Identification of cis-acting sequences and trans-acting factors for targeting the
peripherally associated membrane protein, Trm1-II, to the inner nuclear
membrane
Dissertation
Presented in Partial Fulfillment of the Requirements for the Degree Doctor of
Philosophy in the Graduate School of The Ohio State University
By
Tsung-Po Lai
Graduate Program in Molecular Genetics
The Ohio State University
2012
Dissertation Committee:
Dr. Anita K. Hopper, Advisor
Dr. Stephen A. Osmani
Dr. Hay-Oak Park
Dr. Juan D. Alfonzo
Copyright by
Tsung-Po Lai
2012
Abstract
Appropriate nuclear membrane structure is important in eukaryotic cells.
Significantly, many human diseases are caused by failure to correctly localize inner nuclear membrane (INM) proteins to the nuclear rim. To gain an understanding of the targeting mechanism of peripherally associated INM proteins, I employed the budding yeast Saccharomyces cerevisiae as a model system and Trm1-II, a tRNA modification enzyme that is peripherally bound to the INM, as a reporter.
In Saccharomyces cerevisiae, the TRM1 gene codes for the tRNA-specific N2, N2- dimethylguanosine methyltransferase. It is located in mitochondria and nuclei by encoding two isomeric forms of the proteins, Trm1-I and Trm1-II, via alternative translation initiation. The longer form, Trm1-I, is exclusively localized to the mitochondria while the shorter form, Trm1-II, is located in the nucleus (90%) and mitochondria (10%). The nuclear pool of Trm1-II is peripherally associated with the inner nuclear membrane (INM). The mechanism of targeting Trm1-II to the INM is unclear. To characterize the amino acids important for targeting Trm1-II to the INM,
I employed random and site-directed mutagenesis, and uncovered specific amino acids necessary for Trm1-II to locate at the INM. I defined a sequence of ~20 amino acids that contains information necessary to target Trm1-II to the INM. To address whether the newly defined region necessary for Trm1-II INM location is also
ii sufficient to target reporter proteins to the INM, I demonstrated that this short peptide causes the redistribution of reporter proteins from the nucleoplasm to the
INM. Thus, I identified the first motif for targeting peripherally associated proteins to the INM in yeast (Lai et al., 2009).
A genome-wide study that identified subunits of the N-terminal acetyltransferase
C (Nat C): Mak3, Mak10, and Mak31 function in Trm1-II INM targeting and suggested N-terminal acetylation of Trm1-II is necessary for it INM location (Murthi and Hopper, 2005). The data suggest that Trm1-II contains information for INM targeting other than the INM targeting motif. To further address the mechanism of
Trm1-II INM location, Trm1-II, non-functional INM motif Trm1-II mutant and Trm1-
II from cells without Nat C activity were C-terminally tagged with ZZ domain of
Protein A (ZZ) or GFP-ZZ to search for Trm1-II interacting partner(s) at the INM using biochemical approaches. Surprisingly, no specific interacting proteins were uncovered by these studies. Rather, the evidence showed that Trm1-II may interact with lipids via the INM targeting motif and associate with the INM. In addition, I identified that without acetylation at N-terminus Trm1-II has the ability to modify tRNAs and to interact with membrane lipids. The data support a model that the INM targeting motif, rather than N-acetylation, is important for Trm1-II INM targeting by facilitating Trm1-II-lipid interaction at the INM. Since non-functional INM targeting motif Trm1-II mutant contains an amino acid substitution, it raise a possibility that the non-functional INM targeting motif Trm1-II mutant may be a misfolded protein, and thereby affecting Trm1-II-lipid interactions. Further investigation are required
iii to confirm that the INM targeting motif is important for Trm1-II-lipid binding and
INM targeting.
iv
Dedication
This work is dedicated to my parents, my lovely wife, Huei-Tsu, and my beloved children Brandon and Bryan. You have made me stronger, better and more fulfilled than I could have ever imagined.
v
Acknowledgments
I am deeply indebted to my advisor Dr. Anita K. Hopper for her guidance and support, as well as her dedication to her students and their research. I would like to thank the members of my thesis committee, Dr. Stephen Osmani, Dr. Hay-Oak Park, and Dr. Juan Alfonzo for their valuable inputs and suggestions regarding my projects and my career development.
I am very grateful to Dr. Rebecca Hurto for teaching me the techniques and assays necessary for this research and taking time to review this dissertation. I would also like to acknowledge all current and former members of the Hopper lab for their advice and support throughout the length of my project.
I would also like to thank Aysha Osmani, Kuo-Fang Shen and I-Ju Lee for their friendship and support.
Finally, I must acknowledge my wife, Huei-Tsu, without whose love, encouragement, I would not have finished this thesis.
vi
Vita
1996 – 2000………………………………………………B. S. Nutrition,
Chung Shan Medical University, Taiwan
2000 – 2002………………………………………………M. S. Toxicology,
Chung Shan Medical University, Taiwan
2007 – 2011……………………………………...... Teaching Asst.
The Ohio State University.
2006 – 2012……………………………………...……..Research Asst.
The Ohio State University.
Publications
1. Mechanism and a peptide motif for targeting peripheral proteins to the yeast inner
nuclear membrane. Lai TP, Stauffer KA, Murthi A, Shaheen HH, Peng G, Martin NC,
Hopper AK. Traffic. 2009 Sep;10(9):1243-56.
2. Regulation of tRNA bidirectional nuclear-cytoplasmic trafficking in Saccharomyces
cerevisiae. Murthi A, Shaheen HH, Huang HY, Preston MA, Lai TP, Phizicky EM, Hopper AK.
Mol Biol Cell. 2010 Feb 15;21(4):639-49.
vii
Fields of study
Major Field: Molecular Genetics
viii
Table of Contents
Abstract…………….….……………………….....……………………………………………….………….…ii
Dedication………………..……………………………....……………………………..……………………...v
Acknowledgments……….……………………………...... …………………………..……………….....vi
Vita……………………………………………………………..………………………….………………..…....vii
List of Tables……….……………………………………...... …………...…………………..…………...xiv
List of Figures………..……………...... ………………..xv
Chapter 1: General introduction...... 1
1.1 Overview...... 1
1.2 Review of the literature ...... 3
1.2.1 The nuclear membrane protein………...... ….……...... 3
1.2.2 The NPC and nucleocytoplasmic transport……...... …....……………………….…...6
1.2.3 INM protein targeting ...... 8
1.2.4 The INM proteins and nuclear lamina in human diseases……...... …...………..11
1.2.5 S. cerevisiae Trm1……………...…………………...... …………….……………………….....11
1.3 Yeast as a model system...... 13
Chapter 2: General materials and methods..……………..…...... ………...... ……….24
2.1 Yeast strains…………………………………...... ……………...……………………………………….24
2.2 Yeast genomic DNA isolation…………...... ……...………………………………………….25
2.3 General method for plasmid construction…...... ……………………………………….25
ix 2.4 Oligonucleotides for PCR amplification of DNA fragments…...... ……………….26
2.5 DNA sequencing………………………………...…...... ………………………………………….26
2.6 Preparation of E. coli competent cells…………...... ……………………………………..26
2.7 Chemical transformation of E. coli competent cells………...... …………………….27
2.8 PCR from E. coli colonies……………………………………...... ……………………………..27
2.9 Plasmid DNA Purification………………………………...... ….……………………...………27
2.10 One-step yeast transformation...... 28
2.11 Preparation of yeast competent cells...... 28
2.12 Yeast transformation...... 29
2.13 Isolation of plasmid DNA from yeast using the QIAprep Spin Miniprep Kit...... 29
2 2.14 m 2G methyltransferase activity assay...... 30
2.15 Harvesting yeast cells for cryogenic disruption...... 30
2.16 Cryogenic disruption using planetary ball mill PQ-N04...... 31
2.17 Conjugation of Magnetic beads with rabbit IgG...... 32
2.18 Western Blot analysis...... 32
2.19 Fluorescence Microscopy...... 33
2.20 SYPRO Ruby staining for protein gel...... 33
2.21 Coomassie blue staining...... 33
2.22 Mass spectrometry analysis...... 34
Chapter 3: Mechanism and a peptide motif for targeting peripheral proteins
to the yeast inner nuclear membrane...... 38
3.1 Introduction...... 38
x 3.2 Materials and methods...... 42
3.2.1 Plasmid constructions and DNA...... 42
3.2.2 Indirect immunofluorescence...... 47
2 3.2.3 m 2G methyltransferase activity assay...... 47
3.3 Results...... 48
3.3.1 Altering the composition of the NPC does not affect Trm1-II-GFP INM
distribution...... 48
3.3.2 Trm1 amino acids 73-151 are able to direct some but not all fusion
proteins to the nuclear periphery...... 50
3.3.3 Fusion proteins that contain Trm1 amino acids 73-151 are located to the
INM, rather than the ONM...... 51
3.3.4 Position and context of NLS within Trm1-II is important for Trm1-II
nuclear location...... 52
3.3.5 Trm1 amino acid sequences necessary for INM location...... 53
3.3.6 A short peptide within Trm1 is sufficient for the peripheral association of
reporter proteins to the inner nuclear membrane...... 57
3.3.7 The Trm1 INM targeting motif appears to be structure specific...... 58
3.4 Discussion...... 60
3.4.1 Competition between nuclear and mitochondrial targeting information...... 60
3.4.2 Targeting of peripheral proteins to the INM...... 61
3.4.3 Characterizing a peptide motif for the targeting of Trm1-II to the INM...... 63
xi Chapter 4: Identification of trans-acting elements functioning in the Trm1-II
INM targeting mechanism: achieving and maintaining a peripheral
INM location...... 89
4.1 Introduction...... 89
4.2 Materials and methods...... 94
4.2.1 Plasmid constructions and DNA...... 94
2 4.2.2 m 2G methyltransferase activity assay...... 97
4.2.3 Affinity Protein A-ZZ purification...... 97
4.2.4 Coimmunoprecipitation and immunoblot...... 100
4.2.5 Protein-lipid overlay assays...... 101
4.3 Results...... 101
4.3.1 Loss of N-terminal acetyltransferase C (Nat C) activity does not affect the
enzyme activity of Trm1-II...... 101
4.3.2 Does Trm1-II interact with other proteins to associate with the INM?...... 104
4.3.3 Trm1-II interacts with membrane lipids...... 112
4.4 Discussion...... 114
Chapter 5: General discussion...... 146
5.1 Overview...... 146
5.2 Trm1-II nuclear transport and INM distribution...... 148
5.3 Trm1 INM targeting motif...... 149
5.4 Trm1-II might interact with lipids at the INM...... 150
5.5 N-terminal acetylation and Trm1-II INM targeting...... 152
xii 5.6 The spindle pole body and Trm1-II INM targeting...... 154
Bibliography...... 157
xiii
List of Tables
Table 2.1 Sequences of the oligonucleotides used in this study...... 35
Table 4.1 Plasmids generated for identifying trans-acting factor(s) for Trm1-II INM
targeting...... 120
Table 4.2 Different extraction conditions and subjective qualities for affinity
purifications of Trm1-II-ZZ or Trm1-II-GFP-ZZ from whole cell lysates..126
Table 4.3 Orbitrap LC-MS/MS DATA from complexes associated with (1) GFP-ZZ
under the control of ARG3 promoter in trm1Δ cells, Trm1-II-GFP-ZZ under
the control of TRM1 regulatory sequence in (2) trm1Δ and (3)
mak3Δtrm1Δ cells...... 132
Table 4.4 Summary of proteins identified by mass spectrometry from ZZ-tagged
protein affinity purifications of cell lysate containing (1) GFP-ZZ (2) Trm1-
II-GFP-ZZ (3) Trm1-II(A147D)-GFP-ZZ under the control of GAL1-10
promoter...... 134
xiv
List of Figures
Figure 1.1 Schematic of nucleus structure...... 14
Figure 1.2. KASH and SUN proteins bridge the NE...... 16
Figure 1.3. Structure of the NPC...... 18
Figure 1.4. The nuclear transport cycle for karopherins and their cargos...... 20
Figure 1.5. Incorporation of transmembrane proteins into the INM...... 22
Figure 3.1 The Ran dependent nuclear pathway is important for location of Trm1-II-
GFP to the INM...... 65
Figure 3.2 Distributions of Trm1-II-GFP and Nup49-mCherry in wild-type and
nup133Δ cells...... 67
Figure 3.3 Location of Trm1-II-GFP and Nup49-mCherry in wild-type strain and in
the indicated nucleoporin knockout strains...... 69
Figure 3.4 Trm1 amino acids 73-151 do not direct Pus1-GFP to the INM...... 71
Figure 3.5 The fusion protein NLS-Trm1(73-151)-Trm7-GFP is delivered to the INM
rather than the ONM...... 73
Figure 3.6 Subcellular location of Trm1-II-GFP with various deletions in Trm1 amino
acid 73-151 region...... 75
Figure 3.7 Mutations that do or do not alter Trm1-II INM location...... 77
xv 2 Figure 3.8 m 2G metyltransferase activity of wild-type Trm1 and mutant versions
with single amino acid substitution...... 79
Figure 3.9 Deletion analyses to map region of Trm1 required for INM location...... 81
Figure 3.10 Fine mapping of the Trm1 region sufficient to target NLS-β-
galactosidase and NLS-Trm7- GFP to the INM...... 83
Figure 3.11 Mutations containing changes of amino acids at Trm1 amino acid 126-
151 region that do or do not alter Trm1 INM localization...... 85
Figure 3.12 The helical wheel projection for Trm1 amino acids 145-153...... 87
Figure 4.1 The expression of Trm1-II-ZZ in trm1Δ and mak3Δtrm1Δ cells...... 122
2 Figure 4.2 m 2G methyltransferase activity of Trm1-II-ZZ in trm1Δ and mak3Δ trm1Δ
cells...... 124
Figure 4.3 Affinity purification of GFP-ZZ and Trm1-II-ZZ using IgG-Sepharose
beads...... 128
Figure 4.4 Separation of ZZ-tagged protein associated complexes...... 130
Figure 4.5 Neither Trm1-II nor Trm1-II(A147D) interact with Htb2 or Kar2...... 136
Figure 4.6 Nsp1 interacts with Trm1-II, non N-acetylated Trm1-II and Trm1-
II(A147D)...... 138
Figure 4.7 Location of Trm1-II-GFP and Trm1-II(A147D)-GFP at permissive and
non-permissive temperature in nsp1 ts-10A cells...... 140
Figure 4.8 Trm1-II self-interaction...... 142
Figure 4.9 Trm1-II binds to several lipids...... 144
xvi
Chapter 1
General introduction
1.1 Overview
Eukaryotic cells are surrounded by a plasma membrane, which is made of a lipid bilayer that separates the inside and outside of cells. Inside cells, the cytoplasm possesses many membrane-bound organelles that contain distinct structures and perform various functions critical to the cell’s survival. For example, the mitochondria serve as the power centers to provide primary energy source for the cell, and the endoplasmic reticulum (ER) and Golgi apparati are membrane networks involved in the synthesis, modification, and transport of lipids and proteins.
The nucleus is the defining feature of all eukaryotic cells. It contains the genetic material of the cell and is a site of major metabolic activities, such as DNA replication, gene transcription, RNA processing. The contents of the nucleus (Figure
1.1) are enclosed by two lipid bilayers, the inner (INM) and outer (ONM) nuclear membranes, which together form the nuclear envelope (NE). The ONM, facing to the cytoplasm, is contiguous with the ER(Callan and Tomlin, 1950) and shares a set of proteins with the ER (Amar-Costesec et al., 1974), with a few exceptions (Hetzer et al., 2005; Starr and Fridolfsson, 2010). The INM, by contrast, is composed of a unique set of proteins (Antonin et al., 2011; Hetzer et al., 2005; Lusk et al., 2007),
1 which are either integrated to the INM via transmembrane domains or they are peripherally associated with the INM.
Appropriate nuclear membrane structure is important in eukaryotic cells. There is accumulating evidence from numerous human diseases that alterations in gene expression can be caused by improper targeting of INM associated proteins (Maraldi et al., 2011; Worman, 2012). Although studies have developed paradigms to describe how integral INM proteins are directed to the INM, little information is available regarding the mechanism that target the peripherally associated proteins to the INM. Thus, the goal of this dissertation is to shed light on the INM targeting mechanism for peripherally associated proteins using Saccharomyces cerevisiae
(budding yeast), a single cell eukaryote, as the model organism. In these studies, I used Trm1-II, a yeast protein that is peripherally associated with the INM(Murthi and Hopper, 2005; Rose et al., 1995), as a reporter to characterize a cis-acting sequence, which is sufficient and necessary for a protein to peripherally associate with the INM. To identify tethers for peripherally associated INM proteins, I employed various biochemical approaches. The data indicate that Trm1-II may interact with lipids rather than proteins to achieve its appropriate subcellular location.
2 1.2 Review of the literature
The nuclear envelope (NE), which separates the nucleus from the cytoplasm, is a double-membrane system. It is composed of the outer nuclear membrane (ONM) continuous with the endoplasmic reticulum (ER) and inner nuclear membrane
(INM) (Franke et al., 1981). The NE creates a barrier that allows the cell’s genetic material to be separated from the protein synthesis machinery. The INM and ONM are separated by a narrow lumen and are fused at sites where the nuclear pore complexes (NPCs) are embedded in the NE. The NPCs serve as the highly selective transport gates that enable active bi-directional traffic of macromolecules between the nucleus and the cytoplasm.
1.2.1 The nuclear membrane proteins
The ribosome-associated ER, where membrane proteins are synthesized, is continuous with the ONM (Franke et al., 1981; Pathak et al., 1986). After synthesis on the ER, membrane proteins can diffuse freely between the ER and the ONM
(Bergmann and Singer, 1983; Torrisi and Bonatti, 1985). Although the protein composition of the ONM is very similar to that of the ER (Amar-Costesec et al.,
1974), there are some distinct resident proteins containing the KASH (Klarsicht,
ANC-1, Syne homology) domain that are targeted specifically to the ONM (Figure
1.2). Studies showed that KASH-domain conserved ONM proteins, such as, UNC-83,
ANC-1 and ZYG-12 in C. elegans, Klarsicht and Msp-300/nesprin in Drosophila, the mammalian nesprins, interact with INM SUN-domain proteins (see below) in the
3 perinuclear space. In addition, these KASH-domain proteins associate with either the microtubule-organizing center or the cytoskeleton in the cytoplasm and are responsible for nuclear migration, and nuclear anchorage (Fischer et al., 2004;
McGee et al., 2006; Patterson et al., 2004; Rosenberg-Hasson et al., 1996; Starr and
Han, 2002; Starr et al., 2001; Wilhelmsen et al., 2006; Yu et al., 2006; Zhen et al.,
2002).
The INM of cells contains probably 70 different membrane proteins (Hetzer and
Wente, 2009). Only a few of these INM specific proteins have been analyzed in detail. Most of those well-known proteins have been found to interact with chromatin or, in higher eukaryotes, a network of intermediate filament lamin polymer that associates with the INM (Hetzer and Wente, 2009; Schirmer and
Gerace, 2005; Srsen et al., 2011). Lamin filaments and lamin-binding proteins at the
INM comprise the nuclear lamina, which has crucial functions in serving as a
“scaffold” for lamin-binding proteins, nuclear stability, regulation of chromatin organization, gene expression, and signaling (Dechat et al., 2008; Gruenbaum et al.,
2005). In yeast cell, there are no known lamins. However, previous studies have shown that ectopically expressed lamins interact with nuclear components in yeast and target to the INM (Enoch et al., 1991; Georgatos et al., 1989). These data indicate that there may be similar mechanisms in yeast and higher eukaryotes for targeting proteins to the INM.
In higher eukaryotes, a specific group of INM proteins that shares a structural
4 bihelical LEM (LAP2, Emerin, MAN1) domain (Laguri et al., 2001) is involved in nuclear architecture and chromatin organization. Many studies have shown that the
LEM domain binds to BAF (barrier to autointegration factor), a conserved metazoan chromatin-associated protein (Cai et al., 2001; Cai et al., 2007; Furukawa, 1999; Lee et al., 2001; Shimi et al., 2004; Shumaker et al., 2001), to indirectly associate with chromatin. Moreover, the LEM-like domain has been found in all isoforms of LAP2 that binds directly to DNA, instead of BAF (Cai et al., 2001). Interestingly, the LEM and LEM-like domains show high conservation with the HEH (helix-extension-helix) domain, which is found in yeast INM protein Heh1 and Heh2, at the sequence and structural levels (Brachner and Foisner, 2011; King et al., 2006), suggesting that
Heh1 and Heh2 are LEM protein orthologues in yeast (King et al., 2006). Thus, it is possible that HEH domain proteins might be also involved in DNA binding (Suzuki et al., 2009).
SUN (Sad1 and UNC-84) proteins, integral INM proteins, are conserved from yeast to human. SUN proteins interact with the nucleoskeleton, which is made of lamins and INM proteins and chromatins, to regulate gene expression (Starr and
Fridolfsson, 2010). SUN and KASH proteins interact in the perinuclear space to form the SUN-KASH nuclear-envelop bridge which connects the inner and outer nuclear membrane (Starr and Fridolfsson, 2010) (Figure 1.2). KASH proteins interact with a variety of components of the cytoskeleton (see above). The entire chain of proteins, from cytoskeletal proteins through KASH-SUN nuclear-envelop bridge, to the nucleoskeletal elements, is referred to be the linker of nucleoskeleton and
5 cytoskeleton (LINC) complex, which is important for nuclear structure maintenance and gene regulation (Crisp et al., 2006).
1.2.2 The NPC and nucleocytoplasmic transport
The NPC is a large multiprotein complex conserved throughout eukaryotes. It spans the ONM and INM to form a cylindrical structure with eight-fold symmetry and mediates transport of macromolecules between cytoplasm and nucleoplasm
(Gorlich and Kutay, 1999; Wente, 2000). The estimated mass of NPC is between 60 and 125 MDa in vertebrates and 44 and 66 MDa in yeast (Hetzer et al., 2005). This large structure is comprised of multiple copies of ~30 distinct proteins (Alber et al.,
2007a; Alber et al., 2007b; Cronshaw et al., 2002; Rout et al., 2000), termed nucleoporins (Nups). Nups are classified into four groups: core, linker, FG, and transmembrane Nups (Strambio-De-Castillia et al., 2010)(Figure 1.3). The core proteins, comprising the inner and outer NPC rings, provide a scaffold to support the main structure of the NPC and maintain the stability of the NE. At the inside face of the NPC core scaffold, the linker Nups attach to the core proteins and connect the
FG Nups. The FG Nups, characterized by domains that have multiple phenyalanine- glycine (FG) repeats, directly mediate nucleocytoplasmic transport. At the outer face of the NPC core, the transmembrane Nups are localized between NE and the NPC core to help the NPC anchor into the NE (Fernandez-Martinez and Rout, 2009;
Wente and Rout, 2010).
6 The NPCs serve as the gatekeeper to control macromolecules transport in and out of the nucleus. The nucleus/cytoplasm distribution of macromolecules greater than 40 KDa is mediated by the NPC (Feldherr and Akin, 1997; Keminer and Peters,
1999). To facilitate protein cargo translocation across the NPC, a family of proteins called the karyopherins (also called importins and exportins) act as transport factors. Karyopherins contain a cargo binding domain which recognize specific amino acid sequences, termed nuclear localization sequences (NLSs) or nuclear export sequences (NESs), to form the karyopherin-cargo complex. Also, karyopherins have an NPC binding domain and a Ran GTPase (see below) binding domain at their N-terminus to interact with FG Nups and the Ran GTPase to transport cargo proteins across the NPCs (Fried and Kutay, 2003; Wente and Rout,
2010).
The Ran GTPase binds to the karyopherin to regulate association and dissociation of karyopherin-cargo complexes (Cook et al., 2007; Fried and Kutay,
2003; Madrid and Weis, 2006). The direction of the karyopherin-mediated transport is dependent on the RanGTP gradient (Stewart, 2007; Terry et al., 2007; Weis,
2003). In brief, the association between Ran and different proteins is dependent upon the nucleotide that is bound to Ran. A guanine nucleotide exchange factor
(RanGEF) is localized within the nucleus that allows Ran to acquire GTP to be GTP- bound Ran. On the other hand, a GTPase activating protein (RanGAP) is localized in the cytoplasm to stimulate GTP-bound Ran to hydrolyze to be GDP-bound Ran. The localization of Ran’s regulators generates an asymmetric concentration of RanGTP
7 between the nucleus and cytoplasm. For import, the import karyopherin directs the karyopherin-cargo complex to the NPC and assists transport across the NPC. Once the karyopherin-cargo complex is transported into the nucleus, RanGTP associates with the karyopherin of the complex to release the cargo into the nucleus. The
RanGTP-bound karyopherin is then recycled back to the cytoplasm. After interacting with RanGAP to hydrolyze RanGTP to RanGDP, the freed karyopherin interacts with other cargo to start another cycle of the import. For the export cycle, the export karyopherin and cargo and RanGTP form a complex in the nucleus and then are transported to the cytoplasm. RanGAP stimulates GTP hydrolysis of Ran to help dissociation of the export complex and thereby release cargo into the cytoplasm
(Stewart, 2007; Terry et al., 2007; Weis, 2003; Wente and Rout, 2010) (Figure 1.4).
1.2.3 INM protein targeting
Studies in both yeast and higher eukaryotes have led to four different models
(Figure 1.5) to describe how integral INM proteins are directed to the INM: (1) The diffusion-retention model suggests that integral INM proteins are synthesized on the ER and then move to the ONM. INM proteins are subsequently transfered from the ONM to the INM by passive diffusion at the pore of nuclear membrane into the
INM. According to this model, INM proteins interact with the nuclear lamina or chromatin to become immobilized on the INM (Soullam and Worman, 1995); (2)
The vesicle fusion model proposes that the ER and membrane proteins form vesicles
8 and fuse with the NE to localize proteins to the INM. This model is supported by studies showing that depletion of regulators of vesicle fusion, such as p97 and p47 in Xenopus oocytes, impairs NE assembly at the end of mitosis (Hetzer et al., 2001).
The fusion of vesicles is an energy- and temperature-dependent event and requires calcium (Rothman, 1994). Fusion events have been studied in the ER, the Golgi apparatus and the plasma membrane (Blumenthal et al., 2003; Lippincott-Schwartz et al., 2000). Studies demonstrated that herpes virus capsids and large ribonucleoprotein particle (RNP) granules in Drosophila muscle cells are able to fuse with the NE to export from the nucleus to the cytoplasm (Roller, 2008; Speese et al.,
2012). It is possible that INM proteins and ER form vesicles that facilitate INM proteins target to the INM. Further experiments are required to verify the involvement of vesicle fusion in the incorporation of INM proteins to the NE; (3)
Targeting with classical nuclear localization sequence (NLS) model is based on NLS containing INM proteins that are recognized by karyopherins to translocate membrane proteins to the INM. According to this model, integral INM proteins are translocated to the nucleus via a Ran-dependent interaction between their NLS in the proteins and a member of the karyopherin, importin β family (King et al., 2006);
(4) The INM-sorting motif model proposes that a set of INM proteins containing the
INM-sorting motifs, which have an extremely hydrophobic sequence of 18 amino acids with a sequence with positively charged amino acids at C-terminus, interact with the karyopherin, importin-α16, on the ER (Saksena et al., 2006). This importin-
α16 and INM-motif containing protein interaction facilitates INM proteins transport
9 into the nucleus (Braunagel et al., 2007; Saksena et al., 2006). The contradictions in four non-exclusive models indicate that the targeting of INM proteins is much more complex than first assumed. Thus, the complexity of integral INM protein targeting might be due to the specific characteristics of each individual INM protein. Another factor that may affect INM protein targeting is the mass of INM proteins. A protein may freely diffuse between the ONM and the INM while it has a small mass. The requirement for energy in translocation may be only for large proteins. It is also possible that there are multiple targeting mechanisms to locate membrane proteins to access the INM under distinct conditions, such as the favored targeting mechanism is overburdened or inhibited, and different stages of cell cycle (Zuleger et al., 2008).
Although the models that are discussed above focus on the integral INM proteins that contain the transmembrane domain in their protein sequences, the mechanism(s) of targeting for these peripheral proteins, which do not have any transmembrane domains, to the INM has not been investigated in detail. It is possible that peripheral INM proteins interact with integral INM proteins at the ER and in that way are brought to the nuclear periphery via an integral INM protein pathway type mechanism. Alternatively, peripheral INM proteins may achieve their location by the pathway thought to be used by lamins. Lamin A is imported into the nucleus as a soluble protein and then it associates with the INM (Goldman et al.,
1992; Loewinger and McKeon, 1988). It is also possible these peripheral proteins interact with membrane lipids to associate with the INM.
10 1.2.4 The INM proteins and nuclear lamina in human diseases
INM proteins interact with the nuclear lamina and ONM proteins to mediate many different nuclear functions, including nuclear migration, chromatin organization, gene expression, etc. Therefore, mutations of INM proteins that cause their malfunction and/or mislocalization have been shown to cause numerous abnormal nuclear functions and disorders (Burke and Stewart, 2002). In humans, mutations in lamins and associated proteins cause a wide range of severe genetic disorders referred to as “laminopathies”. Cardiac and skeletal myopathies, partial lipodystrophy, peripheral neuropathy, and severe premature aging are all caused by failure to correctly localize INM proteins (Maraldi et al., 2011; Worman, 2012;
Zwerger et al., 2011). Recent studies have also suggested that lamins have abnormal expression levels and/or mislocalized in different type of cancer cells (Chow et al.,
2012; Zwerger et al., 2011).
1.2.5 S. cerevisiae Trm1
In order to study INM targeting for peripheral membrane proteins, we employ yeast Trm1-II as a reporter. Trm1 is a sorting isozyme located in both nuclei and mitochondria. It is a tRNA modification enzyme that methylates guanine at position
26 on particular tRNAs. The S. cerevisiae TRM1 encodes 2 translational start codons at the 5’ end of its open reading frame. In wild-type cells, the 5’ end of TRM1 most transcripts are located between position +14 to +36 (~90%) between the first and 11 second in-frame ATG, while only ~10% of RNAs are initiated at position -2 upstream of both ATG (Ellis et al., 1987). Transcripts in position +14 to +36 initiate translation at the second AUG, whereas transcripts with 5’ end at -2 initiate translation at the first AUG. Thus, there are two forms of Trm1 produced by different translation starts. The longer form, Trm1-I, contains a 16 amino acid extension at the N-terminus and exclusively targets to the mitochondria. The shorter form, Trm1-II, which is translated at the second AUG (at nucleotide position
+48) is predominately targeted to the nuclear membrane, although a small pool locates to the mitochondria. Trm1-II does not possess a transmembrane domain
(SGD http://www.yeastgenome.org/) and biochemical and genetic studies have shown that it is peripherally associated with the INM (Murthi and Hopper, 2005;
Rose et al., 1995).
To discover trans-acting gene products that function in targeting Trm1-II to the
INM, Murthi and Hopper (2005) conducted a genome-wide screen to identify mutations in unessential genes that disrupt its INM association. They found that
Trm1-II-GFP mislocalizes from the INM to the nucleoplasm in strains with gene deletions in MAK3, MAK10, MAK31 and ICE2. Mak3, Mak10, and Mak31 are subunits of the heterotrimeric Nat C complex (Polevoda and Sherman, 2003; Van Damme et al., 2011). Nat C is one of three N-terminal acetyltransferases (NATs), which modify a protein or peptide by transfer of an acetyl group from acetyl-coenzyme A to amino group of its first amino acid residue (Van Damme et al., 2011). Murthi and Hopper
(2005) showed that the Nat C complex is required for N-terminal acetylation of
12 Trm1-II; this modification is necessary, but not sufficient, for Trm1-II INM targeting.
They also identified an integral membrane protein of the ER, Ice2, and speculated that it might serve as a regulator of a Trm1-II tether.
1.3 Yeast as a model system
S. cerevisiae (budding yeast), a single celled eukaryote, is an excellent model organism for the study of various cellular processes and molecular events relevant to human diseases including progressive neurological diseases, cancer, diabetes, cholesterol metabolism, as well as heart disease (Petranovic and Nielsen, 2008).
Most essential processes such as cytoskeleton assembly, cell-cycle regulation, and transcriptional regulation are highly conserved from yeast to mammals. Yeast has distinct advantages over mammals when experimental approaches use genetic and molecular biology manipulations. Based on SGD, there are 6607 open reading frames in S. cerevisiae genome. About 80% of genes are non-essential. Also, it is relatively easy to delete each non-essential gene or to generate temperature- sensitive mutations of essential genes by homologus recombination or genetic screening. Thus, we can study the functions and involved processes of almost each single gene in live cells. Yeast collections with deletions of non-essential genes
(Winzeler et al., 1999), temperature-sensitive (ts) mutations of essential genes
(Ben-Aroya et al., 2008; Li et al., 2011) and the yeast GFP-tagged protein database
(Huh et al., 2003) are available, making genome-wide analyses achievable.
13
Figure 1.1 Schematic of nucleus structure
The nucleus is surrounded by the nuclear membrane (the INM and the ONM). The
ONM is continuous with the ER. The nucleolus, chromatin and other subnuclear bodies are inside of the nucleus. Nuclear pores are large protein complexes that cross the ONM and the INM. (This figure is courtesy of Dr. G. Diaz)
14
Figure 1.1. Schematic of nucleus structure
15
Figure 1.2. KASH and SUN proteins bridge the NE
KASH proteins (red) span the ONM. The cytoplasmic domains of KASH proteins interact with a variety of cytoskeletal components. SUN proteins (yellow, black and green) span the INM. The nucleoplasmic domains of SUN proteins interact with lamins or other structural components of the nuclear interior. SUN and KASH domains interact in the perinuclear space to form the central link of a bridge that spans the NE, connecting the cytoskeleton to the nucleoskeleton.
16
Figure 1.2. KASH and SUN proteins bridge the NE
17
Figure 1.3. Structure of the NPC
The NPC is anchored to the NE by transmembrane Nups (brown). Outer ring Nups
(purple) and inner ring Nups (green) together form the core scaffold of the NPC.
Linker Nups (red) help anchor the FG Nups (blue) such that they line and fill the center tube and create a bridge between the core scaffold and FG Nups. NPC- associated peripheral structures including cytoplasmic filaments (orange) and the nuclear basket (black) extend into the cytoplasm and nucleus and also harbor FG
Nups.
18
Figure 1.3. Structure of the NPC
19
Figure 1.4. The nuclear transport cycle for karyopherins and their cargos
For the import cycle, import karyopherin-NLS-containing cargo complex forms in the cytoplasm and then is translocated across the NPC. Once the import karyopherin-NLS-containing cargo complex enters the nucleus, RanGTP associates with import karyopherin to dissociate the import karyopherin-NLS-containing cargo complex and release the NLS-containing cargo into the nucleus. RanGTP-import karyopherin complex is recycled to the cytoplasm for next import cycle. For the export cycle, export karyopherin, NES-containing cargo, and RanGTP form an export complex in the nuclear interior. The export complex is translocated through the NPC to the cytoplasm. In the cytoplasm, RanGTP is hydrolyzed to RanGDP by RanGAP which cause dissociation of export complex and release the NES cargo.
20
Figure 1.4. The nuclear import and export cycles for karyopherins and their cargos
21
Figure 1.5. Incorporation of transmembrane proteins into the INM
Four non-exclusive models have been proposed for the transport of proteins to the
INM: (A) diffusion–retention, (B) vesicle fusion, (C) targeting with classical NLSs, and (D) targeting with specific INM-sorting motifs. (See main text for detail)
22
Figure 1.5. Incorporation of transmembrane proteins into the INM
23
Chapter 2
General materials and methods
2.1 Yeast strains
BY4741 [MATa his3Δ leu2Δ met15Δ ura3Δ; Open Biosystems (Winzeler et al.,
1999) was used in most of the experiments. The trm1Δ strain with a Kanr replacement for TRM1 was derived from BY4741 and obtained from the yeast deletion collection [Open Biosystems (Winzeler et al., 1999)]. The mak3Δtrm1Δ (mak3::Kanr, trm1::HPH) strain was generated by homologous recombination to replace TRM1 with HPH (HPH, hygromycin phosphotransferase) in the mak3Δ strain that is a derivative of BY4741 containing a Kanr replacement for
MAK3 [Open Biosystems (Winzeler et al., 1999)]. The nsp1 ts-10A mutant was generated by transformation of BY4741 with a 5 kb DNA fragment containing the complete NSP1 gene with four amino acid substitutions (E706P, L707S, D738V,
K740I), NATr which is located 260 nucleotides upstream of ATG start codon and outside of NSP1 promoter, and additional 5’ and 3’ noncoding sequences of NSP1
[(modified method from Nehrbass et al., (1990)].
24 2.2 Yeast genomic DNA isolation
Yeast cultures were grown in selective liquid media to reach stationary phase.
One ml of the cultures were pelleted and resuspened in 200 µl zymolyase solution
(150 µg zymolyase in 1ml ddH2O) and incubated at 37°C for 30 min to digest the cells. 200 µl phenol: chloroform and 20 µl 10% SDS were added, and then the mixture was briefly vortexed and centrifuged to isolate genomic DNA. 20 µl of 3M
NaOAc and 440 µl of 100% ethanol were added to ~200 µl of the supernatant that contain genomic DNA subsequently place at -80°C for 30min to precipitate the DNA.
This reaction was centrifuged to pellet DNA and then washed by 70% ethanol. After removing 70% ethanol by additional centrifugation, the pellet was dissolved in 50 µl ddH2O.
2.3 General method for plasmid construction
PCR techniques were employed to amplify desired DNA fragments from plasmids or yeast genomic DNA with oligos containing restriction sites at 5’ and 3’ ends of
DNA, and used PfuUltra (Stratagene) or Platinum Taq DNA high fidelity (invitrogen) polymerases. PCR products were subsequently ligated into pGEM-T vector
(Promega) following manufacturer’s instructions and then transformed into E. coli cells. Once confirmed by DNA sequencing, the plasmids were treated with restriction enzyme(s) and CIP (calf intestinal phosphatase; NEB) in same reactions, and then resolved on agarose gel of appropriate percentage in 1X TBE. Gel slices that contain the desired digestion fragments were isolated using QIAquick gel
25 extraction kit (Qiagen) according to manufacturer’s instructions. Purified DNA fragments were ligated into the appropriate vectors to function in yeast cells.
2.4 Oligonucleotides for PCR amplification of DNA fragments
Oligonucleotides were generated by the PSU Coll. Medicine Macromolecular Core
Facility, Invitrogen, or Promega. Sequences of oligonucleotides are provided in
Table 2.1.
2.5 DNA sequencing
DNA sequencing was carried out by the Plant-Microbe Genomics Facility at The
Ohio State University.
2.6 Preparation of E. coli competent cells
10-12 colonies of E. coli (XL 1-Blue) were transferred to 250 ml SOB (2%
Tryptone, 0.5% Yeast extract, 85mM NaCl, 2.5 mM KCl, 10 mM MgCl2), and grown at
18°C with vigorous shaking (250 RPM) until OD=0.55-0.75. The cultures were kept on ice for 10 min, and then harvested by centrifugation. Cell pellets were resuspended in 80 ml of ice-cold TB solution (10 mM HEPES, 15 mM CaCl2, 250 mM
KCl, 55mM MnCl2). The cultures were incubated on ice for 10 min, and then centrifuged at 4°C for 10 min. 20 ml of TB solution was added to resuspended cells.
1.5 ml of DMSO was subsequently added to the mixture and gently mixed by
26 swirling. After incubating the mixture on ice for 10 min, cells were frozen in liquid nitrogen and maintained in 100 µl aliquots at -80°C.
2.7 Chemical transformation of E. coli competent cells
Plasmids or ligation products were added to competent cells. The cells were kept on ice for 30 min. The cells were heat shocked at 42°C for 45 seconds and subsequently placed on ice for 1 min. The cells were then grown in nutrient rich SOC media at 37°C for 1 hr for recovery. Finally, the cells were plated on appropriate media for plasmid selection and grown overnight at 37°C to isolate single colonies.
2.8 PCR from E. coli colonies
Once newly generated plasmids were transformed into E coli, PCR techniques were carried out to amplify specific DNA fragments to confirm that the desired DNA fragments were ligated with appropriate vectors. A part of the bacterial colony was inoculated in the 20 µl PCR reaction to do DNA amplification. 5 µl of PCR products were resolved on agarose gel to verify the plasmid constructions. The verified colonies were then inoculated to the appropriate liquid media to grow at 37°C for overnight.
2.9 Plasmid DNA Purification
Qiagen’s QIAprep Miniprep kit was used for all plasmid DNA purifications following manufacturer’s instructions. In short, E. coli cells that contain plasmids
27 were grown at 37°C for overnight in liquid culture with the appropriate antibiotic.
The bacteria cells were pelleted and then lysed under alkaline conditions. The lysate was subsequently neutralized and adjusted to high-salt binding conditions. The solution that contained plasmids was then applied to the QIAprep column to absorb plasmids to the silica membrane in a high-salt buffer. Endonucleases were then removed with the first wash step. A second wash step with a buffer containing ethanol was used to remove salt. The plasmid DNA was then eluted from the binding column by centrifugation.
2.10 One-step yeast transformation
Yeast cells were grown in liquid media at 23° or 30°C for two to three days to reach the stationary phase. 250 µl yeast cultures were pelleted for each transformation. 100 µl of tranformation buffer, including 40% PEG 3350, 0.2 M
LiOAc, 0.1M DTT, and 100 µg denatured single-stranded salmon sperm DNA
(sssDNA), was added to yeast cells. 2 µl plasmid DNA was subsequently added. The transformation reactions were placed in a 42° or 45°C water bath for 30 minutes.
Cells were then plated on selective media and grown at 23° or 30°C for 2-3 days.
2.11 Preparation of yeast competent cells
A 50 ml yeast culture was grown overnight at 23° or 30°C in YEPD (Yeast Extract
Peptone Dextrose) to the stationary phase (OD600 of 1~3). The cells were harvested then resuspended in 2 ml of freshly prepared 1xTE/1X LiOAc (10 mM
28 Tris-HCl pH 7.5, 1 mM EDTA, 100 mM LiOAc pH 7.5) buffer. Cells were pelleted and resuspended in 2 ml 1xTE/1X LiOAc buffer as before. The cells were harvested again and then resuspended in 1ml 1xTE/1X LiOAc buffer. Cells were maintained in 100 µl aliquots at 4°C for more than a week without losing competency.
2.12 Yeast transformation
5 µl of denatured sssDNA and 10 µl DNA fragments for deletion of or endogenous tagging of desired genes were mixed with 100 µl yeast competent cells, followed by incubated at 30°C for 30 min. 0.65 ml of 1xTE/1X LiOAc/PEG (10 mM
Tris-HCl pH 7.5, 1 mM EDTA, 100 mM LiOAc pH 7.5, 40% PEG 3350) buffer was added, and the mixture was subsequently incubated at 30°C for 1 hr. The mixture was then place in the 42°C water bath for 15 min. Cells were harvested and then resuspended in 200 µl of ddH2O. Finally, cells were plated on selective media and grown at 23° or 30°C for 2-3 days.
2.13 Isolation of plasmid DNA from yeast using the QIAprep Spin Miniprep Kit
(protocol from Michael Jones, Chugai Institute for Molecular Medicine, Ibaraki,
Japan)
A 2 to 5 ml yeast culture was grown at 23° or 30°C for overnight. Cells were harvested and resuspended in 250 µl of buffer P1 containing 0.1mg/ml RNase A.
Cells were broken down by adding 50-100 µl of glass beads to vortex for 5 min. 250
µl buffer P2 was added into the supernatant and then incubated at room
29 temperature (RT) for 5 min. After incubation, 350 µl of buffer N3 was added into the mixture to neutralize the reaction. The reaction was centrifuged for 10 min to get the clarified lysate. The clarified lysate was transferred to QIAprep Spin Column.
The column was centrifuged for 1 min. The column was washed with 0.75 ml of buffer PE. Afterward, 25 µl of plasmid DNA was eluted by centrifugation.
2 2.14 m 2G methyltransferase activity assay
The assay followed the procedures described by Ellis et al. (1986). In brief, the cells were grown to early log phase (OD~0.4). Crude extracts from 15 mL of each culture were obtained after cell disruption employing vortexing (five times, 15 sec at 4ºC) with an equal volume of glass beads. The reaction, containing 3H, S- adenosylmethionine to track nucleoside methylation, was started by the addition of
2 small RNA containing m 2G26-deficient tRNA isolated from trm1Δ cells. The reaction products were precipitated using 10% TCA, collected on glass fiber filters, and the quantity of the 3H, S-adenosylmethionine incorporated tRNAs was determined by using a scintillation counter.
2.15 Harvesting yeast cells for cryogenic disruption
This protocol was modified according to Alber et al. (2007b). Yeast strains that carry Protein A (PrA) ZZ domain tagged proteins were grown in appropriate selective media until they reached early or mid log phase (OD= 0.4-0.6). Cells were harvested and then wash with 50 ml ice-cold ddH2O two times in a 50 ml tube. From
30 this step on, cells were kept on ice. After washing with ice-cold ddH2O, the cell pellets were subsequently resuspended in equal volume of the resuspension buffer
[20 mM K- HEPES pH 7.4, 1.2% PVP, 1mM DTT, 1:100 of protease inhibitor cocktail
(Calbiochem) and 1:100 of solution P (2% PMSF, 0.04% pepstatin A in 100% ethanol)]. Cells were centrifuged at 2,000 xg, 20 min at 4°C and the pellet was pushed through a plastic syringe into a 50 ml tube filled with liquid nitrogen, and the resulting frozen “noodles” were stored at -80°C.
2.16 Cryogenic disruption using planetary ball mill PQ-N04
To prevent any enzyme reactions during the disruption, all equipment for this procedure was pre-chilled by immersing into liquid nitrogen before using. The procedure was according to Alber et al., (2007b) with the following modifications.
Frozen yeast noodles were transferred to the steel jar with the appropriate amount of steel balls. The steel jar was then placed to planetary ball mill PQ-N04 to perform grinding, 400 RPM, 2 min for each direction (clockwise and anti-clockwise) in 8 to
10 cycles. Between each cycle, the steel jar was removed and cooled in liquid nitrogen. The frozen cell powder was transfer to pre-chilled 50 ml tube and stored at -80°C.
31 2.17 Conjugation of Magnetic beads with rabbit IgG
The procedure was according to Alber et al., (2007b). It can also be found from the website for NCDIR (National Center for Dynamic Interactome Research) at http://www.ncdir.org/protocols.php for more detail.
2.18 Western Blot analysis
One to 5 µg proteins from yeast total extract or 1/20 volume of elution after immunoprecipitation were separated by electrophoresis using 8, 10, or 12% bis-tris polyacrylamide gels. The proteins on the gel were subsequently electrotransferred to a hydrophobic polyvinylidene difluoride (PVDF) membrane (Hybond-P; GE healthcare life sciences). The membrane was incubated in TBS-T (20mM Tris-HCl pH7.4, 120mM NaCl, 0.1% Tween-20) with 5% (w/v) non-fat milk at room temperature for 1 hr or at 4°C for overnight to block non-specific binding.
Appropriate concentration of primary antibody in TBS-T with 5% non-fat milk was added to interact with target protein at room temperature (RT) for 1 hr or at 4°C for overnight. The membrane was washed with TBS-T 3 times for 10 min each to remove the unbound antibody. HRP-conjugated second antibody diluted in TBS-T with 5% non-fat milk was then incubated with the membrane at RT for 1hr. The unbound antibody was removed by washing with TBS-T 3 times for 10min each as before. To visualize the results, the chemiluminescent Substrate SuperSignal West
Pico or Femto (Pierce) was used to detect protein signal on the membrane.
32 2.19 Fluorescence Microscopy
Fluorescence microscopy and image capture was done with Nikon90i equipped with a Cool-SNAP HQ2 digital camera and MetaMorph software (Molecular Devices,
Sunnyvale, CA) or NIS-Elements (Nikon, Melville, NY). Nucleic acid containing organelles were located by staining cells with DAPI. Images processing was performed using Adobe photoshop.
2.20 SYPRO Ruby staining for protein gel
Protein signals were visualized by using SYPRO Ruby protein gel stain
(Invitrogen) following manufacturer’s instructions.
2.21 Coomassie blue staining (Protocol from Dr. Stephen Osmani lab)
This protocol is optimized for subsequent Mass spectrometry. Protein gel was fixed with 50% ethanol, 10% acetic acid for more than 4 hr. Fixed gels were then washed in ddH2O 3 times at RT for 10 min each. The appropriate amount of Bio-Safe
Coomassie Blue Stain (Bio-Rad) was added to the gel at RT for 1 hr to develop protein signals. The gel was then washed with ddH2O for more than 2 hr to remove unbound coomassie blue.
33 2.22 Mass spectrometry analysis
Protein bands within gels were excised and the samples were sent to the Ohio
State University Campus Chemical Instrument Center to perform Mass spectrometry analysis.
34 Name Sequence Source VZ005 TAGATCTCTATTAAATTGTTGGATGGG Lai et al., 2009 VZ006 AATAAAAAAAGTAAGAAGAAAAGGTGCGCG Lai et al., 2009 VZ007 CCTTTTCTTCTTACTTTTTTTATTATTTCTCTTT Lai et al., 2009 VZ008 CATGAAATTCCCCATGTGAGGGAAG Lai et al., 2009 TPL001 CATGAAATTCCCCATGTGAGGGAA Lai et al., 2009 TPL002 CCTTTTCTTCTTACTTTTTTTATT Lai et al., 2009 TPL003 AAGCTTACAACGCTTCTTCTTTGACTTCTTTGAA Lai et al., 2009 GTGTTGGGACGGGCTT TPL004 GAATTCATGTTGAAGGCTGCTATATCC Lai et al., 2009 TPL005 AAGCTTTGAAGTGTTGGGACGGGCTTTTGG Lai et al., 2009 TPL006 GGATCCGGCCAAAAGAGAAATAAT Lai et al., 2009 TPL007 GAATTCAGCATACCTAATGGCTCT Lai et al., 2009 TPL012 GAATTCTGAAGTGTTGGGACGGGCTTTTGG Lai et al., 2009 TPL013 GACAACCTATATGGTGAGGAATGT Lai et al., 2009 TPL014 TTCCCTCACATGGGGAATTTCATG Lai et al., 2009 TPL015 AGTTTGGAAGCATTGTCAGCCACT Lai et al., 2009 TPL016 ATTTATATAAGGTTCGTTTCGATTAGA Lai et al., 2009 TPL017 ATTTTGGAAGCATTGTCAGCCACT Lai et al., 2009 TPL018 ATTTATTTTAGGTTCGTTTCGATTAGA Lai et al., 2009 TPL019 CAAGCCACTGGGTTAAGAGCCATT Lai et al., 2009 TPL020 TCAACCACTGGGTTAAGAGCCATT Lai et al., 2009 TPL021 CAATGCTTCCAAAATATTTATATAAGG Lai et al., 2009 TPL022 CCAGTGGTTGACAATGCTTCCAA Lai et al., 2009 TPL023 CCAGTGGCTGGCAATGCTTCCAA Lai et al., 2009 TPL024 GTTAAGAGCCATTAGGTATGCTCA Lai et al., 2009 TPL025 GATGATTCTTCCAAGCGTCAA Lai et al., 2009 TPL026 CGCGCACCTTTTCTTCTTACT Lai et al., 2009 TPL027 TCTTCCAAGCGTCAAAAAATG Lai et al., 2009 TPL028 AGTTTCCGCGCACCTTTTCTTC Lai et al., 2009 TPL029 AAGCGTCAAAAAATGGGAAAC Lai et al., 2009 TPL030 ATCGTTAGTTTCCGCGCACCT Lai et al., 2009 TPL031 CAAAAAATGGGAAACGGGTCA Lai et al., 2009 TPL032 AGAATCATCGTTAGTTTCCGC Lai et al., 2009 TPL033 ATGGGAAACGGGTCACCAAAAG Lai et al., 2009 TPL034 CTTGGAAGAATCATCGTTAGT Lai et al., 2009 TPL035 AACGGGTCACCAAAAGAAGCC Lai et al., 2009 TPL036 TTGACGCTTGGAAGAATCATC Lai et al., 2009 Continued
Table 2.1 Sequences of the oligonucleotides used in this study
35 Table 2.1 continued
TPL037 TCACCAAAAGAAGCCGTTGGT Lai et al., 2009 TPL038 CATTTTTTGACGCTTGGAAGA Lai et al., 2009 TPL039 AAAGAAGCCGTTGGTAATTCT Lai et al., 2009 TPL040 GTTTCCCATTTTTTGACGCTT Lai et al., 2009 TPL041 GCCGTTGGTAATTCTAATCGA Lai et al., 2009 TPL042 TGACCCGTTTCCCATTTTTTG Lai et al., 2009 TPL043 GGTAATTCTAATCGAAACGAA Lai et al., 2009 TPL044 TTTTGGTGACCCGTTTCCCAT Lai et al., 2009 TPL045 TCTAATCGAAACGAACCTTAT Lai et al., 2009 TPL046 GGCTTCTTTTGGTGACCCGTT Lai et al., 2009 TPL047 CGAAACGAACCTTATATAAAT Lai et al., 2009 TPL048 ACCAACGGCTTCTTTTGGTGA Lai et al., 2009 TPL049 GAACCTTATATAAATATTTTG Lai et al., 2009 TPL050 AGAATTACCAACGGCTTCTTTTG Lai et al., 2009 TPL051 TATATAAATATTTTGGAAGCA Lai et al., 2009 TPL052 TCGATTAGAATTACCAACGGCT Lai et al., 2009 TPL053 AATATTTTGGAAGCATTGTCA Lai et al., 2009 TPL054 GTTTCGATTAGAATTACCAAC Lai et al., 2009 TPL055 ATTTTGGAAGCATTGTCAGCC Lai et al., 2009 TPL056 GGATCCGAAGCCGTTGGTAATTCT Lai et al., 2009 TPL057 GGATCCAATTCTAATCGAAACGAA Lai et al., 2009 TPL058 GGATCCAACGAACCTTATATAAAT Lai et al., 2009 TPL059 GGATCCAGCATACCTAATGGCTCT Lai et al., 2009 TPL060 AGCGGCTGACAATGCTTCCAAAAT Lai et al., 2009 TPL061 GGGTTAAGAGCCATTAGGTATGCT Lai et al., 2009 TPL062 CGCAGTGGCTGACAATGCTTCCAA Lai et al., 2009 TPL063 TTAAGAGCCATTAGGTATGCTCAT Lai et al., 2009 TPL064 TGACCCAGTGGCTGACAATGCTTC Lai et al., 2009 TPL065 AGAGCCATTAGGTATGCTCATGAA Lai et al., 2009 TPL066 TGCTAACCCAGTGGCTGACAATGC Lai et al., 2009 TPL067 GCCATTAGGTATGCTCATGAAATT Lai et al., 2009 TPL068 GTCTCTTAACCCAGTGGCTGACAA Lai et al., 2009 TPL069 ATTAGGTATGCTCATGAAATTCCC Lai et al., 2009 TPL070 AGAGGCTCTTAACCCAGTGGCTGA Lai et al., 2009 TPL071 AGGTATGCTCATGAAATTCCCCAT Lai et al., 2009 TPL072 CGCAATGGCTCTTAACCCAGTGGC Lai et al., 2009 TPL073 TATGCTCATGAAATTCCCCATGTG Lai et al., 2009 TPL077 CTCGAGTCACTGATGATTCGCGTC Lai et al., 2009 TPL078 AAGCTTATGAGTAAAGGAGAAGAA Lai et al., 2009 Continued
36 Table 2.1 continued
TPL079 TTTGTATAGTTCATCCATACCATG Lai et al., 2009 TPL082 GCTAGCATGTCCCAGTCGAACCCTAT Lai et al., 2009 TPL083 GACGTCGTCATCGATATCGTTAGCTT Lai et al., 2009 TPL086 CCCGGGATGTCTGAAGAGAATTTGAG Lai et al., 2009 TPL087 AAGCTTATTAGCTGCCGCTTCCGGTT Lai et al., 2009 TPL088 AAGCTTAACGAACCTTATATAAAT Lai et al., 2009 TPL089 AAGCTTAGCATACCTAATGGCTCT Lai et al., 2009 TPL090 AACGAACCTTATATAAATATTTTG Lai et al., 2009 TPL091 CTCGAGAGCATACCTAATGGCTCT Lai et al., 2009 TPL094 GCTAGCATGTTTGGATTAAATAAAGCATCT Lai et al., 2009 TPL095 GACGTCTATGCTCAATGATGCCAG Lai et al., 2009 TPL108 GGATCCAGTGTTACATGCATCAAGG Lai et al., 2009 TPL111 GAGCTCCGTGTGTAAAAATATATG In this study TPL112 CCCGGGATCTACATTGTAAGAGGA In this study TPL113 CTCGAGGAATTTTGATTAGTGTTA In this study TPL114 CTCGAGTATACTTCTTTAGTAAGG In this study TPL115 ACCTTCGATATCTACATTGTAAGA In this study TPL116 TTCTTCAGGATACCCCTCAAG In this study TPL129 AAGCTTCTGATGATTCGCGTC In this study TPL130 AAGCTTGGACCATCGGCCGTGGAC In this study TPL136 ATTCAATGCTCATCGCAAAGTTACAGATCCTGAG In this study CAGTCATAAGTTGATACCTTTCCTCTTACAATGT AGATCCAGGTCGACGG ATCCCCGG TPL137 AGAGAAGCATTCTTTTCCGTCCATTATACCGTTC In this study TCGGGCGGATCCTTAGTTTCTTACGTTTTAGCTC TAACACTAATCAAAATTCCGTGGATCTGATATCA TCGATGAATTCGAGC TPL161 AGGCTTTTAGAAGTTCTTTTTCAA In this study TPL169 CCCGGGATGTCTCAATACGCAAGCTCA In this study TPL170 AAGCTTCAAAACAATTTCCTTTTCTTC In this study
37
Chapter 3
Mechanism and a peptide motif for targeting peripheral proteins to the yeast inner nuclear membrane
3.1 Introduction
In eukaryotic cells, proteins are synthesized in the cytosol and then translocate to different organelles where they exert their functions. Numerous membrane proteins localize to the NE and interact with other marcomolecules to mediate nuclear functions. In particular, the inner nuclear membrane (INM) contains specific proteins that interact with chromatin and/or nuclear lamina to regulate gene expression, nuclear structure, chromatin organization, and nuclear migration
(Dechat et al., 2008; Gruenbaum et al., 2005). These proteins are important for normal cell function as mutations in genes encoding INM proteins and/or mutations that cause mislocalization of normal proteins are linked to various human disorders, laminopathies (Maraldi et al., 2011; Worman, 2012).
The INM contains integral membrane proteins and peripheral membrane proteins. Integral INM proteins, which contain transmembrane domains, are synthesized on membrane-associated polyribosomes and are inserted co- translationally into the ER (Franke et al., 1981; Pathak et al., 1986). After synthesis,
38 these proteins are translocated from the ER to the INM, Studies in both yeast and higher eukaryotes have led to four different models to describe how integral INM proteins are directed to the INM. In the first model, integral INM proteins diffuse in the membrane between ER and INM and then associate with other nuclear components, such as chromatin and/or nuclear lamina to become immobilized on the INM (Soullam and Worman, 1993). The second model proposes that integral
INM proteins are included in vesicles that bud off the ER and subsequently fuse with the NE to transport to the INM (Hetzer et al., 2001). In the third model, integral INM proteins are translocated to the nucleus via a Ran-dependent interaction between
NLS motifs in the proteins and a member of the importin β family (King et al., 2006).
The forth model proposes that importin-α-16, which recognizes INM-sorting motifs, facilitates integral INM protein translocation from the ER to the nucleus (Saksena et al., 2006; Braunagel et al., 2007). The possible explanation for the existence of such different models is that each model may be influenced by specific features of individual INM proteins and/or the organism studied.
Peripheral INM proteins do not contain transmembrane domains to anchor membrane structures. Instead, they associate with the INM via interaction with other INM components, such as proteins and/or lipids. The mechanism(s) for targeting peripheral membrane proteins to the INM is poorly described. The prevailing model for targeting peripheral membrane proteins to the INM has three steps. First, peripheral INM proteins are synthesized in the cytoplasm on free polyribosomes. Next, the newly synthesized proteins are imported into the nucleus
39 using the Ran-dependent pathway following the same mechanism as soluble nuclear proteins nuclear import. Third, once peripheral INM proteins are in the nucleus, they associate to the INM by interacting with other INM components (Burns and
Wente, 2012; Cook et al., 2007; Lai et al., 2009; Stewart, 2007). Since there are many membrane proteins that peripherally associate with the INM, there may be additional mechanisms for targeting peripheral proteins to the INM.
The goal of this dissertation is to gain an understanding of how proteins peripherally associated with the INM are targeted/tethered to this location. S. cerevisiae Trm1-II, was shown to be peripherally associated with the INM by biochemical and genetic evidence (Rose et al., 1995; Murthi and Hopper, 2005).
Thus, I employ Trm1-II as a reporter to investigate how peripheral proteins are targeted to the INM.
To define whether Trm1-II enters the nuclear interior via the Ran-dependent nuclear import pathway, Dr. Murthi determined the subcellular location of newly synthesized Trm1-II-GFP in wild type and rna1-1, a temperature sensitive RanGAP mutation (Corbett et al., 1995), cells and found that the delivery of Trm1-II to the
INM is Ran-dependent. At the nonpermissive temperature in rna1-1 cells the majority of the Trm1-II-GFP pool is distributed throughout the cytoplasm whereas some of the pool becomes associated with mitochondria (Lai et al., 2009). Also, Dr.
Murthi showed that the Ran-dependent pathway is not necessary for the retention of Trm1-II at the INM (Lai et al., 2009) (Figure 3.1). The data suggested that
40 translocation of Trm1-II from cytoplasm to the nucleus occurs via the classical nuclear import pathway.
Although proteins reach their correct subcellular locations by distinct mechanisms, the presence of specific motifs, which allows the proteins to interact with various cellular components, is a common feature to facilitate these processes.
Specific motifs of proteins can be defined by their molecular structure or sequence.
For example, mitochondrial targeting signals (MTS) do not have a defined amino acid sequence motif, but rather they are comprised of an amphiphilic α-helix structure with positively charged residues located at one side, and uncharged and hydrophobic amino acids on the opposite side of the helix (Neupert, 1997; Pfanner,
2000). In contrast, the nuclear localization sequence (NLS) contains a ~5 amino acid long basic region (Goldfarb et al., 1986) or two clusters of basic amino acids separated by a spacer of roughly 10 amino acids (Dingwall et al., 1988) to promote a protein’s import into the nucleus.
Stanford et al (2000) conducted a phylogenetic comparison to study five different sorting isozymes, which are encoded by single genes with dual or multiple subcellular distributions, including Trm1. They found the eukaryotic sorting isozymes contain additional sequences not present in the archaeal and eubacterial counterparts. These additional sequences were proposed to direct the eukaryotic proteins to the appropriate subcellular locations and were named ADEPTs
(Additional Domain for Eukaryotic Protein Targeting). Trm1 contains four ADEPT regions. Studies showed that the first ADEPT region of Trm1 (amino acids 1-48) is
41 sufficient to target Trm1 to mitochondria (Ellis et al., 1989), and the second ADEPT region (amino acids 91-136) contains an efficient NLS (amino acids 95-102) for
Trm1 nuclear import (Rose et al., 1992). Thus, based on the ADEPT hypothesis, a former graduate student K. Staufer in our lab tested whether ADEPTs in Trm1 contain the information for Trm1-II INM targeting. She found that Trm1 amino acids
73-151 which contain the second ADEPT sequence (amino acids 91-136) are sufficient to target reporter protein NLS-β-galactosidase to the nuclear periphery.
Dr. Murthi and Dr. Shaheen also showed that Trm1 amino acids 73-151 are able to localize another reporter protein, NLS-GFP, to the nuclear periphery (Lai et al.,
2009). K. Staufer further demonstrated that Trm1 amino acids 89-151 contain the information to localize NLS-β-galactosidase to the INM (Lai et al., 2009). Here, I further characterized the cis-acting motif of Trm1-II that is necessary and sufficient for locating Trm1-II and three different reporter proteins to the INM. The studies define a short stretch of amino acids for proteins to associate with the INM providing the first INM targeting motif. I also identified an amphipathic α-helix within the motif that is important for INM targeting.
3.2 Materials and methods
3.2.1 Plasmid constructions and DNA
All plasmids described in chapter three were confirmed by DNA sequencing.
Most of constructs used the plasmid construction method described in chapter two.
42 Trm1-β-galactosidase fusion proteins
To identify Trm1 regions sufficient for INM location, I generated constructs that contain Trm1 amino acids 89-151, 122-151, 126-151, and 130-151 fused in-frame with β-galactosidase. Each amplified sequence was subsequently cloned into multi- copy vectors at the BamHI site behind the histone H2B promoter and histone H2B amino acids 1–67 which contain a classical NLS [pFB1-67μ; (Moreland et al., 1987)].
Fluorescent tagged protein fusions
Plasmid pGP54a-GFP was derived from pGP54a, a pRS416-based plasmid containing the GAL1-GAL10 promoter sequence (Murthi et al., 2005), by insertion of a GFP sequence into the HindIII XhoI polylinker sites. Plasmid pGP54a-Trm1-II-GFP was generated by PCR amplifying the TRM1 sequence that encodes only Trm1-II.
The amplified TRM1 fragment was inserted into pGP54a-GFP between EcoRI and
HindIII sites. The sequence of PUS1 was amplified by PCR and inserted into pGP54a-
GFP digested with XmaI and HindIII to generate pGP54a-Pus1-GFP. Plasmid pGP54a-
Pus1-INM-GFP was derived from pGP54a-Pus1-GFP by cloning the sequence that encodes Trm1 amino acids 73-151 to pGP54a-Pus1-GFP at EcoRI site. This plasmid encodes the Pus1-Trm1(73-151)-GFP fusion protein.
Trm1(89–151)-GFP was derived from vector pIGoutA (Butterfield-Gerson et al.,
2006). pIGoutA/Trm1(89–151)-GFP contains a galactose-inducible regulatory sequences and a NLS for histone H2B amino acids 1-67, Trm1 amino acids 89–151, followed by an in-frame fusion of two tandem GFP proteins. pIGoutA/Trm7-GFP
43 which encode NLS-Trm7-GFP was generated by insertion of an amplified Trm7 ORF with terminal EcoRI and HindIII sites into pIGoutA. The vector which encodes NLS-
(73–151)-Trm7-GFP is a derivative of pIGoutA/Trm7-GFP. The sequence encoding
Trm1 amino acids 73-151 was amplified by PCR and was subsequently inserted into pIGoutA/Trm7-GFP digested with EcoRI to generate pIGoutA/73-151-Trm7-GFP.
The protein encoded by this construct maintains catalytic activity (Murthi et al.,
2010). Additional constructs that contain Trm1 amino acids 89–151, 126–151, and
130–151 amino-terminal to Trm7 GFP were generated in a similar fashion. To generate Nup49-mCherry and Tom20-mCherry, we employed a tiling collection of the S. cerevisiae genome inserted into a high-copy vector (Jones et al., 2008) to amplify the ORFs of TOM20, and NUP49. The PCR products were ligated into pGEM-T vector to form pGEM-T/Tom20 and pGEM-T/Nup49. pGEM-T/Tom20 and pGEM-
T/Nup49 were digested with NheI and Aat II and the linear TOM20 and NUP49 DNAs were cloned into a plasmid which contains the constitutive ADH2 promoter and the mCherry reporter, generating pTPL2 and pTPL3, respectively.
Trm1-II-GFP deletions
Trm1-II-GFP deletion constructs were derived from pGP54a-GFP using appropriate TRM1 primers to amplify two fragments. The first fragment has Trm1-II coding sequence from the amino-terminal end to the coding sequence before the amino acid coding sequence to be removed from the Trm1-II. The second fragment has the DNA sequence that encodes Trm1 amino acids after the amino acid to be
44 deleted to the carboxyl-terminal end of Trm1 coding sequence. PCR products were purified and digested with EcoRI and HindIII, respectively, followed by phosphorylation using polynucleotide kinase. The pGP54a-GFP vector was digested with EcoRI and Hind III and ligated with the linear mutant TRM1 DNAs to form pGP54a-GFP/Trm1Δ72-93, pGP54a-GFP/Trm1Δ101-151, and pGP54a-
GFP/Trm1Δ72-151 plasmids. To generate plasmid pGEM-T/Trm1Δ72-151 + NLS, I used with pGEMT/ Trm1Δ72-151 as a template and a primer containing sequences complementary to the Trm1 NLS. PCR products were ligated into pGEM-T vector to generate pGEM-T/Trm1Δ72-151 + NLS, and the Trm1Δ72-151 + NLS sequence was ligated into vector pGP54a-GFP between EcoRI and Hind III sites creating pGP54a-
GFP/Trm1Δ72-151 + NLS.
For fine mapping of Trm1 sequences necessary for INM targeting/tethering, I employed a series of overlapping constructs, each missing five amino acids of Trm1 sequences from 102 to 151. Each construct was generated by ligation of two fragments generated by PCR amplification using pGEM-T/Trm1-II as the template.
The first fragment of each construct was generated by using a T7 primer and an appropriate TRM1 primer. The second fragment was generated using an SP6 primer and appropriate downstream primer for each construct. The first and second fragments were digested with EcoRI and Hind III to remove the sequences from pGEM-T vector, and the resulting fragments were treated with polynucleotide kinase and then ligated into pGP54a-GFP.
45 Mutagenic PCR and site-directed mutations
I employed error-prone mutagenesis using a GeneMorph® II EZClone Domain
Mutagenesis Kit (Stratagene) to generate random mutations of Trm1 amino acids
89–151. Error-prone PCR was performed under following conditions: 1 cycle, 3 min at 94ºC; 30 cycles, 30 sec at 94ºC, 30 sec at 61ºC, 1 min at 72ºC; 1 cycle, 5 min at 72ºC using pGP54a-Trm1-II-GFP as the template. This created a library of DNAs that contained 1–5 nucleotide mutations in the region encoding Trm1-II amino acids 89–
151. The library was then used as a mega primer to introduce the mutations into wild-type TRM1 in plasmid pGP54a-Trm1-II-GFP following the manufacturer’s instructions except that 1 μL Pfu Ultra High Fidelity DNA polymerase (Stratagene) was added into 50 μL EZClone reaction mix. After treatment with DpnI to destroy template plasmid DNA, not produced by PCR, the plasmid library was transformed into E. coli.
To generate site-directed mutations, I used the similar procedures that were used to generate the constructs with five amino acid deletions. In short, two fragments were generated by PCR amplification using pGEM-T/Trm1-II as the template. Using a T7 primer and a TRM1 primer that contains one or two nucleotide mutations on desired codon, the mutation(s) was introduced into the first fragment for each construct. The second fragment was generated using an SP6 primer and appropriate TRM1 downstream primer for each construct. The first and second fragments were then cloned into pGP54a-GFP by the same procedure described to generate the constructs with five amino acid deletions.
46 Additional random mutations of Trm1 amino acids 126-151 to further characterize the specific amino acids important to Trm1-II INM location were generated. After DNA sequencing of each plasmid, all sequences were then compared to the wild-type TRM1 sequence using BLAST in an attempt to determine which mutations were generated.
3.2.2 Indirect immunofluoresence
Indirect immunofluoresence was carried out as described by Pringle et al. (1991) with the modifications previously described by Hopper et al. (1990). Primary antibodies were affinity-purified rabbit anti-β-galactosidase (Hopper et al., 1990), used at 1:10000 dilution. Secondary antibodies were Cy3-conjugated goat anti- rabbit IgG diluted 1:400 (Jackson IR Labs).
2 3.2.3 m 2G methyltransferase activity assay
The assay was described in chapter two with the following changes: trm1Δ cells were transformed with the appropriate pGP54a-Trm1-II-GFP plasmids that encode wild-type Trm1-II or mutant Trm1-II proteins with amino acid alterations of Trm1 with the region encoding amino acids 130–151. Newly synthesized Trm1-II-GFP was produced by galactose induction at 30ºC for 2 hr.
47 3.3 Results
3.3.1 Altering the composition of the NPC does not affect Trm1-II-GFP INM distribution
The NPCs that mediate transport of macromolecules between the nucleus and cytoplasm are built from multiple copies of Nups (Suntharalingam and Wente, 2003;
Wente and Rout, 2010). To translocate cargos from cytoplasm into the nucleus, the import karyopherin-cargo complex facilitates translocation through the NPC to enter the nucleus. The mechanism of karyopherin-cargo translocation is mediated by the RanGTP gradient in the cells (Stewart, 2007). It has been shown that Trm1-II enters the nuclear interior via the Ran-dependent nuclear import pathway by Dr.
Murthi (Lai et al., 2009). This suggests that Trm1-II is actively transported through
NPCs by the nuclear transport machinery for soluble proteins. Therefore, the composition and distribution of NPCs on the NE may be important for Trm1-II-GFP
INM location.
Nup133, an outer ring Nup, is essential for growth and nucleus cytoplasm transport at high temperature, but not at low temperature (23°C). It has been shown that NPCs cluster to a subdomain of the NE in nup133Δ cells (Belgareh and Doye,
1997). To test whether the distribution of NPCs affects Trm1-II-GFP to associate with the INM, I studied newly synthesized Trm1-II-GFP, expressed from a galactose promoter, in both wild type (BY4741) and nup133Δ cells after 1.5 hr of galactose induction of Trm1-II-GFP. After induction, Trm1-II-GFP was located normally at the nuclear rim in wild-type cells. Nup49-mCherry was in the expected punctate pattern
48 distributed throughout the NE (Figure 3.2). As expected, Nup49-mCherry clustered to a subportion of the NE in nup133Δ cells, (Figure 3.2) (Belgareh and Doye, 1997).
For ∼75% of the galactose-induced nup133Δ cells viewed (81 of 104 cells), Trm1-II-
GFP correctly located to the NE; for the remaining ∼25% of the cells (23 of 104 cells), Trm1-II-GFP clustered on a portion of NE with the NPC. The results indicate that the clustering of NPCs in nup133Δ mutant has minimal effect upon Trm1-II-GFP to target to the NE in majority of cells.
The NPC is composed of four classes of proteins: core (inner ring and outer ring), linker, FG, and transmembrane Nups (Strambio-De-Castillia et al., 2010; Wente and
Rout, 2010). To learn whether Nups of each substructure in the NPC affect distribution of Trm1-II-GFP in cells, I chose to study non-essential Nups: Nup2 and
Nup100 (FG Nups), Nup53 and Nup188 (inner ring Nups), and Pom152 (a transmembrane Nup) using mutants derived from S. cerevisiae gene deletion collection (Winzeler et al., 1999). I observed that Trm1-II-GFP was normally located to the nuclear periphery and colocalized with Nup49-mCherry in strains with deletions of NUP2, NUP53, NUP100, POM152 and NUP188 (Figure 3.3). Although I did not study linker Nups (Nic96 and Nup82), which are essential proteins in yeast, the data demonstrate that alteration of NPC composition by deletion of specific
Nups does not affect Trm1-II-GFP INM location.
49 3.3.2 Trm1 amino acids 73-151 are able to direct some but not all fusion proteins to the nuclear periphery
Although Trm1 amino acids 73-151 are sufficient to locate β-galactosidase and
GFP to the nuclear periphery (Lai et al., 2009), it is possible that Trm1 amino acids
73-151 are not capable to localize other yeast proteins to the nuclear periphery. To determine if Trm1 amino acids 73-151 can direct a nucleoplasmic protein to the
INM, I inserted Trm1 amino acids 73-151 downstream of a galactose promoter driven Pus1 [a tRNA pseudouridine synthase (Grosshans et al., 2001; Massenet et al.,
1999)] and upstream of GFP to generate Pus1-(73-151)-GFP fusion protein.
Unexpectedly, after the induction by the addition of galactose, Pus1-(73-151)-GFP located in the nucleoplasm rather than targeting to the nuclear periphery (Figure
3.4). The results suggest that Trm1 amino acids 73-151 are not able to direct nucleoplasm proteins (at least Pus1) to the nuclear periphery. It is possible that
Pus1 interacts with other nuclear factors in the nucleoplasm and Trm1 amino acids
73-151 may not provide interactions strong enough to redirect Pus1 to the nuclear periphery. Alternatively, Trm1 amino acids 73-151 may not be properly exposed in
Pus1-(73-151)-GFP fusion proteins to exert the function for INM targeting.
I also attempted to test if proteins that are normally located outside of the nucleus can be redirected to the INM by Trm1 amino acids 73-151. Trm7 is a cytoplasmic, unessential, splicing-dependent modification enzyme (Grosjean et al.,
1997; Pintard et al., 2002). First, I directed Trm7-GFP to the nucleus, using galactose-inducible promoter and a classical NLS derived from histone H2B. After 2
50 hr galactose induction, the reporter protein NLS-Trm7-GFP is evenly distributed in the nucleoplasm in wild-type cells (Figure 3.10B, panel 1). Then I inserted Trm1 amino acids 73-151 between the NLS and Trm7-GFP to form NLS-(73-151)-Trm7-
GFP. The fusion protein NLS-(73-151)-Trm7-GFP is localized to the nuclear periphery as determined by colocalization with Nup49-mCherry (Figure 3.5, wild type). Surprisingly, NLS-(73-151)-Trm7-GFP forms spots instead of the smooth, even ring shape distribution around the nucleus observed for Trm1-II-GFP. The combined results from Dr. Murthi, Dr. Shaheen, K. Stauffer and my studies indicate that Trm1 amino acids 73-151 are sufficient to target at least 3 different reporter proteins (NLS-β-galactosidase, NLS-GFP, and NLS-Trm7-GFP) to the nuclear periphery.
3.3.3 Fusion proteins that contain Trm1 amino acids 73-151 are located to the
INM, rather than the ONM
Although Trm1 amino acids 73-151 are sufficient to locate different reporter proteins to the nuclear periphery (Lai et al., 2009), one cannot determine by light microscopy is whether the fusion proteins containing Trm1 amino acids 73-151 are located at the INM or the ONM. To address this issue, I determined the distribution of NLS-(73-151)-Trm7-GFP in rna1-1 (a RanGAP temperature-sensitive mutation) cells at permissive and non-permissive temperature. For rna1-1 cells at the permissive temperature (23°C), the RanGTP gradient behaves normally to facilitate the transport of cargo proteins in and out of the nucleus. In contrast, if the RanGTP
51 gradient is disrupted at non-permissive temperature (37°C), the nuclear import pathway cannot function properly to transport cargo proteins into the nucleus resulting cytoplasm distribution of cargo proteins. Thus, if NLS-(73-151)-Trm7-GFP was located at the INM, newly synthesized protein should distribute in the cytoplasm at non-permissive temperature in rna1-1 cells. On the other hand since the Ran pathway is not required for the ER or the ONM location, if NLS-(73-151)-
Trm7-GFP was associated with the ONM or ER rather than the INM, NLS-(73-151)-
Trm7-GFP should still locate to the nuclear periphery when the RanGTP gradient is disrupted. As expected, newly synthesized NLS-(73-151)-Trm7-GFP is evenly distributed throughout the cytoplasm instead of targeting to the nuclear rim at non- permissive temperature in rna1-1 cells (Figure 3.5). The data support the hypothesis that Trm1 amino acids 73-151 are able to deliver the fusion protein to the INM.
3.3.4 Position and context of NLS within Trm1-II is important for Trm1-II nuclear location
To test whether Trm1 amino acids 73-151, which are sufficient to target reporter proteins to the INM are necessary for Trm1-II INM association, I studied the locations of Trm1-II that contain various internal deletions at Trm1 amino acid 73-
151 region. It has been shown that Trm1-II containing mutant NLS at amino acids
95-101 (95KKSKKKR101 to 95EESEEER101) causes disruption of nuclear distribution
(Rose et al., 1995). To maintain Trm1 amino acids 95-101 in Trm1-II mutants, two
52 internal deletions (Trm1Δ72-93 and Trm1Δ101-151) containing the native NLS were generated. I generated a construct that expresses Trm1 mutant containing the deletion of the entire region of amino acids 73-151 in Trm1-II protein (Trm1Δ72-
151). However as Trm1Δ72-151 lacks the native NLS, an exogenous NLS from histone H2B was added to the carboxyl terminal end of mutant Trm1-II before the
GFP sequence to generate Trm1Δ72-151+NLS. As the constructs have galactose driven promoters, the location of mutant proteins in wild type cells was determined after 2 hr galactose induction. Surprisingly, instead of targeting to the INM each mutant protein gave the same result, they located to mitochondria as determined by colocalization with Tom20-mCherry, the mitochondrial outer membrane protein
(Figure 3.6). The results indicate that mutant Trm1-II proteins containing various deletions at Trm1 amino acids 73-151 might cause Trm1 NLS (amino acids 95-101) to be in the wrong conformation or context to interact with the karyopherins.
3.3.5 Trm1 amino acid sequences necessary for INM location
Trm1 amino acids 73-151 are sufficient to locate reporter proteins to the INM
(Lai et al., 2009). To learn whether amino-termial or carboxyl-terminal of Trm1 amino acids 73-151 contain targeting information sufficient for INM location, K.
Stauffer found that Trm1 amino acids 89-151 is sufficient to target NLS-β- galactosidase to the INM (Lai et al., 2009). To analyze which amino acids in the 89-
151 region are necessary for authentic Trm1-II INM location, I employed in vitro random mutagenesis. The DNA sequence that corresponds to Trm1 amino acids 89-
53 151 was amplified by error-prone PCR to create a variety of mutant sequences.
Using pGP54a-Trm1-II-GFP as the template, these mutant DNA sequences were introduced as mega primers to generate a library that has full-length Trm1-II with alterations of amino acids 89-151. Plasmids encoding different mutant Trm1-II-GFP proteins from this library were transformed into wild-type cells. All yeast candidates (~250 candidates) expressed various mutant Trm1-II-GFP proteins after induction by addition of galactose, were subsequently studied to determine the protein location by fluorescent microscopy.
For most of the mutant candidates, Trm1-II was located at the INM site. I randomly chose 60 plasmids among these candidates that contain INM located proteins to conduct DNA sequence analyses. Over half of sequenced candidates contain single or multiple codon changes distributed throughout the coding sequence of Trm1 amino acids 89-151 (Figure 3.7A). Three plasmids contained
Trm1-II mutant proteins that located to the nucleoplasm instead of the INM (Figure
3.7A; see brown, orange, and blue amino acid changes above the Trm1 sequence).
The first plasmid contained a single change of A151D. Codon 151 in Trm1-II-GFP is the last codon of the region subjected to mutagenic PCR (Figure 3.7A, brown amino acid; 3.7B, panel 5). The second plasmid had three changes of amino acids I134K,
S141Q, and A142T in Trm1-II –GFP (Figure 3.7A, orange amino acids; 3.5B, panel 2).
Since another plasmid that encoded normally distributed Trm1-II-GFP possessed an individual mutation of I to K at amino acid 134 (Figure 3.7A), it is unlikely that this mutation contributes to the mislocalization of Trm1-II-GFP to the nucleoplasm. To
54 discriminate the contributions of the other two mutations contained in Trm1-II-GFP of the second plasmid to its mislocalization, I employed site-directed mutagenesis to generate S141Q or A142T. Trm1-II-GFP possessing either S141Q or A142T mutation is located at the INM (Figure 3.7A, orange amino acids above and cyan amino acids below the Trm1 sequence). The data indicate that I134, S141, A142 are not individually necessary for INM location, but that some combination of these amino acids is necessary. The third plasmid possessed two amino acid changes at Y133 and
I136 to 133K and 136S (Figure 3.7A, blue amino acids above the Trm1 sequence).
Site-directed mutagenesis to individually alter these amino acids showed that mutation of I136S alone causes Trm1-II-GFP to become nucleoplasmic. Additionally, the Y133K mutation had no affect on Trm1 distribution (Figure 3.7A, blue amino acid above and cyan amino acid below the Trm1 sequence). Unexpectedly, these three Trm1-II-GFP mutations that cause Trm1-II-GFP to be inappropriately located in the nucleoplasm instead of being located at the INM all possessed amino acids mutations at the carboxyl-terminus of Trm1 amino acids 89-151. Thus, these studies reduced the region necessary to target Trm1-II to the INM from 63 amino acids to
~20 amino acids in a region that is conserved in archaeal and all eukaryotic Trm1 proteins (Figure 3.7A, magenta colored box)(Stanford et al., 2000).
To acquire more information for Trm1-II INM distribution in carboxyl-terminal region of Tm1 amino acids 89-151, I employed site-directed mutagenesis to obtain additional changes. I chose to change each signal amino acid from Trm1 amino acids
145-149 (L145 to S145, R146 to A146, A147 to D147, I148 to S148, and R149 to
55 A149). Several single mutants including L145S, I148S, and R149A were localized to the INM, indicating that these amino acids are not important for targeting Trm1-II-
GFP to the INM (Fig. 3.7A, blue amino acid above and cyan amino acid below the
Trm1 sequence; Figure 3.7B, panel 4). In contrast, the R146A and A147D mutations cause Trm1-II-GFP to mislocalize to the nucleoplasm (Figure 3.7A, green and magenta colored amino acids above Trm1 sequence; Figure 3.7B, panel 3). The results further support that the carboxyl-terminus of Trm1 amino acids 89-151 are important for Trm1-II to achieve its INM location.
The mutations that cause Trm1-II-GFP to mislocate to the nucleoplasm are located in a region of Trm1 that is conserved from archaea to humans (Stanford et al., 2000). Crystal structure of archaeal Trm1 shows that this conserved region is important for Trm1 to associate with tRNAs (Ihsanawati et al., 2008). Since these mutations may affect the tRNA modification activity of Trm1-II, I assayed tRNA methyltransferase activity of these Trm-II-GFP mutants that are mislocalized to nucleoplasm. As expected, I found that these Trm1-II-GFP mutations contain less or no tRNA methyltransferase activity by comparing with wild-type Trm1-II-GFP
(Figure 3.8). However, the R149A mutation in this conserved region which does not affect Trm1 INM location, also causes loss of enzyme activity. This indicates that there is not a strict correlation between enzyme activity and INM targeting in Trm1-
II.
Although the mutations causing nucleoplasmic mislocalization of Trm1-II-GFP identified by random and site-directed mutagenesis approaches have mapped to the
56 very carboxyl-terminal of Trm1 amino acid 89-151 region, it is possible that there are blocks of the larger sequence for which no particular signal amino acid functions in Trm1-II INM location. To address this, I generated a series of overlapping deletions in Trm1-II-GFP throughout the amino acids 89-135, each missing five amino acids. After determining the protein subcellular location of each deletion. I found that deletions between amino acids 102 and 124 caused Trm1-II-GFP to accumulate as ‘spots’ in the cytoplasm (Figure 3.9). A possible explanation is that the deletion of Trm1-II between amino acids 102 and 124 may cause misfolding of
Trm1-II-GFP resulting in inappropriate cytoplasmic location. Trm1-II-GFP mutants missing amino acids 122–126, 124–128 or 126–130 accumulated as spots in the cytoplasm, but for each of these mutations, part of the pool was correctly located at the INM (Figure 3.9). Trm1-II-GFP missing amino acids 128–132 was located at the
INM like wild-type Trm1-II (Figure 3.9). Interestingly, deletion of amino acids 130–
134 or 131–135 resulted in small nucleoplasmic pools of Trm1-II-GFP (Figure 3.9).
The data of overlapping deletion in combination with the amino acid mutations indicate that Trm1 amino acids 130-151 contain information required to target
Trm1-II-GFP to the INM.
3.3.6 A short peptide within Trm1 is sufficient for the peripheral association of reporter proteins to the inner nuclear membrane
To test whether the newly defined region necessary for targeting Trm1-II-GFP to the INM is also sufficient to locate reporter proteins to this subnuclear location. I
57 generated additional β-galactosidase and Trm7 fusion proteins with the short peptides that contain newly defined INM targeting information from Trm1.
Significantly, fusion proteins containing Trm1 amino acids 122–151, 126–151 and
130–151 resulted in the redistribution of NLS-β-galactosidase from nucleoplasmic to location at the INM which is similar to the fusion protein with Trm1 amino acids
89-151 (Figure 3.10A). These same short Trm1 regions also deliver NLS-Trm7-GFP
(Figure 3.10B) to the INM. Thus, a short peptide within Trm1 that is necessary is also sufficient for the peripheral association of proteins to the INM.
3.3.7 The Trm1 INM targeting motif appears to be structure specific
In the studies above, I identified that Trm1-II-GFP mutants containing amino acid alterations in the Trm1 amino acids 130-151 region that cause nucleoplasm mislocation of Trm1-II-GFP; however these studies are still too restricted to define a functional INM targeting motif. To acquire numerous mutations of the Trm1 INM targeting motif, I employed error-prone PCR to generate additional 360 candidate clones, each presumably containing at least one mutation within the Trm1 amino acids 126-151. The localization of each candidate mutant Trm1-II-GFP in yeast was determined by a former undergraduate student, J. Profato, in our laboratory. J.
Profato and I identified 13 new plasmids that demonstrate altered Trm1-II-GFP location from the INM to the nucleoplasm (Figure 3.11, see different color coded amino acids above the Trm1 sequence). Sequence analyses showed that plasmids encoding nucleoplasmic Trm1-II-GFP mutants contain single or multiple changes of
58 amino acids in Trm1 amino acid 130-151 region (Figure 3.11, see different color coded amino acids above the Trm1 sequence). Two Trm1-II-GFP mutant clones that contain alterations of single amino acid [A147D and A151D (Figure 3.11, brown and magenta amino acids)] were also found in my random and site-directed mutagenesis procedures. The data further support that Trm1 amino acids 130-151 contain information necessary for Trm1-II INM location. Although we did not identified any particular amino acid consensus sequences that are important in the
INM targeting motif by analyzing the data from these random and site-directed mutagenesis screens, we found that almost all of the mutations that cause a defect in the INM targeting motif also create a change in the property of the wild-type amino acid, such as hydrophobic to charged (A147 to D147), or charged to hydrophilic
(R146 to A146). Structural analysis comparing archaeal Trm1 (Ihsanawati et al.,
2008) to Saccharomyces cerevisiae Trm1 revealed that Trm1 amino acids 145-153 are located in a highly conserved region and form an amphipathic α-helix. Part of the helix region has been shown to be necessary and sufficient for the INM targeting of Trm1-II (amino acids 145-151). Tracking the mutations using a helical wheel projection allowed us to determine that amino acid changes affecting Trm1-II-GFP localization altered the amphipathic property of the helix (Figure 3.12). Mutations
(R146A and R149S) that changed charged amino acid to the hydrophilic amino acid caused disruption of the amphipathic property of the α-helix. Also, changes of hydrophilic to charged amino acid (i.e. A147D and A151D) that are predicted to affect the structure of the α-helix caused mislocalization of Trm1-II-GFP to the
59 nucleoplasm. The results support the model that the amphipathic nature of this helix is important for Trm1-II INM targeting because disruptions of the amphipathic property of the helix appear to cause a defect in Trm1-II-GFP INM location. Thus, it is likely that Trm1 INM targeting motif is a structure specific motif much like the
MTS.
3.4 Discussion
3.4.1 Competition between nuclear and mitochondrial targeting information
The difference between Trm1-I and Trm1-II amino acid sequences is that Trm1-I contains 16 extra amino acids at its amino terminus (Ellis et al., 1987). Trm1-I and
Trm1-II both contain a potential MTS [amino acids 17-48 (Ellis et al., 1989)] and an essential NLS [amino acids 95-101 (Rose et al., 1992)] in their protein sequences.
However, the distribution of Trm1-I and Trm1-II is different. Trm1-I exclusively locates to the mitochondria, but the majority of Trm1-II is located in the nucleus
(Ellis et al., 1987). Although I attempted to study INM targeting information in Trm1 amino acids 73-151 by generating the deletions in the Trm1 amino acid 73-151 region, surprisingly, I observed that these mutant Trm1-II-GFP proteins which contain either the NLS or an ectopic NLS at the carboxyl terminus distribute to the mitochondria rather than the INM. The data indicate that the structural context of the NLS is important for nuclear entry of Trm1-II. Changes of Trm1-II conformation might prevent nuclear import of Trm1-II and result in relocating proteins to the mitochondria as an alternative. In addition, Dr. Murthi showed that Trm1-II-GFP has
60 mitochondrial location by altering the Ran pathway. The data further support the model that distribution of Trm1-II between mitochondria and the nucleus results from the competition between nuclear and mitochondrial targeting information.
3.4.2 Targeting of peripheral proteins to the INM
Dr. Murthi demonstrated that delivery of Trm1-II from the cytoplasm to the nucleoplasm is via the Ran-dependent nuclear import pathway (Lai et al., 2009). I further studied the consequence of the distribution and structure of the NPCs in distribution of Trm1-II to the INM. The NPCs serve as the gateways for transporting marcomolecules regulated by Ran-dependent pathway between the nucleus and the cytoplasm. My studies show that the distribution of NPCs does not affect Trm1-II-
GFP INM association. In the majority of nup133Δ cells, which cause NPCs to cluster into a subportion of the NE, Trm1-II-GFP is able to associate uniformly with the INM.
I also found that Trm1-II-GFP INM distribution is unaffected by using deletion of specific Nups to alter the composition of substructures (inner ring, outer ring, transmembrane and FG Nups) of the NPC. The data indicate that defects in NPC components do not affect Trm1-II association with the INM.
In my studies to identify cis-acting elements important for Trm1-II INM targeting,
I narrowed down the INM targeting motif of Trm1 to amino acids 130-151 and demonstrated that it is necessary and sufficient for targeting Trm1-II to the INM. No such motifs have been previously described for peripheral INM proteins, although studies of a mutant version of LAP2, an integral INM protein, missing its
61 transmembrane domain showed that a 76 amino acid region of this mutant protein is required to bind to lamin in order to stably associate with the INM (Furukawa et al., 1998). Although Trm1 INM targeting motif fails to direct Pus1-GFP (a nucleoplasm protein) to the INM, the reporter proteins, NLS-β-galactosidase and
NLS-Trm7-GFP, fused with this motif, are able to locate to the INM. Therefore, Trm1 amino acid 130-151 region is the INM targeting motif of peripheral INM proteins that have not been defined before.
Trm1 contains four ADEPT regions by comparing archaeal and eukaryotic Trm1 proteins (Stanford et al., 2000). Trm1 contains the mitochondrial targeting information [amino acid 1-48 (Ellis et al., 1989)] and an efficient NLS [amino acids
95-102(Rose et al., 1992)] in two of four ADEPTs (Stanford et al., 2000). It is possible that ADEPTs are also important for Trm1-II INM location. Here, I found that
Trm1 amino acids 130-151, which are conserved in archaeal and all eukaryotic
Trm1 proteins, contain information for Trm1-II INM targeting. Although the ADEPT hypothesis is useful for locating sequences important for subcellular distribution for several proteins (Stanford et al., 2000), it failed to correctly predict the candidate sequence that facilitates association of Trm1-II with the INM.
The fusion protein, NLS-Trm1(130-151)-β-galactosidase is evenly distributed throughout the INM, while the fusion protein NLS-Trm1(130-151)-Trm7-GFP distributes to few spots on the INM. Proteomic studies in yeast reported that there is Trm1-Trm1 self-interaction (Krogan et al., 2004), and that β-galactosidase self- polymerizes (Aguilar et al., 1997; Jacobson et al., 1994; Rojas et al., 2004). A possible
62 explanation is that the INM motif directs proteins to a particular subdomain of the
INM and that distribution throughout the INM requires an unknown step, presumably via Trm1-Trm1 interaction. A possible model for Trm1-II INM targeting is: (1) translation on free polysomes; (2) transported through the NPC into the nucleus by the Ran-dependent pathway; (3) Trm1-II is directed to the INM by INM targeting motif; (4) evenly distribute Trm1-II to the INM by unknown mechanism, presumably Trm1-II and Trm1-II interaction.
3.4.3 Characterizing a peptide motif for the targeting of Trm1-II to the INM
Using random mutagenesis and site-directed mutagenesis screenings, J. Profato and I attempted to characterize the INM targeting motif in Trm1-II. We failed to identify an amino acid consensus sequence, such as the NLS containing a ~5 amino acid long basic region to promote a protein’s import into the nucleus. Instead, we found that the properties of the amino acids 130-151, such as size, hydrophobicity, and charge, are important for Trm1-II INM targeting. Moreover, Trm1 amino acids
145-153 are located in a highly conserved region between archaea and yeast
(Stanford et al., 2000). The structure of archaeal Trm1 (Ihsanawati et al., 2008) showed that this region contains an amphipathic α-helix. We plotted our amino acid alteration data into the helical wheel projection, we found that the same mutations predicted to change the amphipathic nature of the helix also cause Trm1-II-GFP to mislocalize from the INM to the nucleoplasm. Therefore, the INM motif for Trm1-II
63 INM targeting may be a structure specific motif, similar to the MTS comprised of an amphipathic α-helix that target proteins to the mitochondria.
64
Figure 3.1 The Ran dependent nuclear pathway is important for location of
Trm1-II-GFP to the INM
Live cell imaging of the location of Trm1-II-GFP in rna1-1 cells. The cells in (A) were induced by the addition of galactose and then immediately incubated at the nonpermissive temperature (37°C) for 1 h. Cells in (B) were induced by the addition of galactose for 1 h at permissive temperature (23°C) following by the shifting the cells to the nonpermissive temperature (37°C). (A’) and (B’) are overlays of (A) and
(B), respectively, with DAPI staining. Bar = 5 μm.
65
Figure 3.1 The Ran dependent nuclear pathway is important for location of
Trm1-II-GFP to the INM
66
Figure 3.2 Distributions of Trm1-II-GFP and Nup49-mCherry in wild-type and nup133Δ cells
Left: distributions of Trm1-II-GFP and constitutive expressed Nup49-mCherry in wild-type cells. Trm1-II-GFP is located at the nuclear periphery (top row), as is
Nup49-mCherry (middle row). Bottom row is the overlay of the GFP and mCherry signals. Right: locations of Trm1-II-GFP and Nup49-mCherry in nup133Δ cells.
Trm1-II-GFP is distributed throughout the nuclear periphery that is identical to its distribution in wild-type cells in the majority of nup133Δ cells. As expected, Nup49- mCherry is aberrantly distributed to one or two foci on the nuclear envelop (middle row). Bottom row is the overlay of the GFP and mCherry signals. Bar = 5 μm.
67
Figure 3.2 Distributions of Trm1-II-GFP and Nup49-mCherry in wild-type and nup133Δ cells
68
Figure 3.3 Location of Trm1-II-GFP and Nup49-mCherry in wild-type strain and in the indicated nucleoporin knockout strains
1) Wild-type; 2) nup2Δ; 3) nup53Δ; 4) nup100Δ; 5) pom152Δ; 6) nup188Δ strains were co-transformed with plasmids expressing Trm1-II-GFP and Nup49-mCherry.
Top rows: Trm1-II-GFP distribution in live cells. Middle rows: the location of Nup49- mCherry as the indication for the NE. Bottom rows: merged images of GFP and mCherry. Bar = 5 μm.
69
Figure 3.3 Location of Trm1-II-GFP and Nup49-mCherry in wild-type
strain and in the indicated nucleoporin knockout strains
70
Figure 3.4 Trm1 amino acids 73-151 do not direct Pus1-GFP to the INM
Fluorescence images in the wild-type cells producing Nup49-mCherry and: 1) GFP;
2) Pus1-GFP; 3) Pus1-(73-151)-GFP. Pus1-GFP is in the nucleoplasm in the absence of Trm1 amino acids 73-151. Unexpectively, insertion of Trm1 amino acids 73-151 between Pus1 and GFP does not redistribute Pus1 to the INM. Top row: GFP fusion proteins; middle row: Nup49-mCherry; bottom row: overlay of GFP and mCherry signals. Bar = 5 μm.
71
Figure 3.4 Trm1 amino acids 73-151 do not direct Pus1-GFP to the INM.
72
Figure 3.5 The fusion protein NLS-Trm1(73-151)-Trm7-GFP is delivered to the
INM rather than the ONM.
Trm1 amino acids 73–151 with Trm7 are fused between amino acids 1–67 from histone H2B at the amino terminus and two tandem GFPs at the carboxyl terminus to generate NLS-Trm1(73-151)-Trm7-GFP. This fusion protein is delivered to a subregion of the nuclear envelop depended upon the Ran-dependent nuclear import pathway. Wild-type and rna1-1 mutant cells contain vectors encoding constitutively expressed Nup49-mCherry and galactose-inducible NLS-Trm1(73–151)-Trm7-GFP.
Location of proteins was determined in live cells after 1 h induction at permissive
(23°C) or nonpermissive (37°C) temperatures by galactose induction. Bar = 5 μm.
73
Figure 3.5 The fusion protein NLS-Trm1(73-151)-Trm7-GFP is delivered to the
INM rather than the ONM.
74
Figure 3.6 Subcellular location of Trm1-II-GFP with various deletions in Trm1 amino acid 73-151 region
Top rows: the locations of Trm1-II-GFP and different deletions in live cells. Middle rows: the locations of mitochondria as shown by Tom20-mCherry. Bottom rows: overlay of GFP and mCherry. A) wild-type Trm1-II-GFP; B) deletion of amino acids
72–93; C) deletion of amino acids 101–151; D) deletion of amino acids 72–151; and
E) deletion of amino acids 72–151 in a construct containing an additional NLS located at the end of the Trm1 coding sequence before the GFP. Bar = 5 μm.
75
Figure 3.6 Subcellular location of Trm1-II-GFP with various deletions in Trm1 amino acid 73-151 region
76
Figure 3.7 Mutations that do or do not alter Trm1-II INM location
A) Diagram of the mutations analyzed. Green box indicates the area of Trm1 in only eukaryotic but not archaeal counterparts; magenta box indicates sequences highly conserved in all Trm1 proteins. The region that includes the green and magenta boxes defines Trm1 amino acid 89-151 region subjected to mutagenesis. Mutations that alter the location of Trm1-II-GFP are shown in colors above the wild-type sequence and those that do not alter the location are shown below. Orange and blue amino acids represent a triple and a double alteration, respectively, which affect
Trm1-II-GFP INM location. Magenta and green single amino acid changes above the sequence were generated by site-directed mutagenesis, while the brown alteration was generated by mutagenesis PCR. Black amino acid changes below the sequence were generated by error-prone PCR; cyan changes below the sequence were generated by site-directed mutagenesis. B) Sample data for random and site- directed mutations: 1) wild-type Trm1-II-GFP; 2) Trm1-II-GFP containing a triple mutation is mislocated to the nucleoplasm; 3) mutation of A147 to D eliminates
Trm1-II-GFP association with the INM; 4) mutation of a highly conserved amino acid
(R149 to A) does not affect Trm1-II-GFP subnuclear location; 5) mutation of A151 to
D causes mislocation of Trm1-II-GFP to the nucleoplasm. 1, 2, 3, 4, 5: location of GFP signal; 1′, 2′, 3′, 4′, 5′: DAPI staining of DNA; 1″, 2″, 3″, 4″, 5″: overlay of GFP and
DAPI signals. Bar = 5 μm.
77
Figure 3.7 Mutations that do or do not alter Trm1-II INM location
78
2 Figure 3.8 m 2G metyltransferase activity of wild-type Trm1 and mutant versions with single amino acid substitutions
A trm1Δ strain contained plasmids encoding either wild-type (pGP54a-TRM1-II-
GFP) or mutant versions generated by random or site-directed mutagenesis. After 2 h galactose induction, extracts were generated and the assay conducted as described in the methods. Activities were measured at 0, 45, and 90 min and the assays were repeated twice. Note that all mutations of the Trm1 region 133–151 destroy activity whether the mutations have no affect on INM location (R149A) or whether they cause Trm1 to fail to locate to the INM (I136S, R146A, A147D, A151D).
79
Trm1-II
600000
500000
400000
300000 0 min 45 min 200000 90 min enzymeactivity 100000
0 vector Trm1-II I134K I136S R146A A147D R149A A151D -100000 S141Q A142T 2 sample Figure 3.8 m 2G metyltransferase activity of wild-type Trm1 and mutant versions with single amino acid substitutions
80
Figure 3.9 Deletion analyses to map region of Trm1 required for INM location
Live cell images of seven mutant constructs missing the Trm1-II-GFP amino acids as indicated. Top row: location of Trm1-II-GFP mutant proteins; middle row: the same cells showing DAPI staining of DNA; bottom row; overlay of cells in the top and middle rows. Bar = 5 μm.
81
Figure 3.9 Deletion analyses to map region of Trm1 required for INM location
82
Figure 3.10 Fine mapping of the Trm1 region sufficient to target NLS-β- galactosidase and NLS-Trm7- GFP to the INM
A) Trm1 amino acids 89–151 (1), 122–151 (2), 126–151 (3), and 130–151 (4) were inserted in between the NLS and β-galactosidase to be constitutive expressed in yeast and the location was determined by indirect immunofluorescence. Top: Cy3 β- galactosidase staining; bottom: overlay of Cy3 and DAPI staining. Bar = 5 μm. B)
NLS-Trm7-GFP location in live cells. Cells were transformed with plasmids to constitutive express Nup49-mCherry and various versions of NLS-Trm7-GFP. NLS-
Trm7-GFP (1) is nucleoplasmic in the absence of Trm1 amino acids. Insertions of
Trm1 amino acids 89–151 (2), 126–151 (3), and 130–151 (4) between NLS and
Trm7-GFP redistribute Trm7 from the nucleoplasm to a sub-region of the nuclear periphery. Top row: Trm7-GFP, middle row: Nup49-mCherry; bottom row, merged images of GFP and mCherry signals. Bar = 5 μm.
83
Figure 3.10 Fine mapping of the Trm1 region sufficient to target β- galactosidase and NLS-Trm7-GFP to the INM
84
Figure 3.11 Mutations containing changes of amino acids at Trm1 amino acid
126-151 region that do or do not alter Trm1 INM localization
A diagram of the mutations analyzed. Green box indicates the area of Trm1 in eukaryotic but not archaeal counterparts; Magenta box indicates sequences highly conserved in all Trm1 proteins. Trm1 amino acids 126-151 are highlighted in bold.
The underlined region indicates the amino acids that make up the amphipathic α- helix. Mutations that alter the location of Trm1-II-GFP are shown above the wild- type sequence with different colors (color coordinated mutant Trm1-II-GFP that hold single or multiple amino acid mutations), and those that do not alter the location are shown below.
85
Figure 3.11 Mutations containing changes of amino acids at Trm1 amino acid 126-151 region that do or do not alter Trm1 INM localization
86
Figure 3.12 The helical wheel projection for Trm1 amino acids 145-153
The Helical wheel demonstrated the amphipathic property of the helix. The right side of the helix is composed of charged residues and the left side is composed of hydrophobic or hydrophilic residues. The output presents the hydrophilic residues as circles, hydrophobic residues as diamonds, potentially negatively charged as triangles, and potentially positively charged as pentagons. Hydrophobicity is color coded as well: the most hydrophobic residue is green, and the amount of green is decreasing proportionally to the hydrophobicity, with zero hydrophobicity coded as yellow. The potentially charged residues are light blue. Some amino acid changes within the helix that cause Trm1 to mislocalize to the nucleoplasm are indicated.
87
Figure 3.12 The helical wheel projection for Trm1 amino acids 145-153
88
Chapter 4
Identification of trans-acting elements functioning in the Trm1-II INM targeting mechanism: achieving and maintaining a peripheral INM location
4.1 Introduction
In eukaryotic cells, correct subcellular localization is essential for proteins to perform their normal function (Butler and Overall, 2009; Hung and Link, 2011). To achieve their locations and to participate in biological pathways, such as signaling networks, metabolism and structural maintenance, proteins associate with their interacting partners via signal sequences and/or post-translational modifications
(Schmidt et al., 2010; Suntharalingam and Wente, 2003; Terry et al., 2007; Wickner and Schekman, 2005; Wolf et al., 2010). Significantly, inappropriate subcellular localization of proteins has been linked to many human diseases, such as cardiovascular diseases, neurodegenerative diseases, and various types of cancer
(Hung and Link, 2011).
The INM contains a subset of integral and peripheral membrane proteins which function in DNA replication, chromatin organization, regulation of nuclear/cytoplasm exchange, and cell differentiation as well as maintenance of
89 nuclear structure and shape (Heessen and Fornerod, 2007; Parnaik, 2008). Studies in yeast and higher eukaryotes have shown that integral INM proteins, which directly associate with the INM via transmembrane domains, interact with chromatin, nuclear lamina, and/or ONM proteins to maintain their functions and to locate at the INM (Chi et al., 2007; Chikashige et al., 2006; Crisp et al., 2006; Ding et al., 2007; Fridkin et al., 2004; Haque et al., 2006; Hasan et al., 2006; King et al., 2008;
Lee et al., 2002; Mansharamani and Wilson, 2005; Oza et al., 2009; Sakaki et al.,
2001; Worman et al., 1988). For example, integral INM proteins, SUN proteins, conserved between higher eukaryotic cells and yeast, interact with KASH proteins in perinuclear space and associate with lamins and/or chromatin at the INM to maintain the structure of the nucleus and regulate gene expression (see detail in chapter one).
By contrast, there are few studies which address the interaction between peripheral INM proteins and their binding partner(s). The best characterized peripheral INM proteins are lamins. Lamins are post-transltionally modified by farnesylation (Rusinol and Sinensky, 2006) and they polymerize to form intermediate filaments which associate with the INM (Wilson and Foisner, 2010).
These perinuclear lamin filaments interact with lamin-binding proteins, which are integral INM proteins; they also interact with chromatin at the INM and thereby serve as “scaffolds” for lamin-binding proteins and complexes to function in the nucleus (Schirmer and Foisner, 2007; Wilson and Foisner, 2010). Nuclear import of lamin A is dependent on the RanGTP gradient similar to other soluble proteins that
90 are transported from the cytoplasm to the nucleoplasm. Once in the nucleoplasm, lamins are able to associate with the INM (Goldman et al., 1992; Loewinger and
McKeon, 1988). Thus, it is possible that other peripheral INM proteins reach the
INM by the same pathway used by lamins (Burns and Wente, 2012). Alternatively, peripheral INM proteins might interact with integral INM proteins, which are synthesized and anchored at the ER and then be co-transported with such integral
INM binding partners to the nuclear periphery via an integral INM protein pathway type mechanism.
In addition to protein-protein interactions, protein-lipid interactions may be important for targeting/tethering proteins to the INM. Lipid composition, which affects many aspects of nuclear function, including growth, signaling, and transport, is crucial for nuclear shape and NE integrity (Siniossoglou, 2009). Membrane- binding proteins contain specific secondary structures, such as amphipathic α- helixes, to facilitate their association with membrane lipids. Previous studies proposed that the amphipathic α-helix-containing Nups (Nup133, Nup120, Nup85,
Nup170, and Nup188) may associate with lipids to anchor to the nuclear membrane
(Alber et al., 2007b; Doucet and Hetzer, 2010; Drin and Antonny, 2010; Drin et al.,
2007). In yeast, it has been recently reported that Nbp1, a spindle pole body component, achieves INM localization via interaction between an N-terminal amphipathic α-helix of Nbp1 and lipids on the INM (Kupke et al., 2011). Therefore, peripheral INM proteins may achieve their INM location by interacting with nuclear membrane lipids.
91 In order to study INM targeting mechanism for peripheral membrane protein,
Trm1-II, I investigated whether Trm1-II contains any cis-acting elements that affect
Trm1-II INM location. I identified that Trm1 amino acids 130-151 contain the information for Trm1-II INM targeting. In addition, I determined that this short peptide motif is not only necessary for Trm1-II INM association, but it is also sufficient to direct reporter proteins to the INM (Lai et al., 2009). Moreover, using an amino acid sequence alignment and structure comparison with archaeal Trm1 J.
Profato and I identified a potential amphipathic α-helix that resides in the carboxyl terminus of Trm1 amino acids 130-151. However, characterization of the nature of the cis-acting elements reveals only part of the mechanism. Identifying and defining the trans-acting factor(s) that interact directly with Trm1-II are required to understand how peripheral membrane proteins achieve and maintain peripheral
INM interaction.
As mentioned in chapter one, a genome-wide screen of unessential genes was conducted to uncover trans-acting gene products that influence in the Trm1-II INM targeting (Murthi and Hopper, 2005). The studies revealed that Nat C N-terminal acetyltransferase complex, which contains Mak3, Mak10 and Mak31 as subunits, and Ice2, an integral membrane ER protein, are required for Trm1-II INM targeting.
These results indicate that Trm1-II N-acetylation may play a role for its INM location. However, Murthi and Hopper (2005) did not uncover binding partner(s) that associate with Trm1-II that are important for Trm1-II targeting to the INM by this genome-wide screen. It is possible that the Trm1-II binding partner(s) is an
92 essential protein not represented in the deletion collection or that Trm1-II interacts with multiple proteins to target to the INM. The second possibility may not have been detected if the proteins function in parallel such that deletion of one could not have a large effect upon Trm1-II localization.
The goal of the studies in chapter four was to employ biochemical approaches to identify Trm1-II binding partner(s) in order to gain an understanding of the INM targeting mechanism. Based of the results from Lai et al. (2009) and Murthi and
Hopper (2005) studies, I took advantages of two different types of mutations that affect Trm1-II INM localization: a non-functional INM motif Trm1-II mutation
[A147D (Lai et al., 2009)] and the mak3Δ mutation that causes Trm1-II to be mislocalized to the nucleoplasm. The idea was to compare the interactions of wild- type Trm1-II to the Trm1-II mutant and Trm1-II in the mutant strain in which
Trm1-II is not located at the INM to identify Trm1-II interacting partner(s) that are important for INM location. To identify potential Trm1-II interacting proteins, I conducted affinity purification (AP) studies of Trm1-II. By comparing Trm1-II co- purifying proteins from normal Trm1-II to mutations that mislocalize Trm1-II to the nucleoplasm, I attempted to identify candidate INM protein binding partner(s) that specifically contribute to the association of Trm1-II with the INM.
To identify potential lipid interactions contributing to the association of Trm1-II with the INM, I also performed in vitro lipid binding assays. Using lipid-protein overlay assays, I observed that Trm1-II interacts with several lipids, suggesting that lipid interactions may facilitate Trm1-II association with the INM.
93 4.2 Materials and methods
4.2.1 Plasmid constructions and DNA
All constructs described in chapter four were sequenced by Plant Microbe
Genetics Facility in The Ohio State University to confirm DNA sequences. All constructs were generated using standard molecular techniques described in chapter two for the plasmid construction. A summary of each construct is presented in Table 4.1.
Since I attempted to identify the nuclear binding partners of Trm1-II, I took two different approaches to minimize the contribution of mitochondrial interactions to the complexes obtained by AP of Trm1-II. First, as Trm1 is known to self-interact from large-scale proteomics studies (Krogan et al., 2004), I used trm1Δ cells to further reduce potential mitochondrial interactions that could occur by Trm1-II interacting with Trm1-I at the mitochondria. Second, I utilized Trm1-II constructs that have the first ATG mutated so that only Trm1-II is expressed (see below).
To conduct affinity purification and immunoprecipitation of Trm1-II and the
Trm1-II mutant from trm1Δ cells and Trm1-II from mak3Δtrm1Δ cells, I fused several different affinity tags with wild-type and mutations of Trm1-II. To generate
Trm1-II-GFP expressed under the control of endogenous promoter, I amplified
TRM1 promoter sequence and ORF by PCR changing the first ATG to ATC. I changed the first ATG so that the constructs encoded only Trm1-II, rather than both Trm1-I and Trm1-II. The PCR products were digested with SacI and HindIII and then ligated into a SacI and HindIII digested plasmid that contains a GFP and TRM1 terminator
94 sequence to generate pTPL7. The DNA fragment obtained from SacI and NaeI digestion of pTPL7 contains TRM1 promoter sequence, the ORF for Trm1-II fused in- frame with GFP, and the TRM1 terminator sequence; it was ligated into SacI and
NaeI digested pRS415 to generate pTPL10. To generate a construct that encodes
GFP fused Protein A ZZ domain (GFP-ZZ) under control of a galactose inducible promoter to serve as the negative control for affinity purification, the GFP sequence and the sequence of Protein A ZZ domain (ZZ) were amplified by PCR. The amplified fragments of GFP and ZZ were digested with HindIII and XhoI, respectively. Two digested fragments were treated with polynucleotide kinase and then ligated to pGP54a that was previously digested with HindIII and XhoI to generate pTPL11. The
PCR products of the ORF for Trm1-II and mutated Trm1-II(A147D) were digested with EcoRI and HindIII, and then ligated to pTPL11 that was digested with EcoRI and
HindIII to generate pTPL12 and pTPL13, respectively. Plasmids pTPL12 and pTPL13 encode galactose-inducible Trm1-II-GFP-ZZ and Trm1-II(A147D)-GFP-ZZ. The plasmid pTPL23, which encodes Trm1-II-ZZ under control of TRM1 regulatory sequence, is derived from pTPL7 with a replacement of GFP with the ZZ domain sequence between HindIII and XhoI sites. The plasmid pTPL24 was obtained by replacing the GAL1-10 promoter of pTPL11 for the ARG3 promoter sequence, which was a gift from Dr. H.-Y. Chu. The ARG3 promoter sequence was inserted into pTPL11 that was previously digested with SacI and XmaI sites. pTPL24 encodes
GFP-ZZ under the control of the ARG3 promoter.
95 Tandem affinity purifications were conducted to obtain Trm1-II-GFP, mutated
Trm1-II-GFP and Trm1-II-GFP from mak3Δ cells that were employed for protein- lipid overlay assays. A GFP-3Cprotease site-ZZ tag was generated by PCR to amplify GFP and 3C-ZZ fragments. The amplified GFP and 3C-ZZ fragments were then digested with HindIII and XhoI, respectively. Two digested fragments were treated with polynucleotide kinase and ligated into HindIII and XhoI digested pTPL7 to generate pTPL26. The plasmid pTPL26 encodes Trm1-II-GFP-3C-ZZ under the control of the
TRM1 promoter. To express the negative control for tandem purification and protein-lipid overlay assays, GFP-3C-ZZ was expressed from the plasmid pTPL29 under control of the ARG3 promoter in wild-type cells. The ARG3 promoter sequence was amplified by PCR and then digested with SacI and XmaI (a gift from Dr. H.-Y.
Chu). This digested fragment was then cloned into pRS416 to generate an intermediate plasmid. The DNA fragment of GFP-3C-ZZ from pTPL26 was then cloned into this intermediate plasmid between HindIII and XhoI sites to generate pTPL29. Two plasmids pTPL34 and pTPL35 encoding galactose inducible Trm1-II-
GFP-3C-ZZ and Trm1-II (A147D)-GFP-3C-ZZ were derived from pTPL 29. The DNA fragment that contains GAL1-10 promoter with ORF for Trm1-II (from pTPL12) or mutated Trm1-II(A147D) (from pTPL13) was ligated into the SacI and HindIII digested pTPL29 to form pTPL34 and pTPL35, respectively. To obtain the positive control for protein-lipid overlay assays, Kes1, a sterol-binding protein (Mousley et al., 2012; Rogaski et al., 2010; Stefan et al., 2011), was tagged with GFP-3C-ZZ and expressed from the plasmid pTPL44 in wild-type cells. The plasmid pTPL44 encodes
96 Kes1-GFP-3C-ZZ under the control of the GAL1-10 promoter. The PCR products of
KES1 sequence were ligated into pGEM-T vector to form pGEM-T/Kes1. pGEM-
T/Kes1 was digested with XmaI and HindIII sites, and then the linear KES1 fragment was cloned into a plasmid which contain the GAL1-10 promoter and GFP-3C-ZZ tag to generate pTPL44.
2 4.2.2 m 2G methyltransferase activity assay
The assay followed the procedures in chapter two. trm1Δ cells were transformed with pRS416 as a control or pTPL23 plasmid encoding Trm1-II-ZZ. mak3Δtrm1Δ cells were transformed with pTPL23.
4.2.3 Affinity Protein A-ZZ purification
The protocol for the purification of ZZ domain containing complexes was modified from Alber et al. (2007a). In brief, 2 g (GFP-ZZ control, and Trm1-II-GFP-ZZ in trm1Δ strain), 4g (Trm1-II-GFP-ZZ in mak3Δtrm1Δ strain), 1 g (galactose inducible GFP-ZZ control, and Trm1-II-GFP-ZZ in trm1Δ strain), or 2.5 g (galactose inducible Trm1-II(A147D)-GFP-ZZ in trm1Δ strain) frozen and ground cell powder were thawed into various extraction buffer (Table 4.2) with 1:100 of protease inhibitor cocktail (Calbiochem) and 1:100 of solution P (9 ml per gram cell powder).
Different amounts of frozen cell powder had to be used in order to recover comparable quantities of ZZ domain-containing proteins (the expression level of each ZZ domain-containing protein is determined by Western blot analysis, Figure
97 4.1 as an example). Each mixture was vortexed for 30 sec 2-4 times till the cell powder dissolved completely in the extraction buffer. Cell lysates were clarified by centrifugation at 2000 xg, at 4°C for 20 min. The clarified lysates were then incubated with IgG-conjugated magnetic beads (50 µl IgG beads for 1 g of cells)
(washed with extraction buffer 3 times before used) with gentle rotation at 4°C for 1 hr. The magnetic beads were then collected with a magnet, washed 5 times with 1 ml of the specified wash buffer (Table 4.2) at 4°C and once with 1ml of 0.1M
NH4OAc, 0.1mM MgCl2, 0.02% Tween-20 at room temperature (RT) for 5 min.
Subsequently, the proteins were eluted with 700 µl of 0.5M NH4OH, 0.5mM EDTA by rotation at RT for 20 min. The eluant was lyophilized for overnight, resuspended in
1X LDS sample buffer (Invitrogen), supplemented with 50mM DTT, separated on
10% Bis-Tris gels, and visualized after staining with SypoRuby (Invitrogen) or
Coomassie blue (Bio-Rad).
For the preparation of purified GFP, Kes1-GFP, Trm1-II-GFP, Trm1-II(A147D)-
GFP or Trm1-II-GFP from mak3Δ cells used in the protein-lipid overlay assay, the ground cell powder of each sample (2 g for GFP-3C-ZZ control in BY4741, 3 g for
Trm1-II-GFP-3C-ZZ in trm1Δ strain, 6 g for Trm1-II-GFP-3C-ZZ in mak3Δtrm1Δ strain, 2 g for Kes1-GFP-3C-ZZ in BY4741, 2 g for galactose inducible
Trm1-II-GFP-3C-ZZ in trm1Δ strain, and 6 g for galactose inducible Trm1-II(A147D)-
GFP-3C-ZZ in trm1Δ strain) was resuspended in extraction buffer (9ml per gram of cell powder) [20mM K/HEPES pH 7.4, 110mM KOAC, 2mM MgCl2, 150mM NaCl, 1%
Triton X-100, 0.1% NP-40, 1:100 of protease inhibitor cocktail (Calbiochem) and
98 1:100 of solution P] to obtain similar amounts of GFP-3C-ZZ tagged proteins. The mixtures were then homogenized and clarified as described for affinity purification of ZZ-containing proteins. Clarified cell lysates were incubated with 500 µl IgG sepharose beads (GE Healthcare Life Sciences), pre-washed with extraction buffer 3 times at 4°C for 1 hr with rotation. The IgG-sepharose beads were collected by centrifugation for 1100 xg, 1 min at 4°C, followed by washing 2 times with extraction buffer and then 4 times with 3C cleavage buffer (10mM Tris-Cl, pH 8.0,
150mM NaCl, 0.5mM EDTA, 1mM DTT, 0.1% Tween 20) at 4°C before performing
Protease 3C cleavage. IgG-sepharose beads were then added 600 µl of 3C cleavage buffer and 10 µl (65 µg) of GST-3C protease (a gift from Dr. E. Phizicky) (Gelperin et al., 2005) and incubated at 4°C for overnight on a gently rotated rotor to release
GFP-3C-ZZ tagged proteins form IgG-sepharose beads. After cleavage, 400 µl
Glutathione-sepharose beads (GE Healthcare Life Sciences)(pre-washed with 3C cleavage buffer 3 times) were added into each IgG sepharose-3C protease reaction and incubated with mixing at 4°C for 1hr to remove GST-3C protease from the supernatant. The mixture was centrifuged at 4°C, 1100 xg for 1 min and the supernatant was saved. The sepharose beads were washed with 1 ml 3C cleavage buffer for 4 more times and the supernatant, from each washing procedure was saved. This procedure generated ~5 ml of supernatant of each sample. Each supernatant was clarified by passage through a syringe filter [(Millipore) 0.22 μm cellulose acetate] followed by an additional wash of the syringe filter with 2 ml of 3C cleavage buffer. The resulting ~7 ml samples of proteins were then added to the
99 Amicon Ultra-15 Centrifugal Filter Unit (Millipore) to concentrate the purified proteins by centrifugation at 4°C, 5000 xg until the volume of purified proteins were
~500 µl. Once the proteins were concentrated, 5 ml storage buffer (20 mM K-
HEPES, pH 7.5, 200 mM NaCl, 2 mM DTT, 50% glycerol) was added to the filter unit to exchange buffer in the protein solution and then centrifuged at 4°C, 5000 xg until the volume of the protein solution were concentrated to ~500 to 1000 µl. The buffer exchange procedure was then repeated again to result ~500 to 1000 µl of the protein solution and stored at -20 °C.
4.2.4 Coimmunoprecipitation and immunoblot
0.25g (GFP-ZZ control, and Trm1-II-ZZ in trm1Δ strain), 0.5g (Trm1-II-ZZ in mak3Δtrm1Δ strain), 0.125g (galactose inducible GFP-ZZ control, and Trm1-II-ZZ in trm1Δ strain), or 0.25g (galactose inducible mutated Trm1-II-ZZ) were thawed into extraction buffer [20mM K/HEPES pH 7.4, 110mM KOAC, 2mM MgCl2, 50mM NaCl,
1% Triton X-100, 0.1% NP-40, 1:100 of protease inhibitor cocktail (Calbiochem) and
1:100 of solution P] (9 ml extraction buffer for 1g cell powder) to extract comparable amounts of ZZ-tagged proteins. The ZZ-tagged protein-containing complexes were extracted by using the procedure for affinity Protein A-ZZ purification. Samples of each cell lysate and each purified complex were resolved on
Bis-Tris polyacrylamide gels and the resolved proteins were transferred onto PVDF membrane. Protein A-ZZ, GFP, Kar2, Htb2 and Nsp1 were detected by immunoblotting using antibodies against with Protein A (Gallus Immunotech), GFP
100 (Roche), Kar2 (Santa Cruz Biotechnology), Htb2 (Abcam) and Nsp1 (EnCor
Biotechnology).
4.2.5 Protein-lipid overlay assays
Membrane lipid strips that contain a variety of lipids were purchased from
Echelon Biosciences. The strips were blocked in TBST buffer (20mM Tris-HCl pH
7.5, 150mM NaCl, and 0.1% Tween 20) with 3% fatty acid-free BSA (Sigma) at RT for 1 hr and then incubated with 0.5 µg/ml of GFP, Kes1-GFP, Trm1-II-GFP, Trm1-
II(A147D)-GFP or Trm1-II-GFP from mak3Δ cells at RT for 1 hr. Each strip was then washed with TBST for 3 times at RT for 5 min. Subsequently, bound proteins were detected using anti-GFP antibody [(Roche) 1:1000 dilution] in TBST with 3% fatty acid-free BSA (Sigma).
4.3 Results
4.3.1 Loss of N-terminal acetyltransferase C (Nat C) activity does not affect the enzyme activity of Trm1-II
Mutations of Trm1-II, which contain changes of amino acids in the Trm1 INM targeting motif (amino acids 130-151, which are highly conserved between archaeal and eukaryotic Trm1 proteins), not only cause Trm1-II to mislocalize to the nucleoplasm, but they also cause Trm1-II to loose its tRNA methyltransferase activity (Lai et al., 2009). Since this region is important for archaeal Trm1 to interact with tRNAs (Ihsanawati et al., 2008), and amino acid substitutions of proteins might
101 cause inappropriate folding of protein resulting in alterations of protein structure and function (Powers et al., 2009), it is not surprising that non-functional Trm1-II mutants lack tRNA methyltransferase activity.
Murthi and Hopper (2005) showed that subunits of the Nat C (Mak3, Mak10 and
Mak31) function in Trm1-II INM targeting and that N-acetylation of Trm1-II is necessary, but it is not sufficient, for Trm1-II INM targeting. As the effect of Trm1-II in Nat C depletion cells is the post-translational N-acetylation of Trm1-II rather than alterations of the composition of Trm1-II amino acids, N-acetylation may not affect
Trm1-II conformation. It is possible that Trm1-II mutants that contain non- functional INM targeting motif and non-N-acetylated Trm1-II (in Nat C depletion cells) may independently affect Trm1-II INM location. Therefore, I investigated the effect of the Nat C complex for expression and tRNA modification enzyme activity of
Trm1-II. Since Trm1-II extracted from E. coli, which does not contain Nat C complexes to modify proteins at their N termini, has tRNA methyltransferase activity (Ellis et al., 1986), it is likely that N-acetylation does not influence the methyltransferase activity of Trm1-II. To test this possibility, TRM1 was deleted in the mak3Δ strain to generate mak3Δtrm1Δ strain. The trm1Δ (contains Nat C activity) and mak3Δtrm1Δ (no Nat C activity) strains were transformed with either a plasmid encoding Trm1-II tagged with Protein A ZZ domain (Trm1-II-ZZ) or GFP-
ZZ at carboxyl terminus (Trm1-II-GFP-ZZ) under the control of TRM1 promoter. I confirmed that Trm1-II carrying the GFP-ZZ tag locates appropriately in trm1Δ and
102 mak3Δtrm1Δ cells. As expected, Trm1-II-GFP-ZZ locates to the INM in trm1Δ cells and Trm1-II-GFP-ZZ is nucleoplasmic in mak3Δtrm1Δ cells (data not shown).
N-acetylation protects proteins from degradation thereby stabilizing proteins
(Ciechanover and Ben-Saadon, 2004; Jornvall, 1975). It is possible that without N- acetylation Trm1-II may be unstable resulting in lower level of Trm1-II. To test this,
I performed the Western blot analysis using Trm1-II-ZZ-containing cell lysates from trm1Δ and mak3Δtrm1Δ cells. Indeed, I observed that a reduction of the Trm1-II-ZZ expression in mak3Δtrm1Δ cells by comparing to the level of expression of Trm1-II-
ZZ in trm1Δ cells (Figure 4.1). The results indicate that in mak3Δtrm1Δ cells Trm1-
II-ZZ has a lower level of expression compared with the expression level of Trm1-II-
ZZ in trm1Δ cells. The data support the hypothesis that N-acetylation influences
Trm1-II stability.
To test if mislocalized Trm1-II in mak3Δtrm1Δ cells maintains tRNA modification
2 activity, I performed the m 2G methyltransferase activity assay. After normalizing the expression levels of Trm1-II-ZZ in trm1Δ and mak3Δtrm1Δ cells, I observed that
Trm1-II-ZZ containing lysate from mak3Δtrm1Δ cells had slightly more methyltransferase activity than the Trm1-II-ZZ containing lysate from trm1Δ cells
(Figure 4.2). The data indicate that N-acetylation of Trm1-II is not necessary for the methyltransferase activity of Trm1-II. The results also suggest that Trm1 INM targeting motif and Nat C modification may have different roles for Trm1-II INM location.
103 4.3.2 Does Trm1-II interact with other proteins to associate with the INM?
The combined use of affinity purification (AP) and mass spectrometry (MS) has been known to be a powerful approach to reveal protein-protein interactions (Alber et al., 2007a; Arifuzzaman et al., 2006; Butland et al., 2005; Ewing et al., 2007; Gavin et al., 2006; Krogan et al., 2004; Liu et al., 2009). AP has proven particularly successful for the retrieval of protein complexes. One advantage to using this approach for yeast is that almost every yeast protein has been analyzed by MS to create a protein identification database (Database from SGD http://www.yeastgenome.org/). It is possible that Trm1-II associates with the INM via protein-protein interactions. Thus, to identify Trm1-II binding partner(s), I employed AP followed by MS analysis to identify the co-purifying protein(s).
Although no INM proteins have been reported to interact with Trm1 from large- scale proteomics studies (Krogan et al., 2006; Krogan et al., 2004), it is possible that the conditions and/or procedures for AP in these studies are not suitable to identify the interactions between Trm1-II and its interacting partner(s) at the INM.
Affinity tags provide a powerful approach to purify proteins for analytical and preparative purposes (Sawin et al., 2010). One of the most well known AP approach has been the tandem affinity purification (TAP). TAP involves in two successive APs and a cleavage step by specific protease via introducing a protease cleavage site between the tag and the protein of interest (Puig et al., 2001). Although TAP has been widely used to study protein-protein interaction (Gavin et al., 2002; Krogan et al., 2006; Krogan et al., 2004; Puig et al., 2001), it extends the purification time and
104 decreases purification efficiency (Gloeckner et al., 2007; Strambio-de-Castillia et al.,
2005). Protein A has a high affinity for IgG, but can be readily eluted using different conditions such as, high pH, low pH, or denaturants, making it an excellent AP tag for single-step AP (Aitchison et al., 1995; Alber et al., 2007a; Grandi et al., 1993;
Niepel et al., 2005; Stirling et al., 1992; Strambio-de-Castillia et al., 2005). The IgG binding domain of Protein A is the ZZ domain. Therefore, Trm1-II-ZZ or Trm1-II-
GFP-ZZ fusion proteins were generated to study Trm1-II-protein interactions by AP.
To attempt to reduce the non-specific interactions while maintaining putative protein-protein interactions, I conducted AP employing numerous extraction conditions (Table 4.2).
The first approach was to use IgG-Sepharose beads (GE Healthcare Life Sciences) to capture Trm1-II-ZZ or Trm1-II-GFP-ZZ interacting complexes. IgG-Sepharose beads are widely used and inexpensive for large-scale purification of ZZ tagged proteins and for the tandem affinity purification (TAP)(Puig et al., 2001). Since the extraction buffers with different salt contractions affect protein-protein interactions during AP procedures, I analyzed the effect of salt concentration for specificity of AP.
Using extraction buffers with different salt concentrations ranging from 25 mM to
100 mM of NaCl (Table 4.2 No. 1, 2 and 3) to perform AP by IgG-Sepharose beads, I was able to affinity purify Trm1-II-ZZ or Trm1-II-GFP-ZZ (in trm1Δ cells). However, the results show that many proteins co-purified with Trm1-II-ZZ or Trm1-II-GFP-ZZ
(in trm1Δ cells) were non-specific interactions because they also co-purified with the negative control, GFP-ZZ (in trm1Δ cells), by using different salt concentrations
105 for AP (Table 4.2 No. 1, 2 and 3 and Figure 4.3). Although the salt concentrations that I used for AP by commercial available and inexpensive IgG-Sepharose beads may not have been stringent enough to remove non-specific proteins, IgG–
Sepharose beads are based on agarose matrix that may cause non-specific binding of proteins and may not be suitable for single-step purification (Sawin et al., 2009; Dr.
M.P. Rout personal communication)
IgG-magnetic beads were selected to attempt the next AP. IgG-magnetic beads were effective for capturing the ZZ tagged protein complex via using single-step purification for the dynamic of the NPC (Alber et al., 2007a, b) as well as other protein-protein interactions (Dokudovskaya et al., 2011; Niepel et al., 2005;
Oeffinger et al., 2009). Therefore, I conjugated rabbit-IgG to the magnetic beads and then using extraction buffers with various salt concentrations to optimize the conditions for AP by IgG-magnetic beads. Since it was also possible that a Trm1-II interacting protein is an integral INM protein, I employed different detergents that could gently disrupt protein-membrane association. In addition, a recent study for dynamic of the NPC (Alber et al., 2007a) showed that different washing buffers for
AP affect the specificity of protein-protein interactions. Thus, I also employed different washing buffers to wash IgG-magnetic beads after binding with ZZ-tagged protein containing complexes. After testing many different salt concentrations
(Table 4.2 No. 6, 7, 9, 10 and 11), detergents (Table 4.2 No. 9, 12, 13 and 14) and washing buffers (Table 4.2 No 9, 14, 15 and 16), I found that using extraction buffer
M and washing buffer O (Table 4.2 No.16) is sufficient to remove most of the
106 proteins that co-purified with GFP-ZZ (in trm1Δ cells). Under these conditions, I could co-purify proteins with Trm1-II-GFP-ZZ (in trm1Δ cells) or Trm1-II-ZZ (in trm1Δ cells) (Table 4.2 and Figure 4.4A, B), although it is possible that some of specific proteins that interact with Trm1-II-GFP-ZZ (in trm1Δ cells) or Trm1-II-ZZ
(in trm1Δ cells) were lost by this procedure.
To compare the interactions of wild-type Trm1-II to the Trm1-II mutant and
Trm1-II in the mutant strain in which Trm1-II is not located at the INM to identify
Trm1-II interacting partner(s) that are important for INM location, purified protein samples were analyzed by MS. I color-coded the data of MS analysis for each purified protein sample. To identify candidates for Trm1-II to achieve its INM location, co-purifying proteins can be divided into seven groups as indicated in
Table 4.3 and 4.4. Proteins that co-purified with GFP-ZZ (in trm1Δ cells), Trm1-II-
GFP-ZZ (in trm1Δ cells) and Trm1-II(A147D)-GFP-ZZ (in trm1Δ cells) or Trm1-II-
GFP-ZZ in mak3Δtrm1Δ cells (color coded with orange), with GFP-ZZ (in trm1Δ cells) and Trm1-GFP-ZZ (in trm1Δ cells) (color coded with green), with GFP-ZZ (in trm1Δ cells) and Trm1-II(A147D)-GFP-ZZ (in trm1Δ cells) or Trm1-II-GFP-ZZ in mak3Δtrm1Δ cells (color coded with gray), and with GFP-ZZ (in trm1Δ cells) (color coded with cyan) were considered to be the non-specific binding proteins. Proteins identified with Trm1-II-GFP-ZZ (in trm1Δ cells) and Trm1-II(A147D)-GFP-ZZ (in trm1Δ cells) or Trm1-II-GFP-ZZ in mak3Δtrm1Δ cells (color coded with blue) might serve as Trm1-II interacting proteins in general but not for its INM location.
Candidates that co-purified with Trm1-II(A147D)-GFP-ZZ (in trm1Δ cells) or Trm1-
107 II-GFP-ZZ in mak3Δtrm1Δ cells (color coded with magenta) might be the proteins that associate with mislocalized Trm1-II in the nucleoplasm. I expected that proteins involved in targeting Trm1-II to the INM would co-purify exclusively with
Trm1-II-GFP-ZZ (in trm1Δ cells) (color coded with yellow), but not with GFP-ZZ (in trm1Δ cells) nor Trm1-II(A147D)-GFP-ZZ (in trm1Δ cells) or Trm1-II-GFP-ZZ in mak3Δtrm1Δ cells. Unexpectedly, I failed to identify any proteins that co-purified with Trm1-II-GFP-ZZ (in trm1Δ cells) had a known INM location [according to the protein information provided by SGD (http://www.yeastgenome.org/) and the yeast GFP-tagged protein database (Huh et al., 2003)]. Thus, no proteins likely to serve as potential Trm1-II binding partners for INM association were identified
(Table 4.3 and 4.4). Although it is possible that conditions for affinity purification for the ZZ tagged Trm1-II proteins are not suitable to co-purify Trm1-II INM binding partner(s), the data are consistent with the results of several large-scale proteomics studies that failed to identify any proteins that are known to locate at the INM that interact with Trm1 (Krogan et al., 2006; Krogan et al., 2004).
From the MS analysis data, Trm1-II-GFP-ZZ (in trm1Δ cells), Trm1-II(A147D)-
GFP-ZZ (in trm1Δ cells) and non N-acetylated Trm1-II-GFP-ZZ (in mak3Δtrm1Δ cells) were found to interact with mitochondrial pyruvate dehydrogenase complex proteins, such as Pdc1, Pdx1 and Lpd1 (Table 4.3 and 4.4). Since Trm1-II contains the mitochondrial targeting sequence at its N terminus (Ellis et al., 1989) and about
10% of Trm1-II is localized in the mitochondria (Rose et al., 1992), it is possible that
108 Trm1-II interacts with mitochondrial pyruvate dehydrogenase proteins to achieve its mitochondrial location.
Using AP combined with MS analysis, I did not identify candidate INM associated proteins that could interact with Trm1-II. However, it is possible that identified proteins from MS analysis that localize adjacent to the INM might play roles for
Trm1-II to achieve its INM location. From MS analysis, I found that Kar2 and Htb2 interact with wild-type Trm1-II and Trm1-II mutant [Trm1-II(A147D)](Table 4.4).
KAR2 is an essential gene in yeast. Kar2 is an ER protein that mediates protein folding and regulates unfolded protein response (Okamura et al., 2000; Romisch,
1999; Tokunaga et al., 1992). Since the NE is contiguous with the ER, Kar2 may locate at both the ER and nuclear membrane, and thereby serve as an interacting partner for ER and INM proteins in both locations. Htb2 is a histone protein required for chromatin assembly and chromosome function (Briggs et al., 2002;
Dover et al., 2002; Hwang et al., 2003; Kao et al., 2004; Martini et al., 2002; Robzyk et al., 2000; Yamashita et al., 2004). In higher eukaryotic cells, peripherally associated INM proteins, lamins, directly interact with histones (Mattout et al.,
2007; Taniura et al., 1995). It is possible that Trm1-II interacts with Htb2 at nuclear periphery to help Trm1-II achieve its INM location. To test whether Trm1-II interacts with Kar2 or Htb2, I performed coimmunoprecipitation (co-IP) experiments followed by the immunoblotting using Trm1-II-GFP-ZZ (in trm1Δ cells) and Trm1-II(A147D)-GFP-ZZ (in trm1Δ cells) as baits. Kar2 or Htb2 failed to co- purify with either Trm1-II-GFP-ZZ (in trm1Δ cells) or Trm1-II(A147D)-GFP-ZZ (in
109 trm1Δ cells) (Figure 4.5A and B). The results indicate that Kar2 and Htb2 are false- positive candidates identified from MS analyses.
Another protein of interest from the MS analysis is Nsp1 (Table 4.3 and 4.4).
Nsp1 is one of FG Nups in the NPC. Nsp1 locates in the central channel of the NPC to mediate nuclear import and export (Strambio-De-Castillia et al., 2010; Wente and
Rout, 2010). Although Nsp1 is not known to be an INM associated protein, it is possible that Nsp1 may facilitate Trm1-II to interact with its INM tether(s). To test the specificity of the Trm1-II-Nsp1 interaction, I used Trm1-II-ZZ (in trm1Δ cells),
Trm1-II(A147D)-ZZ (in trm1Δ cells) and non N-acetylated Trm1-II-ZZ (in mak3Δtrm1Δ cells) as baits to perform co-IP experiments followed by the immunoblotting. Interestingly, I observed that Nsp1 coimmunoprecipitated with all three baits (Figure 4.6A and B). Moreover, I observed that mutant Trm1-II(A147D)-
ZZ (in trm1Δ cells) appears to interact with Nsp1 more efficiently than wild-type
Trm1-II-ZZ (in trm1Δ cells) (Figure 4.6B). The results suggest that Trm1-II and
Trm1-II(A147D) may have different abilities to interact with Nsp1 during nuclear import. Reciprocal co-IP experiments are required to further confirm the interaction of Trm1-II-Nsp1. Since Nsp1 is essential for cell growth (Hurt, 1988), I re-generated a previously described temperature-sensitive (ts) nsp1 mutant [nsp1 ts-10A
(Nehrbass et al., 1990)], which contains several amino acid substitutions (E706P,
L707S, D738V, and K740I), by site-directed mutagenesis. Plasmids that encode
Trm1-II-GFP or Trm1-II(A147D)-GFP from a galactose-inducible promoter were transformed into the nsp1 ts-10A cells to determine the subcellular location of these
110 proteins by florescence microscopy. If Nsp1 is important for Trm1-II-GFP and/or
Trm1-II(A147D)-GFP nuclear import and their subcellular distributions, newly synthesized proteins should be cytoplasmic rather than nuclear when Nsp1 was rendered non-functional at non-permissive temperature. In nsp1 ts-10A cells shifted to the non-permissive temperature immediately after galactose induction, Trm1-II-
GFP distributes evenly around the NE similarly to its distribution at permissive temperature (Figure 4.7). In contrast, Trm1-II(A147D)-GFP forms “spots” in the cytoplasm, in addition to a nucleoplasmic pool at non-permissive temperature
(Figure 4.7). The data are consistent with the results that Trm1-II(A147D)-ZZ (in trm1Δ cells) has a stronger interaction with Nsp1 than Trm1-II-ZZ (in trm1Δ cells).
The results also indicate that Nsp1-mediated nuclear transport is more important for distribution of Trm1-II mutant containing non-functional INM targeting motif than for distribution of wild-type Trm1-II.
In higher eukaryotic cells, peripheral membrane proteins, lamins, form nuclear intermediate filaments by polymerization and associate with the INM (Dechat et al.,
2008; Wilson and Foisner, 2010). From yeast proteomics studies, Trm1 was reported to self-interact (Krogan et al., 2004). It is possible that Trm1-II forms dimers or even polymers while it associates with the INM. However, Trm1-II self- interaction was not previously confirmed by co-IP studies. To investigate this, I co- transformed two plasmids into trm1Δ strain to express Trm1-II-GFP from its own promoter and Trm1-II-ZZ from a GAL1-10 promoter. Using Trm1-II-ZZ as the bait to perform co-IP experiment, I identified that Trm1-II-GFP coimmunoprecipitated by
111 Trm1-II-ZZ (Figure 4.8). The results are consistent with published work (Krogan et al., 2004) showing Trm1 self-interaction. The data also support the hypothesis that
Trm1-II forms dimers or polymers to associate with the INM, such as lamins.
4.3.3 Trm1-II interacts with membrane lipids
Lipids are important for determining and maintaining nuclear membrane structure (Siniossoglou, 2009; van Meer et al., 2008). The ER membrane is the primary site of lipid biosynthesis and in yeast it contains many phospholipids
(Henry et al., 2012; Paltauf and Daum, 1992). Ice2, an integral ER membrane protein, is important for ER structure (Estrada de Martin et al., 2005) and it plays an important role in Trm1-II INM targeting (Murthi and Hopper, 2005). Thus, Trm1-II
INM association is possible via Trm1-II-lipid interaction. To determine if lipid- protein interaction(s) occur with Trm1-II INM, I employed the protein-lipid overlay assays. In order to test whether N-acetylation of Trm1-II is necessary for Trm1-II- lipid interaction, I studied Trm1-II-GFP-3C-ZZ proteins from the mak3Δtrm1Δ cells.
I also investigated whether the INM targeting motif is important for potential Trm1-
II-lipid associations by analyzing whether Trm1-II(A147D)-GFP-3C-ZZ isolated from the trm1Δ strain can interact with lipids. Using affinity purification followed by GST-
3C protease digestion, and contraction of proteins, I obtained purified Trm1-II-GFP
(in trm1Δ cells), non-N-acetylated Trm1-II-GFP (in mak3Δtrm1Δ cells), and Trm1-
II(A147D)-GFP (in trm1Δ cells) and subsequently carried out the protein-lipid overlay assays (Figure 4.9 A).
112 Membrane lipid strips onto which a variety of lipids were spotted were incubated with equal amounts of GFP (as a negative control), Kes1-GFP [a sterol- binding protein (Mousley et al., 2012; Rogaski et al., 2010; Stefan et al., 2011), as the positive control], or various Trm1-II-GFP proteins followed by immunoblotting using anti-GFP antibody. I observed that Trm1-II-GFP (in trm1Δ cells) proteins expressed from either a native or a galacotse-inducible promoter interact with similar lipid components (Figure 4.9B). The results indicate that Trm1-II interacts with phosphatidylserine (PS), Cardiolipin, phosphatidylinositol 4-phosphate
[PI(4)P], phosphatidylinositol 4,5-biphosphate [PI(4,5)P2] and phosphatidylinositol
3,4,5-biphosphate [PI(3,4,5)P3]. I did not observe significant changes of lipid binding efficiency in the protein-lipid overlay assay for nucleoplasmic Trm1-II-GFP isolated from mak3Δtrm1Δ cells (Figure 4.9 B). However, I observed that Trm1-II(A147D)-
GFP (in trm1Δ cells) has less affinity to interact with PS, PI(4)P, PI(4,5)P2, and
PI(3,4,5)P3. The data suggest that membrane lipids may play roles in Trm1-II INM targeting. In addition, the results also further support the hypothesis that the Trm1
INM targeting motif and N-terminal acetylation have different roles in Trm1-II INM targeting mechanism. Alternatively, since a protein contains change of its amino acids may cause abnormal folding (Powers et al., 2009), it is possible Trm1-
II(A147D) is an unfolded protein resulting in its loss of lipid binding.
113 4.4 Discussion
The studies of this chapter are aimed to define binding partner(s) of Trm1-II to shed light on the macromolecule(s) that participate in the INM targeting mechanism for peripheral membrane proteins. The biological membranes of eukaryotic cells are mainly composed by two fundamental groups of biochemical components, proteins and lipids, to support the structure and to regulate the functions of the membrane.
These marcomolecules play important roles facilitating membrane protein subcellular location. Therefore, Trm1-II might interact with other INM proteins and/or lipids to achieve its INM localization.
In order to gain more information for Trm1-II INM targeting mechanism, I investigated not only the Trm1-II mutant that has a non-functional INM targeting motif but also Trm1-II from cells with a Nat C complex disruption that causes Trm1-
II mislocation to the nucleoplasm. I found that in cells without Nat C activity Trm1-II still contains enzyme activity to modify tRNAs. It has been studied by Ellis et al.
(1986) that the recombinant Trm1-II from E. coli is capable to modify tRNAs. My data are consistent with Ellis et al. (1986) and show that N-terminal acetylation of
Trm1-II is not necessary for Trm1-II enzyme activity.
To test whether Trm1-II targets to the INM via protein-protein interaction, I attempted to identify Trm1-II interacting proteins using AP combined with MS analysis. I compared co-purifying proteins from Trm1-II to Trm1-II(A147D) (a
Trm1-II mutant which contains non-functional INM targeting motif) or to non-N- acetylated Trm1-II (from Nat C inactive cells) to identify candidate INM binding
114 partner(s) for Trm1-II located at the INM. However, I did not identify candidate proteins which co-purified with Trm1-II that also localize to the INM. In fact, no candidates for a Trm1-II INM binding partner have been uncovered in studies of proteome-wide protein interaction networks (Krogan et al., 2004; Krogan et al.,
2006). It is possible that the interaction between Trm1-II and the binding partner(s) is not stable or the interaction is transient, or my affinity purification conditions are not suitable to maintain the interaction of Trm1-II and its binding partner(s). In addition, no such candidates were discovered by two hybrid screens (Dr. Nancy C.
Martin unpublished data). These results suggest that the interacting partner(s) of
Trm1-II might not be protein(s), but rather other types of macromolecules.
Although I failed to identify Trm1-II interacting proteins that served as Trm1-II
INM binding partner(s), I uncovered that Trm1-II, Trm1-II(A147D) and non-N- acetylated Trm1-II interact with Nsp1. Moreover, I found that Trm1-II(A147D) appears to interact with Nsp1 more efficiently than Trm1-II. Using nsp1 ts-10A strain to study whether Nsp1 is important for Trm1-II-GFP and Trm1-II(A147D)-
GFP nuclear import and subcellular distributions, I found that Nsp1-mediated nuclear import is more important for Trm1-II with the non-functional INM motif than for wild-type Trm1-II to be delivered to the nucleus. That is, newly synthesized
Trm1-II-GFP locates to the NE in nsp1 ts-10A cells at either permissive or non- permissive temperature, but Trm1-II(A147D)-GFP was located in the cytoplasmic spots and nucleoplasm in nsp1 ts-10A cells. The data indicate that Nsp1-mediated nuclear import may not be a major factor for wild-type Trm1-II INM targeting. A
115 possible explanation is that Trm1-II interacts with not only Nsp1 but also other FG
Nups to facilitate its nuclear import.
I confirmed that Trm1-II has self-interaction by co-IP experiment. In higher eukaryotic cells, A- and B-type lamins polymerize to form separate networks of nuclear intermediate filaments that peripherally associate with the INM (Dechat et al., 2008; Wilson and Foisner 2010). It is possible that Trm1-II self-interaction forms dimers or polymers that facilitate Tm1-II INM distribution.
Finally, in an attempt to test Trm1-II-lipid interaction(s), I performed the protein-lipid overlay assays. I demonstrated that Trm1-II interacts with lipids in vitro, although the liposome binding assays need to be performed to verify the results and to determine the specificity of lipid binding. Using protein-lipid overlay assays, I observed that Trm1-II interacts with PS, PI(4)P, PI(4, 5)P2 and PI(3, 4, 5)P3.
It has been shown that PS is one of the major lipid components of the nuclear membrane (van Meer et al., 2008; Zinser et al., 1991). Moreover, PI(4, 5)P2 is the substrate for inositol polyphosphate (IP)-metabolizing enzyme Plc1 in yeast (Flick and Thorner, 1993; Payne and Fitzgerald-Hayes, 1993; Yoko-o et al., 1993). Studies demonstrated that IPs function in the nucleus to regulate gene expression (Alcazar-
Roman et al., 2006; Odom et al., 2000; York et al., 1999). Plc1 and many IP- metabolizing enzymes that participate in Plc1-driven IPs signaling pathway have been shown that primarily localize to the nucleus or nuclear periphery. Therefore,
PI(4, 5)P2 has been purposed to associate with the INM in the nucleus (Alcazar-
Roman and Wente, 2008). Thus, analogously Trm1-II may interact with lipids at the
116 INM. Interestingly, Trm1-II also associates with cardiolipin, a major lipid component in mitochondria (van Meer et al., 2008; Zinser et al., 1991). The data indicate that
Trm1-II may associate with mitochondria by interacting with lipids on the mitochondria and this may further explain how Trm1-II localizes to mitochondria.
Interestingly, I found that Trm1-II(A147D)-GFP associates less well with lipids compared to wild-type Trm1-II-GFP. As discussed in chapter three, J. Profato and I proposed that the INM targeting motif of Trm1 is a structure motif and contains an amphipathic α-helix. As it has been shown that Nbp1, a spindle pole body component, contains an amphipathic α-helix that facilitates its INM targeting by association with membrane lipids (Kupke et al., 2011) and the Trm1 INM targeting motif is also an amphipathic α-helix, it is possible that the binding partners of Trm1-
II for INM location may be lipids rather than proteins.
Surprisingly, I observed that Trm1-II-GFP proteins extracted from mak3Δtrm1Δ cells bind as well or even more efficiently with lipids than Trm1-II-GFP from trm1Δ cells. Murthi and Hopper (2005) demonstrated that Trm1-II-GFP mislocalized to the nucleoplasm in strains with gene deletions in MAK3, MAK10, and MAK31. In yeast, the N-terminal acetyltransferase C (Nat C) complex contains Mak3, Mak10 and
Mak31, and all three subunits are necessary for Nat C activity. The Nat C complex potentially acetylates methionine N terminus of proteins when the second residue is one of the hydrophobic amino acids leucine, isoleucine, phenylalanine, or tryptophan (Polevoda and Sherman, 2003; Van Damme et al., 2011). Using deletion
[Met-Leu-Lys-Ala- to Met-Δ-Lys-Ala- (Trm1-II-ΔL2)] or mutation [Met-Leu-Lys-Ala-
117 to Met-Leu-Glu-Ala- (Trm1-II-K3 to E3)] of amino acid at N-terminal of Trm1-II predicted to be Nat C recognition site to prevent N-acetylation of Trm1-II, they found that these mutant proteins of Trm1-II localize to the nucleoplasm instead of the INM in wild-type cells. However, when they introduced ectopic Nat C recognition sequence to the Trm1-II-GFPΔL2, they observed that ectopic Nat C recognition sequences are not able to redistribute Trm1-II-GFPΔL2 from the nucleoplasm to the
INM. Thus, they concluded that N-terminal modification is necessary but not sufficient for targeting Trm1-II to the INM. Since approximately 50% of yeast proteins are N-terminally acetylated (Arnesen et al., 2009), it is possible that Nat C dependent N-terminal acetylation of other proteins affecting the composition of lipids and/or interacting with Trm1-II at the INM is the reason that Trm1-II fails to locate at the INM in Nat C mutant cells. Also, alterations of amino acids at Trm1-II N- terminus might cause changes of Trm1-II conformation rather than disruption of N- terminal acetylation of Trm1-II resulting in locating Trm1-II to the nucleoplasm instead of the INM. Further experiments are required to learn whether Trm1-II-ΔL2 and Trm1-II-K3 to E3 contain Trm1-II enzyme activity and interact with lipids to further understand N-acetylation for Trm1-II to achieve its INM location.
Taken together, using different biochemical approaches to study Trm1-II interacting partner(s) for INM targeting, I learned that Trm1-II may interact with membrane lipids rather than proteins to achieve its INM location. I found that non- functional INM targeting motif Trm1-II mutant [Trm1-II(A147D)] rather non-N- acetylated Trm1-II interacts less efficiently with lipids than wild-type Trm1-II in
118 vitro. The data indicate that the INM targeting motif may affect Trm1-II INM location by altering the interaction between Trm1-II and lipids. Alternatively, Trm1-
II(A147D) may be a misfolded protein affecting its lipid binding and loss of tRNA methyltransferase activity. However, I favor the model that the motif itself is responsible for lipid interaction because other mutations, such as Trm1-II(I148S) and Trm1-II(R149A), close to Trm1-II(A147D) do not affect Trm1-II INM location
(Lai et al., 2009). Future experiments to test whether the INM targeting motif (Trm1 amino acids 130-151) will confer lipid binding upon reporter proteins are required to confirm that this motif acts in Trm1-II by aiding Trm1-II association with membrane lipids.
119 Name Encoded fusion protein Promoter Description pTPL7 Trm1-II-GFP TRM1 A plasmid in pRS416 backbone to serve as the template to obtain DNA fragments to generate pTPL10, pTPL23, and pTPL26
pTPL10 Trm1-II-GFP TRM1 For coimmunopreciptation experiments
pTPL11 GFP-ZZ GAL1-10 For serving as a negative control for affinity purification and coimmunopreciptation experiments
pTPL12 Trm1-II-GFP-ZZ GAL1-10 For affinity purification to identify Trm1-II INM interacting protein(s), coimmunopreciptation experiments and fluorescence microscopy
pTPL13 Trm1-II (A147D)-GFP-ZZ GAL1-10 For affinity purification to identify Trm1-II INM interacting protein(s), coimmunopreciptation experiments and fluorescence microscopy
pTPL23 Trm1-II-ZZ TRM1 For methyltransferase activity assays and coimmunopreciptation experiments
Continued
Table 4.1 Plasmids generated for identifying trans-acting factor(s) for Trm1-II
INM targeting
120 Table 4.1 continued
pTPL24 GFP-ZZ ARG3 For serving as a negative control for affinity purification and coimmunopreciptation experiments
pTPL26 Trm1-II-GFP-3C-ZZ TRM1 For protein-lipid overlay assays
pTPL29 GFP-3C-ZZ ARG3 For protein-lipid overlay assays
pTPL34 Trm1-II-GFP-3C-ZZ GAL1-10 For protein-lipid overlay assays
pTPL35 Trm1-II (A147D)-GFP-3C- GAL1-10 For protein-lipid overlay ZZ assays
pTPL44 Kes1-GFP-3C-ZZ GAL1-10 For protein-lipid overlay assays
121
Figure 4.1 The expression of Trm1-II-ZZ in trm1Δ and mak3Δtrm1Δ cells
Western blot analysis of trm1Δ and mak3Δtrm1Δ cells containing either vector or plasmid encoding Trm1-II-ZZ probed with anti-Protein A antibody (top) to determine the levels of expression of Trm1-II-ZZ and with anti-Pgk1 to control for loading levels. Ratios of the signal intensities of Trm1-II-ZZ/Pgk1 are shown.
122
Figure 4.1 The expression of Trm1-II-ZZ in trm1Δ and mak3Δtrm1Δ cells
123
2 Figure 4.2 m 2G methyltransferase activity of Trm1-II-ZZ in trm1Δ and mak3Δ trm1Δ cells
Cell lysate from trm1Δ cells containing either vector or Trm1-II-ZZ, and from mak3Δtrm1Δ cells with Trm1-II-ZZ were assayed for methyltransferase activity using protocol described in chapter 2. The activity of the extracts was determined at
0, 45, and 90 min and the assays were performed in triplicate.
124
2 Figure 4.2 m 2G methyltransferase activity of Trm1-II-ZZ in trm1Δ and mak3Δ trm1Δ cells
125 No. EB WB Resin Quality 1 A A S 1 2 B B S 2 3 C C S 2 4 D D S 2 5 E E S 2 6 F F MB 2 7 G G MB 3 8 H H S 2 9 H H MB 4 10 I I MB 4 11 J J MB 4 12 K K MB 4 13 L L MB 4 14 M M MB 4 15 H N MB 4-5 16 M O MB 5
Continued
Table 4.2 Different extraction conditions and subjective qualities for affinity purifications of Trm1-II-ZZ or Trm1-II-GFP-ZZ from whole cell lysates
Extraction Buffer (EB) and Washing Buffer (WB)
126 Table 4.2 continued
A. 20 mM HEPES, pH 7.4, 110 mM KOAc, 2 mM MgCl2, 25 mM NaCl, 0.5% Triton X-100 B. 20 mM HEPES, pH 7.4, 110 mM KOAc, 2 mM MgCl2, 50 mM NaCl, 0.5% Triton X-100 C. 20 mM HEPES, pH 7.4, 110 mM KOAc, 2 mM MgCl2, 100 mM NaCl, 0.5% Triton X-100 D. 20 mM HEPES, pH 7.4, 110 mM KOAc, 2 mM MgCl2, 50 mM NaCl, 1% Triton X- 100 E. 20 mM HEPES, pH 7.4, 110 mM KOAc, 2 mM MgCl2, 50 mM NaCl, 1% NP-40 F. 20 mM HEPES, pH 7.4, 110 mM KOAc, 2 mM MgCl2, 1% Triton X-100, 0.1% Tween 20 G. 20 mM HEPES, pH 7.4, 110 mM KOAc, 2 mM MgCl2, 25 mM NaCl, 1% Triton X- 100, 0.1% Tween 20 H. 20 mM HEPES, pH 7.4, 110 mM KOAc, 2 mM MgCl2, 50 mM NaCl, 1% Triton X- 100, 0.1% Tween 20 I. 20 mM HEPES, pH 7.4, 110 mM KOAc, 2 mM MgCl2, 100 mM NaCl, 1% Triton X-100, 0.1% Tween 20 J. 20 mM HEPES, pH 7.4, 110 mM KOAc, 2 mM MgCl2, 150 mM NaCl, 1% Triton X-100, 0.1% Tween 20 K. 20 mM HEPES, pH 7.4, 110 mM KOAc, 2 mM MgCl2, 50 mM NaCl, 1% CHAPS, 0.1%, Tween 20 L. 20 mM HEPES, pH 7.4, 110 mM KOAc, 2 mM MgCl2, 50 mM NaCl, 1% ASB-14, 0.1% Tween 20 M. 20 mM HEPES, pH 7.4, 110 mM KOAc, 2 mM MgCl2, 50 mM NaCl, 1% Triton X-100, 0.1% NP-40 N. 20 mM HEPES, pH 7.4, 110 mM KOAc, 2 mM MgCl2, 50 mM NaCl, 0.1% Tween 20, 1mg/ml Heparin O. 20 mM HEPES, pH 7.4, 110 mM KOAc, 2 mM MgCl2, 50 mM NaCl, 0.1% NP-40, 1mg/ml Heparin (1) S: Sepharose, MB: Magnetic Beads (2) The quality of the affinity purification based on a five note scale: 5-excellent, 4- good, 3-average, 2-bad, 1-terrible
127
Figure 4.3 Affinity purification of GFP-ZZ and Trm1-II-ZZ using IgG-Sepharose beads
Wild-type cells expressing GFP-ZZ or Trm1-II-GFP-ZZ under the control of GAL1-10 promoter were affinity isolated using extraction buffer (20 mM HEPES, pH 7.4, 110 mM KOAc, 2 mM MgCl2, 100 mM NaCl, 0.5% Triton X-100) with IgG-Sepharose beads. The complexes were separated by 10% Bis-Tris gel, visualized by Coomassie blue staining. Molecular weight markers are indicated to the left of the gels.
128
Figure 4.3 Affinity purification of GFP-ZZ and Trm1-II-ZZ using IgG-Sepharose beads
129
Figure 4.4 Separation of ZZ-tagged protein associated complexes
ZZ-tagged protein-containing complexes were affinity purified from whole cell lysates expressing (A) GFP-ZZ under the control of ARG3 promoter as a control, or
Trm1-II-GFP-ZZ (in trm1Δ and mak3Δtrm1Δ) under the control of TRM1 regulatory sequence; (B) GFP-ZZ, Trm1-II-GFP-ZZ, or A147D-GFP-ZZ under the control of GAL1-
10 promoter. The complexes were separated by 10% Bis-Tris gel, visualized by
SyproRuby staining. Molecular weight markers are indicated to the left of the gels.
130
(A) (B)
Figure 4.4 Separation of ZZ-tagged protein associated complexes.
131 (1)GFP-ZZ (trm1Δ) (2)Trm1-II-GFP-ZZ (trm1Δ) (3)Trm1-II-GFP-ZZ(mak3Δtrm1Δ) Yar010 (4,7,2) Rpl17a (0,1,0) Trm1 (32,47,41) Rpl8b (3,0,0) Rrn3 (0,1,0) Trm1 (33,46,39) Ded1 (2,0,0) Hos3 (1,0,0)
Tdh3 (2,6,3) Lte1 (0,1,0) Lat1 (16,30,2) Fba1 (2,0,0) Dig1 (0,1,0) Tef1 (12,27,4) Cdc48 (0,0,2) Sse1 (0,0,1)
Lat1 (1,3,1) Esf1 (1,0,0) Ssa2 (4,18,11) Vip1 (0,2,0) Rpl26b (1,0,0) Lat1 (14,20,2) Met6 (0,0,2) Spt5 (0,0,1)
Ugp1 (23,39,0) Nsr1 (0,0,1) Ura2 (1,4,11) Eno2 (2,0,0) Opi6 (1,0,0) Ssa2 (6,15,14) Rps3 (2,0,0) Yhr020w (0,0,1)
Tef1 (7,19,0) Yil16bw (0,1,0) Pdc1 (1,4,4) Rps6a (2,0,0) Spb1 (0,1,0) Ssb1 (7,20,11) Vps16 (0,2,0) Ilv3 (0,0,1)
Rpa190 (11,9,0) Nip100 (1,0,0) Pda1 (25,39,0) Cdc48 (0,0,2) Rts3 (0,1,0) Ssa1 (4,13,14) Tao3 (0,0,2) Frs2 (0,0,1)
Ssa1 (3,9,0) Sog2 (0,0,1) Lpd1 (19,29,0) Esp1 (2,0,0) Ilv2 (1,0,0) Pdx1 (5,16,1) Rpl17b (2,0,0) Rvb2 (0,0,1)
Ecm31 (2,8,0) Pdx1 (15,25,0) Tao3 (0,0,2) Sam2 (1,0,0) Pdc1 (3,10,8) Ssa3 (2,0,0) Ycr050c (0,0,1)
Rpa43 (0,2,6) Tef1 (12,22,0) Nsp1 (0,0,2) Srb8 (0,0,1) Ura2 (2,8,10) Eno1 (0,2,0) Rps18b (0,1,0)
Rpc40 (3,0,5) Pdb1 (16,17,0) Krs1 (0,2,0) Dbp9 (0,0,1) Pma1 (2,10,7) Rpl12a (2,0,0) Dps1 (0,1,0)
Ppn1 (2,6,0) Ssb1 (9,24,0) Imd2 (2,0,0) Cka2 (0,1,0) Pab1 (1,14,1) Nug1 (2,0,0) Rpl28 (0,1,0)
Ssb2 (1,7,0) Ugp1 (7,12,0) Lsb3 (0,2,0) Pet9 (0,1,0) Tdh3 (9,3,1) Bfr1 (2,0,0) Rpl6b (1,0,0)
Rpa135 (5,0,2) Ssb2 (9,8,0) Htb2 (0,1,0) Cka1 (1,0,0) Eno2 (2,3,3) Cop1 (0,2,0) Rps1b (1,0,0)
Pil1 (2,4,0) Tdh3 (6, 7,0) Set2 (1,0,0) Sum1 (1,0,0) Pgk1 (2,3,2) Rpl9b (0,2,0) Rps13 (0,1,0)
Gcd11 (1,3,0) Ssa1 (3, 9,0) Hmo1 (0,1,0) Ptc6 (0,1,0) Pfk1 (1,3,1) Nop1 (1,0,0) Rpl7b (1,0,0)
Rpb5 (1,3,0) Yar010c (7,0,4) Sam1 (1,0,0) Sec7 (1,0,0) Pda1 (19,34,0) Sui3 (1,0,0) Rps19a (0,1,0)
Rpl6a (1,2,0) Ydr210C-C (0,7,4) Nop56 (1,0,0) Lcb4 (1,0,0) Ugp1 (19,27,0) Nop56 (1,0,0) Psd2 (0,0,1)
Fol2 (1,2,0) Pma1 (5,0,4) Adh1 (0,1,0) Pdb1 (11,14,0) Snu13 (0,1,0) Hef3 (0,0,1)
Cdc19 (1,0,1) Pab1 (1,7,0) Ecm31 (1,0,0) Cdc19 (0,12,13) Rpp0 (1,0,0) Rna14 (1,0,0)
Fba1 (1,1,0) Muk1 (1,0,7) Sui3 (0,1,0) Rpa190 (2,16,0) Sam1 (0,0,1) Tif4631 (1,0,0)
Yol103w-a (7,0,0) Rpp0 (2,5,0) Pil1 (1,0,0) Lpd1 (3,11,0) Set2 (0,1,0) Scp160 (0,1,0)
Pda1 (0,4,0) Imd4 (2,4,0) Nop1 (1,0,0) Pil1 (5,10,0) Fba1 (1,0,0) Spt16 (1,0,0)
Kar2 (3,0,0) Rps3 (2, 4,0) Rpl17b (1,0,0) Ydr210c-c (9,4,0) Hmo1 (0,1,0) Prp43 (0,1,0)
Ssa2 (3,0,0) Rpl5 (1,4,0) Sec27 (0,0,1) Lsp1 (4,9,0) Htb2 (0,1,0) Rps0b (0,1,0)
Rpc19 (0,3,0) Rps5 (2,3,0) Cpa2 (0,0,1) Yar010C (3,9,0) Ecm31 (1,0,0) Rps15 (0,1,0)
Pdb1 (0,0,2) Kar2 (0,3,1) Gpm1 (0,0,1) Rpa135 (1,10,0) Gde1 (0,1,0) Phb1 (1,0,0)
Nop1 (0,2,0) Nop15 (3,0,1) Vps16 (1,0,0) Imd3 (2,7,0) Gcd11 (1,0,0) Rpl32 (1,0,0)
Rpp0 (0,2,0) Hsc82 (3,0,1) Pgk1 (0,1,0) Pgi1 (6,0,2) Rpo26 (0,1,0) Rps12 (0,1,0)
Lsp1 (2,0,0) Snu13 (1,3,0) Lys21 (1,0,0) Rpl4b (3,4,0) Sec27 (0,0,1) Rpl25 (0,1,0)
Rpl38 (0,2,0) Hcr1 (2,2,0) Yef3 (0,1,0) Rpc40 (1,4,0) Rpl8a (1,0,0) Bir1 (1,0,0)
Rpa49 (0,0,2) Cdc19 (1,0,2) Rpl8a (1,0,0) Kar2 (0,2,2) Apc1 (0,0,1) Rpl30 (1,0,0)
Rpb8 (2,0,0) Rpc40 (1,2,0) Phb1 (1,0,0) Vma2 (2,0,2) Gsc2 (0,0,1) Vma1 (1,0,0)
Sam1 (1,0,0) Ppn1 (2,0,1) Alg13 (0,1,0) Rpl5 (3,1,0) Yef3 (1,0,0) Ilv5 (0,1,0)
Htb2 (0,1,0) Rpl6a (1,2,0) Rpl1b (1,0,0) Eft1 (0,1,2) Muk1 (0,0,1) Fun12 (0,1,0)
Hmo1 (1,0,0) Trs130 (2,0,1) Prp16 (0,1,0) Pcs60 (2,0,1) Esp1 (0,1,0) Rpl20a (1,0,0)
Set2 (0,1,0) Eft1 (0,2,1) Gsc2 (0,0,1) Fas2 (0,1,2) Bbc1 (0,1,0) Inm1 (1,0,0)
Rps5 (1,0,0) Rpl1b (1,2,0) Apc1 (0,0,1) Trs130 (0,1,1) Lys21 (0,1,0) Dot1 (1,0,0)
Vip1 (1,0,0) Asc1 (1, 2,0) Yra1 (1,0,0) Fas1 (1,1,0) Yra1 (1,0,0) Myo5 (1,0,0)
Adh1 (1,0,0) Rpl10 (1,0,1) Sgo1 (0,1,0) Tcb1 (1,1,0) Alg13 (1,0,0) Ubx2 (0,1,0)
Sui3 (0,1,0) Fol2 (1,1,0) Rpa43 (1,0,0) Imd4 (6,0,0) Rpl1b (0,1,0) Rim8 (0,1,0)
Nop56 (0,0,1) Rpa190 (12,0,0) Cct7 (1,0,0) Vip1 (0,6,0) Sgo1 (1,0,0) Irc5 (0,1,0)
Pma1 (1,0,0) Bbc1 (0,10,0) Rpl7a (0,1,0) Tef4 (4,0,0) Yor304c-a (0,1,0) Nde1 (0,1,0)
Snu13 (1,0,0) Tdh2 (6,0,0) Ubr2 (1,0,0) Ybr012w-b (0,0,4) Prp16 (0,1,0) Cdc12 (1,0,0)
Ura2 (0,1,0) Rpl4a (0,5,0) Srp14 (0,1,0) Iki3 (0,4,0) Rpl11b (1,0,0) Rgd2 (1,0,0)
Nop15 (0,1,0) Rpa135 (4,0,0) Rpl2b (1,0,0) Hxt7 (4,0,0) Gpm1 (1,0,0) Gpa2 (0,1,0)
Rpo26 (0,1,0) Yol103w-a (0,0,4) Yor304c-a (1,0,0) Adh1 (3,0,0) Rpl10 (1,0,0) Rsc8 (0,1,0)
Gde1 (1,0,0) Tcp1 (4,0,0) Rps7b (0,1,0) Asc1 (0,3,0) Hta2 (0,1,0) Pol5 (0,1,0)
Ded1 (0,0,1) Rpl4b (3,0,0) Rps24b (1,0,0) Hsc82 (0,0,3) Pfk2 (0,1,0) Rps9b (1,0,0)
Rpa14 (0,1,0) Tef4 (0,3,0) Taf4 (1,0,0) Rps6a (3,0,0) Rrp5 (0,1,0) Sts1 (1,0,0)
Vps13 (0,0,1) Met6 (0,0,3) Nfu1 (1,0,0) Rps7a (0,3,0) Nip1 (1,0,0) Clb2 (0,1,0)
Atp16 (0,0,1) Rps7a (0,3,0) Nhp2 (0,1,0) Cpa2 (0,0,3) Arp3 (1,0,0) Bpt1 (0,1,0)
Kin1 (1,0,0) Pfk1 (0,0,3) Spp41 (0,1,0) Pdc5 (3,0,0) Pat1 (1,0,0) Vhr1 (1,0,0)
Bug1 (0,1,0,) Yhm2 (3,0,0) Gtt2 (1,0,0) Rps5 (0,2,0) Ssz1 (1,0,0)
Continued
Table 4.3 Orbitrap LC-MS/MS DATA from complexes associated with (1) GFP-
ZZ under the control of ARG3 promoter in trm1Δ cells, Trm1-II-GFP-ZZ under the control of TRM1 regulatory sequence in (2) trm1Δ and (3) mak3Δtrm1Δ cells
132 Table 4.3 continued
Each protein sample was affinity purified using IgG magnetic beads, and then resolved by 10% Bis-Tris gel. Protein bands within gels were excised and subsequently analyzed by Orbitrap LC-MS/MS.
: Proteins identified in GFP-ZZ in trm1Δ, Trm1-II-GFP-ZZ in trm1Δ, and Trm1-II-GFP-ZZ in mak3Δtrm1Δ
: Proteins identified in GFP -ZZ in trm1Δ and Trm1-II-GFP-ZZ in trm1Δ
: Proteins identified in GFP-ZZ in trm1Δ and Trm1-II-GFP-ZZ in mak3Δtrm1Δ
: Proteins identified in Trm1 -II-ZZ in trm1Δ and Trm1-II-GFP-ZZ in mak3Δtrm1Δ
: Proteins identified in GFP -ZZ in trm1Δ
: Proteins identified in Trm1 -II-GFP-ZZ in trm1Δ
: Proteins identified in Trm1 -II-GFP-ZZ in mak3Δtrm1Δ
( ): Unique peptides identified in each mass spectrometric analysis
133 (1) GFP-ZZ (2) Trm1-GFP-ZZ (3) Trm1-II(A147D)-GFP-ZZ Ssa1 (15) Trm1 (55) Htb2 (2) Trm1 (44) Rpl5 (6) Hxt7 (4) Oac1 (3) Mrpl7 (1) Ynl134c (1) Tdh3 (13) Pda1 (26) Kar2 (2) Ssa1 (38) Sam1 (6) Pfk1 (4) Spt5 (3) Lys12 (1) Nop4 (1) Trm1 (7) Lat1 (23) Gal7 (2) Ssa2 (36) Fas2 (6) Pab1 (4) Rpl36a (3) Erg10 (1) Fen1 (1) Hsc82 (6) Ssb2 (20) Yef3 (2) Ssb2 (30) Pfk2 (6) Rpl31a (4) Pst2 (3) Clu1 (1) Pup3 (1) Pdb1 (6) Ssa1 (19) Fas1 (2) Ssb1 (29) Rps6a (6) Aco1 (4) Cox6 (3) Rpp1b (1) Tim11 (1) Yar010c (5) Ssa2 (16) Ded1 (2) Tdh3 (27) Cdc48 (6) Rpl19b (4) Cpa2 (3) Rpl11b (1) Acc1 (1) Adh1 (3) Tdh3 (14) Ilv3 (2) Eft1 (26) Rps16b (6) Sam2 (4) Met6 (2) Rpt6 (1) Sub2 (1) Sam1 (3) Pdb1 (13) Ecm10 (1) Tdh2 (24) Rpl14b (6) Sti1 (4) Cct4 (2) Rim1 (1) Frs2 (1) Pda1 (3) Eno2 (12) Gnd1 (1) Tef1 (22) Rps20 (6) Rpl8b (4) Ino1 (2) Nug1 (1) Emi2 (1) Tef1 (2) Tef1 (12) Imd4 (1) Pma1 (21) Rps14a (6) Hsp104 (4) Glk1 (2) Ynl208w (1) Ynr040w (1) Lat1 (2) Pdx1 (12) Ino1 (1) Cdc19 (21) Gpm1 (6) Rps4a (4) Htb2 (2) Pho86 (1) Ahp1 (1) Ydr210c-c (2) Muk1 (12) Pfk1 (1) Eno2 (18) Rpl2b (6) Ald6 (4) Lys21 (2) Snu13 (1) Cbr1 (1) Eno2 (2) Tdh2 (10) Leu1 (1) Hsc82 (17) Rps7a (6) Ilv5 (4) Kgd1 (2) Pcs60 (1) Vas1 (1) Fba1 (2) Eft1 (8) Glk1 (1) Pgk1 (17) Rps2 (6) Rpl15a (4) Rps19a (2) Rpl18a (1) Hom3 (1) Pet9 (2) Cdc19 (8) Tub2 (1) Pet9 (16) Rps1b (6) Rpl35b (4) Rps22a (2) Rtn1 (1) Sec18 (1) Hsp60 (2) Pdc1 (7) Kgd1 (1) Pdc1 (15) Rpl10 (6) Rpl7a (4) Tcb1 (2) Myo2 (1) Ssz1 (1) Aac3 (1) Pgk1 (7) Cct4 (1) Vma2 (14) Cha1 (6) Ydj1 (4) Mnp1 (2) Gsc2 (1) Cpr1 (1) Hxk1 (1) Atp2 (7) Yjl045w (1) Mir1 (14) Yar010c (5) Ths1 (4) Bmh2 (2) Fmp10 (1) Far1 (1) Ydr210c-c Rpl5 (1) Gal1 (7) Fas2 (1) Ssc1 (14) (5) Rpl16a (4) Rps11a (2) Mdj1 (1) Hsp42 (1) Ssb2 (1) Vma2 (6) Ald4 (1) Por1 (14) Fas1 (5) Vma1 (4) Rvb1 (2) Rpt4 (1) Tsl1 (1) Vma2 (1) Yar010c (6) Ilv2 (0,0,1) Tdh1 (13) Leu1 (5) Aac3 (3) Hom6 (2) Odc1 (1) Rsp5 (1) Ecm10 (1) Eno1 (6) Sec27 (1) Eno1 (13) Psa1 (5) Gnd1 (3) Arg4 (2) Ggc1 (1) Rpp2a (1) Mir1 (1) Rpl4b (6) Sse1 (1) Hsp82 (13) Pgi1 (5) Kar2 (3) Rpg1 (2) Nog1 (1) Rpl37a (1) Rpl16b (1) Adh1 (5) Aco1 (1) Ura2 (13) Yhm2 (5) Sse1 (3) Ndi1 (2) Rpl22a (1) Ses1 (1) Bgl2 (1) Tdh1 (5) Itr1 (1) Hxk2 (12) Tub2 (5) Rps15 (3) Atp3 (2) Rpl40b (1) Aap1 (1) Gal10 (5) Lys21 (1) Ssa4 (12) Rps12 (5) Rpl38 (3) Bat1 (2) Rpt3 (1) Ach1 (1) Psa1 (5) Erg6 (1) Hxk1 (11) Rps18b (5) Rps26b (3) Rpl23a (2) Tsa1 (1) Smc3 (1) Fba1 (4) Ycr050c (1) Atp2 (11) Rpl12a (5) Rpl17a (3) Nde1 (2) Sec23 (1) Yhb1 (1) Atp1 (4) Cit1 (1) Rpl4b (11) Tpi1 (5) Rps27b (3) Cop1 (2) Pre6 (1) Tps1 (1) Act1 (4) Trs130 (1) Rps3 (11) Rpl25 (5) Rpl1b (3) Ipp1 (2) Pbp1 (1) Hht1 (1) Hxt7 (4) Kgd2 (1) Rpl3 (11) Rps5 (5) Rps9b (3) Rpl34b (2) Faa1 (1) Dug1 (1) Hsc82 (3) Vps1 (1) Gal10 (10) Rps17a (5) Rps9a (3) Iki3 (2) Tif34 (1) Pre8 (1) Hxk1 (3) Mdh1 (1) Fba1 (9) Rps1a (5) Rpl17b (3) Nop56 (2) Rnq1 (1) Arp2 (1) Rpl5 (3) Vps16 (1) Adh1 (9) Hhf1 (5) Rps25a (3) Aro1 (2) Cys3 (1) Rga2 (1) Pet9 (3) Ded81 (1) Gal1 (9) Rps24b (5) Rps26a (3) Aac1 (2) Rfc3 (1) Aac3 (3) Aat2 (1) Gal7 (9) Rpl28 (5) Rpl24a (3) Uba1 (2) Rps23a (1) Pgi1 (3) Tef4 (1) Gdh1 (9) Rpl20a (5) Rpl13a (3) Phb2 (2) Far3 (1) Gal2 (3) Srb8 (1) Ssa3 (9) Rps7b (5) Tif1 (3) Rpl33a (2) Ybr141c (1) Hxk2 (3) Tao3 (1) Act1 (8) Rpp0 (5) Rpl43a (3) Cor1 (2) Skp2 (1) Yhm2 (3) Dbp9 (1) Atp1 (8) Rpl9b (5) Tub1 (3) Pda1 (1) Mnn11 (1) Pab1 (3) Psd2 (1) Ald4 (8) Rps10b (5) Rpl21b (3) Lat1 (1) Vph1 (1) Sam1 (2) Gph1 (1) Asc1 (8) Rpl9a (5) Pdc5 (3) Sec27 (1) Srp1 (1) Ydr210c-c (2) Utp20 (1) Rps13 (8) Rps8a (5) Gdh3 (3) Itr1 (1) Nsp1 (1) Rpl3 (2) Yhr054c (1) Rpl16b (7) Idh1 (5) Rps0b (3) Yjl045w (1) Cho2 (1) Met6 (2) Tfb2 (1) Gal2 (7) Pdb1 (4) Rpl30 (3) Imd4 (1) Rpp1a (1) Pfk2 (2) Swi6 (1) Yef3 (7) Hsp60 (4) Chc1 (3) Erg6 (1) Tcb3 (1) Pma1 (2) Rpl27a (7) Ilv2 (4) Qcr2 (3) Vma8 (1) Cdc10 (1) Continued
Table 4.4 Summary of proteins identified by mass spectrometry from ZZ- tagged protein affinity purifications of cell lysate containing (1) GFP-ZZ (2)
Trm1-II-GFP-ZZ (3) Trm1-II(A147D)-GFP-ZZ under the control of GAL1-10 promoter (method as described in table 4.2)
134 Table 4.4 continued
: Proteins identified in GFP-ZZ in trm1Δ, Trm1-II-GFP-ZZ in trm1Δ, and Trm1-II-GFP-ZZ in mak3Δtrm1Δ
: Proteins identified in GFP -ZZ in trm1Δ and Trm1-II-GFP-ZZ in trm1Δ
: Proteins identified in GFP -ZZ in trm1Δ and Trm1-II-GFP-ZZ in mak3Δtrm1Δ
: Proteins identified in Trm1 -II-ZZ in trm1Δ and Trm1-II-GFP-ZZ in mak3Δtrm1Δ
: Proteins identified in GFP -ZZ in trm1Δ
: Proteins identified in Trm1 -II-GFP-ZZ in trm1Δ
: Proteins identified in Trm1 -II-GFP-ZZ in mak3Δtrm1Δ
( ): Unique peptides identified in mass spectrometric analysis
135
Figure 4.5 Neither Trm1-II nor Trm1-II(A147D) interact with Htb2 or Kar2
Western blots of affinity-purified complexes (IP) and cell lysates (Lysate) of cells expressing GFP-ZZ, Trm1-GFP-ZZ, and A147D-GFP-ZZ probed with antibodies against Htb2 (A, top), Kar2 (B, top), and Protein A (A and B bottom)
136
(A)
(B)
Figure 4.5 Neither Trm1-II nor Trm1-II(A147D) interact with Htb2 or Kar2.
137
Figure 4.6 Nsp1 interacts with Trm1-II, non N-acetylated Trm1-II and Trm1-
II(A147D)
(A)Strains that express GFP-ZZ under the control of ARG3 promoter (in trm1Δ cells),
Trm1-II-GFP-ZZ (in trm1Δ and mak3Δtrm1Δ cells) under the control of TRM1 promoter were immunopurified using IgG-magnetic beads. Cell lysates (Lysate) and eluted proteins (IP) were separated by Bis-Tris gel and transferred to PVDF membranes for immunoblot analysis with Nsp1 and Protein A antibodies. (B) Whole cell lysates of cells expressing newly synthesized GFP-ZZ, Trm1-II-GFP-ZZ or Trm1-
II(A147D)-GFP-ZZ by addition of galactose were purified and analyzed (method as
A).
138
(A)
(B)
Figure 4.6 Nsp1 interacts with Trm1-II, non N-acetylated Trm1-II and Trm1-
II(A147D)
139
Figure 4.7 Location of Trm1-II-GFP and Trm1-II(A147D)-GFP at permissive and non-permissive temperature in nsp1 ts-10A cells
Plasmids that encode galactose-inducible GFP, Trm1-II-GFP, and Trm1-II(A147D)-
GFP were transformed into ts nsp1 mutant cells, respectively. Live cells were imaged after 2 hr induction at permissive (23 °C) or non-permissive (37 °C) temperatures by the addition of galactose. Top row: GFP; middle row: DIC; bottom row: overly of
GFP and DIC.
140
Figure 4.7 Location of Trm1-II-GFP and Trm1-II(A147D)-GFP at permissive and non-permissive temperature in nsp1 ts-10A cells
141
Figure 4.8 Trm1-II self-interaction trm1Δ cells expressing Trm1-II-ZZ, Trm1-II-GFP or the combination of Trm1-II-ZZ and Trm1-II-GFP were submitted to the ZZ-tagged protein affinity purification. Top, purified proteins probed by immunoblotting for GFP and Protein A (PrA). Bottom, whole cell lysates were probed using GFP and Protein A antibodies.
142
Figure 4.8 Trm1-II self-interaction
143
Figure 4.9 Trm1-II binds to several lipids
(A) Purified GFP, Kes1-GFP, Trm1-II-GFP (expressed under the control of TRM1 promoter in trm1D cells), non-N-acetylated Trm1-II-GFP (expressed under the control of TRM1 promoter in mak3Δtrm1Δ cells), galactose inducible Trm1-II-GFP and Trm1-II(A147D)-GFP (with an asterisk) were analyzed by 10% Bis-Tris gel followed by Coomassie blue staining. Image J (NIH image) was performed to quantify the concentration of each purified protein by using 0.1 µg of BSA. (B)
Protein-lipid overlay assay of GFP, Kes1-GFP, and various Trm1-II-GFP proteins (as described in A). (C) Layout of the membrane lipid strip.
144
(A)
(B) (C)
Figure 4.9 Trm1-II binds to several lipids.
145
Chapter 5
General discussion
5.1 Overview
The eukaryotic cell consists of membrane-covered compartments, organelles that have biologically distinct functions. Proteins are synthesized at the cytoplasm and then translocate to different organelles to exert their functions. Appropriate subcellular location is crucial for proteins to achieve their functions in the cell. If a protein does not reach its appropriate location, it could result in either inactivation of its function or harmful effects by acting at an inappropriate subcellular location
(Hung and Link, 2011). Therefore, it is important to understand the mechanism of how proteins target to the appropriate subcellular compartment. INM associated proteins are particularly important because they interact with chromatin and/or nuclear lamina to regulate gene expression, signaling, etc. (Wilson and Foisner,
2010). Consistent with this, it is known that aberrant localization or mutation of
INM proteins results in many human diseases, such as aging-related diseases, and cancers (Worman, 2012). Although several models for integral INM membrane
146 proteins targeting have been proposed, the INM targeting mechanism(s) of peripherally associated INM proteins has not been studied in great detail.
In this thesis, I used yeast Trm1-II, a peripherally associated INM protein, as a reporter to study cis-acting sequences and trans-acting macromolecules that are involved in Trm1-II INM association to define the mechanism for targeting peripheral membrane proteins to the INM.
First, to test the involvement of the nuclear transport machinery in the targeting of Trm1-II, I studied Trm1-II-GFP location in cells that possess deletion/mutation of specific Nups. I found that the distribution and the composition of the NPC do not have a large effect upon Trm1-II INM location (Lai et al., 2009). Second, using random and site-directed mutagenesis approaches, I learned that Trm1 amino acids
130-151 are necessary for Trm1-II INM targeting. I also demonstrated that this peptide is sufficient to distribute reporter proteins (NLS-β-galactosidase and NLS-
Trm7-GFP) to the INM (Lai et al., 2009). J. Profato and I further demonstrated that
Trm1 INM targeting motif contains an amphipathic α-helix that serves as a structural motif to facilitate Trm1-II to associate with the INM by random mutagenesis method and structure analysis.
The combination of affinity purification and MS analysis did not uncover Trm1-II interacting proteins at the INM. One interpretation of the results is that Trm1-II INM targeting may not be via protein-protein interaction. Therefore, to explore whether
Trm1-II interact with lipids on the INM, a protein-lipid overlay assay was performed using purified Trm1-II-GFP, Trm1-II(A147D)-GFP (Trm1-II mutant with non-
147 functional INM targeting motif), and non-N-acetylated Trm1-II-GFP (from Nat C depletion cells). Surprisingly, Trm1-II was found to associate with several lipids and the lipid binding was reduced in Trm1-II(A147D). Although further experiments need to be performed to learn the effect between Trm1-II folding and lipid binding in mutants that contain the amino acid alterations in the region of INM targeting motif, the data suggest that Trm1-II interacts with lipids which may facilitate its INM targeting.
Taken together, this work has utilized genetic and biochemical approaches to identify not only an INM targeting motif as a cis-acting sequence but also the possible association of lipids as trans-acting element for a peripheral membrane protein to associate with the INM.
5.2 Trm1-II nuclear transport and INM distribution
It has been proposed that transport of peripheral INM proteins from cytoplasm to the nucleus is similar to soluble nuclear proteins, which interact with karyopherins in the cytoplasm and transport through the central channel of the NPC by the Ran-dependent pathway (Burns and Wente, 2012; Cook et al., 2007; Lusk et al., 2007; Stewart, 2007). Dr. Murthi demonstrated that Trm1-II nuclear import is
Ran dependent (Lai et al., 2009). In this study, I learned that Trm1-II physically interacts with one of central FG Nups, Nsp1. The data support that nuclear transport of Trm1-II is through the central channel of the NPC to the nucleus. The data are consistent with the model that nuclear import of Trm1-II is directed by the same
148 mechanism for soluble nuclear proteins. In addition, I observed that Trm1-II-GFP normally distributes to the INM in various nup knockout strains (Lai et al., 2009).
The results suggested that Trm1-II is able to be imported to the nucleus through the
NPC that without the specific Nup in NPC’s composition and associates with the
INM.
5.3 Trm1 INM targeting motif
The regulation of protein subcellular location relies on information that is encoded within the protein sequence. Proteins targeted to their particular subdomains in the cell often contain the signal sequences either sequence specific, such as the NLS, or structure specific, such as the MTS, that are recognized by specific receptors. In addition, the post-translational modifications are also important for protein subcellular location. For example, C-terminal isoprenylation of lamin, a peripherally associated INM protein, via its CaaX motif is important for its INM location (Hennekes and Nigg, 1994). When this work was initiated, no such peptide sequences that serve for the INM targeting motif for peripheral membrane proteins were identified. Although it was previously shown that the fusion protein containing a 76 amino acid region (amino acids 298-373) of LAP2, a lamin-binding protein (Furukawa et al., 1995), with N-terminal HA tag and an ectopic transmembrane-domain from chicken hepatic lectin at C-terminus is sufficient to target to the INM, without the ectopic transmembrane domain LAP2 amino acids
298-373 are not able to associate with the INM (Furukawa et al., 1998). In this
149 study, I identified that Trm1 peptide containing amino acids 130-151 is necessary for Trm1-II INM location and this short peptide is sufficient to target reporter proteins to the INM (Lai et al., 2009). To the best of my knowledge, this is the first time that an INM targeting motif for a peripheral membrane protein was reported.
Since I described the Trm1 INM targeting motif, it was reported that the Nbp1 (a spindle pole body component) amino acids 1-103 that contain an amphipathic α- helix are sufficient to target the protein to the INM by interacting with membrane lipids (Kupke et al., 2011). Using random mutagenesis method and structure analysis, J. Profato and I learned that the INM targeting motif in Trm1-II likely contains an amphipathic α-helix that serves as a structure specific peptide motif to facilitate Trm1-II INM targeting. It raised a possibility that Trm1-II might interact with lipids via the INM targeting motif to achieve its INM location.
5.4 Trm1-II might interact with lipids at the INM
In order to identify Trm1-II trans-acting factors that are important for Trm1-II
INM association, I conducted affinity pull-down experiments combined with MS analysis to identify protein candidates that might interact with Trm1-II to assist its
INM location. However despite studies employing numerous different salt concentrations and detergents to optimize conditions for the affinity purification of
ZZ tagged proteins, I failed to identify proteins that co-purified with Trm1-II that are likely to serve as the Trm1-II INM binding partners. Although the negative results could be due to the conditions employed for affinity purification, the results are
150 consistent with genome-wide studies of yeast interactome using other affinity purification approaches (Krogan et al., 2006; Krogan et al., 2004) and the results from yeast two-hybrid experiments using Trm1-II as a bait to target other proteins
(Dr. Nancy C. Martin unpublished). Taken together, the data suggest that association of Trm1-II to the INM may not be via protein-protein interactions. However, I confirmed that Trm1-II directly interacts with Trm1-II by co-IP experiments. It has been shown that lamins, which are peripherally associated INM proteins, form lamin filaments at the INM by self-association (Aebi et al., 1986; Goldman et al., 2002;
Stuurman et al., 1998). It is possible that Trm1-II interacts with Trm1-II to form dimers or polymers to facilitate Trm1-II even distribution at the INM.
In contrast to failed attempts to identify protein interactions, protein-lipid overlay assays described in chapter four showed that Trm1-II is able to interact with several lipids in vitro. Some of the identified lipids are known to be components of nuclear and mitochondrial membranes. The results support the hypothesis that the INM targeting motif containing an amphipathic α-helix is important for Trm1-II to interact with lipids at the INM.
Trm1-II locates to the nucleoplasm instead of the INM in ice2Δ cells by genome- wide screen (Murthi and Hopper, 2005). Ice2, an integral ER membrane protein, is important for ER structure (Estrada de Martin et al., 2005). The ER is the primary site of lipid biosynthesis and comprises many phospholipids (Henry et al., 2012;
Paltauf and Daum, 1992). The interaction between Trm1-II and lipids provides a possible explanation of how an ER protein might function in locating the peripheral
151 membrane protein to the INM. Ice2 might be directly or indirectly involved in the lipid biosynthesis at the ER affecting the interaction between Trm1-II and lipids at the INM. Moreover, Dr. Murthi and I both observed that Trm1-II distributes to mitochondria when nuclear location is prohibited by alteration of the Ran pathway and by generating mutations in Trm1 amino acid 73-151 region (Lai et al., 2009), which contains an NLS for Trm1-II nuclear import (Rose et al., 1992). We suggested that there is a competition between nuclear and mitochondrial targeting information because Trm1-II contains the NLS and the MTS in its protein sequence
(Ellis et al., 1989; Rose et al., 1992). The results from Trm1-II-lipid overlay assay indicate that Trm1-II interacts with cardiolipin, a major lipid component of mitochondrial membranes. The data provide additional information for Trm1-II subcellular distribution between the INM and mitochondria.
5.5 N-terminal acetylation and Trm1-II INM targeting
Approximately 50% of yeast proteins and 80% of mammalian proteins are N- terminally acetylated (Arnesen et al., 2009). This modification impacts a large number of cellular processes, including targeted protein degradation, protein- protein interaction, protein localization, enzymatic function, protease inhibition, and protein synthesis (Starheim et al., 2012; Van Damme et al., 2011).
Murthi and Hopper (2005) showed that amino acid substitution or deletion at the putative Nat C recognition site of Trm1-II causes Trm1-II-GFP to mislocate to the nucleoplasm. They also showed by MS analysis that Trm1-II is normally N-
152 terminally acetylated by MS analysis. However, when they introduced ectopic sequences that are reported to be recognized by Nat C complex into mislocalized
Trm1-II, the INM location of Trm1-II was not restored. Thus, they suggested that N- terminal acetylation is necessary but not sufficient for Trm1-II INM targeting. In fact, several studies showed that N-terminal acetylation by Nat C is required for protein subcellular localization in yeast, mammalian, and plant cells, while they all demonstrated that N-terminal acetylation of proteins is not the only factor to affect targeting of proteins (Behnia et al., 2007; Behnia et al., 2004; Hofmann and Munro,
2006; Pesaresi et al., 2003; Setty et al., 2004; Starheim et al., 2009). The data indicate that N-terminal acetylation by Nat C plays a general role in subcellular location of proteins.
In this thesis, I demonstrated that Trm1-II without N-terminal acetylation is enzymatically active and possesses the same ability to interact with lipids, as does the acetylated protein. It is possible that mislocalization of Trm1-II to the nucleoplasm in cells without Nat C complex is not directly due to the lack of N- acetylation of Trm1-II; rather it could be due to an indirect effect of the failure to N- acetylate a different protein important for targeting Trm1-II to the INM or to a protein involved in the INM composition. As described above, since N-terminal acetylation affects not only subcellular localization of proteins but also globally influence many aspects of proteins such as stability and activity, it is possible that N- acetylation impinges lipid biosynthesis or transport machinery and/or interaction
153 between other proteins with Trm1-II resulting in nucleoplasmic mislocalization of
Trm1-II in Nat C disruption cells.
Using protein-lipid overlay assays, I observed that non-functional INM targeting motif Trm1-II mutant, Trm1-II(A147D), rather non-acetylated Trm1-II affects Trm1-
II-lipid interaction in vitro. The data suggest that Trm1-II may interact with lipids via its INM targeting motif. The data also suggest that N-acetylation may indirectly affect Trm1-II INM location. However, Trm1-II(A147D) which contains a single amino acid substitution of Trm1-II, may cause inappropriate folding of Trm1-II and thereby affecting lipid binding. An alternative interpretation for Trm1-II-lipid interactions is that binding to the membrane lipids is not important for Trm1-II to achieve its INM location. Although the favor model is that Trm1 INM targeting motif is important for Trm1-II to interact with membrane lipids thereby facilitating Trm1-
II INM association, further experiments to study whether the INM targeting motif
(Trm1 amino acids 130-151) is sufficient to interact with lipids are required to confirm this hypothesis.
5.6 The spindle pole body and Trm1-II INM targeting
Murthi and Hopper (2005) conducted a genome-wide screen to characterize
Trm1-II INM targeting mechanism by using yeast unessential gene collection. They successfully uncovered that Mak3, Mak10, Mak31, and Ice2 are involved in Trm1-II
INM targeting. To address whether essential yeast genes whose gene products are also important for targeting Trm1-II to the INM, Dr. G. Diaz and T. Harchar used the
154 available collection of temperature sensitive essential yeast genes to screen Trm1-
II-GFP location. They found that loss of function of gene products for spindle pole body (SPB) components cause aberrant distribution of Trm1-II-GFP. Dr. G. Diaz further identified that Trm1-II-GFP locates close to the junction between the ER and the ONM (ER/ONM) in cells that possess mutations of SPB components (Dr. G. Diaz unpublished). The data suggest that Trm1-II might associate to the ER/ONM before entering the nucleus to associate with the INM. As the ER is continuous with the NE and comprises many different phospholipids and Trm1-II-GFP interacts with several phospholipids in vitro, it is possible that Trm1-II-GFP may associate with the
ER/ONM before nuclear import. However, using rna1-1 ts strain, Dr. Murthi demonstrated that Trm1-II-GFP locates to the cytoplasm and mitochondria rather the ER with the defect in Ran-dependent nuclear import pathway (Lai et al., 2009).
This indicates that Trm1-II may not associate with the ER/ONM before entering the nucleus. Trm1-II-GFP ER/ONM location may be due to the effects of mutations of
SPB components. A recent study showed that one of the SPB components, Mps3, is important for nuclear membrane morphology and lipid biosynthesis in yeast
(Friederichs et al., 2011). Mutation or deletion of MPS3 causes nuclear membrane expansion and aberrant lipid levels in cells (Friederichs et al., 2011). It is possible that cells containing mutations of SPB components have defects in the nuclear morphology and contain abnormal lipid composition in the ER and nuclear membrane resulting in the ER/ONM location of Trm1-II-GFP. Dr. G. Diaz also observed that Trm1-II(A147D)-GFP (a Trm1-II mutant with non functional INM
155 targeting motif) distributes in the nucleoplasm rather than tethers to the ER/NE in the SPB ts mutant (Dr. G. Diaz unpublished). Since Trm1-II(A147D)-GFP has less affinity to interact with lipids than Trm1-II-GFP and it locates to the nucleoplasm in wild-type cells , it seems possible that Trm1-II(A147D) is not able to associate with
ER and nuclear membrane structures and distributes in the nucleoplasm after being translocated to the nucleus in the SPB ts mutants.
In sum, using genetic, biochemical, and fluorescent microscopy approaches, I defined an INM targeting motif that is necessary and sufficient for Trm1-II to associate with the INM and uncovered that Trm1-II directly interacts with lipids in vitro, although further investigation of how Trm1-II-lipids interaction facilitates
Trm1-II INM location are required to understand the targeting mechanism. Based on this study, I propose a model for Trm1-II INM targeting: 1) Trm1-II is synthesized in the cytoplasm; 2) Trm1-II is either directed to associate with the
ER/NE (similar to integral INM proteins) or directed to the NPC (similar to soluble nuclear proteins) before entering the nucleus upon Ran-dependent pathway; 3)
Trm1-II is translocated to the nucleus though the central channel of the NPC with assistance of karyopherins; 4) Trm1-II targets to the INM by using INM targeting motif and interacts with lipids at the INM; 5) Trm1-II interacts with Trm1-II to form dimers or polymers of Trm1-II to facilitate Trm1-II INM distribution.
156
Bibliography
Aebi, U., Cohn, J., Buhle, L., and Gerace, L. (1986). The nuclear lamina is a meshwork of intermediate-type filaments. Nature 323, 560-564.
Aguilar, R.C., Ohno, H., Roche, K.W., and Bonifacino, J.S. (1997). Functional domain mapping of the clathrin-associated adaptor medium chains mu1 and mu2. The
Journal of biological chemistry 272, 27160-27166.
Aitchison, J.D., Rout, M.P., Marelli, M., Blobel, G., and Wozniak, R.W. (1995). Two novel related yeast nucleoporins Nup170p and Nup157p: complementation with the vertebrate homologue Nup155p and functional interactions with the yeast nuclear pore-membrane protein Pom152p. J Cell Biol 131, 1133-1148.
Alber, F., Dokudovskaya, S., Veenhoff, L.M., Zhang, W., Kipper, J., Devos, D., Suprapto,
A., Karni-Schmidt, O., Williams, R., Chait, B.T., et al. (2007a). Determining the architectures of macromolecular assemblies. Nature 450, 683-694.
Alber, F., Dokudovskaya, S., Veenhoff, L.M., Zhang, W., Kipper, J., Devos, D., Suprapto,
A., Karni-Schmidt, O., Williams, R., Chait, B.T., et al. (2007b). The molecular architecture of the nuclear pore complex. Nature 450, 695-701.
157 Alcazar-Roman, A.R., Tran, E.J., Guo, S., and Wente, S.R. (2006). Inositol hexakisphosphate and Gle1 activate the DEAD-box protein Dbp5 for nuclear mRNA export. Nature cell biology 8, 711-716.
Alcazar-Roman, A.R., and Wente, S.R. (2008). Inositol polyphosphates: a new frontier for regulating gene expression. Chromosoma 117, 1-13.
Amar-Costesec, A., Beaufay, H., Wibo, M., Thines-Sempoux, D., Feytmans, E., Robbi,
M., and Berthet, J. (1974). Analytical study of microsomes and isolated subcellular membranes from rat liver. II. Preparation and composition of the microsomal fraction. J Cell Biol 61, 201-212.
Antonin, W., Ungricht, R., and Kutay, U. (2011). Traversing the NPC along the pore membrane: targeting of membrane proteins to the INM. Nucleus 2, 87-91.
Arifuzzaman, M., Maeda, M., Itoh, A., Nishikata, K., Takita, C., Saito, R., Ara, T.,
Nakahigashi, K., Huang, H.C., Hirai, A., et al. (2006). Large-scale identification of protein-protein interaction of Escherichia coli K-12. Genome research 16, 686-691.
Arnesen, T., Van Damme, P., Polevoda, B., Helsens, K., Evjenth, R., Colaert, N.,
Varhaug, J.E., Vandekerckhove, J., Lillehaug, J.R., Sherman, F., et al. (2009).
Proteomics analyses reveal the evolutionary conservation and divergence of N- terminal acetyltransferases from yeast and humans. Proceedings of the National
Academy of Sciences of the United States of America 106, 8157-8162.
Behnia, R., Barr, F.A., Flanagan, J.J., Barlowe, C., and Munro, S. (2007). The yeast orthologue of GRASP65 forms a complex with a coiled-coil protein that contributes to ER to Golgi traffic. J Cell Biol 176, 255-261.
158 Behnia, R., Panic, B., Whyte, J.R., and Munro, S. (2004). Targeting of the Arf-like
GTPase Arl3p to the Golgi requires N-terminal acetylation and the membrane protein Sys1p. Nature cell biology 6, 405-413.
Belgareh, N., and Doye, V. (1997). Dynamics of nuclear pore distribution in nucleoporin mutant yeast cells. J Cell Biol 136, 747-759.
Ben-Aroya, S., Coombes, C., Kwok, T., O'Donnell, K.A., Boeke, J.D., and Hieter, P.
(2008). Toward a comprehensive temperature-sensitive mutant repository of the essential genes of Saccharomyces cerevisiae. Molecular cell 30, 248-258.
Bergmann, J.E., and Singer, S.J. (1983). Immunoelectron microscopic studies of the intracellular transport of the membrane glycoprotein (G) of vesicular stomatitis virus in infected Chinese hamster ovary cells. J Cell Biol 97, 1777-1787.
Blumenthal, R., Clague, M.J., Durell, S.R. and Epand, R.M. (2003)
Membrane fusion. Chem. Rev. 103, 53–69
Brachner, A., and Foisner, R. (2011). Evolvement of LEM proteins as chromatin tethers at the nuclear periphery. Biochemical Society transactions 39, 1735-1741.
Braunagel, S.C., Williamson, S.T., Ding, Q., Wu, X., and Summers, M.D. (2007). Early sorting of inner nuclear membrane proteins is conserved. Proceedings of the
National Academy of Sciences of the United States of America 104, 9307-9312.
Briggs, S.D., Xiao, T., Sun, Z.W., Caldwell, J.A., Shabanowitz, J., Hunt, D.F., Allis, C.D., and Strahl, B.D. (2002). Gene silencing: trans-histone regulatory pathway in chromatin. Nature 418, 498.
159 Burke, B., and Stewart, C.L. (2002). Life at the edge: the nuclear envelope and human disease. Nat Rev Mol Cell Biol 3, 575-585.
Burns, L.T., and Wente, S.R. (2012). Trafficking to uncharted territory of the nuclear envelope. Current opinion in cell biology 24, 341-349.
Butland, G., Peregrin-Alvarez, J.M., Li, J., Yang, W., Yang, X., Canadien, V., Starostine,
A., Richards, D., Beattie, B., Krogan, N., et al. (2005). Interaction network containing conserved and essential protein complexes in Escherichia coli. Nature 433, 531-537.
Butler, G.S., and Overall, C.M. (2009). Proteomic identification of multitasking proteins in unexpected locations complicates drug targeting. Nature reviews Drug discovery 8, 935-948.
Butterfield-Gerson, K.L., Scheifele, L.Z., Ryan, E.P., Hopper, A.K., and Parent, L.J.
(2006). Importin-beta family members mediate alpharetrovirus gag nuclear entry via interactions with matrix and nucleocapsid. Journal of virology 80, 1798-1806.
Cai, M., Huang, Y., Ghirlando, R., Wilson, K.L., Craigie, R., and Clore, G.M. (2001).
Solution structure of the constant region of nuclear envelope protein LAP2 reveals two LEM-domain structures: one binds BAF and the other binds DNA. The EMBO journal 20, 4399-4407.
Cai, M., Huang, Y., Suh, J.Y., Louis, J.M., Ghirlando, R., Craigie, R., and Clore, G.M.
(2007). Solution NMR structure of the barrier-to-autointegration factor-Emerin complex. The Journal of biological chemistry 282, 14525-14535.
160 Callan, H.G., and Tomlin, S.G. (1950). Experimental studies on amphibian oocyte nuclei. I. Investigation of the structure of the nuclear membrane by means of the electron microscope. Proc R Soc Lond B Biol Sci 137, 367-378.
Chi, Y.H., Haller, K., Peloponese, J.M., Jr., and Jeang, K.T. (2007). Histone acetyltransferase hALP and nuclear membrane protein hsSUN1 function in de- condensation of mitotic chromosomes. The Journal of biological chemistry 282,
27447-27458.
Chikashige, Y., Tsutsumi, C., Yamane, M., Okamasa, K., Haraguchi, T., and Hiraoka, Y.
(2006). Meiotic proteins bqt1 and bqt2 tether telomeres to form the bouquet arrangement of chromosomes. Cell 125, 59-69.
Chow, K.H., Factor, R.E., and Ullman, K.S. (2012). The nuclear envelope environment and its cancer connections. Nat Rev Cancer 12, 196-209.
Ciechanover, A., and Ben-Saadon, R. (2004). N-terminal ubiquitination: more protein substrates join in. Trends in cell biology 14, 103-106.
Cook, A., Bono, F., Jinek, M., and Conti, E. (2007). Structural biology of nucleocytoplasmic transport. Annual review of biochemistry 76, 647-671.
Corbett, A.H., Koepp, D.M., Schlenstedt, G., Lee, M.S., Hopper, A.K., and Silver, P.A.
(1995). Rna1p, a Ran/TC4 GTPase activating protein, is required for nuclear import.
J Cell Biol 130, 1017-1026.
Crisp, M., Liu, Q., Roux, K., Rattner, J.B., Shanahan, C., Burke, B., Stahl, P.D., and
Hodzic, D. (2006). Coupling of the nucleus and cytoplasm: role of the LINC complex. J
Cell Biol 172, 41-53.
161 Cronshaw, J.M., Krutchinsky, A.N., Zhang, W., Chait, B.T., and Matunis, M.J. (2002).
Proteomic analysis of the mammalian nuclear pore complex. J Cell Biol 158, 915-
927.
Dechat, T., Pfleghaar, K., Sengupta, K., Shimi, T., Shumaker, D.K., Solimando, L., and
Goldman, R.D. (2008). Nuclear lamins: major factors in the structural organization and function of the nucleus and chromatin. Genes & development 22, 832-853.
Ding, X., Xu, R., Yu, J., Xu, T., Zhuang, Y., and Han, M. (2007). SUN1 is required for telomere attachment to nuclear envelope and gametogenesis in mice.
Developmental cell 12, 863-872.
Dingwall, C., Robbins, J., Dilworth, S.M., Roberts, B., and Richardson, W.D. (1988).
The nucleoplasmin nuclear location sequence is larger and more complex than that of SV-40 large T antigen. J Cell Biol 107, 841-849.
Dokudovskaya, S., Waharte, F., Schlessinger, A., Pieper, U., Devos, D.P., Cristea, I.M.,
Williams, R., Salamero, J., Chait, B.T., Sali, A., et al. (2011). A conserved coatomer- related complex containing Sec13 and Seh1 dynamically associates with the vacuole in Saccharomyces cerevisiae. Molecular & cellular proteomics : MCP 10, M110
006478.
Doucet, C.M., and Hetzer, M.W. (2010). Nuclear pore biogenesis into an intact nuclear envelope. Chromosoma 119, 469-477.
Dover, J., Schneider, J., Tawiah-Boateng, M.A., Wood, A., Dean, K., Johnston, M., and
Shilatifard, A. (2002). Methylation of histone H3 by COMPASS requires
162 ubiquitination of histone H2B by Rad6. The Journal of biological chemistry 277,
28368-28371.
Drin, G., and Antonny, B. (2010). Amphipathic helices and membrane curvature.
FEBS letters 584, 1840-1847.
Drin, G., Casella, J.F., Gautier, R., Boehmer, T., Schwartz, T.U., and Antonny, B. (2007).
A general amphipathic alpha-helical motif for sensing membrane curvature. Nature structural & molecular biology 14, 138-146.
Ellis, S.R., Hopper, A.K., and Martin, N.C. (1987). Amino-terminal extension generated from an upstream AUG codon is not required for mitochondrial import of yeast N2,N2-dimethylguanosine-specific tRNA methyltransferase. Proceedings of the National Academy of Sciences of the United States of America 84, 5172-5176.
Ellis, S.R., Hopper, A.K., and Martin, N.C. (1989). Amino-terminal extension generated from an upstream AUG codon increases the efficiency of mitochondrial import of yeast N2,N2-dimethylguanosine-specific tRNA methyltransferases.
Molecular and cellular biology 9, 1611-1620.
Ellis, S.R., Morales, M.J., Li, J.M., Hopper, A.K., and Martin, N.C. (1986). Isolation and characterization of the TRM1 locus, a gene essential for the N2,N2- dimethylguanosine modification of both mitochondrial and cytoplasmic tRNA in
Saccharomyces cerevisiae. The Journal of biological chemistry 261, 9703-9709.
Enoch, T., Peter, M., Nurse, P., and Nigg, E.A. (1991). p34cdc2 acts as a lamin kinase in fission yeast. J Cell Biol 112, 797-807.
163 Estrada de Martin, P., Du, Y., Novick, P., and Ferro-Novick, S. (2005). Ice2p is important for the distribution and structure of the cortical ER network in
Saccharomyces cerevisiae. J Cell Sci 118, 65-77.
Ewing, R.M., Chu, P., Elisma, F., Li, H., Taylor, P., Climie, S., McBroom-Cerajewski, L.,
Robinson, M.D., O'Connor, L., Li, M., et al. (2007). Large-scale mapping of human protein-protein interactions by mass spectrometry. Molecular systems biology 3, 89.
Feldherr, C.M., and Akin, D. (1997). The location of the transport gate in the nuclear pore complex. J Cell Sci 110 ( Pt 24), 3065-3070.
Fernandez-Martinez, J., and Rout, M.P. (2009). Nuclear pore complex biogenesis.
Current opinion in cell biology 21, 603-612.
Fischer, J.A., Acosta, S., Kenny, A., Cater, C., Robinson, C., and Hook, J. (2004).
Drosophila klarsicht has distinct subcellular localization domains for nuclear envelope and microtubule localization in the eye. Genetics 168, 1385-1393.
Flick, J.S., and Thorner, J. (1993). Genetic and biochemical characterization of a phosphatidylinositol-specific phospholipase C in Saccharomyces cerevisiae.
Molecular and cellular biology 13, 5861-5876.
Franke, W.W., Scheer, U., Krohne, G., and Jarasch, E.D. (1981). The nuclear envelope and the architecture of the nuclear periphery. J Cell Biol 91, 39s-50s.
Fridkin, A., Mills, E., Margalit, A., Neufeld, E., Lee, K.K., Feinstein, N., Cohen, M.,
Wilson, K.L., and Gruenbaum, Y. (2004). Matefin, a Caenorhabditis elegans germ line-specific SUN-domain nuclear membrane protein, is essential for early
164 embryonic and germ cell development. Proceedings of the National Academy of
Sciences of the United States of America 101, 6987-6992.
Fried, H., and Kutay, U. (2003). Nucleocytoplasmic transport: taking an inventory.
Cellular and molecular life sciences : CMLS 60, 1659-1688.
Friederichs J.M., Ghosh S., Smoyer C.J., McCroskey S., Miller B.D., Weaver K.J.,
Delventhal K.M., Unruh J., Slaughter B.D., and Jaspersen S.L. (2011). The SUN protein
Mps3 is required for spindle pole body insertion into the nuclear membrane and nuclear envelope homeostasis. PLoS Genet 7(11): e1002365
Furukawa, K. (1999). LAP2 binding protein 1 (L2BP1/BAF) is a candidate mediator of LAP2-chromatin interaction. J Cell Sci 112 ( Pt 15), 2485-2492.
Furukawa, K., Fritze, C.E., and Gerace, L. (1998). The major nuclear envelope targeting domain of LAP2 coincides with its lamin binding region but is distinct from its chromatin interaction domain. The Journal of biological chemistry 273, 4213-
4219.
Furukawa, K., Pante, N., Aebi, U., and Gerace, L. (1995). Cloning of a cDNA for lamina- associated polypeptide 2 (LAP2) and identification of regions that specify targeting to the nuclear envelope. The EMBO journal 14, 1626-1636.
Gavin, A.C., Aloy, P., Grandi, P., Krause, R., Boesche, M., Marzioch, M., Rau, C., Jensen,
L.J., Bastuck, S., Dumpelfeld, B., et al. (2006). Proteome survey reveals modularity of the yeast cell machinery. Nature 440, 631-636.
165 Gavin, A.C., Bosche, M., Krause, R., Grandi, P., Marzioch, M., Bauer, A., Schultz, J., Rick,
J.M., Michon, A.M., Cruciat, C.M., et al. (2002). Functional organization of the yeast proteome by systematic analysis of protein complexes. Nature 415, 141-147.
Gelperin, D.M., White, M.A., Wilkinson, M.L., Kon, Y., Kung, L.A., Wise, K.J., Lopez-
Hoyo, N., Jiang, L., Piccirillo, S., Yu, H., et al. (2005). Biochemical and genetic analysis of the yeast proteome with a movable ORF collection. Genes & development 19,
2816-2826.
Georgatos, S.D., Maroulakou, I., and Blobel, G. (1989). Lamin A, lamin B, and lamin B receptor analogues in yeast. J Cell Biol 108, 2069-2082.
Gloeckner, C.J., Boldt, K., Schumacher, A., Roepman, R., and Ueffing, M. (2007). A novel tandem affinity purification strategy for the efficient isolation and characterisation of native protein complexes. Proteomics 7, 4228-4234.
Goldfarb, D.S., Gariepy, J., Schoolnik, G., and Kornberg, R.D. (1986). Synthetic peptides as nuclear localization signals. Nature 322, 641-644.
Goldman, A.E., Moir, R.D., Montag-Lowy, M., Stewart, M., and Goldman, R.D. (1992).
Pathway of incorporation of microinjected lamin A into the nuclear envelope. J Cell
Biol 119, 725-735.
Goldman, R.D., Gruenbaum, Y., Moir, R.D., Shumaker, D.K., and Spann, T.P. (2002).
Nuclear lamins: building blocks of nuclear architecture. Genes & development 16,
533-547.
Gorlich, D., and Kutay, U. (1999). Transport between the cell nucleus and the cytoplasm. Annu Rev Cell Dev Biol 15, 607-660.
166 Grandi, P., Doye, V., and Hurt, E.C. (1993). Purification of NSP1 reveals complex formation with 'GLFG' nucleoporins and a novel nuclear pore protein NIC96. The
EMBO journal 12, 3061-3071.
Grosjean, H., Szweykowska-Kulinska, Z., Motorin, Y., Fasiolo, F., and Simos, G. (1997).
Intron-dependent enzymatic formation of modified nucleosides in eukaryotic tRNAs: a review. Biochimie 79, 293-302.
Grosshans, H., Lecointe, F., Grosjean, H., Hurt, E., and Simos, G. (2001). Pus1p- dependent tRNA pseudouridinylation becomes essential when tRNA biogenesis is compromised in yeast. The Journal of biological chemistry 276, 46333-46339.
Gruenbaum, Y., Margalit, A., Goldman, R.D., Shumaker, D.K., and Wilson, K.L. (2005).
The nuclear lamina comes of age. Nat Rev Mol Cell Biol 6, 21-31.
Haque, F., Lloyd, D.J., Smallwood, D.T., Dent, C.L., Shanahan, C.M., Fry, A.M.,
Trembath, R.C., and Shackleton, S. (2006). SUN1 interacts with nuclear lamin A and cytoplasmic nesprins to provide a physical connection between the nuclear lamina and the cytoskeleton. Molecular and cellular biology 26, 3738-3751.
Hasan, S., Guttinger, S., Muhlhausser, P., Anderegg, F., Burgler, S., and Kutay, U.
(2006). Nuclear envelope localization of human UNC84A does not require nuclear lamins. FEBS letters 580, 1263-1268.
Heessen, S., and Fornerod, M. (2007). The inner nuclear envelope as a transcription factor resting place. EMBO reports 8, 914-919.
Hennekes, H., and Nigg, E.A. (1994). The role of isoprenylation in membrane attachment of nuclear lamins. A single point mutation prevents proteolytic cleavage
167 of the lamin A precursor and confers membrane binding properties. J Cell Sci 107 (
Pt 4), 1019-1029.
Henry, S.A., Kohlwein, S.D., and Carman, G.M. (2012). Metabolism and regulation of glycerolipids in the yeast Saccharomyces cerevisiae. Genetics 190, 317-349.
Hetzer, M., Meyer, H.H., Walther, T.C., Bilbao-Cortes, D., Warren, G., and Mattaj, I.W.
(2001). Distinct AAA-ATPase p97 complexes function in discrete steps of nuclear assembly. Nature cell biology 3, 1086-1091.
Hetzer, M.W., Walther, T.C., and Mattaj, I.W. (2005). Pushing the envelope: structure, function, and dynamics of the nuclear periphery. Annu Rev Cell Dev Biol 21, 347-
380.
Hetzer, M.W., and Wente, S.R. (2009). Border control at the nucleus: biogenesis and organization of the nuclear membrane and pore complexes. Developmental cell 17,
606-616.
Hofmann, I., and Munro, S. (2006). An N-terminally acetylated Arf-like GTPase is localised to lysosomes and affects their motility. J Cell Sci 119, 1494-1503.
Hopper, A.K., Traglia, H.M., and Dunst, R.W. (1990). The yeast RNA1 gene product necessary for RNA processing is located in the cytosol and apparently excluded from the nucleus. J Cell Biol 111, 309-321.
Huh, W.K., Falvo, J.V., Gerke, L.C., Carroll, A.S., Howson, R.W., Weissman, J.S., and
O'Shea, E.K. (2003). Global analysis of protein localization in budding yeast. Nature
425, 686-691.
168 Hung, M.C., and Link, W. (2011). Protein localization in disease and therapy. J Cell Sci
124, 3381-3392.
Hurt, E.C. (1988). A novel nucleoskeletal-like protein located at the nuclear periphery is required for the life cycle of Saccharomyces cerevisiae. The EMBO journal 7, 4323-4334.
Hwang, W.W., Venkatasubrahmanyam, S., Ianculescu, A.G., Tong, A., Boone, C., and
Madhani, H.D. (2003). A conserved RING finger protein required for histone H2B monoubiquitination and cell size control. Molecular cell 11, 261-266.
Ihsanawati, Nishimoto, M., Higashijima, K., Shirouzu, M., Grosjean, H., Bessho, Y., and
Yokoyama, S. (2008). Crystal structure of tRNA N2,N2-guanosine dimethyltransferase Trm1 from Pyrococcus horikoshii. Journal of molecular biology
383, 871-884.
Jacobson, R.H., Zhang, X.J., DuBose, R.F., and Matthews, B.W. (1994). Three- dimensional structure of beta-galactosidase from E. coli. Nature 369, 761-766.
Jones, G.M., Stalker, J., Humphray, S., West, A., Cox, T., Rogers, J., Dunham, I., and
Prelich, G. (2008). A systematic library for comprehensive overexpression screens in Saccharomyces cerevisiae. Nature methods 5, 239-241.
Jornvall, H. (1975). Acetylation of Protein N-terminal amino groups structural observations on alpha-amino acetylated proteins. Journal of theoretical biology 55,
1-12.
169 Kao, C.F., Hillyer, C., Tsukuda, T., Henry, K., Berger, S., and Osley, M.A. (2004). Rad6 plays a role in transcriptional activation through ubiquitylation of histone H2B.
Genes & development 18, 184-195.
Keminer, O., and Peters, R. (1999). Permeability of single nuclear pores. Biophysical journal 77, 217-228.
King, M.C., Drivas, T.G., and Blobel, G. (2008). A network of nuclear envelope membrane proteins linking centromeres to microtubules. Cell 134, 427-438.
King, M.C., Lusk, C.P., and Blobel, G. (2006). Karyopherin-mediated import of integral inner nuclear membrane proteins. Nature 442, 1003-1007.
Krogan, N.J., Cagney, G., Yu, H., Zhong, G., Guo, X., Ignatchenko, A., Li, J., Pu, S., Datta,
N., Tikuisis, A.P., et al. (2006). Global landscape of protein complexes in the yeast
Saccharomyces cerevisiae. Nature 440, 637-643.
Krogan, N.J., Peng, W.T., Cagney, G., Robinson, M.D., Haw, R., Zhong, G., Guo, X., Zhang,
X., Canadien, V., Richards, D.P., et al. (2004). High-definition macromolecular composition of yeast RNA-processing complexes. Molecular cell 13, 225-239.
Kupke, T., Di Cecco, L., Muller, H.M., Neuner, A., Adolf, F., Wieland, F., Nickel, W., and
Schiebel, E. (2011). Targeting of Nbp1 to the inner nuclear membrane is essential for spindle pole body duplication. The EMBO journal 30, 3337-3352.
Laguri, C., Gilquin, B., Wolff, N., Romi-Lebrun, R., Courchay, K., Callebaut, I., Worman,
H.J., and Zinn-Justin, S. (2001). Structural characterization of the LEM motif common to three human inner nuclear membrane proteins. Structure 9, 503-511.
170 Lai, T.P., Stauffer, K.A., Murthi, A., Shaheen, H.H., Peng, G., Martin, N.C., and Hopper,
A.K. (2009). Mechanism and a peptide motif for targeting peripheral proteins to the yeast inner nuclear membrane. Traffic 10, 1243-1256.
Lee, K.K., Haraguchi, T., Lee, R.S., Koujin, T., Hiraoka, Y., and Wilson, K.L. (2001).
Distinct functional domains in emerin bind lamin A and DNA-bridging protein BAF. J
Cell Sci 114, 4567-4573.
Lee, K.K., Starr, D., Cohen, M., Liu, J., Han, M., Wilson, K.L., and Gruenbaum, Y. (2002).
Lamin-dependent localization of UNC-84, a protein required for nuclear migration in
Caenorhabditis elegans. Molecular biology of the cell 13, 892-901.
Li, Z., Vizeacoumar, F.J., Bahr, S., Li, J., Warringer, J., Vizeacoumar, F.S., Min, R.,
Vandersluis, B., Bellay, J., Devit, M., et al. (2011). Systematic exploration of essential yeast gene function with temperature-sensitive mutants. Nature biotechnology 29,
361-367.
Lippincott-Schwartz, J., Roberts, T.H. and Hirschberg, K. (2000) Secretory protein trafficking and organelle dynamics in living cells. Annu. Rev. Cell
Dev. Biol. 16, 557–589
Liu, H.L., De Souza, C.P., Osmani, A.H., and Osmani, S.A. (2009). The three fungal transmembrane nuclear pore complex proteins of Aspergillus nidulans are dispensable in the presence of an intact An-Nup84-120 complex. Molecular biology of the cell 20, 616-630.
171 Loewinger, L., and McKeon, F. (1988). Mutations in the nuclear lamin proteins resulting in their aberrant assembly in the cytoplasm. The EMBO journal 7, 2301-
2309.
Lusk, C.P., Blobel, G., and King, M.C. (2007). Highway to the inner nuclear membrane: rules for the road. Nat Rev Mol Cell Biol 8, 414-420.
Madrid, A.S., and Weis, K. (2006). Nuclear transport is becoming crystal clear.
Chromosoma 115, 98-109.
Mansharamani, M., and Wilson, K.L. (2005). Direct binding of nuclear membrane protein MAN1 to emerin in vitro and two modes of binding to barrier-to- autointegration factor. The Journal of biological chemistry 280, 13863-13870.
Maraldi, N.M., Capanni, C., Cenni, V., Fini, M., and Lattanzi, G. (2011). Laminopathies and lamin-associated signaling pathways. Journal of cellular biochemistry 112, 979-
992.
Martini, E.M., Keeney, S., and Osley, M.A. (2002). A role for histone H2B during repair of UV-induced DNA damage in Saccharomyces cerevisiae. Genetics 160, 1375-
1387.
Massenet, S., Motorin, Y., Lafontaine, D.L., Hurt, E.C., Grosjean, H., and Branlant, C.
(1999). Pseudouridine mapping in the Saccharomyces cerevisiae spliceosomal U small nuclear RNAs (snRNAs) reveals that pseudouridine synthase pus1p exhibits a dual substrate specificity for U2 snRNA and tRNA. Molecular and cellular biology 19,
2142-2154.
172 Mattout, A., Goldberg, M., Tzur, Y., Margalit, A., and Gruenbaum, Y. (2007). Specific and conserved sequences in D. melanogaster and C. elegans lamins and histone H2A mediate the attachment of lamins to chromosomes. J Cell Sci 120, 77-85.
McGee, M.D., Rillo, R., Anderson, A.S., and Starr, D.A. (2006). UNC-83 IS a KASH protein required for nuclear migration and is recruited to the outer nuclear membrane by a physical interaction with the SUN protein UNC-84. Molecular biology of the cell 17, 1790-1801.
Moreland, R.B., Langevin, G.L., Singer, R.H., Garcea, R.L., and Hereford, L.M. (1987).
Amino acid sequences that determine the nuclear localization of yeast histone 2B.
Molecular and cellular biology 7, 4048-4057.
Mousley, C.J., Yuan, P., Gaur, N.A., Trettin, K.D., Nile, A.H., Deminoff, S.J., Dewar, B.J.,
Wolpert, M., Macdonald, J.M., Herman, P.K., et al. (2012). A sterol-binding protein integrates endosomal lipid metabolism with TOR signaling and nitrogen sensing.
Cell 148, 702-715.
Murthi, A., and Hopper, A.K. (2005). Genome-wide screen for inner nuclear membrane protein targeting in Saccharomyces cerevisiae: roles for N-acetylation and an integral membrane protein. Genetics 170, 1553-1560.
Murthi, A., Shaheen, H.H., Huang, H.Y., Preston, M.A., Lai, T.P., Phizicky, E.M., and
Hopper, A.K. (2010). Regulation of tRNA bidirectional nuclear-cytoplasmic trafficking in Saccharomyces cerevisiae. Molecular biology of the cell 21, 639-649.
173 Nehrbass, U., Kern, H., Mutvei, A., Horstmann, H., Marshallsay, B., and Hurt, E.C.
(1990). NSP1: a yeast nuclear envelope protein localized at the nuclear pores exerts its essential function by its carboxy-terminal domain. Cell 61, 979-989.
Neupert, W. (1997). Protein import into mitochondria. Annual review of biochemistry 66, 863-917.
Niepel, M., Strambio-de-Castillia, C., Fasolo, J., Chait, B.T., and Rout, M.P. (2005). The nuclear pore complex-associated protein, Mlp2p, binds to the yeast spindle pole body and promotes its efficient assembly. J Cell Biol 170, 225-235.
Odom, A.R., Stahlberg, A., Wente, S.R., and York, J.D. (2000). A role for nuclear inositol 1,4,5-trisphosphate kinase in transcriptional control. Science 287, 2026-
2029.
Oeffinger, M., Zenklusen, D., Ferguson, A., Wei, K.E., El Hage, A., Tollervey, D., Chait,
B.T., Singer, R.H., and Rout, M.P. (2009). Rrp17p is a eukaryotic exonuclease required for 5' end processing of Pre-60S ribosomal RNA. Molecular cell 36, 768-
781.
Okamura, K., Kimata, Y., Higashio, H., Tsuru, A., and Kohno, K. (2000). Dissociation of
Kar2p/BiP from an ER sensory molecule, Ire1p, triggers the unfolded protein response in yeast. Biochemical and biophysical research communications 279, 445-
450.
Oza, P., Jaspersen, S.L., Miele, A., Dekker, J., and Peterson, C.L. (2009). Mechanisms that regulate localization of a DNA double-strand break to the nuclear periphery.
Genes & development 23, 912-927.
174 Paltauf, F., and Daum, G. (1992). Phospholipid transfer proteins from yeast. Methods in enzymology 209, 514-522.
Parnaik, V.K. (2008). Role of nuclear lamins in nuclear organization, cellular signaling, and inherited diseases. International review of cell and molecular biology
266, 157-206.
Pathak, R.K., Luskey, K.L., and Anderson, R.G. (1986). Biogenesis of the crystalloid endoplasmic reticulum in UT-1 cells: evidence that newly formed endoplasmic reticulum emerges from the nuclear envelope. J Cell Biol 102, 2158-2168.
Patterson, K., Molofsky, A.B., Robinson, C., Acosta, S., Cater, C., and Fischer, J.A.
(2004). The functions of Klarsicht and nuclear lamin in developmentally regulated nuclear migrations of photoreceptor cells in the Drosophila eye. Molecular biology of the cell 15, 600-610.
Payne, W.E., and Fitzgerald-Hayes, M. (1993). A mutation in PLC1, a candidate phosphoinositide-specific phospholipase C gene from Saccharomyces cerevisiae, causes aberrant mitotic chromosome segregation. Molecular and cellular biology 13,
4351-4364.
Pesaresi, P., Gardner, N.A., Masiero, S., Dietzmann, A., Eichacker, L., Wickner, R.,
Salamini, F., and Leister, D. (2003). Cytoplasmic N-terminal protein acetylation is required for efficient photosynthesis in Arabidopsis. The Plant cell 15, 1817-1832.
Petranovic, D., and Nielsen, J. (2008). Can yeast systems biology contribute to the understanding of human disease? Trends in biotechnology 26, 584-590.
175 Pfanner, N. (2000). Protein sorting: recognizing mitochondrial presequences. Curr
Biol 10, R412-415.
Pintard, L., Lecointe, F., Bujnicki, J.M., Bonnerot, C., Grosjean, H., and Lapeyre, B.
(2002). Trm7p catalyses the formation of two 2'-O-methylriboses in yeast tRNA anticodon loop. The EMBO journal 21, 1811-1820.
Polevoda, B., and Sherman, F. (2003). Composition and function of the eukaryotic N- terminal acetyltransferase subunits. Biochemical and biophysical research communications 308, 1-11.
Powers, E.T., Morimoto, R.I., Dillin, A., Kelly, J.W., and Balch, W.E. (2009). Biological and chemical approaches to diseases of proteostasis deficiency. Annual review of biochemistry 78, 959-991.
Pringle, J.R., Adams, A.E., Drubin, D.G., and Haarer, B.K. (1991). Immunofluorescence methods for yeast. Methods in enzymology 194, 565-602.
Puig, O., Caspary, F., Rigaut, G., Rutz, B., Bouveret, E., Bragado-Nilsson, E., Wilm, M., and Seraphin, B. (2001). The tandem affinity purification (TAP) method: a general procedure of protein complex purification. Methods 24, 218-229.
Robzyk, K., Recht, J., and Osley, M.A. (2000). Rad6-dependent ubiquitination of histone H2B in yeast. Science 287, 501-504.
Rogaski, B., Lim, J.B., and Klauda, J.B. (2010). Sterol binding and membrane lipid attachment to the Osh4 protein of yeast. The journal of physical chemistry B 114,
13562-13573.
176 Rojas, A.L., Nagem, R.A., Neustroev, K.N., Arand, M., Adamska, M., Eneyskaya, E.V.,
Kulminskaya, A.A., Garratt, R.C., Golubev, A.M., and Polikarpov, I. (2004). Crystal structures of beta-galactosidase from Penicillium sp. and its complex with galactose.
Journal of molecular biology 343, 1281-1292.
Roller, R.J. (2008). Nuclear egress of herpesviruses. Virol. Sin. 23, 406-415.
Romisch, K. (1999). Surfing the Sec61 channel: bidirectional protein translocation across the ER membrane. J Cell Sci 112 ( Pt 23), 4185-4191.
Rose, A.M., Belford, H.G., Shen, W.C., Greer, C.L., Hopper, A.K., and Martin, N.C.
(1995). Location of N2,N2-dimethylguanosine-specific tRNA methyltransferase.
Biochimie 77, 45-53.
Rose, A.M., Joyce, P.B., Hopper, A.K., and Martin, N.C. (1992). Separate information required for nuclear and subnuclear localization: additional complexity in localizing an enzyme shared by mitochondria and nuclei. Molecular and cellular biology 12,
5652-5658.
Rosenberg-Hasson, Y., Renert-Pasca, M., and Volk, T. (1996). A Drosophila dystrophin-related protein, MSP-300, is required for embryonic muscle morphogenesis. Mechanisms of development 60, 83-94.
Rothman, J.E. (1994) Mechanisms of intracellular protein transport.
Nature 372, 55–63
Rout, M.P., Aitchison, J.D., Suprapto, A., Hjertaas, K., Zhao, Y., and Chait, B.T. (2000).
The yeast nuclear pore complex: composition, architecture, and transport mechanism. J Cell Biol 148, 635-651.
177 Rusinol, A.E., and Sinensky, M.S. (2006). Farnesylated lamins, progeroid syndromes and farnesyl transferase inhibitors. J Cell Sci 119, 3265-3272.
Sakaki, M., Koike, H., Takahashi, N., Sasagawa, N., Tomioka, S., Arahata, K., and
Ishiura, S. (2001). Interaction between emerin and nuclear lamins. Journal of biochemistry 129, 321-327.
Saksena, S., Summers, M.D., Burks, J.K., Johnson, A.E., and Braunagel, S.C. (2006).
Importin-alpha-16 is a translocon-associated protein involved in sorting membrane proteins to the nuclear envelope. Nature structural & molecular biology 13, 500-
508.
Sawin, K.E., Bicho, C.C., and Snaith, H.A. (2010). Inexpensive synthetic-based matrix for both conventional and rapid purification of protein A- and tandem affinity purification-tagged proteins. Analytical biochemistry 397, 241-243.
Schirmer, E.C., and Foisner, R. (2007). Proteins that associate with lamins: many faces, many functions. Exp Cell Res 313, 2167-2179.
Schirmer, E.C., and Gerace, L. (2005). The nuclear membrane proteome: extending the envelope. Trends Biochem Sci 30, 551-558.
Schmidt, O., Pfanner, N., and Meisinger, C. (2010). Mitochondrial protein import: from proteomics to functional mechanisms. Nat Rev Mol Cell Biol 11, 655-667.
Setty, S.R., Strochlic, T.I., Tong, A.H., Boone, C., and Burd, C.G. (2004). Golgi targeting of ARF-like GTPase Arl3p requires its Nalpha-acetylation and the integral membrane protein Sys1p. Nature cell biology 6, 414-419.
178 Shimi, T., Koujin, T., Segura-Totten, M., Wilson, K.L., Haraguchi, T., and Hiraoka, Y.
(2004). Dynamic interaction between BAF and emerin revealed by FRAP, FLIP, and
FRET analyses in living HeLa cells. Journal of structural biology 147, 31-41.
Shumaker, D.K., Lee, K.K., Tanhehco, Y.C., Craigie, R., and Wilson, K.L. (2001). LAP2 binds to BAF.DNA complexes: requirement for the LEM domain and modulation by variable regions. The EMBO journal 20, 1754-1764.
Siniossoglou, S. (2009). Lipins, lipids and nuclear envelope structure. Traffic 10,
1181-1187.
Soullam, B., and Worman, H.J. (1993). The amino-terminal domain of the lamin B receptor is a nuclear envelope targeting signal. J Cell Biol 120, 1093-1100.
Soullam, B., and Worman, H.J. (1995). Signals and structural features involved in integral membrane protein targeting to the inner nuclear membrane. J Cell Biol 130,
15-27.
Speese S.D., Ashley J., Jokhi V., Nunnari J., Barria R., Li Y., Ataman B., Koon A., Chang
YT., Li Q., Moore J.M,. and Budnik V. (2012). Nuclear envelope budding enables large ribonucleoprotein particle export during synaptic Wnt singnaling. Cell 149, 832-846.
Srsen, V., Korfali, N., and Schirmer, E.C. (2011). Nuclear envelope influences on cell- cycle progression. Biochemical Society transactions 39, 1742-1746.
Stanford, D.R., Martin, N.C., and Hopper, A.K. (2000). ADEPTs: information necessary for subcellular distribution of eukaryotic sorting isozymes resides in domains missing from eubacterial and archaeal counterparts. Nucleic Acids Res 28, 383-392.
179 Starheim, K.K., Gevaert, K., and Arnesen, T. (2012). Protein N-terminal acetyltransferases: when the start matters. Trends Biochem Sci 37, 152-161.
Starheim, K.K., Gromyko, D., Evjenth, R., Ryningen, A., Varhaug, J.E., Lillehaug, J.R., and Arnesen, T. (2009). Knockdown of human N alpha-terminal acetyltransferase complex C leads to p53-dependent apoptosis and aberrant human Arl8b localization. Molecular and cellular biology 29, 3569-3581.
Starr, D.A., and Fridolfsson, H.N. (2010). Interactions between nuclei and the cytoskeleton are mediated by SUN-KASH nuclear-envelope bridges. Annu Rev Cell
Dev Biol 26, 421-444.
Starr, D.A., and Han, M. (2002). Role of ANC-1 in tethering nuclei to the actin cytoskeleton. Science 298, 406-409.
Starr, D.A., Hermann, G.J., Malone, C.J., Fixsen, W., Priess, J.R., Horvitz, H.R., and Han,
M. (2001). unc-83 encodes a novel component of the nuclear envelope and is essential for proper nuclear migration. Development 128, 5039-5050.
Stefan, C.J., Manford, A.G., Baird, D., Yamada-Hanff, J., Mao, Y., and Emr, S.D. (2011).
Osh proteins regulate phosphoinositide metabolism at ER-plasma membrane contact sites. Cell 144, 389-401.
Stewart, M. (2007). Molecular mechanism of the nuclear protein import cycle. Nat
Rev Mol Cell Biol 8, 195-208.
Stirling, D.A., Petrie, A., Pulford, D.J., Paterson, D.T., and Stark, M.J. (1992). Protein A- calmodulin fusions: a novel approach for investigating calmodulin function in yeast.
Molecular microbiology 6, 703-713.
180 Strambio-De-Castillia, C., Niepel, M., and Rout, M.P. (2010). The nuclear pore complex: bridging nuclear transport and gene regulation. Nat Rev Mol Cell Biol 11,
490-501.
Strambio-de-Castillia, C., Tetenbaum-Novatt, J., Imai, B.S., Chait, B.T., and Rout, M.P.
(2005). A method for the rapid and efficient elution of native affinity-purified protein A tagged complexes. Journal of proteome research 4, 2250-2256.
Stuurman, N., Heins, S., and Aebi, U. (1998). Nuclear lamins: their structure, assembly, and interactions. Journal of structural biology 122, 42-66.
Suntharalingam, M., and Wente, S.R. (2003). Peering through the pore: nuclear pore complex structure, assembly, and function. Developmental cell 4, 775-789.
Suzuki, R., Shindo, H., Tase, A., Kikuchi, Y., Shimizu, M., and Yamazaki, T. (2009).
Solution structures and DNA binding properties of the N-terminal SAP domains of
SUMO E3 ligases from Saccharomyces cerevisiae and Oryza sativa. Proteins 75, 336-
347.
Taniura, H., Glass, C., and Gerace, L. (1995). A chromatin binding site in the tail domain of nuclear lamins that interacts with core histones. J Cell Biol 131, 33-44.
Terry, L.J., Shows, E.B., and Wente, S.R. (2007). Crossing the nuclear envelope: hierarchical regulation of nucleocytoplasmic transport. Science 318, 1412-1416.
Tokunaga, M., Kawamura, A., and Kohno, K. (1992). Purification and characterization of BiP/Kar2 protein from Saccharomyces cerevisiae. The Journal of biological chemistry 267, 17553-17559.
181 Torrisi, M.R., and Bonatti, S. (1985). Immunocytochemical study of the partition and distribution of Sindbis virus glycoproteins in freeze-fractured membranes of infected baby hamster kidney cells. J Cell Biol 101, 1300-1306.
Van Damme, P., Arnesen, T., and Gevaert, K. (2011). Protein alpha-N-acetylation studied by N-terminomics. The FEBS journal 278, 3822-3834. van Meer, G., Voelker, D.R., and Feigenson, G.W. (2008). Membrane lipids: where they are and how they behave. Nat Rev Mol Cell Biol 9, 112-124.
Weis, K. (2003). Regulating access to the genome: nucleocytoplasmic transport throughout the cell cycle. Cell 112, 441-451.
Wente, S.R. (2000). Gatekeepers of the nucleus. Science 288, 1374-1377.
Wente, S.R., and Rout, M.P. (2010). The nuclear pore complex and nuclear transport.
Cold Spring Harb Perspect Biol 2, a000562.
Wickner, W., and Schekman, R. (2005). Protein translocation across biological membranes. Science 310, 1452-1456.
Wilhelmsen, K., Ketema, M., Truong, H., and Sonnenberg, A. (2006). KASH-domain proteins in nuclear migration, anchorage and other processes. J Cell Sci 119, 5021-
5029.
Wilson, K.L., and Foisner, R. (2010). Lamin-binding Proteins. Cold Spring Harb
Perspect Biol 2, a000554.
Winzeler, E.A., Shoemaker, D.D., Astromoff, A., Liang, H., Anderson, K., Andre, B.,
Bangham, R., Benito, R., Boeke, J.D., Bussey, H., et al. (1999). Functional
182 characterization of the S. cerevisiae genome by gene deletion and parallel analysis.
Science 285, 901-906.
Wolf, J., Schliebs, W., and Erdmann, R. (2010). Peroxisomes as dynamic organelles: peroxisomal matrix protein import. The FEBS journal 277, 3268-3278.
Worman, H.J. (2012). Nuclear lamins and laminopathies. J Pathol 226, 316-325.
Worman, H.J., Yuan, J., Blobel, G., and Georgatos, S.D. (1988). A lamin B receptor in the nuclear envelope. Proceedings of the National Academy of Sciences of the United
States of America 85, 8531-8534.
Yamashita, K., Shinohara, M., and Shinohara, A. (2004). Rad6-Bre1-mediated histone
H2B ubiquitylation modulates the formation of double-strand breaks during meiosis. Proceedings of the National Academy of Sciences of the United States of
America 101, 11380-11385.
Yoko-o, T., Matsui, Y., Yagisawa, H., Nojima, H., Uno, I., and Toh-e, A. (1993). The putative phosphoinositide-specific phospholipase C gene, PLC1, of the yeast
Saccharomyces cerevisiae is important for cell growth. Proceedings of the National
Academy of Sciences of the United States of America 90, 1804-1808.
York, J.D., Odom, A.R., Murphy, R., Ives, E.B., and Wente, S.R. (1999). A phospholipase
C-dependent inositol polyphosphate kinase pathway required for efficient messenger RNA export. Science 285, 96-100.
Yu, J., Starr, D.A., Wu, X., Parkhurst, S.M., Zhuang, Y., Xu, T., Xu, R., and Han, M. (2006).
The KASH domain protein MSP-300 plays an essential role in nuclear anchoring during Drosophila oogenesis. Developmental biology 289, 336-345.
183 Zhen, Y.Y., Libotte, T., Munck, M., Noegel, A.A., and Korenbaum, E. (2002). NUANCE, a giant protein connecting the nucleus and actin cytoskeleton. J Cell Sci 115, 3207-
3222.
Zinser, E., Sperka-Gottlieb, C.D., Fasch, E.V., Kohlwein, S.D., Paltauf, F., and Daum, G.
(1991). Phospholipid synthesis and lipid composition of subcellular membranes in the unicellular eukaryote Saccharomyces cerevisiae. J Bacteriol 173, 2026-2034.
Zuleger, N., Korfali, N., and Schirmer, E.C. (2008). Inner nuclear membrane protein transport is mediated by multiple mechanisms. Biochemical Society transactions 36,
1373-1377.
Zwerger, M., Ho, C.Y., and Lammerding, J. (2011). Nuclear mechanics in disease.
Annu Rev Biomed Eng 13, 397-428.
184