. hat1Δ mutation troubles the repair process and we observed the growth of spontaneous mutagenesis in the ordered seeding test and a slight change in the level of mutagenesis in the Coulson test. In the ordered seeding test, hsm3Δ and hif1Δ, mutants showed a much higher frequency of spontaneous mutations than the mutant hat1Δ, which epistatized to hsm3Δ and hif1Δ mutations in the double hat1Δ hsm3Δ and hat1Δ hif1Δ mutants. Taken together, the results obtained allow us to conclude that the HSM3 gene product is a new subunit of NuB4 complex. The inactivation of two anti-recombination helicases Srs2 and Mph1 and Mms4 subunit of endonuclease terminating DNA synthesis in the D-loop suppresses hsm3- specific mutagenesis [38,43]. Both of these helicases and Mus81/Mms4 endonuclease decrease the average length of the synthesized DNA region [53–58]. Consequently, their inactivation will lead to an increase in the length of the newly synthesized DNA in the D- loop, and this event is the reason for the suppression of hsm3- and hif1-specific mutagenesis. From this, it follows that the change of polymerases occurs after the destruction of the D-loop and the gap is filled with an erroneous polymerase. We observed the same events in him1Δ mutant [44]. Earlier, we have shown that mismatch repair plays a role in hsm3-dependent mutagenesis [30]. The mutation frequency in hsm3Δ pms1Δ double mutant was significantly higher than in both single mutants. This data shows that mismatch repair substrates arose in the cells of hsm3Δ mutant as a result of the attraction of erroneous DNA polymerases. Consistent with this conclusion, we found that Polη inactivation completely blocks hsm3-dependent UV mutagenesis. This conclusion is also supported by data showed that Polη-dependent mutagenesis in NBP sites occurs significantly more frequently in hsm3Δ mutant than in the double him1Δ rad30Δ mutant. We showed that mutations in HSM3 gene suppresses UV-induced expression of RNR genes. Genetic data we obtained are consistent with the results of a study of physical Genes 2021, 12, 1083 interactions subunits of NuB4 complex with Hsm3p [22,24], indicating that the product of 15 of 17 HSM3 gene can function as part of a NuB4 complex (Figure 9).

. Figure 9. A model describing the potential mechanism of action of the Hsm3p as part of NuB4 complex. This model describes an approximate mechanism of action of Hsm3p, as a subunit of the histone acetyltransferases complex NuB4. Most likely, Hsm3p joins in the Hat1p/Hat2p complex, as well as Hif1p.

Author Contributions: T.A.E., E.A.A., D.V.F., V.T.P. performed all the experimental work; methodol- ogy, V.T.P.; formal analysis, D.V.F.; data curation, T.A.E., V.G.K.; writing—original draft preparation, V.G.K., E.A.A.; writing—review and editing, V.G.K., E.A.A.,T.A.E.; visualization, E.A.A.; All authors have read and agreed to the published version of the manuscript. Funding: The work has been performed as part of the Genome Research Center development program “Kurchatov Genome Center—PNPI” (agreement no. 075-15-2019-1663). Institutional Review Board Statement: Not applicable. The study did not involve humans or animals. Informed Consent Statement: Not applicable. Data Availability Statement: Not applicable. Acknowledgments: We thank Pavlov Y.I. for discussion of these results and for critical reading of the manuscript. Conﬂicts of Interest: The authors declare no conﬂict of interest.

References 1. Luger, K.; Mäder, A.W.; Richmond, R.K.; Sargent, D.F.; Richmond, T.J. Crystal structure of the nucleosome core particle at 2.8 Å resolution. Nature 1997, 389, 251–260. [CrossRef][PubMed] 2. Ransom, M.; Dennehey, B.; Tyler, J.K. Chaperoning histones during DNA replication and repair. Cell 2010, 140, 183–195. [CrossRef] 3. Kouzarides, T. Chromatin modifications and their function. Cell 2007, 128, 693–705. [CrossRef][PubMed] 4. Lee, K.K.; Workman, J.L. Histone acetyltransferase complexes: One size doesn’t fit all. Nat. Rev. Mol. Cell Biol. 2007, 8, 284–295. [CrossRef][PubMed] 5. Parthun, M.R.; Widom, J.; Gottschling, D.E. The major cytoplasmic histone acetyltransferase in yeast: Links to chromatin replication and histone metabolism. Cell 1996, 87, 85–94. [CrossRef] 6. López-Rodas, G.; Tordera, V.; Del Pino, M.M.S.; Franco, L. Subcellular localization and nucleosome specificity of yeast histone acetyltransferases. Biochemistry 1991, 30, 3728–3732. [CrossRef][PubMed] 7. Lopez-Rodas, G.; Tordera, V.; del Pino, M.M.S.; Franco, L. Yeast contains multiple forms of histone acetyltransferase. J. Biol. Chem. 1989, 264, 19028–19033. [CrossRef] 8. Lopez-Rodas, G.; Perez-Ortin, J.; Tordera, V.; Salvador, M.; Franco, L. Partial purification and properties of two histone acetyltransferases from the yeast, Saccharomyces cerevisiae. Arch. Biochem. Biophys. 1985, 239, 184–190. [CrossRef] 9. Wiegand, R.C.; Brutlag, D.L. Histone acetylase from Drosophyla melanogaster specific for H4. J. Biol. Chem. 1981, 256, 4578–4583. [CrossRef][PubMed] 10. Garcea, R.; Alberts, B. Comparative studies of histone acetylation in nucleosomes, nuclei, and intact cells. Evidence for special factors which modify acetylase action. J. Biol. Chem. 1980, 255, 11454–11463. [CrossRef] 11. Kleff, S.; Andrulis, E.D.; Anderson, C.W.; Sternglanz, R. Identification of a gene encoding a yeast histone H4 acetyltransferase. J. Biol. Chem. 1995, 270, 24674–24677. [CrossRef] 12. Megee, P.; Morgan, B.A.; Mittman, B.A.; Smith, M.M. Genetic analysis of histone H4: Essential role of lysines subject to reversible acetylation. Science 1990, 247, 841–845. [CrossRef][PubMed] Genes 2021, 12, 1083 16 of 17

13. Zhang, W.; Bone, J.R.; Edmondson, D.G.; Turner, B.M.; Roth, S.Y. Essential and redundant functions of histone acetylation revealed by mutation of target lysines and loss of the Gcn5p acetyltransferase. EMBO J. 1998, 17, 3155–3167. [CrossRef][PubMed] 14. Ma, X.-J.; Wu, J.; Altheim, B.A.; Schultz, M.C.; Grunstein, M. Deposition-related sites K5/K12 in histone H4 are not required for nucleosome deposition in yeast. Proc. Natl. Acad. Sci. USA 1998, 95, 6693–6698. [CrossRef] 15. Ruiz-Garcia, A.B.; Sendra, R.; Galiana, M.; Pamblanco, M.; Pérez-Ortín, J.E.; Tordera, V. HAT1 and HAT2 proteins are components of a yeast nuclear histone acetyltransferase enzyme specific for free histone H4. J. Biol. Chem. 1998, 273, 12599–12605. [CrossRef] [PubMed] 16. Ai, X.; Parthun, M.R. The nuclear Hat1p/Hat2p complex: A molecular link between type B histone acetyltransferases and chromatin assembly. Mol. Cell 2004, 14, 195–205. [CrossRef] 17. Poveda, A.; Pamblanco, M.; Tafrov, S.; Tordera, V.; Sternglanz, R.; Sendra, R. Hif1 is a component of yeast histone acetyltransferase B, a complex mainly localized in the nucleus. J. Biol. Chem. 2004, 279, 16033–16043. [CrossRef] 18. Verreault, A.; Kaufman, P.; Kobayashi, R.; Stillman, B. Nucleosomal DNA regulates the core-histone-binding subunit of the human Hat1 acetyltransferase. Curr. Biol. 1998, 8, 96–108. [CrossRef] 19. Suganuma, T.; Pattenden, S.G.; Workman, J.L. Diverse functions of WD40 repeat proteins in histone recognition. Genes Dev. 2008, 22, 1265–1268. [CrossRef] 20. Song, J.-J.; Garlick, J.D.; Kingston, R.E. Structural basis of histone H4 recognition by p55. Genes Dev. 2008, 22, 1313–1318. [CrossRef] 21. Furuyama, T.; Dalal, Y.; Henikoff, S. Chaperone-mediated assembly of centromeric chromatin in vitro. Proc. Natl. Acad. Sci. USA 2006, 103, 6172–6177. [CrossRef] 22. Gavin, A.-C.; Bösche, M.; Krause, R.; Grandi, P.; Marzioch, M.; Bauer, A.; Schultz, J.; Rick, J.M.; Michon, A.-M.; Cruciat, C.-M.; et al. Functional organization of the yeast proteome by systematic analysis of protein complexes. Nature 2002, 415, 141–147. [CrossRef] [PubMed] 23. Blackwell, J.S.; Wilkinson, S.T.; Mosammaparast, N.; Pemberton, L.F. Mutational analysis of H3 and H4 N termini reveals distinct roles in nuclear import. J. Biol. Chem. 2007, 282, 20142–20150. [CrossRef] 24. Ge, Z.; Wang, H.; Parthun, M.R. Nuclear Hat1p complex (NuB4) components participate in DNA repair-linked chromatin reassembly. J. Biol. Chem. 2011, 286, 16790–16799. [CrossRef][PubMed] 25. Ivanov, E.; Kovaltzova, S.; Korolev, V. Saccharomyces cerevisiae mutants with enhanced induced mutation and altered mitotic gene conversion. Mutat. Res. Mol. Mech. Mutagen. 1989, 213, 105–115. [CrossRef] 26. Ivanov, E.L.; Fedorova, I.V.; Koval’tsova, S.V. Isolation and characteristics of new mutants of Saccharomyces cerevisiae with increased spontaneous mutability. Russ. J. Genet. 1992, 28, 47–55. 27. Fedorova, I.V.; Kovaltzova, S.V.; Ivanov, E.L. Influence of hsm mutations increasing spontaneous mutability on induced mutagenesis and spontaneous mitotic gene conversion in the yeast Saccharomyces cerevisiae. Russ. J. Genet. 1992, 28, 54–65. [PubMed] 28. Fedorova, I.V.; Kovaltzova, S.V.; Korolev, V.G. The yeast HSM3 gene is involved in DNA mismatch repair in slowly dividing cells. Genetics 2000, 154, 495–496. [CrossRef] 29. Fedorova, I.; Kovaltzova, S.; Gracheva, L.; Evstuhina, T.; Korolev, V. Requirement of HSM3 gene for spontaneous mutagenesis in Saccharomyces cerevisiae. Mutat. Res. Mol. Mech. Mutagen. 2004, 554, 67–75. [CrossRef] 30. Fedorova, I.V.; Gracheva, L.M.; Kovaltzova, S.V.; Evstuhina, T.A.; Alekseev, S.Y.; Korolev, V.G. The yeast HSM3 gene acts in one of the mismatch repair pathways. Genetics 1998, 148, 963–973. [CrossRef] 31. Kovaltzova, S.V.; Gracheva, L.M.; Evstyukhina, T.A.; Fedorova, I.V.; Korolev, V.G. Mutator genes of the Yeast Saccharomyces cerevisiae: Interaction between mutations him and hsm with mutations blocking three principal pathways of induced DNA damage repair. Russ. J. Genet. 1996, 32, 921–927. [PubMed] 32. Besche, H.C.; Peth, A.; Goldberg, A.L. Getting to first base in proteasome assembly. Cell 2009, 138, 25–28. [CrossRef] 33. Gödderz, D.; Dohmen, R.J. Hsm3/S5b joins the ranks of 26S proteasome assembly chaperones. Mol. Cell 2009, 33, 415–416. [CrossRef] 34. Le Tallec, B.; Barrault, M.-B.; Guérois, R.; Carré, T.; Peyroche, A. Hsm3/S5b participates in the assembly pathway of the 19S regulatory particle of the proteasome. Mol. Cell 2009, 33, 389–399. [CrossRef] 35. Takagi, K.; Kim, S.; Yukii, H.; Ueno, M.; Morishita, R.; Endo, Y.; Kato, K.; Tanaka, K.; Saeki, Y.; Mizushima, T. Structural basis for specific recognition of Rpt1p, an ATPase subunit of 26 S proteasome, by proteasome-dedicated chaperone Hsm3p. J. Biol. Chem. 2012, 287, 12172–12182. [CrossRef][PubMed] 36. Chernenkov, A.Y.; Ivanova, S.V.; Kovaltzova, S.V.; Gracheva, L.M.; Peshekhonov, V.T.; Fedorova, I.V.; Korolev, V.G. Genet-ic analysis of the Hsm3 protein domain structure in yeast Saccharomyces cerevisiae. Russ. J. Genet. 2010, 46, 652–658. [CrossRef] [PubMed] 37. Kovaltzova, S.V.; Korolev, V.G. The Saccharomyces cerevisiae yeast strain for testing environmental mutagens based on the interaction between rad2 and him1 mutations. Russ. J. Genet. 1996, 32, 366–372. [PubMed] 38. Chernenkov, A.Y.; Fedorov, D.V.; Gracheva, L.M.; Evstuhina, T.A.; Kovaltsova, S.V.; Peshekhonov, V.T.; Fedorova, I.V.; Korolev, V.G. Interactions of the HSM3 gene with genes initiating homologous recombination repair in yeast Saccharomyces cerevisiae. Russ. J. Genet. 2012, 48, 284–290. [CrossRef] 39. Zakharov, I.A.; Kozhin, S.A.; Kozhina, T.A.; Fedorova, I.V.; Yarovoy, B.F. A Collection of Methods in Yeast Saccharomyces Cerevisiae Genetics; Nauka: Leningrad, Russia, 1984. Genes 2021, 12, 1083 17 of 17

40. Lea, D.E.; Coulson, C.A. The distribution of the numbers of mutants in bacterial populations. J. Genet. 1949, 49, 264–285. [CrossRef][PubMed] 41. Khromov-Borisov, N.N.; Saffi, J.; Henriques, J.A.P. Perfect order plating: Principal and applications. TTO 2002, 1, TO2638. [CrossRef] 42. Benson, L.J.; Phillips, J.A.; Gu, Y.; Parthun, M.R.; Hoffman, C.; Annunziato, A.T. Properties of the type B histone acetyltransferase Hat1. J. Biol. Chem. 2007, 282, 836–842. [CrossRef] 43. Chernenkov, A.Y.; Gracheva, L.M.; Evstyukhina, T.A.; Koval’tsova, S.V.; Peshekhonov, V.T.; Fedorova, I.V.; Korolev, V.G. HSM3 gene interaction with epistatic RAD6 group genes in yeasts Saccharomyces cerevisiae. Russ. J. Genet. 2012, 48, 159–166. [CrossRef] [PubMed] 44. Alekseeva, E.A.; Evstyukhina, T.A.; Peshekhonov, V.T.; Korolev, V.G. Participation of the HIM1 gene of yeast Saccharomyces cerevisiae in the error-free branch of post-replicative repair and role Polη in him1-dependent mutagenesis. Curr. Genet. 2021, 67, 141–151. [CrossRef] 45. Kozmin, S.G.; Pavlov, Y.; Kunkel, T.; Sage, E. Roles of Saccharomyces cerevisiae DNA polymerases Pol and Pol in response to irradiation by simulated sunlight. Nucleic Acids Res. 2003, 31, 4541–4552. [CrossRef] 46. Zhao, X.; Muller, E.G.; Rothstein, R. A Suppressor of Two Essential Checkpoint Genes Identifies a Novel Protein that Negatively Affects dNTP Pools. Mol. Cell 1998, 2, 329–340. [CrossRef] 47. Zhao, X.; Chabes, A.; Domkin, V.; Thelander, L.; Rothstein, R. The ribonucleotide reductase inhibitor Sml1 is a new target of the Mec1/Rad53 kinase cascade during growth and in response to DNA damage. EMBO J. 2001, 20, 3544–3553. [CrossRef][PubMed] 48. Chabes, A.; Georgieva, B.; Domkin, V.; Zhao, X.; Rothstein, R.; Thelander, L. Survival of DNA damage in yeast directly depends on increased dNTP levels allowed by relaxed feedback inhibition of ribonucleotide reductase. Cell 2003, 112, 391–401. [CrossRef] 49. Zhou, Z.; Elledge, S.J. DUN1 encodes a protein kinase that controls the DNA damage response in yeast. Cell 1993, 75, 1119–1127. [CrossRef] 50. Keck, K.M.; Pemberton, L.F. Histone chaperones link histone nuclear import and chromatin assembly. Biochim. Biophys. Acta (BBA) Bioenerg. 2012, 1819, 277–289. [CrossRef] 51. Burgess, R.J.; Zhang, Z. Histone chaperones in nucleosome assembly and human disease. Nat. Struct. Mol. Biol. 2013, 20, 14–22. [CrossRef][PubMed] 52. Cook, A.J.; Gurard-Levin, Z.A.; Vassias, I.; Almouzni, G. A specific function for the histone chaperone NASP to fine-tune a reservoir of soluble H3-H4 in the histone supply chain. Mol. Cell 2011, 44, 918–927. [CrossRef] 53. Rong, L.; Klein, H. Purification and characterization of the SRS2 DNA helicase of the yeast Saccharomyces cerevisiae. J. Biol. Chem. 1993, 268, 1252–1259. [CrossRef] 54. Dupaigne, P.; Le Breton, C.; Fabre, F.; Gangloff, S.; Le Cam, E.; Veaute, X. The Srs2 helicase activity is stimulated by Rad51 filaments on dsDNA: Implications for crossover incidence during mitotic recombination. Mol. Cell 2008, 29, 243–254. [CrossRef] [PubMed] 55. Colavito, S.; Macris-Kiss, M.; Seong, C.; Gleeson, O.; Greene, E.C.; Klein, H.; Krejci, L.; Sung, P. Functional significance of the Rad51-Srs2 complex in Rad51 presynaptic filament disruption. Nucleic Acids Res. 2009, 37, 6754–6764. [CrossRef][PubMed] 56. Panico, E.R.; Ede, C.; Schildmann, M.; Schürer, K.A.; Kramer, W. Genetic evidence for a role ofSaccharomyces cerevisiaeMph1 in recombinational DNA repair under replicative stress. Yeast 2010, 27, 11–27. [CrossRef] 57. Prakash, R.; Satory, D.; Dray, E.; Papusha, A.; Scheller, J.; Kramer, W.; Krejci, L.; Klein, H.; Haber, J.; Sung, P.; et al. Yeast Mph1 helicase dissociates Rad51-made D-loops: Implications for crossover control in mitotic recombination. Genes Dev. 2009, 23, 67–79. [CrossRef][PubMed] 58. Fabre, F.; Chan, A.; Heyer, W.D.; Gangloff, S. Alternate pathways involning Sgs1/Top3, Mus81/Mms4, and Srs2 prevent formation of toxic recombination inter mediates from singlestranded gaps created by DNA replication. Proc. Natl Acad. Sci. USA. 2002, 99, 16887–16892. [CrossRef]