US 20090 137519A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2009/0137519 A1 Krieg et al. (43) Pub. Date: May 28, 2009
(54) SEMI-SOFT C-CLASS Related U.S. Application Data MMUNOSTIMULATORY OLGONUCLEOTDES (62) Division of application No. 1 1/255,100, filed on Oct. 20, 2005. (75) Inventors: Arthur M. Krieg, Wellesley, MA (US); Ulrike Samulowitz (60) Provisional application No. 60/620,759, filed on Oct. Langenfeld (DE); Jorg Vollmer, 20, 2004. Dusseldorf (DE); Eugen Uhlmann, O O Glashuetter (DE) Publication Classification (51) Int. Cl. Correspondence Address: A63L/7088 (2006.01) WOLF GREENFIELD & SACKS, PC. C7H 2L/00 (2006.01) 6OO ATLANTIC AVENUE BOSTON, MA 02210-2206 (US) (52) U.S. Cl...... 514/44; 536/22.1 (73) Assignees: Coley Pharmaceutical Group, (57) ABSTRACT Inc., New York, NY (US); Coley Pharmaceutical GmbH The invention relates to specific C-Class semi-soft CpG Duesseldorf (DE) s immunostimulatory oligonucleotides that are useful for stimulating an immune response. In particular the oligonucle (21) Appl. No.: 12/336,986 otides are useful for treating allergy, such as allergic rhinitis and asthma, cancer and infectious disease. Such as hepatitis B (22) Filed: Dec. 17, 2008 and hepatitis C.
A UNINFECTED UNREATED B VIRUS NFECTED TEST VEHICLE C VIRUS INFECTED SEOD NO:10.03 mg/kg D VIRUS INFECTED SEQID NO:1, 0.3 mg/kg E VIRUSINFECTED SEQID NO:1.3 mg/kg F VIRUSINFECTED SEQID NO2, 0.03 mg/kg G VIRUS INFECTED SEQID NO;2,0.3 mg/kg H VIRUSINFECTED SEQID NO:2, 3 mg/kg I VIRUS INFECTED SEQID NO:3,0.03 mg/kg J VIRUS INFECTED SEQID NO:3,0.3 mg/kg K VIRUS INFECTED SEQID NO:3, 3 mg/kg
NFLUENZAWIRUS LOAD (ABSORBANCE UNITS) 2.5-
2.0-
15
1.O-
0.5- n.d. 0.0-1 r. A B C. D. E F G. H J K Patent Application Publication May 28, 2009 Sheet 1 of 52 US 2009/0137519 A1
SEOID NO:1 SEOID NO:2 E 5000 S3000 40003000- E:2000 1500 is 2000: is 1000 aF 1000O. ! 500O O.O. O.1 O.O1 O.1 1 ODNuM) ODNEM)
SEOID NO:3 SEOID NO:4
E 2500- E 10000 R 2000- R 8000 - g 1500- 6000 1000- 4000
it e 500- E 2000 o O --- O O.O1 0.1 1 O,O1 O.1 1 ODNuM) ODNuM)
SEOID NO:5 SEO ED NO:6
E 2500 E 3000 S. 2000 S. 2500 1500 O 2000 1 OOO - 10001500 D. 500 500 O LE O O.O1 O.1 O.O. O. ODNEuM) ODNuM) N- Ny - Patent Application Publication May 28, 2009 Sheet 2 of 52 US 2009/0137519 A1
NASAL RESESTANCE (cmH2O) mimin1) 150
1.25
OO -& - UNCHALLENGED ... ANTIGENCHALLENGED, TREATED WITH TEST VEHICLE O.75 ANTIGENCHALLENGED, TREATED WITH SEQID NO:71 mg/kg O.50 O 10 20 30 40 TIME AFTER ANTIGEN CHALLENGE (MINUTES) Fig. 2A
NASAL RESISTANCE (cmH2O) milmin) "& UNCHALLENGED 150 . ANTIGENCHALLENGED, 1.25 TREATED WITH TEST VEHICLE ANTIGENCHALLENGED, 1.OO TREATED WITH SEQID NO:7 0.03 mg/kg - ANTIGENCHALLENGED, O.75 TREATED WITH SEQID NO:70.1 mg/kg ANTIGENCHALLENGED, O.50 TREATED WITH SEQID NO:70.3 mg/kg O O 20 30 40 TFMEAFTERANTIGEN CHALLENGE (MINUTES) Fig.2B Patent Application Publication May 28, 2009 Sheet 3 of 52 US 2009/0137519 A1
NUMBER OFSNEEZES (10 MINUTES) 60
50
40
BO
2O
1 O
O UNCHALLENGED ANTIGENCHALLENGED SEOD NO:7 BUDESONIDE O 3 30 300 300 ug/kg ug/kg Fig. 3A NUMBER OF RUBS (10 MINUTES) 16 14 12 1O
UNCHALLENGED ANTIGEN CHALLENGED SEQID NO:7 BUDESONIDE O 3 30 300 BOO lg/kg ug/kg Fig. 3B Patent Application Publication May 28, 2009 Sheet 4 of 52 US 2009/0137519 A1
TOTAL LEUKOCYTES (x103/mi) 2OOO WRUSDOSE 1500 -o- 50 EED50
- A - 500 ED50 SOO
O O 1 3 6 9 14 DAYS AFTER INFECTION Fig. 4 Patent Application Publication May 28, 2009 Sheet 5 of 52 US 2009/0137519 A1
A UNNFECTED UNTREATED B VIRUS INFECTED TEST VEHICLE C VIRUS INFECTED SEQID NO:10.03 mg/kg D VIRUS INFECTED SEQID NO;1, 0.3 mg/kg E VIRUSINFECTED SEQID NO:1, 3 mg/kg F VIRUS INFECTED SEQID NO2, 0.03 mg/kg G VIRUS INFECTED SEQID NO:2, 0.3 mg/kg H VIRUSINFECTED SEQED NO:2, 3 mg/kg I VIRUS INFECTED SEQID NO:3,0.03 mg/kg J VIRUS INFECTED SEC ID NO:3,0.3 mg/kg K VIRUS INFECTED SEQID NO:3, 3 mg/kg
NFLUENZAWIRUS LOAD (ABSORBANCE UNITS) 2.5
2.0
1.5
1.O
O.5 n.d. 0.0-1 A B CD E F. G. H J K Fig.5 Patent Application Publication May 28, 2009 Sheet 6 of 52 US 2009/0137519 A1
A UNINFECTED UNTREATED B VIRUS INFECTED TEST VEHICLE TOTAL LEUKOCYTES (x103/ml) C VIRUSINFECTED SEQLD NO:10.03 mg/kg 1 OOO D VIRUS INFECTED SEQID NO:1, 0.3 mg/kg E VIRUS INFECTED SEQID NO:1, 3 mg/kg 750 F VIRUSINFECTED SEQID NO2, 0.03 mg/kg G VIRUSINFECTED SEQID NO2, 0.3 mg/kg 500 H VIRUSINFECTED SEQID NO:2, 3 mg/kg 250 I VIRUSINFECTED SEQID NO:3,0.03 mg/kg J VIRUS INFECTED SEOID NO:3,0.3 mg/kg O K VIRUSINFECTED SEQID NO:3, 3 mg/kg
N Y - Fig.6A
A UNENFECTED UNTREATED B VIRUS INFECTED ES WEHICLE NEUTROPHILS (x10.3/ml) C VIRUSINFECTED SEQID NO:10.03 mg/kg 700 D VERUSINFECTED SEQID NO;1, 0.3 mg/kg 600 E VIRUSINFECTED SEQID NO:1, 3 mg/kg 5 OO F VIRUS INFECTED SEQID NO2, 0.03 mg/kg 40 G VIRUSINFECTED SEQID NO:2,0.3 mg/kg 300 H VIRUSINFECTED SEOID NO:2, 3 mg/kg 200 I VIRUS INFECTED SEQID NO:3,0.03 mg/kg 100 J VIRUS INFECTED SEQED NO:3,0.3 mg/kg K VIRUS INFECTED SEQID NO:3, 3 mg/kg Patent Application Publication May 28, 2009 Sheet 7 of 52 US 2009/0137519 A1
3 A UNINFECTED UNTREATED MONONUCLEAR CELLS (x10/ml) B WRUS INFECTED TEST WEHICLE 600 C VIRUS INFECTED SEQID NO:10.03 mg/kg 500 D VIRUSINFECTED SEQID NO:1, 0.3 mg/kg 400 E VIRUSINFECTED SEQDNO;1.3 mg/kg 300 F VIRUSINFECTED SEQ DNO2, 0.03 mg/kg G VIRUSINFECTED SEQID NO2, 0.3 mg/kg 200 H VIRUSINFECTED SEQID NO2, 3 mg/kg 100 I VIRUS INFECTED SEQID NO:3, 0.03 mg/kg J VIRUSINFECTED SEQED NO:3,0.3 mg/kg K VIRUS INFECTED SEQID NO:3, 3 mg/kg N - - - - Fig.6C Patent Application Publication May 28, 2009 Sheet 8 of 52 US 2009/0137519 A1
A UNCHALLENGED UNTREATED B ANTIGENCHALLENGED UNTREATED C ANTIGENCHALLENGED WEHICLE D ANTIGENCHALLENGED SEQED NO:7, 1.g/kg E ANTIGENCHALLENGED SEQDN0:7, 10 pg/kg EOSINOPHILS (x103/ml) F ANTIGENCHALLENGED SEQIDN0:7, 100 g/kg 700 G ANTIGENCHALLENGED SEQDN0:1, 1ug/kg 600 H ANTIGENCHALLENGED SEQID NO:1, 10 g/kg 500 ANTIGENCHALLENGED SEQID NO;1,100 g/kg J ANTIGENCHALLENGED SEQID NO2, 1 g/kg 400 K ANTIGENCHALLENGED SEQID NO2, 10 g/kg 300 L ANTIGENCHALLENGED SEQID NO2,100 g/kg MANTIGENCHALLENGED SEQIDNC3, 1g/kg N ANTIGENCHALLENGED SEQID NO:3, 10 g/kg O ANTIGENCHALLENGED SEQIDNO3,100 g/kg
A UNCHALLENGED UNTREATED B AMTGEN CHALLENGED UNTREATED C ANTIGENCHALLENGED WEHICLE D ANTIGENCHALLENGED SEQID NO:7, 19/kg E ANTIGENCHALLENGED SEQID NO7, 10 pg/kg NEUTROPHILS (x103/ml) F ANTIGENCHALLENGED SEQIDN07, 100 g/kg 1 OO G ANTIGENCHALLENGED SEQID NO:1, 1 g/kg H ANTIGENCHALLENGED SEQID NO:1, 10 g/kg | ANTIGENCHALLENGED SEQID NO:1, 100 g/kg J ANTIGENCHALLENGED SEQDNO2, 1 g/kg K ANTIGENCHALLENGED SEQED NO2, 10 pg/kg L ANTIGENCHALLENGED SEQID NO:2, 100 g/kg Patent Application Publication May 28, 2009 Sheet 9 of 52 US 2009/0137519 A1
A UNCHAENGED UNTREATED E ANTEGEN CHALLENGED UNTREATED C ANTIGENCHALENGED WEHICLE D ANTIGENCHALLENGED SEQID NO:7, 1 g/kg TOTALT CELS E ANTIGENCHALLENGED SEQID NO:7, 10 g/kg (CD3t CELLS, x10.3/mi) F ANTIGENCHALLENGED SEQIDNO:7, 100 g/kg 600 G ANTIGENCHALLENGED SEQID NO:1, 1 g/kg H ANTIGENCHALLENGED SEQID NO:1, 10 g/kg 500 | ANTIGENCHALLENGED SEQID NO:1, 100 g/kg
400 J ANTIGENCHALLENGED SEQID NO2, 1 g/kg BOO | | || K ANTIGENCHALLENGED SEQID NO2, 10 g/kg L ANTIGENCHALLENGED SEQIDNO2, 10Cug/kg 2OO MANTIGENCHALLENGED SEQDNC3, 1 g/kg 1 OO i N ANTIGENCHALLENGED SEQDNO3, 10 pg/kg O-I O ANTIGENCHALLENGED SEQIDNO:3, 100 g/kg A B C D E F GH J K L MNO Y- - - Fig.8A
A UNCHALLENGED UNTREATED B ANTIGENCHALLENGED UNTREATED C ANTIGENCHALENGED WEHICLE D ANTIGENCHALLENGED SEQIDN0:7, 1 g/kg CD4+ T CELLS E ANTIGENCHALLENGED SEQIDN07, 10ug/kg (CD3t CD4+CELLS, x103/ml) F ANTIGENCHALLENGED SEQID NO7, 100 pg/kg 4OO G ANTIGENCHALLENGED SEQDNO:1, 1 g/kg
H ANTIGENCHALLENGED SEQDN0:1, 10 pg/kg 300 | ANTIGENCHALLENGED SEQIDNO:1,100 g/kg J ANTIGENCHALLENGED SEQID NO2, lug/kg 300 K ANTIGENCHALLENGED SEQID NO2, 10 g/kg L ANTIGENCHALLENGED SEQID NO2, 100 g/kg OO MANTIGENCHALLENGED SEQID NO3, 1 g/kg N ANTIGENCHALLENGED SEQID NO3, 10 g/kg O O ANTIGENCHALLENGED SEQID NO3, 100 g/kg A B C D EF GH KL Y -- - - Fig.8B Patent Application Publication May 28, 2009 Sheet 10 of 52 US 2009/0137519 A1
8 HOURS AFTER DOSNG 15 HOURS AFTER DOSING WITH 0.1 mg/kg WITH 0.1 mg/kg TOTAL LEUKOCYTES (x103/ml) TOTAL LEUKOCYTES (x10.3/mi) 400 400
3OO 300
200 200
1OO 1 OO O'CONTROL'7' ' ' ' O'CONTROL" 7" ' " ' " 's SEOID NO SEO D NO Fig 9A Fig 9B
8 HOURS AFTER DOSING 15 HOURS AFTER DOSING WITH 1 mg/kg WITH 1 mg/kg TOTAL LEUKOCYTES(x10.3/ml) TOTAL LEUKOCYTES (x103/ml) 400 400
300 300
200 200
1OO 100
O CONTROL 7 1 2 3 O CONTROL"7" 1 2 3 SEOD NO SEC ID NO Fig 9C Fig 9D Patent Application Publication May 28, 2009 Sheet 11 of 52 US 2009/0137519 A1
8 HOURS AFTER DOSING 15 HOURS AFTER DOSNG WITH 0.1 mg/kg WITH 0.1 mg/kg IFNo. (pg/ml) IFNo. (pg/ml) 600 600 500 500 400 400 300 300 200 200 100 100 Oisy, a g 0-ri-ye ; ; SEOID NO SEQID NO Fig. 10A Fig. 10B
8 HOURS AFTER DOSING 15 HOURS AFTER DOSING WITH 1 mg/kg WITH 1 mg/kg IFNo. (pg/ml) IFNo. (pg/ml) 600 500 400 300 2OO 1OO O -CE 8 CONTROL 7 1 2 CONTROL 7 1 2 3 SEO DNO SEQID NO Fig. 10C Fig. 10D Patent Application Publication May 28, 2009 Sheet 12 of 52 US 2009/0137519 A1
8 HOURS AFTER DOSING 15 HOURS AFTER DOSING WITH 0.1 mg/kg WITH 0.1 mg/kg IFNY (pg/ml) FNY (pg/ml) 400 A.OO 300 300 200 200 100 100 i .
O-I-comic SSHng Lice RaS O CONTROL 7 2 3 coifoli SEOD NO SEOID NO Fig.11A Fig.11B
8 HOURS AFTER DOSING 15 HOURS AFTER DOSENG WITH 1 mg/kg WITH 1 mg/kg IFNY (pg/ml) IFNY (pg/ml) 400 400 300 300 200 200 OO 100
O - E. sise-ee-ae - CONTROL 7 1 2 3 O CONTROL 7 2 3 SEOID NO SEOID NO Fig.11C Fig.11D Patent Application Publication May 28, 2009 Sheet 13 of 52 US 2009/0137519 A1
8 HOURS AFTER DOSING 15 HOURS AFTER DOSING WITH 0.1 mg/kg WITH 0.1 mg/kg IP-10 (pg/ml) P-10 (pg/ml) 2000 2OOO 1500 1500 1000 1 OOO 500 500 O CONTROL 7 1 2 3 O CONTROL 7 2 3 SEO DNO SEOID NO Fig. 12A Fig.12B
8 HOURS AFTER DOSNG 15 HOURS AFTER DOSING WITH 1 mg/kg WITH 1 mg/kg iP-10 (pg/ml) IP-10 (pg/ml) 2OOO 2OOO 1500 1500 1 OOO OOO 500 5OO O O CONTROL 7 1 2 B CONTROL 7 1 2 3 SEOD NO SEOD NO Fig. 12C Fig. 12D Patent Application Publication May 28, 2009 Sheet 14 of 52 US 2009/0137519 A1
8 HOURS AFTER DOSING 15 HOURS AFTER DOSING WITH 0.1 mg/kg WITH 0.1 mg/kg L-12p40 (pg/ml) IL-12p40 (pg/ml) 1250 1250 1000 1000 A50 O) 750 500 " . . 500 og so -o- 39 - o 250 : - - - CONTRO 7 1 2 3 CONTROL 7 1 2 3 SEO ED NO SEQID NO Fig. 13A Fig. 13B 8 HOURS AFTER DOSING 15 HOURSAFER DOSING WITH 1 mg/kg WITH 1 mg/kg IL-12p40 (pg/ml) IL-12p40 (pg/ml) 1250 250 1000 o a 1000 750 ". 750 500 ... 500 & S. g -e- ce 250 - - - : ... 250 &c. 8 O CONTROL 7 1 2 3 CONTROL 7 1 2 3 SEOID NO SEOD NO Fig. 13C Fig. 13C Patent Application Publication May 28, 2009 Sheet 15 of 52 US 2009/0137519 A1
8 HOURS AFTER DOSENG 5 HOURS AFTER DOSING WITH 0.1 mg/kg WITH 0.1 mg/kg IL-6 (pg/ml) IL-6 (pg/ml) 5OOO 5000 4000 4000 3OOO 3OOO 2OOO 2000 1000 1OOO O-Hamid &3.r.sgs O CONTROL 7 1 2 3 CONTROL 7 1 2. 3 SEOD NO SEOD NO Fig. 14A Fig.14B
8 HOURS AFTER DOSNG 15 HOURS AFTER DOSING WITH 1 mg/kg WITH 1 mg/kg IL-6 (pg/ml) IL-6 (pg/ml) SOOO 5OOO 4000 4OOO 3OOO 3OOO 2OOO 2OOO 1000 1OOO O sis 3. O s CONTROL 7 2 3 CONTROL 7 2 3 SEOD NO SEOID NO Fig.14C Fig.14D Patent Application Publication May 28, 2009 Sheet 16 of 52 US 2009/0137519 A1
8 HOURS AFTER DOSING 15 HOURSAFER DOSENG WITH 0.1 mg/kg WITH 0.1 mg/kg TNFO, (pg/ml) TNFO (pg/ml) 2OOO 2000 1500 1500 1 OOO 1OOO 500 . . . 5OO se O-I -acre-case of O--Carr...(socces big-H9. CONTROL 7 2 3 CONTROL 7 1 2 3 SEOID NO SEOID NO Fig.15A Fig.15B
8 HOURS AFTER DOSING 15 HOURS AFTER DOSING WITH 1 mg/kg WITH 1 mg/kg TNFO (pg/ml) TNFO (pg/ml) 2OOO 2OOO
15OO s 1500
1 OOO s 1OOO
500 oe -e- 500 o
O Cs- Sg CONTROL 7 1 2 3 CONTROL 7 1 2 3 SEO ED NO SEOID NO Fig.15C Fig.15D Patent Application Publication May 28, 2009 Sheet 17 of 52 US 2009/0137519 A1
8 HOURS AFTER DOSING 15 HOURS AFTER DOSING WITH 0.1 mg/kg WITH 0.1 mg/kg IFNY (pg/ml) IFNY (pg/ml) 2OO 150 100 50 -- O st-oriesii-ters as O s d o CONTROL 2 3 CONTROL 7 1 2 3 SEOID NO SEOID NO Fig.16A Fig.16B
8 HOURS AFTER DOSING 15 HOURS AFTER DOSING WITH 1 mg/kg WITH 1 mg/kg EFNY (pg/ml) IFNY (pg/ml) 200 200 150 150 1 OO OO 50 50 8 go a
ESsa t s O E. st S. cool CONTRO 7 1 2 3 SEOID NO SEOD NO Fig.16C Fig.16D Patent Application Publication May 28, 2009 Sheet 18 of 52 US 2009/0137519 A1
8 HOURS AFTER DOSENG 15 HOURS AFTER DOSING WITH 0.1 mg/kg WITH 0.1 mg/kg L-6 (pg/ml) IL-6 (pg/ml) 2OOO 2OOO 1500 15OO OOO 1 OOO 500 500 O age sias 3. O CONTROL 7 1 3 g-i-s-s SEOID NO SEOID NO Fig.17A Fig.17B
8 HOURS AFTER DOSNG 15 HOURS AFTER DOSNG WITH 1 mg/kg WITH 1 mg/kg IL-6 (pg/ml) IL-6 (pg/ml) 6000 2000 5000 1500 4000 3000 1OOO 2OOO 500 1000 & O O SS E. 3. CONTROL 7 1 2 3. CONTROL 7 1 2 3 SEO D NO SEOD NO Fig.17C Fig.17D Patent Application Publication May 28, 2009 Sheet 19 of 52 US 2009/0137519 A1
8 HOURS AFTER DOSING 15 HOURS AFTER DOSING WITH 0.1 mg/kg WITH 0.1 mg/kg TNFC. (pg/ml) TNFO (pg/ml) 400 400 BOO 3OO 200 2OO 100 OO
O Si ES O as: s s CONTROL 7 2 3 CONTROL 7 1 2 3 SEOID NO SEOID NO Fig. 18A Fig. 18B
8 HOURS AFTER DOSNG 15 HOURS AFTER OOSING WITH 1 mg/kg WITH 1 mg/kg TNFO (pg/ml) TNFO. (pg/ml) 400 400 3OO 300 200 2OO 1 OO 1OO
3.E. CONTROL 7 2 3 CONTROL 7 1 2 3. SEOID NO SEOID NO Fig.18C Fig.18D Patent Application Publication May 28, 2009 Sheet 20 of 52 US 2009/0137519 A1
ANTIGEN-SPECIFICIgE (ABSORBANCE UNITS) O.25
O.2O
O.15
O.O
WEHICLE 1 0 100 1000 UNSENSTZED - SEOID- NO: 2 (4g/kg) - ANTIGEN SENSTIZED Fig. 19A
ANTIGEN-SPECIFIC IgG2a (ABSORBANCE UNITS) 2.5
2.0
15
1.0
0.5
O.O S T. WEHICLE 1 1 0 100 1000 UNSENSTIZED - SEC ID NO: 2- (Ig/kg) ANTGEN SENSTIZED Fig. 19B
Patent Application Publication May 28, 2009 Sheet 22 of 52 US 2009/0137519 A1
SENSTIZATION AEROSOLIZED OVA CHALLENGE (0.5ml, 1% OVA i.p./s.c.) (196-20 min)
D-1 D-4 A. D-15 D-18 A. D-22 D-25 D-26 D-13 D-2O SALINE/SEOD NO:2/ A SEOID NO:7 (200ul, i.t.) LUNG FUNCTION Fig.21 Patent Application Publication May 28, 2009 Sheet 23 of 52 US 2009/0137519 A1
s
e ls ?o a h 5 2s 2 set is to
2 - 2 - S 9 l s C t S S 3 : S 3 : 3 is (NTSW3-O %) t (DW) NWIld WOD CN DNWIldWOO EDN?. NSWDO EN NSWDO C
s 2 E: m | - Se ! |S
I SSS is seases a - - i S
us a - 0 5 s is is is is b S & 3 : 5 & 5 Š T (NIHSws O96) onw)3ONVISIS3 DNWLSIS AWWNSWDN WNAW NSWDN NTT - - - Patent Application Publication May 28, 2009 Sheet 24 of 52 US 2009/0137519 A1
One-way Analysis of Variance (ANOVA) The P value is 0.0032, considered very significant. Variation among column means is significantly greater than expected by chance. Dunnett Multiple Comparisons Test Control column: OVA if the value of q is greater than 2.632 then the P value is less than 0.05.
Mean Comparison Difference P value OVA Vs SAL 6783.6 4.311 ** P&O.O1 OWAWS 10upk 1943.2 . 91 n5 P.O.O.5 OVA vs SEOID 30upk 3482.7 2.34 ns P.O.05 OVA vs NO:7 100upk 2900.9 1700 ns P.O.05 OVA WS 300upk 5095. 2.986 * P&O.05 Mean lower Upper Difference Difference 95% CI 95% CI OVA - SAL 6783.6 2642.4 10925 OVA -10upk 1943.2 -2351.8 6238.1 OVA SEQIDJ-3Oupk 34.82.7 -812.18 7777.6 OWA NO:7-100upk 2900.9 -1590.8 7392.7 OVA -300upk 5095.1 603.3 9586.8
Assumption test: Are the standard deviations of the groups equal?
Fig.23A Patent Application Publication May 28, 2009 Sheet 25 of 52 US 2009/0137519 A1
One-way Analysis of Variance (ANOVA) The P value is 0.0001, considered extremely significant. Variation among column means is significantly greater than expected by chance. Dunnett Multiple Comparisons Test Control Column: OVA If the value of q is greater than 2.632 then the P value is less than 0.05.
Mean Comparison Difference q P Walue OVA Vs SAL 34457 5.770 * P&O.O1 OWAWS 10upk 135.02 2.80 ns. P0.05 OVA vs SEOID 30upk 133.59 2.157 nS P-0.05 OVA vs NO:7 100upk 81.278 1255 nS P-0.05 OVA Vs 300upk 142.28 2.197 nS P-0.05 Mean Lower. Upper Difference Difference 95% CI 95% CI OVA - SAL 34457 18741 501.73 OVA - -10upk 135.02 -27.982 298.01 OVA - SEQIDJ-30upk 13359 -29.41 O 296.58 OVA - NO:7-100upk 81.278 -89.189 251.74 OVA - -300upk 142.28 -28.189 312.74
Assumption test: Are the standard deviations of the groups equal?
Fig.23B Patent Application Publication May 28, 2009 Sheet 26 of 52 US 2009/0137519 A1
C r C H : as 2 - HNssC s as N al w c d - 2 S 2
s / - - S is * |
21 S, a s 2 %. 539 Frn 3 & et - s & . SS. . . 2 s st a S-- A e isSS a Q 29 c a c co 3 S e is $ 3 5 s 2 : 3 is (NITSWO %) (OW) NWIld WOD s ONWI WOD ENTNSWDO EN NSWDO O) - S LL +H is s an s FNs-- 5 2 - N HC2. - - Lr 9. s i %27. O2 L.E. - ". . . S, a C " " on Š a sas SS --IN sa S. S.S. ccS.S. 2.is 32S. - c. SSS s s St St al s S- - A.
A N er s. dC. E a 2 k - S S S S S S S SC S. z is 2 K. G. K. (NITSWSO96) (DW) NWLSIS ONWISIS WAWIWNSWON WIWW NSWON Patent Application Publication May 28, 2009 Sheet 27 of 52 US 2009/0137519 A1
One-way Analysis of Wariance (ANOVA) The P value is < 0.0001, considered extremely significant. Variation among Column means is significantly greater than expected by chance. Dunnett Multiple Comparisons Test Control column: OVA If the value of q is greater than 2.620 then the P value is less than 0.05.
Mean Comparison Difference q P value OVA WS SAL 6783.6 6.220 PKO,01 OWA WS -10 upk 5140.3 4,346 P &O.01 OVA vs SEOD U-30 upk 4723.6 4.176 s P &O.01 OVA vs NO:2-100upk 4100.3 3,760 P <0.01 OVA wis -300upk 3032.2 2.780 P <0.05 Mean Lower Upper Difference Difference 95% C 95% CI OVA - SAL 6783.6 39264 9640.8 OVA - -10upk 5140.3 204.2 8239.3 OVA - SEQID U-30 upk 4723.6 1760.3 7686.8 OVA - NO:2 -100upk 4100.3 1243.1 6957.5 OVA - -300upk 3032.2 175,01 5889.4
Assumption test: Are the standard deviations of the groups equal?
Fig.25A Patent Application Publication May 28, 2009 Sheet 28 of 52 US 2009/0137519 A1
One-way Analysis of Variance (ANOVA) The P value is 0.0003, considered extremely significant. Variation among column means is significantly greater than expected by chance. Dunnett Multiple Comparisons Test Control Column: OVA lf the value of q is greater than 2.620 then the P value is less than 0.05.
Mean Comparison Difference P value OVA vs SAL 344.57 4,854 ** PK0.01 OVA VS -10upk 217.61 2,826 * P&O.05 OVA vs SEQID U-30upk 151.02 2,051 nS P 0.05 OVA vs NO:2-100upk 137.94 1943 nS P 0.05 OVA vs -300upk 35,569 0.5011 ns Ps0.05 Mean Lower. Upper Difference Difference 95% CI 95% CI OVA - SAL 344.57 15859 530.55 OVA - -10 upk 217.6 5.892 49.33 OVA - SEQIDJ-30 upk 151.02 -41.864 343.90 OVA - NO:2-100upk 137.94 -48,031 323.92 OVA - -300upk 35,569 -150,41 221.55
Assumption test: Are the standard deviations of the groups equal?
Fig.25B Patent Application Publication May 28, 2009 Sheet 29 of 52 US 2009/0137519 A1 15000 AUCRESISTANCE 125OO 1 OOOO 7500 5000 2500
Saline OVA 10 30 OO 3OO SEOID NO:2 (ig/kg, i.t.) Fig.26A
AUC-COMPLIANCE
1250
1 OOO
750 2 500 sain ova 10' 30" 100 300 SEQID NO:2 (ug/kg, it) Fig.26B Patent Application Publication May 28, 2009 Sheet 30 of 52 US 2009/0137519 A1
15000 (n-6-9) AUC-RESISTANCE 125OO 1 OOOO 5 7500 5000 25 OO Saline owA 10' 30 100 soo SEQID NO:2 (ag/kg, i.t.) Fig.26C
- AUC-COMPLIANCE
Saline OWA 10 30 100 300 SEQD NO:2 (ug/kg, i.t.) Fig.26D
Patent Application Publication May 28, 2009 Sheet 32 of 52 US 2009/0137519 A1
TNF-alpha SOO m0- 9 450 --V-- 10 400 ---- 2 350 --K)-- 1 3OO --A-- 1 250 -----C---- 12 200 --O-- 3 150 0.01 0.1 1 medium:249 pg/ml ODNuM) LPS;867 pg/ml Fig.28A IFN-gamma 180 alm 9 160 --V-- 10 40 ---- 2 120 --(x-- 1 OO --A- 11 80 ---O---- 12 60 - --O-- 3 40 0.01 0.1 1 medium;77 pg/ml ODNuM) LPS:543 pg/ml Fig.28B L-6 600 -O- 9 500 --V-- 10 400 ---n 2 300 --C)- 1 200 --A- 11 OO ---O---- 12 O --O-- 3 O.O1 0.1 1 medium: 16 pg/ml ODNuM) LPS:624 pg/ml Fig.28C Patent Application Publication May 28, 2009 Sheet 33 of 52 US 2009/0137519 A1
008 OOZ u/6d eude-N
May 28, 2009 Sheet 35 of 52 US 2009/0137519 A1
09 u/6d euuef-N- Patent Application Publication May 28, 2009 Sheet 36 of 52 US 2009/0137519 A1
30 NK CEL S : CD69
15 10 5 O 0.01 O. 1 medium:10 ODNLM) PS:32 Fig 32A i-2/IL-12:76
BCELLS : CD80
2. 8 ?
O.O. 0.1 1 medium:21 ODNuM) LPS:24 Fig.32B 30 BCES: CD86
Patent Application Publication May 28, 2009 Sheet 37 of 52 US 2009/0137519 A1
“, £Z?11I. Saš.
sy ssossossp.ssossp.
KO
W 69C) Patent Application Publication US 2009/0137519 A1
98C]]OZNOJIVALLOWTTHO8 ZL|-Z†71 ssp.ssossiossp.ssp.?dp-uou
ld W980) Patent Application Publication May 28, 2009 Sheet 39 of 52 US 2009/0137519 A1
Patent Application Publication May 28, 2009 Sheet 40 of 52 US 2009/0137519 A1
MONOCYTES: CD8O 18O 60 140 120 OO 8O 60 40 2O O O.O1 0.1 1 medium:36 ODNuM) LPS: 177 Fig 36A IL-2/ L-12:250
MONOCYTES: CD86
15 O 100 5 O O O.O1 O. 1 medium: 137 ODNuM) LPS:20 Fig 36B L-2/ L-12:432 PLASMACYTOD DC: CD86 600 500 4. O O 3OO 2OO 1OO
O.O1 O.1 1 medium: 103 ODNuM) (LPS:326) Patent Application Publication May 28, 2009 Sheet 41 of 52 US 2009/0137519 A1 ssoSSDssp.ssossio?dp-uou 0||£16 {Dssp. 009 09:17 00?7 {09€. 008 09:2 00Z 09|| 001 09 W980) Patent Application Publication May 28, 2009 Sheet 42 of 52 US 2009/0137519 A1
I.I.?. ssp.ssiossp.9d9-uou
C O 09, 00€ ul Se W 08OD Patent Application Publication May 28, 2009 Sheet 43 of 52 US 2009/0137519 A1
98C]D:NOLIVALIDWDQ|q
006 008 Patent Application Publication May 28, 2009 Sheet 44 of 52 US 2009/0137519 A1
MONOCYTES: INTRACELLULAR P-10
O.01 0.1 medium: 146 ODNuM) LPS: 185 Fig. 40A
BCELLS:NTRACELLULAR P-10
55 50 45 40 35 3O 25 O.O. 0.1 1 medium:35 ODNuM) LPS:41 Fig. 40B Patent Application Publication US 2009/0137519 A1
Patent Application Publication US 2009/0137519 A1
£ZI.llLZ†7L ssoSSDssp.ssp.ssp.podp-uou8Dssb
IW Old Patent Application Publication May 28, 2009 Sheet 47 of 52 US 2009/0137519 A1 FNo. (pg/ml) OOO
750 SEOD NO. 2
A SEOID NO.: 16 250 v SEOID NO. 17 O O.O. CpGODNug/ml)0.1 10 Fig. 43A
IFNY (pg/ml) 125OO
o SEOID NO.15 7500 A SEOID NO.:16 5000 v SEO ED NO.: 17 2500 O ...-mo-T-" O.O. CpGO.1 ODNug/ml) 10 Fig. 43B
IP-10 (pg/ml) 5OOO 4000 SEOID NO.:2 3OOO SEC D NO.15 2OOO A SEOID NO.: 16 OOO v SEOD NO.: 17
O -wa-l-m-to O.O. CpGO, ODNug/ml) 1 10 Fig. 43C Patent Application Publication May 28, 2009 Sheet 48 of 52 US 2009/0137519 A1
IL-6 (pg/ml) 5OOO
SEOD NO.:2 10000 o SEOID NO.: 15 5000 A SEOD NO.; 16 v SEQ DNO.: 17
O -rrrrrrl-TTETTTTT-T "r tritt Fr. O.O1 cGoDNg/ml).0.1 10 Fig. 43D
IL-10 (pg/ml) 1250 OOO SEO, ID NO.:2 750 o SEOD NO.: 15 500 A SEQID NO.16 250 v SEOID NO.: 17
O ---o-Ho O.O. O.1 1 1 O CpG ODNug/ml) Fig. 43E
TNFO (pg/ml) 500
400 SEOD NO.:2 3OO o SEOD NO.: 15 2OO A SEOID NO.; 16
O -...-H...--To O.O1 CpGO. ODN Lig/ml)1 10 Fig. 43F Patent Application Publication May 28, 2009 Sheet 49 of 52 US 2009/0137519 A1 IFNo. (pg/ml) 1 OOO SEOD NO2 750 O SEQID NO.: 18 500 A SEO D NO.: 19 v SEO ED NO.:20 250
O O.O. O. 10 CpG ODNug/ml) Fig. 44A
IFNy (pg/ml) 125OO OOOO SEOID NO.:2 7500 O SEOID NO.: 18 5OOO A SEQID NO.: 19 2500 v SEO D NO.:20
O -w-To O.O1 O.1 O CpG ODNug/ml) Fig. 4.4B
IP-10 (pg/ml) 5OOO 4000 SEOID NO.:2 3OOO O SEO DNO.: 18 2000 A SEQID NO.: 19 v SEOID NO.:20 1 OOO
O. 10 CpG ODN (ug/ml) Fig. 44C Patent Application Publication May 28, 2009 Sheet 50 of 52 US 2009/0137519 A1 IL-6 (pg/ml) 15OOO 125OO 10000 SEO iD NO.:2 7500 O SEOD NO.: 18 5000 A SEOD NO.: 19 25OO v SEO ED NO.:20 O ...--Terro-T-TTFT-rror TTT O.O. O.1 1 10 CpG ODNug/ml) Fig. 44D
IL-10 (pg/ml) 1250 1 OOO SEOID NO.;2 750 o SEOD NO.: 18 A SECD NO.: 19 500 v SEOID NO.:20 250 O O.O1 O.1 1 O CpG ODNug/ml) Fig. 44E
TNFO (pg/ml) 500
400 SEC ID NO.:2 300 to SEOID NO.: 18 2OO A SEO D NO.: 19 100 v SEOID NO.:20 O O.O. O. 1 10 CpG ODNug/ml) Fig. 44F Patent Application Publication May 28, 2009 Sheet 51 of 52 US 2009/0137519 A1
IFNo. (pg/ml) 1000
750 SEO D NO.:2 500 O SEOID NO.:21 250 A SEO D NO.:22 v SEOD NO.:23 O 0.01 0.1 10 CpG ODNug/ml) Fig. 45A IFNY (pg/ml) 1 OOOO
7500 SEQID NO.:2 5000 O SEOD NO.:21 2500 A SEOD NO.:22 v SEOD NO.:23 O --rrrrrror TTTTTTT-TT I I I It O.O1 0,1 1 10 CpG ODNug/ml) Fig. 45B
IP-10 (pg/ml) 6OOO
5OOO 4000 SEOID NO.:2 3000 O SEOID NO.:21 2OOO A SEOD NO.:22 OOO v SEOD NO.:23
CpG ODNug/ml) Fig. 45C Patent Application Publication May 28, 2009 Sheet 52 of 52 US 2009/0137519 A1
IL-6 (pg/ml) SOOO
1 OOOO SEOD NO.:2 O SEOID NO.:21 SOOO A SEOD NO.: 22 v SEOID NO.:23 O 0.01 O. 10 CpG ODNug/ml) Fig. 45D IL-10 (pg/ml) 1500 250 1 OOO SEOD NO.:2 750 O SEOD NO.:21 500 A SEOD NO.: 22 250 v SEOD NO.:23 O -mer-To O.01 O.1 1 1 O CpG ODNEug/ml) Fig. 45E
TNFO (pg/ml) 400
3OO SEOID NO.:2 o SEOID NO.:21 OO A SEQD NO.:22 1OO v SEOD NO.:23
O Herre-room O.O1 0. 1 1O CpG ODNug/ml) Fig. 45F US 2009/0137519 A1 May 28, 2009
SEMI-SOFT C-CLASS cells and dendritic cells (Hartmann et al., 1999 Proc. Natl. IMMUNOSTIMULATORY Acad. Sci. USA 96:9305-10; Liang, 1996 J. Clin. Invest. OLGONUCLEOTDES 98: 1119-1129). 0005. Several different classes of CpG oligonucleotides RELATED APPLICATION has recently been described. One class is potent for activating B cells but is relatively weak in inducing IFN-O. and NK cell 0001. This application is a divisional of co-pending U.S. activation; this class has been termed the B class. The B class Application Serial No. 1 1/255,100, filed Oct. 20, 2005, which CpG oligonucleotides typically are fully stabilized and claims priority to U.S. Provisional Application having Ser. include an unmethylated CpG dinucleotide within certain No. 60/620,759 entitled “SEMI-SOFT C-CLASS IMMU preferred base contexts. See, e.g., U.S. Pat. Nos. 6,194,388; NOSTIMULATORY OLIGONUCLEOTIDES filed Oct. 6,207,646; 6,214,806; 6,218,371; 6,239,116; and 6,339,068. 20, 2004, the entire contents of which are incorporated by Another class of CpG oligonucleotides activates B cells and reference herein. NK cells and induces IFN-O.; this class has been termed the C-class. The C-class CpG oligonucleotides, as first charac FIELD OF THE INVENTION terized, typically are fully stabilized, include a B class-type 0002 The present invention relates generally to immuno sequence and a GC-rich palindrome or near-palindrome. This stimulatory oligonucleotides with reduced renal inflamma class has been described in co-pending U.S. patent applica tory effects, compositions thereof and methods of using the tion US 10/224,523 filed on Aug. 19, 2002 and related PCT immunostimulatory oligonucleotides. In particular the Patent Application PCT/US02/26468 published under Inter immunostimulatory oligonucleotides are C-class semi-soft national Publication Number WO 03/O15711. oligonucleotides that are particularly effective in the treat ment of allergy and asthma, cancer and infectious disease. SUMMARY OF THE INVENTION 0006. It has been discovered that immunostimulatory BACKGROUND OF THE INVENTION properties of specific C-class CpG oligonucleotides with the 0003 Bacterial DNA has immune stimulatory effects to selective inclusion of one or more non-stabilized linkages activate B cells and natural killer cells, but vertebrate DNA between certain nucleotides have significant activity and are does not (Tokunaga, T., et al., 1988. Jpn. J. Cancer Res. particularly useful in the treatment of allergy and asthma. The 79:682-686: Tokunaga, T., et al., 1984, JNCI 72:955-962: non-stabilized linkages are preferably natural linkages, i.e., Messina, J. P., et al., 1991, J Immunol. 147: 1759-1764; and phosphodiester linkages or phosphodiester-like linkages. A reviewed in Krieg, 1998. In: Applied Oligonucleotide Tech non-stabilized linkage will typically, but not necessarily, be nology, C. A. Stein and A. M. Krieg, (Eds.), John Wiley and relatively susceptible to nuclease digestion. The immuno Sons, Inc., New York, N.Y., pp. 431-448). It is now under stimulatory oligonucleotides of the instant invention include stood that these immune stimulatory effects of bacterial DNA at least one non-stabilized linkage situated between a 5° C. are a result of the presence of unmethylated CpG dinucle and an adjacent 3' G, wherein both the 5°C. and the 3' Gare otides in particular base contexts (CpG motifs), which are internal nucleotides. common in bacterial DNA, but methylated and underrepre 0007. The immunostimulatory oligonucleotides of the sented in vertebrate DNA (Kriegetal, 1995 Nature 374:546 instant invention are useful for inducing a Th1-like immune 549; Krieg, 1999 Biochim. Biophys. Acta 93321:1-10). The response. Accordingly, the immunostimulatory oligonucle immune stimulatory effects of bacterial DNA can be mim otides of the instant invention are useful as adjuvants for icked with synthetic oligodeoxynucleotides (ODN) contain vaccination, and they are useful for treating diseases includ ing these CpG motifs. Such CpG ODN have highly stimula ing cancer, infectious disease, allergy, and asthma. They are tory effects on human and murine leukocytes, inducing B cell believed to be of particular use in any condition calling for proliferation; cytokine and immunoglobulin secretion; natu prolonged or repeated administration of immunostimulatory ral killer (NK) cell lytic activity and IFN-y secretion; and oligonucleotide for any purpose, but are particularly useful in activation of dendritic cells (DCs) and other antigen present the treatment of asthma and allergic diseases such as allergic ing cells to express costimulatory molecules and secrete rhinitis. cytokines, especially the Th1-like cytokines that are impor 0008. The present invention relates in part to immuno tant in promoting the development of Th1-like T cell stimulatory CpG containing oligonucleotides. In one aspect responses. These immune stimulatory effects of native phos the invention is an oligonucleotide having the formula: 5' phodiester backbone CpG ODN are highly CpG specific in TC GXC GXN XC GNCG 3' (SEQ ID NO: 26). The that the effects are dramatically reduced if the CpG motif is oligonucleotide includes at least 2 stabilized internucleotide methylated, changed to a GpC, or otherwise eliminated or linkages. represents phosphodiester or phosphodiester altered (Krieg et al., 1995 Nature 374:546-549; Hartmann et like internucleotide linkage. N is 0-3 nucleotides in length, al, 1999 Proc. Natl. Acad. Sci. USA96:9305-10). N is 0-9 nucleotides in length with N referring to any nucle 0004. In early studies, it was thought that the immune otide. X1, X2, and X are any nucleotide. In some embodi stimulatory CpG motif followed the formula purine-purine ments X, X, and X are T. CpG-pyrimidine-pyrimidine (Krieg et al., 1995 Nature 374: 0009. In some embodiments the oligonucleotide may 546-549; Pisetsky, 1996.J. Immunol. 156:421-423; Hackeret comprise 5' TC GTC GTNTC GGCGCNGCCG 3' al., 1998 EMBO.J. 17:6230-6240; Lipford et al., 1998 Trends (SEQ ID NO: 27). In one embodiment the oligonucleotide in Microbiol. 6:496-500). However, it is now clear that mouse may comprise 5 T:C G*T*C G*T*N*T*C lymphocytes respond quite well to phosphodiester CpG G*G*C*G*CNG*C*C*G 3' (SEQ ID NO: 27). In some motifs that do not follow this “formula” (Yi et al., 1998 J. embodiments N is 3 or 2 nucleotides in length. In other Immunol. 160:5898-5906) and the same is true of human B embodiments N is 0 nucleotides in length. US 2009/0137519 A1 May 28, 2009
0010. The immunostimulatory oligonucleotide may com 0020. In other aspects of the invention the oligonucleotide prise 5' T.C G*T*C G*T*C G*T*T*C G*G*C*G*C has one of the following formulas TCGTCGTC, G*C*G*C*C*G 3' (SEQ ID NO: 2), wherein * represents a CGTCGTCG, GTCGTCGT, TCGTCGTT, CGTCGTTC, stabilized internucleotide linkage. Optionally, when specifi GTCGTTCG, TCGTTCGG, CGTTCGGC, GTTCGGCG, cally stated, 5' may refer to the free 5' end of the oligonucle TTCGGCGC, TCGGCGCG, CGGCGCGC, GGCGCGCG, otide and 3' may refer to the free 3' end of the oligonucleotide. GCGCGCGC, CGCGCGCC, or GCGCGCCG. 0011. In other embodiments the immunostimulatory oli gonucleotide may comprise 5' T.C. G*T*C G*T*T*C G*G*C*G*C*G*C*C*G 3' (SEQID NO:3), wherein * rep resents a stabilized internucleotide linkage. Optionally, when specifically stated, 5' may refer to the free 5' end of the oligonucleotide and 3' may refer to the free 3' end of the oligonucleotide. 0012. In another aspect, the immunostimulatory oligo nucleotide has the following formula TC GXC GXC G XTC GGCGC G. N.3" (SEQID NO: 28). 0013 N is 1-5 nucleotides in length with N referring to any nucleotide. In one embodiment N is 5 nucleotides. X, X, and X are any nucleotide. In some embodiments X and X are T. 0014. In one embodiment the oligonucleotide may com prise 5' TC GTC GAC GATC GGCGC GCGCCG3' (SEQID NO: 4), wherein the oligonucleotide includes at least 2 stabilized internucleotide linkages and represents phos phodiester or phosphodiester-like internucleotide linkage. In one embodiment the oligonucleotide may comprise 5'TC G*T*C G*A*C G*A*T*C G*G*C*G*C G*C*G*C*C*G 3' (SEQ ID NO: 4). Optionally, when spe cifically stated, 5' may refer to the free 5' end of the oligonucleotide and 3' may refer to the free 3' end of the oligonucleotide. 0015. According to another aspect of the invention an immunostimulatory oligonucleotide having the following formula: 5’ TTC GXC GNX GXC GTT 3' (SEQ ID NO: 24) is provided. The oligonucleotide includes at least 2 stabilized internucleotide linkages and represents phos phodiester orphosphodiester-like internucleotide linkage. N is 1-3 nucleotides in length with N referring to any nucleotide. X is a pyrimidine. X and X are any nucleotide. In some embodiments X and X are T. 0016. In one embodiment the oligonucleotide may com prise 5 TTC GTC GTTTX GTC GTT3' (SEQ ID NO: 25). In another embodiment the oligonucleotide may com 0024. A pharmaceutical composition comprising an oli prise 5 TTC G*T*C G*T*T*T*X, G*T*C G*T*T 3' gonucleotide of the invention and a pharmaceutically accept (SEQID NO: 25). In some embodiments X is T or C. able carrier is provided. 0017. The oligonucleotide may comprise 5' TT*C 0025. In some embodiments the composition is formu G*T*C G*T*T*T*T G*T*C G*T*T 3' (SEQ ID NO. 5), lated in a nebulizer or an inhaler. The inhaler may be a wherein * represents a stabilized internucleotide linkage. metered dose inhaler. Alternatively the inhaler is a powder Optionally, when specifically stated, 5' may refer to the free 5' inhaler. end of the oligonucleotide and 3' may refer to the free 3' end of the oligonucleotide. 0026. In other embodiments the pharmaceutical composi 0018. The oligonucleotide may comprise 5' TT*T*C tion may include a chemotherapeutic agent. In yet other G*T*C G*T*T*T*C G*T*C G*T*T3' (SEQ ID NO: 6), embodiments the composition may include an anti-viral wherein * represents a stabilized internucleotide linkage. agent. Optionally, when specifically stated, 5' may refer to the free 5' 0027. The pharmaceutical composition may optionally end of the oligonucleotide and 3' may refer to the free 3' end include a pharmaceutically acceptable carrier formulated for of the oligonucleotide. Subcutaneous administration, oral administration or intrana 0019. In some aspects of the invention the oligonucleotide sal administration. has one of the following formulas TCGTCGTTCG 0028. In one embodiment the oligonucleotide is in a phar GCGCGCCG (SEQ ID NO. 3), TCGTCGTCGTTCG maceutical composition optionally comprising a pharmaceu GCGCGCGCCG (SEQ ID NO: 2), TCGTCGACGATCG tically acceptable carrier. In some embodiments the oligo GCGCGCGCCG (SEQ ID NO: 4), nucleotide is formulated as an aerosol. TTCGTCGTTTTGTCGTT. (SEQ ID NO. 5), or 0029. In one embodiment the oligonucleotide further TTTCGTCGTTTCGTCGTT. (SEQID NO: 6) comprises an adjuvant or a cytokine. US 2009/0137519 A1 May 28, 2009
0030. In one embodiment the oligonucleotide further 0041 According to another aspect of the invention a comprises an antigen, wherein the oligonucleotide is a vac method of stimulating an immune response is provided. The cine adjuvant. method involves administering a CpG immunostimulatory 0031. In one embodiment the antigen is selected from the oligonucleotide to a subject in an amount effective to induce group consisting of a viral antigen, a bacterial antigen, a an immune response in the subject. Preferably the CpG fungal antigen, a parasitic antigen, and a tumor antigen. In immunostimulatory oligonucleotide is administered orally, one embodiment the antigen is encoded by a nucleic acid locally, in a Sustained release device, mucosally, systemically, vector. In one embodiment the antigen is a peptide antigen. In parenterally, or intramuscularly. When the CpG immuno one embodiment the antigen is covalently linked to the oli stimulatory oligonucleotide is administered to the mucosal gonucleotide or immunostimulatory nucleic acid molecule. surface it may be delivered in an amount effective for induc In another embodiment the antigen is not covalently linked to ing a mucosal immune response or a systemic immune the oligonucleotide or immunostimulatory nucleic acid mol response. In preferred embodiments the mucosal Surface is ecule. selected from the group consisting of an oral, nasal, rectal, 0032. In one embodiment the phosphodiester or phos vaginal, and ocular Surface. phodiester-like linkage is phosphodiester. In one embodi 0042. In some embodiments the method includes expos ment the phosphodiester-like linkage is boranophosphonate ing the Subject to an antigen wherein the immune response is or diastereomerically pure Rp phosphorothioate. an antigen-specific immune response. In some embodiments 0033. In one embodiment the stabilized backbone com the antigen is selected from the group consisting of a tumor prises a plurality of internucleotide linkages selected from the antigen, a viral antigen, a bacterial antigen, a parasitic antigen group consisting of phosphorothioate, phosphorodithioate, and a peptide antigen. methylphosphonate, methylphosphorothioate, and any com 0043 CpG immunostimulatory oligonucleotides are bination thereof. In one embodiment the stabilized backbone capable of provoking a broad spectrum of immune response. comprises a plurality of phosphorothioate internucleotide For instance these CpG immunostimulatory oligonucleotides linkages. can be used to redirecta Th2 to a Th1 immune response. CpG 0034. In one embodiment the immunostimulatory nucleic immunostimulatory oligonucleotides may also be used to acid molecule is 4-100 nucleotides long. activate an immune cell. Such as a lymphocyte (e.g., B and T cells), a dendritic cell, and an NK cell. The activation can be 0035. In other aspects the invention is a method for treat performed in Vivo, in vitro, or ex vivo, i.e., by isolating an ing asthma by administering to a subject having or at risk of immune cell from the subject, contacting the immune cell having asthma an oligonucleotide of the invention in an effec with an effective amount to activate the immune cell of the tive amount to treat asthma. CpG immunostimulatory oligonucleotide and re-administer 0036. In yet other aspects the invention is a method for ing the activated immune cell to the Subject. In some embodi treating allergy by administering to a Subject having or at risk ments the dendritic cell presents a cancer antigen. The den of having allergy an oligonucleotide of the invention in an dritic cell can be exposed to the cancer antigen ex vivo. effective amount to treat allergy. In one embodiment the 0044) The immune response produced by CpG immuno Subject has allergic rhinitis. In one embodiment the oligo stimulatory oligonucleotides may also result in induction of nucleotide is administered to a mucosal Surface. In other cytokine production, e.g., production of IL-6, IL-8, IL-12, embodiments the oligonucleotide is administered in an aero Sol formulation. Optionally the oligonucleotide is adminis IL-18, TNF, IFN-O, chemokines, and IFN-Y. 0045. In still another embodiment, the CpG immuno tered intranasally. stimulatory oligonucleotides are useful for treating cancer. 0037. A method for inducing cytokine production is pro The CpG immunostimulatory oligonucleotides are also use vided according to another aspect of the invention. The ful according to other aspects of the invention in preventing method is performed by administering to a Subject an immu cancer (e.g., reducing a risk of developing cancer) in a subject nostimulatory CpG oligonucleotide described herein in an at risk of developing a cancer. The cancer may be selected effective amount to induce a cytokine selected from the group from the group consisting of biliary tract cancer, breast can consisting of IL-6, IL-8, IL-12, IL-18, TNF, IFN-O, chemok cer, cervical cancer, choriocarcinoma, colon cancer, endome ines, and IFN-Y. trial cancer, gastric cancer, intraepithelial neoplasms, lym 0038. In another aspect the invention is a composition of phomas, liver cancer, lung cancer (e.g. Small cell and non the CpG immunostimulatory oligonucleotides described Small cell), melanoma, neuroblastomas, oral cancer, ovarian herein in combination with an antigen or other therapeutic cancer, pancreatic cancer, prostate cancer, rectal cancer, sar compound, such as an anti-microbial agent. The anti-micro comas, thyroid cancer, and renal cancer, as well as other bial agent may be, for instance, an anti-viral agent, an anti carcinomas and sarcomas. In some important embodiments, parasitic agent, an anti-bacterial agent oran anti-fungal agent. the cancer is selected from the group consisting of bone 0039. A composition of a sustained release device includ cancer, brain and CNS cancer, connective tissue cancer, ing the CpG immunostimulatory oligonucleotides described esophageal cancer, eye cancer, Hodgkin's lymphoma, larynx herein is provided according to another aspect of the inven cancer, oral cavity cancer, skin cancer, and testicular cancer. tion. 0046 CpG immunostimulatory oligonucleotides may also 0040. The composition may optionally include a pharma be used for increasing the responsiveness of a cancer cell to a ceutical carrier and/or be formulated in a delivery device. In cancer therapy (e.g., an anti-cancer therapy), optionally when some embodiments the delivery device is selected from the the CpG immunostimulatory oligonucleotide is administered group consisting of cationic lipids, cell permeating proteins, in conjunction with an anti-cancer therapy. The anti-cancer and Sustained release devices. In one embodiment the Sus therapy may be a chemotherapy, a vaccine (e.g., an in vitro tained release device is a biodegradable polymer or a micro primed dendritic cell vaccine or a cancer antigen vaccine) or particle. an antibody based therapy. This latter therapy may also US 2009/0137519 A1 May 28, 2009
involve administering an antibody specific for a cell Surface 0055. In some embodiments the subject is a human and in antigen of for example, a cancer cell, wherein the immune other embodiments the subject is a non-human vertebrate response results in antibody dependent cellular cytotoxicity selected from the group consisting of a dog, cat, horse, cow, (ADCC). In one embodiment, the antibody may be selected pig, turkey, goat, fish, monkey, chicken, rat, mouse, and from the group consisting of Ributaxin, Herceptin, Quad sheep. In another aspect the invention relates to a method for ramet, Panorex, IDEC-Y2B8, BEC2, C225. Oncolym, inducing a TH1 immune response by administering to a Sub SMART M195, ATRAGEN, Ovarex, Bexxar, LDP-03, ior té, ject any of the compositions of the invention in an effective MDX-210, MDX-111, MDX-22, OV103, 3622W94, anti amount to produce a TH1 immune response. VEGF, Zenapax, MDX-220, MDX-447, MELIMMUNE-2, 0056. In another aspect, the invention relates to a method MELIMMUNE-1, CEACIDE, Pretarget, NovoMAb-G2, for treating autoimmune disease by administering to a subject TNT, Gliomab-H, GNI-250, EMD-72000, LymphoCide, having orat risk of having an autoimmune disease an effective CMA 676, Monopharm-C, 4B5, ior egfr3, ior c5, BABS, amount for treating or preventing the autoimmune disease of anti-FLK-2, MDX-260, ANA Ab, SMART 1D10 Ab, any of the compositions of the invention. SMART ABL 364 Ab and ImmuRAIT-CEA. 0057. In other embodiments the oligonucleotide is deliv 0047 Thus, according to some aspects of the invention, a ered to the subject in an effective amount to induce cytokine Subject having cancer or at risk of having a cancer is admin expression. Optionally the cytokine is selected from the istered a CpG immunostimulatory oligonucleotide and an group consisting of IL-6, TNFC, IFNC, IFNY and IP-10. In anti-cancer therapy. In some embodiments, the anti-cancer other embodiments the oligonucleotide is delivered to the therapy is selected from the group consisting of a chemo Subject in an effective amount to shift the immune response to therapeutic agent, an immunotherapeutic agent and a cancer a Th1 biased response form a Th2 biased response. vaccine. In some embodiments the cancer medicament is 0058. The invention in some aspects is a method for treat taxol or a combination of carboplatin and paclitaxel. ing airway remodeling, comprising: administering to a Sub 0.048. In still another embodiment of the methods directed ject an oligonucleotide comprising a CG dinucleotide, in an to preventing or treating cancer, the Subject may be further effective amount to treat airway remodeling in the Subject. In administered interferon-C. one embodiment the Subject has asthma, chronic obstructive 0049. The invention in other aspects relates to methods for pulmonary disease, or is a Smoker. In other embodiments the preventing disease in a Subject. The method involves admin Subject is free of symptoms of asthma. istering to the Subject a CpG immunostimulatory oligonucle 0059 Use of an oligonucleotide of the invention for stimu otide on a regular basis to promote immune system respon lating an immune response is also provided as an aspect of the siveness to prevent disease in the Subject. Examples of invention. diseases or conditions sought to be prevented using the pro 0060 Use of an oligonucleotide of the invention in the phylactic methods of the invention include microbial infec manufacture of a medicament of for stimulating an immune tions (e.g., sexually transmitted diseases) and anaphylactic response and performing any of the methods of the invention shock from food allergies. is also provided. 0061 Each of the limitations of the invention can encom 0050. In other aspects, the invention is a method for induc pass various embodiments of the invention. It is, therefore, ing an innate immune response by administering to the Sub anticipated that each of the limitations of the invention ject a CpG immunostimulatory oligonucleotide in an amount involving any one element or combinations of elements can effective for activating an innate immune response. be included in each aspect of the invention. 0051. According to another aspect of the invention a method for treating or preventing a viral or retroviral infec tion is provided. The method involves administering to a BRIEF DESCRIPTION OF THE DRAWINGS Subject having or at risk of having a viral or retroviral infec 0062 FIG. 1 is a series of graphs depicting IFN-alpha tion, an effective amount for treating or preventing the viral or induction by human PBMC treated with CpG ODN. retroviral infection of any of the compositions of the inven 0063 FIG. 2 is a series of graphs depicting the effects of tion. the CpG oligodeoxynucleotide SEQ ID NO. 7 against anti 0052. In some embodiments the virus is caused by a hepa gen-induced increase in nasal resistance in guinea pigs titis virus e.g., hepatitis B, hepatitis C, HIV, herpes virus, or administered in a dose of (A) 1 mg/kg and (B) (0.03-0.3 papillomavirus. mg/kg). Results are meants.e.m. ((A)=n=5-8; (B)=n=14-15). 0053 A method for treating or preventing a bacterial * P-0.05 compared with antigen-challenged group treated infection is provided according to another aspect of the inven with test vehicle (t test). tion. The method involves administering to a subject having 0064 FIG. 3 is a series of graphs depicting the effects of or at risk of having a bacterial infection, an effective amount the CpG oligodeoxynucleotide SEQ ID NO. 7 on antigen for treating or preventing the bacterial infection of any of the induced Sneezing (3A) and nasal rubbing (3B) in a mouse compositions of the invention. In one embodiment the bacte model of allergic rhinitis. Results are meants.e.m. (n=10). * rial infection is due to an intracellular bacteria. P<0.05 compared with vehicle-treated group (Mann-Whit 0054. In another aspect the invention is a method for treat ney test). ing or preventing a parasite infection by administering to a 0065 FIG. 4 is a graph depicting a titration of influenza Subject having or at risk of having a parasite infection, an virus and determination of time course of infection. Cell effective amount for treating or preventing the parasite infec numbers in bronchoalveolar lavage fluid. Results are meants. tion of any of the compositions of the invention. In one e.m. (n=5). Mice infected with 500 EIDs were sacrificed embodiment the parasite infection is due to an intracellular after 6 days because of weight loss. parasite. In another embodiment the parasite infection is due 0.066 FIG. 5 is a graph depicting the protective effects of to a non-helminthic parasite. CpG ODNs on virus load in the lung. Virus load assayed by US 2009/0137519 A1 May 28, 2009 enzyme immunoassay. Results are meants.e.m. (n=5-10). * 0077 FIG. 16 is a series of graphs depicting concentra P<0.05 compared with group B (Kruskal-Wallis test, Dunn's tions of IFN gamma in serum 8 hours after dosing with 0.1 post-test). n.d. no data. mg/kg ODN (16A); 15 hours after dosing with 0.1 mg/kg 0067 FIG. 6 is a series of graphs depicting the protective ODN (16B): 8 hours after dosing with 1 mg/kg ODN (16C); effects of CpG ODNs on virus-induced airways inflammation and 15 hours after dosing with 1 mg/kg ODN (16D). measuring total leukocytes (6A), total neutrophils (6B) and 0078 FIG. 17 is a series of graphs depicting concentra total mononuclear cells (6C). Cell numbers in bronchoalveo tions of IL-6 in serum 8 hours after dosing with 0.1 mg/kg lar lavage fluid. Results are meants.e.m. (n=10). * P-0.05 ODN (17A): 15 hours after dosing with 0.1 mg/kg ODN compared with group B (Kruskal-Wallis test, Dunn's post (17B): 8 hours after dosing with 1 mg/kg ODN (17C); and 15 test). hours after dosing with 1 mg/kg ODN (17D). 0068 FIG. 7 is a series of graphs depicting the protective 007.9 FIG. 18 is a series of graphs depicting concentra effects of CpG ODNs on cell numbers in antigen-induced tions of TNF alpha in serum 8 hours after dosing with 0.1 airways inflammation in eosinophils (7A) and neutrophils mg/kg ODN (18A); 15 hours after dosing with 0.1 mg/kg (7B). Results are meants.e.m. (n=10-14). *P-0.05 compared ODN (18B): 8 hours after dosing with 1 mg/kg ODN (18C); with antigen challenged, vehicle-treated group (Kruskal and 15 hours after dosing with 1 mg/kg ODN (18D). Wallis multiple comparison test, Dunn's post test). 0080 FIG. 19 is a series of graphs depicting the effects of 0069 FIG. 8 is a series of graphs depicting the protective CpG oligodeoxynucleotides ODN SEQID NO: 2 and ODN effects of CpG ODNs on CD3" (8A) and CD3"CD4" (8B) cell SEQ ID NO: 7 on antigen-induced IgE (19A) and IgG2a numbers in antigen-induced airways inflammation. Results (19B) production in the mouse. Results are meants.e.m. are meants.e.m. (n=8).* P-0.05 compared with antigen chal (n=10). * P-0.05 compared with antigen sensitized, vehicle lenged, vehicle-treated group (Kruskal-Wallis multiple com treated group (Kruskal-Wallis test with Dunn's post test). parison test, Dunn's post test). I0081 FIG. 20 is a series of graphs depicting Effects of 0070 FIG.9 is a series of graphs depicting cell numbers in ODNSEQID NO: 2 against influenza-induced exacerbation bronchoalveolar lavage fluid 8 hours after dosing with 0.1 of allergic airway inflammation in mice, depicting total leu mg/kg ODN (9A); 15 hours after dosing with 0.1 mg/kg ODN kocytes (20A), eosinophils (20B), neutrophils (20C), mono (9B); 8 hours after dosing with 1 mg/kg ODN (9C); and 15 nuclear cells (20D), and body weight (20E). hours after dosing with 1 mg/kg ODN (9D). Results are I0082 FIG. 21 is a guinea pig AHR Protocol used herein. meants.e.m (n=10) I0083 FIG.22 is a set of graphs depicting the effect of SEQ 0071 FIG. 10 is a series of graphs depicting concentra ID NO:7 on Airway resistance and lung compliance. For each tions of IFN alpha in bronchoalveolar lavage fluid 8 hours animal, a dose-responsecurve was obtained, and airway reac after dosing with 0.1 mg/kg ODN (10A); 15 hours after tivity was quantified as the area under the curve. Guinea pigs dosing with 0.1 mg/kg ODN (10B); 8 hours after dosing with were given intranasally either carrier (saline). OVA alone, or 1 mg/kg ODN (10C); and 15 hours after dosing with 1 mg/kg concentrations of SEQ ID NO:7 of 10 ul/kg, 30 ul/kg, 100 ODN (10D). ul/kg, or 300 ul/kg, i.t. The data demonstrate that SEQ ID 0072 FIG. 11 is a series of graphs depicting concentra NO:7 caused a dose-dependent reduction in AUC-resistance. tions of IFN gamma in bronchoalveolar lavage fluid 8 hours FIGS. 22A and 22B depict histamine release as a function of after dosing with 0.1 mg/kg ODN (11A); 15 hours after increased airway resistance (22A) or decrease in lung com dosing with 0.1 mg/kg ODN (11B); 8 hours after dosing with pliance (22B). FIGS. 22C and 22D are bar graphs depicting 1 mg/kg ODN (11C); and 15 hours after dosing with 1 mg/kg the increase in airway resistance (22C) or decrease in lung ODN (11D). compliance (22D) in response to treatment with saline, OVA 0073 FIG. 12 is a series of graphs depicting concentra or SEQID NO 7 at the indicated dosages. tions of IP-10 in bronchoalveolar lavage fluid 8 hours after I0084 FIG. 23 is a Summary of Statistical Analysis used dosing with 0.1 mg/kg ODN (12A); 15 hours after dosing herein (FIG. 22) for airway resistance (23A) and lung com with 0.1 mg/kg ODN (12B); 8 hours after dosing with 1 pliance (23B). mg/kg ODN (12C); and 15 hours after dosing with 1 mg/kg I0085 FIG.24 is a set of graphs depicting the effect of SEQ ODN (12D). ID NO:2 on Airway resistance and lung compliance. For each 0074 FIG. 13 is a series of graphs depicting concentra animal, a dose-responsecurve was obtained, and airway reac tions of IL-12p40 in bronchoalveolar lavage fluid 8 hours tivity was quantified as the area under the curve. Guinea pigs after dosing with 0.1 mg/kg ODN (13A); 15 hours after were given intranasally either carrier (saline). OVA alone, or dosing with 0.1 mg/kg ODN (13B); 8 hours after dosing with concentrations of SEQ ID NO:2 of 10 ul/kg, 30 ul/kg, 100 1 mg/kg ODN (13C); and 15 hours after dosing with 1 mg/kg ul/kg or 300 ul/kg, i.t. The data demonstrate that SEQ ID ODN (13D). NO:2 caused a dose-dependent reduction in AUC-resistance. 0075 FIG. 14 is a series of graphs depicting concentra FIGS. 24A and 24B depict histamine release as a function of tions of IL-6 in bronchoalveolar lavage fluid 8 hours after increased airway resistance (24A) or decrease in lung com dosing with 0.1 mg/kg ODN (14A); 15 hours after dosing pliance (24B). FIGS. 24C and 24D are bar graphs depicting with 0.1 mg/kg ODN (14B); 8 hours after dosing with 1 the increase in airway resistance (24C) or decrease in lung mg/kg ODN (14C); and 15 hours after dosing with 1 mg/kg compliance (24D) in response to treatment with saline, OVA ODN (14D). or SEQID NO 2 at the indicated dosages. 0076 FIG. 15 is a series of graphs depicting concentra I0086 FIG. 25 is a Summary of Statistical Analysis used tions of TNFalpha in bronchoalveolar lavage fluid 8 hours herein (FIG. 24) for airway resistance (25A) and lung com after dosing with 0.1 mg/kg ODN (15A); 15 hours after pliance (25B) dosing with 0.1 mg/kg ODN (15B); 8 hours after dosing with I0087 FIG. 26 is a summary of the graphs in FIGS. 22 and 1 mg/kg ODN (15C); and 15 hours after dosing with 1 mg/kg 24. FIGS. 26A and 26B correspond to FIGS. 22C and 22D. ODN (15D). FIGS. 26C and 26D correspond to FIGS. 24C and 24D. US 2009/0137519 A1 May 28, 2009
0088 FIG. 27 is a set of graphs depicting levels of IL-10 of the graph. Each data point is the mean fluorescence inten ug/ml) secreted from human PBMC (3 donors) following sity of three donors. The cells were incubated with the indi exposure of these cells to the oligonucleotides listed by SEQ cated ODN concentrations for 24, or 48 hours. Cells were ID No. along the bottom X-axis of the graph (data points from stained and analyzed by flow cytometry. the 3 donors are depicted by a A, and x) for 48 hours. The 0094 FIG.33 is a set of graphs depicting levels of levels of test oligonucleotides shown in FIG. 27 include SEQID NOs: CD69 expression on NK cells as an indicator of NK cell 10, 9, 13, 14, 1, and 2. The concentration of oligonucleotide activation following exposure of these cells to the oligonucle used to produce a particular data point is depicted along the otides for 24 hours listed by the SEQID NO along the bottom X-axis (uM). Supernatants were harvested and IL-10 mea X-axis of the graph. The oligonucleotides shown in FIG. 33 sured by ELISA. Given are the mean cytokine amounts of all include SEQ ID NO: 9, 13, 10, 14, 2, 1, 11, 12, and 3. The donors. concentration of oligonucleotide used to produce a particular I0089 FIG. 28 is a set of graphs depicting levels of TNF data point is depicted along the X-axis (LLM). The data shown alpha (28A), interferon-gamma (28B), and IL-6 (28C) (LM) represents the values of three donors. Below the SEQID NOS secreted from human PBMC following exposure of these is a designation referring to the class of ODN. Css=C-class cells to the oligonucleotides listed by SEQID NO. in the key semi soft, C=C-class, B-B-class, non-CpG-an ODN without of the graph. Each data point is the calculated mean cytokine an unmethylated CpG. The cells were stained with antibodies value of three donors. The PBMC were incubated with the to CD3, CD56, and CD69 and analyzed by flow cytometry. indicated ODN concentrations. Supernatants were harvested The data presented is the mean fluorescence intensity. and cytokines measured by ELISA. Given are the calculated 0.095 FIG.34 is a set of graphs depicting CD86 expression mean cytokine amounts of all donors. on human PBMC following exposure of these cells to the 0090 FIG. 29 is a set of graphs depicting levels of TNF oligonuelcotides for 48 hours listed by the SEQID NO along alpha (pg/ml) secreted from human PBMC following expo the bottom X-axis of the graph. The oligonucleotides shown sure of these cells to the oligonucleotides for 16 hours listed in FIG.34 include SEQID NO: 9, 13, 10, 14, 2, 1, 11, 12, and by the SEQID NO along the bottom X-axis of the graph. The 3. The concentration of oligonucleotide used to produce a oligonucleotides shown in FIG.29 include SEQID NO: 9, 13, particular data point is depicted along the X-axis (LLM). The 10, 14, 2, 1, 11, 12, and 3. The concentration of oligonucle data shown represents the values of three donors. Below the otide used to produce a particular data point is depicted along SEQID NOS is a designation referring to the class of ODN. the X-axis (uM). The data shown represents the values of Css=C-class semi soft, C=C-class, B-B-class, non-CpG-an three donors. Below the SEQID NOS is a designation refer ODN without an unmethylated CpG. The cells were stained ring to the class of ODN. Css=C-class semi soft, C=C-class, with antibodies to CD86, CD80, CD19, and CD14 and ana B-B-class, non-CpG-an ODN without an unmethylated lyzed by flow cytometry. The data presented is the mean CpG. Supernatants were harvested and IL-6 measured by fluorescence intensity. ELISA. Given are the mean cytokine amounts of all donors. 0096 FIG.35 is a set of graphs depicting CD86 expression 0091 FIG. 30 is a set of graphs depicting levels of IL-6 on human PBMC following exposure of these cells to the (pg/ml) secreted from human PBMC following exposure of oligonucleotides for 48 hours listed by the SEQID NO along these cells to the oligonucleotides for 24 hours listed by the the bottom X-axis of the graph. The oligonucleotides shown SEQ ID NO along the bottom X-axis of the graph. The oli in FIG.35 include SEQID NO: 9, 13, 10, 14, 2, 1, 11, 12, and gonucleotides shown in FIG. 30 include SEQID NO: 9, 13, 3. The concentration of oligonucleotide used to produce a 10, 14, 2, 1, 11, 12, and 3. The concentration of oligonucle particular data point is depicted along the X-axis (LLM). The otide used to produce a particular data point is depicted along data shown represents the values of three donors. Below the the X-axis (uM). The data shown represents the values of SEQID NOS is a designation referring to the class of ODN. three donors. Below the SEQID NOS is a designation refer Css=C-class semi soft, C=C-class, B-B-class, non-CpG-an ring to the class of ODN. Css=C-class semi soft, C=C-class, ODN without an unmethylated CpG. The cells were stained B-B-class, non-CpG-an ODN without an unmethylated with antibodies to CD86, CD80, CD19, and CD14 and ana CpG. lyzed by flow cytometry. The data presented is the mean 0092 FIG. 31 is a set of graphs depicting levels of IFN fluorescence intensity. gamma (pg/ml) secreted from human PBMC following expo (0097 FIG. 36 is a set of graphs depicting levels of CD86 sure of these cells to the oligonucleotides for 48 hours listed expression on plasmacytoid dendritic cells (36A) and CDSO by the SEQID NO along the bottom X-axis of the graph. The (36B) and CD86 (36C) expression on monocytes following oligonucleotides shown in FIG.31 include SEQID NO. 9, 13, exposure of these cells to the oligonucleotides listed by SEQ 10, 14, 2, 1, 11, 12, and 3. The concentration of oligonucle ID NO. in the key of the graph. Each data point is the a otide used to produce a particular data point is depicted along calculated mean fluorescence intensity of three donors. The the X-axis (uM). The data shown represents the values of cells were incubated with the indicated ODN concentrations three donors, Below the SEQID NOS is a designation refer for 48 hours. Cells were stained and analyzed by flow cytom ring to the class of ODN. Css=C-class semi soft, C=C-class, etry. B-B-class, non-CpG-an ODN without an unmethylated (0098 FIG. 37 is a set of graphs depicting levels of CD86 CpG. Supernatants were harvested and IFN-gamma mea expression on monocytes following exposure of the cells to sured by ELISA. Given are the mean cytokine amounts of all the oligonucleotides for 48 hours listed by the SEQID NO donors. along the bottom X-axis of the graph. The oligonucleotides 0093 FIG. 32 is a set of graphs depicting levels of CD69 shown in FIG.37 include SEQID NO: 9, 13, 10, 14, 2, 1, 11, expression (MFI) on NK cells as an indicator of NK cell 12, and 3. The concentration of oligonucleotide used to pro activation (32A) and CD80 (32B) and CD86 (32C) expres duce a particular data point is depicted along the X-axis (LLM). sion on B cells following exposure of these cells to the oligo The data shown represents the values of three donors. Below nucleotides for 24 or 48 hours listed by SEQID NO. in the key the SEQ ID NOS is a designation referring to the class of US 2009/0137519 A1 May 28, 2009
ODN. Css=C-class semi soft, C=C-class, B-B-class, non ring to the class of ODN. Css=C-class semi soft, C=C-class, CpG-an ODN without an unmethylated CpG. The cells were B-B-class, non-CpG-an ODN without an unmethylated stained with antibodies to CD86, CD80, CD19, and CD14 CpG. The cells were stained with antibodies to CD14, CD19, and analyzed by flow cytometry. The data presented is the and IP-10 and analyzed by flow cytometry. The data pre mean fluorescence intensity. sented is the mean fluorescence intensity. 0099 FIG.38 is a set of graphs depicting CD80 expression 0104 FIG. 43 is a set of graphs depicting a comparison of on monocytes following exposure of these cells to the oligo the abilities of SEQID NO. 2 and fragments thereof (SEQID nucleotides for 48 hours listed by the SEQID NO along the NO 15-17) to induce cytokine secretion from mouse spleno bottom X-axis of the graph. The oligonucleotides shown in cytes. The cytokines analyzed include IFNC. (43A), IFNY FIG.38 include SEQID NO: 9, 13, 10, 14, 2, 1, 11, 12, and 3. (43B), IP-10 (43C), IL-6 (43D), IL-10 (43E), and TNFC. The concentration of oligonucleotide used to produce a par (43F). ticular data point is depicted along the X-axis (LLM). The data 0105 FIG. 44 is a set of graphs depicting a comparison of shown represents the values of three donors. Below the SEQ the abilities of SEQID NO. 2 and fragments thereof (SEQID IDNOs is a designation referring to the class of ODN.Css=C- NO 18-20) to induce cytokine secretion from mouse spleno class semi soft, C=C-class, B-B-class, non-CpG-an ODN cytes. The cytokines analyzed include IFNC (44A), IFNY without an unmethylated CpG. The cells were stained with (44 B), IP-10 (44C), IL-6 (44D), IL-10 (44E), and TNFC. antibodies to CD86, CD80, CD19, and CD14 and analyzed by (44F). flow cytometry. The data presented is the mean fluorescence 0106 FIG. 45 is a set of graphs depicting a comparison of intensity. the abilities of SEQID NO. 2 and fragments thereof (SEQID 0100 FIG. 39 is a set of graphs depicting CD80 expression NO 21-23) to induce cytokine secretion from mouse spleno on plasmacytoid dendritic cells following exposure of these cytes. The cytokines analyzed include IFNC. (45A), IFNY cells to the oligonucleotides for 48 hours listed by the SEQID (45B), IP-10 (45C), IL-6 (45D), IL-10 (45E), and TNFo. NO along the bottom X-axis of the graph. The oligonucle (45F). otides shown in FIG.37 include SEQID NO: 9, 13, 10, 14, 2. 1, 11, 12, and 3. The concentration of oligonucleotide used to DETAILED DESCRIPTION produce a particular data point is depicted along the X-axis 0107 A sub-set of C-class semi-soft immunostimulatory (uM). The data shown represents the values of three donors. oligonucleotides are provided according to the invention. The Below the SEQID NOS is a designation referring to the class immunostimulatory oligonucleotides of the invention of ODN. Css=C-class semi soft, C=C-class, B-B-class, non described herein, in some embodiments have improved prop CpG-an ODN without an unmethylated CpG. The cells were erties including similar or enhanced potency, reduced sys stained with antibodies to CD86, CD11c, CD123, and HLA temic exposure to the kidney, liver and spleen, and may have DRandanalyzed by flow cytometry. The data presented is the reduced reactogenicity at injection sites. Although applicant mean fluorescence intensity. is not bound by a mechanism, it is believed that these 0101 FIG. 40 is a set of graphs depicting levels of expres improved properties are associated with the strategic place sion of intracellular IP-10 in B cells (40B) and monocytes ment within the immunostimulatory oligonucleotides of (40A) following exposure of these cells to the oligonucle phosphodiester or phosphodiester-like “internucleotide link otides for 24 hours listed by SEQ ID NO. in the key of the ages'. The term “internucleotide linkage' as used herein graph. Each data point is the a calculated mean fluorescence refers to the covalent backbone linkage joining two adjacent intensity of three donors. The cells were incubated with the nucleotides in a nucleic acid molecule. The covalent back indicated ODN concentrations for 24 hours. Cells were bone linkage will typically be a modified or unmodified phos stained and analyzed by flow cytometry. phate linkage, but other modifications are possible. Thus a 0102 FIG. 41 is a set of graphs depicting levels of expres linear oligonucleotide that is n nucleotides long has a total of sion of intracellular IP-10 in monocytes following exposure n-1 internucleotide linkages. These covalent backbone link of the cells to the oligonucleotides for 24 hours listed by the ages can be modified or unmodified in the immunostimula SEQ ID NO along the bottom X-axis of the graph. The oli tory oligonucleotides according to the teachings of the inven gonucleotides shown in FIG. 41 include SEQID NO: 9, 13, tion. 10, 14, 2, 1, 11, 12, and 3. The concentration of oligonucle 0108. In particular, phosphodiester orphosphodiester-like otide used to produce a particular data point is depicted along internucleotide linkages involve “internal dinucleotides'. An the X-axis (uM). The data shown represents the values of internal dinucleotide in general shall mean any pair of adja three donors. Below the SEQID NOS is a designation refer cent nucleotides connected by an internucleotide linkage, in ring to the class of ODN. Css=C-class semi soft, C=C-class, which neither nucleotide in the pair of nucleotides is a termi B-B-class, non-CpG-an ODN without an unmethylated nal nucleotide, i.e., neither nucleotide in the pair of nucle CpG. The cells were stained with antibodies to CD14, CD19, otides is a nucleotide defining the 5' or 3' end of the oligo and IP-10 and analyzed by flow cytometry. The data pre nucleotide. Thus a linear oligonucleotide that is n nucleotides sented is the mean fluorescence intensity. long has a total of n-1 dinucleotides and only n-3 internal 0103 FIG. 42 is a set of graphs depicting levels of expres dinucleotides. Each internucleotide linkage in an internal sion of intracellular IP-10 in B cells following exposure of dinucleotide is an internal internucleotide linkage. Thus a these cells to the oligonucleotides for 24 hours listed by the linear oligonucleotide that is n nucleotides long has a total of SEQ ID NO along the bottom X-axis of the graph. The oli n-1 internucleotide linkages and only n-3 internal inter gonucleotides shown in FIG. 42 include SEQID NO: 9, 13, nucleotide linkages. The strategically placed phosphodiester 10, 14, 2, 1, 11, 12, and 3. The concentration of oligonucle or phosphodiester-like internucleotide linkages, therefore, otide used to produce a particular data point is depicted along refer to phosphodiester or phosphodiester-like internucle the X-axis (uM). The data shown represents the values of otide linkages positioned between any pair of nucleotides in three donors. Below the SEQID NOS is a designation refer the nucleic acid sequence. In some embodiments the phos US 2009/0137519 A1 May 28, 2009
phodiester or phosphodiester-like internucleotide linkages and 100 nucleotides long. In typical embodiments the immu are not positioned between either pair of nucleotides closest nostimulatory oligonucleotides are between 6 and 40 or 10 to the 5' or 3' end. and 40 nucleotides long. In certain preferred embodiments 0109 The invention is based at least in some aspects on the according to the instant invention, the immunostimulatory Surprising discovery that the specific C-class semi-soft oligo oligonucleotides are between 6 and 19 or 6 and 24 nucleotides nucleotides described herein have important immunostimu long. latory activity and are preferably useful in the treatment of 0.115. It is also believed that the foregoing properties of allergy and asthma. These molecules have at least the same or semi-soft oligonucleotides generally increase with increasing in many cases possess greater immunostimulatory activity, in “dose” of phosphodiester or phosphodiester-like internucle many instances, than corresponding fully stabilized immuno otide linkages involving internal CG dinucleotides. Thus it is stimulatory oligonucleotides having the same nucleotide believed, for example, that generally for a given oligonucle Sequence. otide sequence with five internal CG dinucleotides, an oligo 0110. A semi-soft oligonucleotide is an immunostimula nucleotide with five internal phosphodiester or phosphodi tory oligonucleotide having a partially stabilized backbone, ester-like CG internucleotide linkages is more in which phosphodiester or phosphodiester-like internucle immunostimulatory than an oligonucleotide with four inter otide linkages occur only within at least one internal pyrimi nal phosphodiester or phosphodiester-like CG internucle dine-purine (YZ. preferably CG) dinucleotide. Semi-soft oli otide linkages, which in turn is more immunostimulatory than gonucleotides generally possess increased an oligonucleotide with three internal phosphodiester or immunostimulatory potency relative to corresponding fully phosphodiester-like CG internucleotide linkages, which in stabilized immunostimulatory oligonucleotides. Due to the turnis more immunostimulatory than an oligonucleotide with greater potency of semi-soft oligonucleotides, semi-soft oli two internal phosphodiester orphosphodiester-like CG inter gonucleotides may be used at lower effective concentrations nucleotide linkages, which in turn is more immunostimula and have lower effective doses than conventional fully stabi tory than an oligonucleotide with one internal phosphodiester lized immunostimulatory oligonucleotides in order to or phosphodiester-like CG internucleotide linkage. Impor achieve a desired biological effect. tantly, inclusion of even one internal phosphodiester orphos 0111. Whereas fully stabilized immunostimulatory oligo phodiester-like CG internucleotide linkage is believed to be nucleotides can exhibit dose-response maxima, semi-soft oli advantageous over no internal phosphodiester or phosphodi gonucleotides of the instant invention appear to have mono ester-like CG internucleotide linkage. In addition to the num tonically increasing dose-response curves (as assayed by ber of phosphodiester orphosphodiester-like internucleotide TLR9 stimulation) extending into higher concentrations linkages, the position along the length of the oligonucleotide beyond the optimal concentration for corresponding fully can also affect potency. stabilized immunostimulatory oligonucleotides. Thus it is 0116. The immunostimulatory oligonucleotides of the believed that semi-soft oligonucleotides of the instant inven present invention are generally protected from rapid degra tion may induce greater immunostimulation than fully stabi dation in the serum. The immunostimulatory oligonucle lized immunostimulatory oligonucleotides. otides of the present invention are also generally protected 0112. Whereas fully stabilized immunostimulatory oligo from rapid degradation in most tissues, with the exception of nucleotides less than 20 nucleotides long can have modest particular tissues with specific or excessive nuclease activity immunostimulatory activity compared with longer (e.g., 24 that are capable of degrading the immunostimulatory oligo nucleotides long) fully stabilized oligonucleotides, semi-soft nucleotides. This results in the reduction of immunostimula oligonucleotides as short as 16 nucleotides long have been tory oligonucleotides in those particular tissues, the accumu discovered to have immunostimulatory activity at least equal lation of which could otherwise lead to undesirable effects to immunostimulatory activity of fully stabilized oligonucle from long-term therapy utilizing degradation-resistant oligo otides over 20 nucleotides long. nucleotides. The oligonucleotides of the instant invention will 0113. In some instances where a 6-mer phosphorothioate generally include, in addition to the phosphodiester or phos oligonucleotide appeared to lack immunostimulatory activ phodiester-like internucleotide linkages at preferred internal ity, substitution of even one phosphodiesterinternal CG inter positions, 5' and 3' ends that are resistant to degradation. Such nucleotide linkage for a phosphorothioate linkage was found degradation-resistant ends can involve any suitable modifica to yield a corresponding 6-mer with immunostimulatory tion that results in an increased resistance against exonuclease activity. digestion over corresponding unmodified ends. For instance, 0114 Thus the size (i.e., the number of nucleotide residues the 5' and 3' ends can be stabilized by the inclusion there of at along the length of the oligonucleotide) of the immunostimu least one phosphate modification of the backbone. In a pre latory oligonucleotide may also contribute to the stimulatory ferred embodiment, the at least one phosphate modification of activity of the oligonucleotide. For facilitating uptake into the backbone at each end is independently a phosphorothio cells immunostimulatory oligonucleotides may have a mini ate, phosphorodithioate, methylphosphonate, or methylphos mum length of 6 nucleotide residues. Oligonucleotides of any phorothioate internucleotide linkage. In another embodi size greater than 6 nucleotides (even many kb long) are ment, the degradation-resistant end includes one or more capable of inducing an immune response according to the nucleotide units connected by peptide or amide linkages at invention if sufficient immunostimulatory motifs are present, the 3' end. Yet other stabilized ends, including but not limited since larger nucleic acids are degraded inside of cells. It is to those described further below, are meant to be encom believed by the instant inventors that semi-soft oligonucle passed by the invention. otides as short as 4 nucleotides can also be immunostimula 0117. As described above, the oligonucleotides of the tory if they can be delivered to the interior of the cell. In instant invention include phosphodiester or phosphodiester certain preferred embodiments according to the instant inven like linkages within and optionally adjacent to internal CG tion, the immunostimulatory oligonucleotides are between 4 dinucleotides. Such CG dinucleotides are frequently part of US 2009/0137519 A1 May 28, 2009
immunostimulatory motifs. It is not necessary, however, that ate. Other stabilized internucleotide linkages include, without an oligonucleotide contain phosphodiester or phosphodi limitation: peptide, alkyl, dephospho, and others as described ester-like linkages within every immunostimulatory motif. above. Additional phosphodiester or phosphodiester-like linkages I0121 Modified backbones such as phosphorothioates may also be maintained for even more rapid renal digestion of may be synthesized using automated techniques employing these otherwise “stabilized oligonucleotides”. either phosphoramidate or H-phosphonate chemistries. Aryl 0118. A phosphodiester internucleotide linkage is the type and alkyl-phosphonates can be made, e.g., as described in of linkage characteristic of nucleic acids found in nature. The U.S. Pat. No. 4,469,863; and alkylphosphotriesters (in which phosphodiester internucleotide linkage includes a phospho the charged oxygen moiety is alkylated as described in U.S. rus atom flanked by two bridging oxygen atoms and bound Pat. No. 5,023,243 and European Patent No. 092.574) can be also by two additional oxygen atoms, one charged and the prepared by automated Solid phase synthesis using commer other uncharged. Phosphodiester internucleotide linkage is cially available reagents. Methods for making other DNA particularly preferred when it is important to reduce the tissue backbone modifications and substitutions have been half-life of the oligonucleotide. described. Uhlmann E et al. (1990) Chem Rev. 90:544: Good 0119) A phosphodiester-like internucleotide linkage is a child J (1990) Bioconjugate Chem 1:165. Methods for pre phosphorus-containing bridging group that is chemically paring chimeric oligonucleotides are also known. For and/or diastereomerically similar to phosphodiester. Mea instance patents issued to Uhlmann et al have described Such sures of similarity to phosphodiester include susceptibility to techniques. nuclease digestion and ability to activate RNAse H. Thus for I0122) Mixed backbone modified ODN may be synthe example phosphodiester, but not phosphorothioate, oligo sized using a commercially available DNA synthesizer and nucleotides are Susceptible to nuclease digestion, while both standard phosphoramidite chemistry. (F. E. Eckstein, “Oligo phosphodiester and phosphorothioate oligonucleotides acti nucleotides and Analogues—A Practical Approach IRL vate RNAse H. In a preferred embodiment the phosphodi Press. Oxford, UK, 1991, and M. D. Matteucci and M. H. ester-like internucleotide linkage is boranophosphate (or Caruthers, Tetrahedron Lett. 21, 719 (1980)). After coupling, equivalently, boranophosphonate) linkage. U.S. Pat. No. PS linkages are introduced by sulfurization using the Beau 5,177, 198: U.S. Pat. No. 5,859,231; U.S. Pat. No. 6,160,109: cage reagent (R. P. Iyer, W. Egan, J. B. Regan and S. L. U.S. Pat. No. 6,207,819; Sergueev et al., (1998).JAm Chem Beaucage, J. Am. Chem. Soc. 112, 1253 (1990)) (0.075 M in Soc 120:9417-27. In another preferred embodiment the phos acetonitrile) or phenyl acetyl disulfide (PADS) followed by phodiester-like internucleotide linkage is diasteriomerically capping with acetic anhydride, 2.6-lutidine in tetrahydro pure Rp phosphorothioate. It is believed that diasteriomeri furane (1:1:8; V:V:V) and N-methylimidazole (1.6% in tetrahy cally pure Rp phosphorothioate is more Susceptible to drofurane). This capping step is performed after the Sulfur nuclease digestion and is better at activating RNAse H than ization reaction to minimize formation of undesired mixed or diastereomerically pure Sp phosphorothioate. It is to phosphodiester (PO) linkages at positions where a phospho be noted that for purposes of the instant invention, the term rothioate linkage should be located. In the case of the intro “phosphodiester-like internucleotide linkage' specifically duction of a phosphodiester linkage, e.g. at a CpG dinucle excludes phosphorodithioate and methylphosphonate inter otide, the intermediate phosphorous-III is oxidized by nucleotide linkages. treatment with a solution of iodine in water/pyridine. After 0120. The immunostimulatory oligonucleotide molecules cleavage from the Solid Support and final deprotection by of the instant invention have chimeric backbone. For pur treatment with concentrated ammonia (15 hrs at 50° C.), the poses of the instant invention, a chimeric backbone refers to a ODN are analyzed by HPLC on a Gen-Pak Fax column (Mil partially stabilized backbone, wherein at least one internucle lipore-Waters) using a NaCl-gradient (e.g. buffer A: 10 mM otide linkage is phosphodiester or phosphodiester-like, and NaH2PO in acetonitrile/water-1:4/v:v pH 6.8; buffer B: 10 wherein at least one other internucleotide linkage is a stabi mM NaHPO, 1.5 M NaCl in acetonitrile/water-1:4/v:v: 5 lized internucleotide linkage, wherein the at least one phos to 60% B in 30 minutes at 1 ml/min) or by capillary gel phodiester orphosphodiester-like linkage and the at least one electrophoresis. The ODN can be purified by HPLC or by stabilized linkage are different. Since boranophosphonate FPLC on a Source High Performance column (Amersham linkages have been reported to be stabilized relative to phos Pharmacia). HPLC-homogeneous fractions are combined phodiesterlinkages, for purposes of the chimeric nature of the and desalted via a C18 column or by ultrafiltration. The ODN backbone, boranophosphonate linkages can be classified was analyzed by MALDI-TOF mass spectrometry to confirm either as phosphodiester-like or as stabilized, depending on the calculated mass. the context. For example, a chimeric backbone according to I0123. The oligonucleotides of the invention can also the instant invention could in one embodiment include at least include other modifications. These include nonionic DNA one phosphodiester (phosphodiester or phosphodiester-like) analogs, such as alkyl- and aryl-phosphates (in which the linkage and at least one boranophosphonate (stabilized) link charged phosphonate oxygen is replaced by an alkyl or aryl age. In another embodiment a chimeric backbone according group), phosphodiester and alkylphosphotriesters, in which to the instant invention could include boranophosphonate the charged oxygen moiety is alkylated. Oligonucleotides (phosphodiester or phosphodiester-like) and phosphorothio which contain diol. Such as tetraethyleneglycol or hexaethyl ate (stabilized) linkages. A “stabilized internucleotide link eneglycol, at either or both termini have also been shown to be age' shall mean an internucleotide linkage that is relatively Substantially resistant to nuclease degradation. resistant to in vivo degradation (e.g., via an exo- or endo 0.124. The oligonucleotides of the present invention are nuclease), compared to a phosphodiester internucleotide nucleic acids that contain specific sequences found to elicitan linkage. Preferred stabilized internucleotide linkages immune response. These specific sequences that elicit an include, without limitation, phosphorothioate, phospho immune response are referred to as “immunostimulatory rodithioate, methylphosphonate, and methylphosphorothio motifs, and the oligonucleotides that contain immunostimu US 2009/0137519 A1 May 28, 2009
latory motifs are referred to as “immunostimulatory nucleic I0129. The C CpG ODN may have the formula: 5' acid molecules' and, equivalently, “immunostimulatory XDCGHX 3". X and X are independently any sequence 0 nucleic acids' or “immunostimulatory oligonucleotides'. to 10 nucleotides long. D is a nucleotide other than C. C is The immunostimulatory oligonucleotides of the invention cytosine. G is guanine. H is a nucleotide other than G. The thus include at least one immunostimulatory motif. In a pre nucleic acid sequence also includes a nucleic acid sequence ferred embodiment the immunostimulatory motif is an “inter selected from the group consisting of P and N positioned nal immunostimulatory motif. The term “internal immuno immediately 5' to X or immediately 3' to X, N is a B-cell stimulatory motif refers to the position of the motifsequence neutralizing sequence which begins with a CGG trinucleotide within a longer nucleic acid sequence, which is longer in and is at least 10 nucleotides long. P is a GC-rich palindrome length than the motif sequence by at least one nucleotide containing sequence at least 10 nucleotides long. linked to both the 5' and 3' ends of the immunostimulatory 0.130. In some embodiments the immunostimulatory motif sequence. nucleic acid is 5' NXDCGHX, 3',5' XDCGHXN 3',51 0.125. The immunostimulatory oligonucleotides include PX DCGHX, 3',5 rich palindrome includes at least four CG dinucleotides. In nucleotides long, S. comprises a non-nucleotidic linker, an certain preferred embodiments the GC-rich palindrome has a abasic linker (dSpacers), triethylene glycol units or hexaeth central CG dinucleotide. ylene glycol units, and/or (N)... (N2)(N) S (N)(N). . 0144. In certain embodiments the GC-rich palindrome is . (N) has a GC content that is less than %. CGGCGCGCGCCG (SEQIDNO:58), CGGCGGCCGCCG 0153. In one embodiment each of N. N. ... N, and N, (SEQID NO. 59), CGACGATCGTCG (SEQID NO:60) or N2, ... N, is chosen from C, G, or modifications thereof, CGACGTACGTCG (SEQID NO: 61). wherein C base-pairs with G. 0145. In certain embodiments the GC-rich palindrome is 0154) In one embodiment each of N. N. ... N, and N, CGCGCGCGCGCG (SEQID NO:62), GCGCGCGCGCGC N2, ... N, is chosen from T, A, or modifications thereof, and (SEQ ID NO: 63), CCCCCCGGGGGG (SEQ ID NO: 64), T base-pairs with A. GGGGGGCCCCCC (SEQ ID NO: 65), CCCCCGGGGG 0.155. In these and other embodiments each of C, G, A, and (SEQ ID NO: 66) or GGGGGCCCCC (SEQID NO: 67). T can refer to deoxynucleotides with corresponding bases 0146). In some embodiments NPyGN is a sequence cytosine, guanine, adenine, and thymine. selected from the group consisting of TTTTTCG, TCG, 0156. In one embodiment each of N, N ... N, and N, TTCG, TTTCG, TTTTCG, TCGT, TTCGT, TTTCGT, and N. . . . N is chosen from C, T, A, G, or modifications TCGTCGT. thereof, and C base-pairs with G., T base-pairs with G. A 0147 An immunostimulatory nucleic acid of 13-100 base-pairs with T, and A base-pairs with G. nucleotides in length is provided according to other aspects of I0157. In one embodiment each of N. N. ... N, and N, the invention. The nucleic acid has the formula: 5' NPyG/ N2, ... N, is chosen from unmodified or modified nucle INP3'. G/I refers to single nucleotide which is either a G or otides which form Watson-Crick basepairs. an I.G is guanine and I is Inosine. 0158. In one embodiment each of N, N ... N, and N, 0148 N is any sequence 1 to 6 nucleotides long. Py is a N. . . . N is chosen from unmodified or modified nucle pyrimidine. N is any sequence 0 to 30 nucleotides long. otides which form non-Watson-Crick basepairs. 0149 P is a palindrome containing sequence at least 10 0159. In one embodiment the immunostimulatory nucleic nucleotides long. In some embodiments P is a GC-rich pal acid molecule includes a partially stabilized backbone with at indrome. In other embodiments P is an IC-rich palindrome. least one phosphodiester bond. 0150. NPyIN in some embodiments is TCITCITTTT 0160. In one embodiment the immunostimulatory nucleic (SEQ ID NO: 62). acid molecule includes a backbone with at least one stabilized 0151. A class of oligonucleotides referred to herein as internucleotide linkage. modified C-class oligonucleotides are characteristically 0.161. In one embodiment internucleotide linkages of the monomeric in solution. It is believed that these nucleic acid oligonucleotide are all phosphorothioate linkages. molecules can form intramolecular duplex structures in vitro, 0162. In one embodiment the immunostimulatory nucleic rendering them stable against nuclease digestion. It is also acid molecule includes a partially stabilized backbone with a believed that these same nucleic acid molecules can form phosphodiester bond joining at least one of YR or YR. intermolecular duplex and possibly even higher order struc 0163. In one embodiment Y is C. tures within the environment of the intraendosomal compart 0164. In one embodiment R is G. ment, where they are believed to exert their biological activ (0165. In one embodiment Y is C and R is G. ity. 0166 In one embodiment X or X is T. 0152 Modified C-class oligonucleotides have 3 general (0167. In one embodiment X is TX is TY is C, R is G, formulas. Formula I and k is 1. 0.168. In one embodiment X is T. X is TY is C, R is G, (Formula I) k is 1. p is 1, N and N' and Z. each contain Zero nucleotides, and Z is TTTT or d(UUUU). wherein each of Z, Z, and Z is independently any sequence (0169. In one embodiment S is a non-nucleotidic linker. 0 to 12 nucleotides long which optionally includes a non 0170 In one embodiment S contains at least one abasic nucleotidic linker or abasic dSpacer; each of X and X is dSpacer residue. independently a thymidine, deoxyuridine, deoxyadenosine or 0171 In one embodiment the oligonucleotide includes at a 5-substituted deoxyruridine; each of Y and Y is indepen least one branched non-nucleoside linkage. dently a cytosine (C) or a modified cytosine; each of R and 0172. In one embodiment the immunostimulatory nucleic R is independently aguanine (G) or a modified guanine; each acid molecule includes at least one doubler unit, at least one of Nand N' is independently any sequence 0 to 12 nucleotides trebler unit, or at least one doubler unit and at least one trebler long which optionally includes a non-nucleotidic linker or unit. abasic dSpacer, S is a non-nucleotidic linker, anabasic linker (0173. In one embodiment S is a doubler unit or a trebler (dSpacers), triethylene glycol units or hexaethylene glycol unit. units, which optionally provides for 2'5'-, 5'5'-3'3'-, 2'2'-, or 0.174. In one embodiment the oligonucleotide includes at 2'3-internucleoside linkages; S is any non-palindromic least one 2'5'-, 5'5'-3'3'-, 2'2'-, or 23'-internucleoside link sequence 1 to 10 nucleotides long or a non-nucleotidic linker, age. an abasic linker (dSpacers), triethylene glycol units or hexa 0.175. In one aspect the invention provides an immuno ethylene glycol units; each of N. N. ... N, and N. N. stimulatory nucleic acid molecule of Formula II ... N, is any nucleotide or modified nucleotide wherein N base-pairs with N. N. base-pairs with N. . . . and N, Z1 (N)(N-1)... (N2)(N1)S2(N1)(N2). . . (N-1) base-pairs with N.; k is an integer from 0 to 5; n is an integer (Na)(S)ZI(X;YR)N(X-YR2)Z2). (Formula II) from 2 to 16; p is an integer from 1 to 6; and q is an integer wherein each of Z, Z, and Z is independently any sequence from 0 to 10, and wherein when (N) . . . (N)(N) S (N) 0 to 12 nucleotides long which optionally includes a non (N2) . . . (N) is 10 to 42 nucleotides long, S is 4 to 10 nucleotidic linker or abasic dSpacer, each of X and X is US 2009/0137519 A1 May 28, 2009 independently a thymidine, deoxyuridine, deoxyadenosine or 0.192 In one embodiment X is T. X is TY is C, R is G, a 5-substituted deoxyuridine; each of Y and Y is indepen k is 1. p is 1, N and N' and Z. each contain Zero nucleotides, dently a cytosine (C) or a modified cytosine; each of R and and Z is TTTT or d(UUUU). R is independently a guanine (G) or a modified guanine; N is (0193 In one embodiment S is a non-nucleotidic linker. any sequence 0 to 12 nucleotides long which optionally (0194 In one embodiment S contains at least one abasic includes a non-nucleotidic linker or abasic dSpacer; S is a dSpacer residue. non-nucleotidic linker, an abasic linker (dSpacers), triethyl 0.195. In one embodiment the oligonucleotide includes at ene glycol units or hexaethylene glycol units, which option least one branched non-nucleoside linkage. ally provides for 2'5'-, 5'5'-3'3'-2'2'-, or 2'3'-internucleoside 0196. In one embodiment the immunostimulatory nucleic linkages; S is any non-palindromic sequence 1 to 10 nucle acid molecule includes at least one doubler unit, at least one otides long or a non-nucleotidic linker, an abasic linker trebler unit, or at least one doubler unit and at least one trebler (dSpacers), triethylene glycol units or hexaethylene glycol unit units; each of N. N. . . . N. N. and N. N. N. N. is any nucleotide or modified nucleotide wherein N base (0197) In one embodiment S is a doubler unit or a trebler pairs with N. N. base-pairs with N2, ... N, base-pairs unit with N- and N, base-pairs with N.; k is an integer from 0 0.198. In one embodiment the oligonucleotide includes at to 5; n is an integer from 2 to 16; p is an integer from 1 to 6: least one 2'5'-, 5'5'-3'3'-, 2'2'-, or 23'-internucleoside link and q is an integer from 0 to 10, and wherein when (N). . . age. (N)(N) S (N)(N)... (N) is 10 to 42 nucleotides long, 0199. In one aspect the invention provides an immuno S is 4 to 10 nucleotides long, S. comprises a non-nucleotidic stimulatory nucleic acid molecule of Formula III linker, an abasic linker (dSpacers), triethylene glycol units or hexaethylene glycol units, and/or (N). . . (N2)(N)S (N) (U), Z3 (S3) (Formula III) (N). . . (N) has a GC content that is less than %. wherein U is Z (X,YR)N(X,Y.R.), Zal (S), N (N). (0176). In one embodiment Z (N)(N) is TYR, where Y . (N)(N)(N) S (N)(N)(N)... (N); each of Z, Z. is a cytosine or a modified cytosine and R is a guanine or a and Z is independently any sequence 0 to 12 nucleotides long modified guanine. which optionally includes a non-nucleotidic linker or abasic dSpacer; each of X and X is independently a thymidine, 0177. In one embodiment each of N. N. ... N, N and deoxyuridine, deoxyadenosine or a 5-substituted deoxyuri N. N. ... N, N is chosen from C, G, or modifications dine; each of Y and Y is independently a cytosine or a thereof, wherein C base-pairs with G. modified cytosine; each of R and R is independently a gua 0178. In one embodiment each of N. N. ... N, N and nine or a modified guanine; each of N and N' is independently N, N2, ... N, N is chosen from T, A, or modifications any sequence 0 to 12 nucleotides long which optionally thereof, and T base-pairs with A. includes a non-nucleotidic linker or abasic dSpacer; S is a 0179. In these and other embodiments each of C, G, A, and non-nucleotidic linker, an abasic linker (dSpacers), triethyl T can refer to deoxynucleotides with corresponding bases ene glycol units or hexaethylene glycol units, which option cytosine, guanine, adenine, and thymine. ally provides for 2'5'-, 5'5'-3'3'-2'2'-, or 2'3'-internucleoside 0180. In one embodiment each of N. N. ... N, N and linkages; S is any non-palindromic sequence 1 to 10 nucle N. N. . . . N, N is chosen from C, T, A, G, or otides long or a non-nucleotidic linker, an abasic linker modifications thereof, and C base-pairs with G., T base-pairs (dSpacers), triethylene glycol units or hexaethylene glycol with G. A base-pairs with T. and A base-pairs with G. units: S is a director indirect 2'5'-, 5'5'-3'3'-, 2'2'-, or 23'- 0181. In one embodiment each of N. N. ... N, N and internucleoside linkage, or a non-nucleotidic linker, said non N, N2, ... N, N is chosen from unmodified or modi nucleotidic linker including abasic linkers (dSpacers), trieth fied nucleotides which form Watson-Crick basepairs. ylene glycol units, or hexaethylene glycol units facilitating a 0182. In one embodiment each of N. N. ... N, N and 2'5'-, 5'5'-3'3'- 2'2'-, or 23'-linkage of m sequence parts: N. N. ... N, N is chosen from unmodified or modified each of N, N2, ... N, and N, N2, ... N, is any nucleotide nucleotides which form non-Watson-Crick basepairs. or modified nucleotide wherein N base-pairs with N. N. 0183 In one embodiment the immunostimulatory nucleic base-pairs with N, N base-pairs with N. . . . and N, acid molecule includes a partially stabilized backbone with at base-pairs with N.; k is an integer from 0 to 5; m is an integer least one phosphodiester bond. from 2 to 10; n is an integer from 2 to 16; p is an integer from 0184. In one embodiment the immunostimulatory nucleic 1 to 6; and q is an integer from 0 to 10. acid molecule includes a backbone with at least one stabilized (0200. In certain embodiments Z (XYR) NCXYR), internucleotide linkage. Zal (SI), is a non-palindromic sequence. 0185. In one embodiment internucleotide linkages of the 0201 In certain embodiments Z (XYR) N (XYR) oligonucleotide are all phosphorothioate linkages. Z. (S), is TCGTCGTTTT (SEQ ID NO:29), 0186. In one embodiment the immunostimulatory nucleic TCGTCGTTDD (SEQ ID NO:30), TCGA, TCGAC, acid molecule includes a partially stabilized backbone with a TCGACGTC, or TCGACGTCG, wherein D is dSpacer. phosphodiester bond joining at least one of YR or YR. (0202) In certain embodiments Z (X,YR)N(X,Y,R), 0187. In one embodiment Y is C. Zal (SI), is a palindromic sequence. 0203. In certain embodiments Z (XYR) N (XYR) 0188 In one embodiment R is G. Z. (S, ), is TCGACGTCGA (SEQID NO:31) or TCGTC (0189 In one embodiment Y is C and R is G. GACGA (SEQID NO:32). (0190. In one embodiment X or X is T. 0204. In certain embodiments Z (XYR) N (XYR) 0191 In one embodiment X is T. X is TY is C, R is G, Z. (S), is TCGCGACGTT (SEQ ID NO:33) or and k is 1. TCGCGTCGTT (SEQID NO:34). US 2009/0137519 A1 May 28, 2009 0205. In one embodiment (N)... (N)(N) S (N)(N) 0212. The nucleic acid also includes a partially stabilized ... (N) Z includes a sequence AGCGAAGCT, CAATATT backbone including at least one phosphodiester 5'-CpG-3' TATTG (SEQID NO:35), CCGTTTTTGG (SEQID NO:36), linkage. CGGCGCCGTGCCG (SEQ ID NO:37), CGGCGCCGT 0213. In some instances the double-stranded part of the TGCCG (SEQ ID NO:38), CGGCGDDCGCCG (SEQ ID molecule may also contain unnatural (non-standard) base NO:39), CGGCGDDDTGCCG (SEQID NO:40), CGGCG pairs (e.g., diaminopyridine paired with Xanthosinc). Lutz M GDDCCGCCG (SEQ ID NO:41), CGGCGTCGCCGCCG J et al. (1998) Recognition of a non-standard base pair by (SEQ ID NO:42), CGTCGACGGGACGGG (SEQ ID thermostable DNA polymerases. Bioorg Med Chem Lett NO:43), CGTCGACGTGACGGG (SEQ ID NO:44), 8:1149-52. GAGAGTTGGGCTCTC (SEQ ID NO:45), GTCGAG 0214. The formulas define subsets of the class of CpG GAGGT (SEQ ID NO:46), TAATADDTATTA (SEQ ID oligonucleotides which demonstrated excellent immune stimulating properties. In the formulas 5' refers to the free 5' NO:47), TAATATCCATTA (SEQID NO:48), or TAATATT end of the oligonucleotide and 3' refers to the free 3' end of the TATTA (SEQID NO:49), wherein D is dSpacer. oligonucleotide. 0206. In one embodiment (N)... (N)(N) S (N)(N) 0215. The oligonucleotides may have one or more acces ... (N) includes a sequence GGCGCGCTGCCG (SEQID sible 5' or 3' ends. In some embodiments a 3' end can be linked NO:50). to another 3' end. Since the importance of the 5' and 3' motifs 0207. In one embodiment the 5' end of the nucleic acid has been discovered and described herein, it is also possible to begins with an immunostimulatory motif chosen from (TCG) create modified oligonucleotides having two such 5' or 3' N and RDCGYYN. T is thymine, C is unmethylated ends. This may be achieved, for instance by attaching two cytosine, G is guanine, Risa purine, Dis not C, each of Y and oligonucleotides through a 3'-3' linkage to generate an oligo Y independently is a pyrimidine, n is an integer between 1 nucleotide having one or two accessible 5' ends. Such a struc and 4, inclusive, and N is any sequence 0-12 bases long. ture might have a formula such as 5'-R 0208. The 3' end of the nucleic acid terminates in an DCGYY-N-NY.Y.GCDR-5' (wherein D represents not C: inverted repeat capable of forming a hairpin or stem-loop SEQ ID NO:51) or 5'-(TCG), N N(GCT)-5' (SEQ ID NO:52). The 3'3'- or 5'5'-linkage may be a phosphodiester, structure. The term “terminates’ refers to a structureator near phosphorothioate, or any other modified internucleoside the 3' end. Thus, the end of the near palindrome may be bridge. Methods for accomplishing Such linkages are known positioned at the actual 3' end of the molecule or alternatively in the art. For instance, such linkages have been described in the 3' end may include 1 or more additional nucleotides that Seliger Hetal. (1991) Oligonucleotide analogs with terminal are not part of the inverted repeat structure. Preferably the 3' 3'-3'- and 5'-5'-internucleotidic linkages as antisense inhibi end of the molecule includes 3 or fewer nucleotides that do tors of viral gene expression, Nucleosides & Nucleotides not form part of the inverted repeat structure. 10:469-77 and Jiang Zetal. (1999) Pseudo-cyclic oligonucle 0209. In one embodiment an “inverted repeat capable of otides: in vitro and in vivo properties, Bioorg Med Chem forming a hairpin or stem-loop structure' as used herein 7:2727-35. refers to a sequence of nucleotides that forms a GC-rich stem 0216. In some embodiments the oligonucleotide has one or hairpin that is 2 to 10 consecutive base pairs long, and of the following structures: includes at least one unmatched or mismatched base. In indi vidual embodiments the GC-rich stem is 2, 3, 4, 5, 6, 7, 8, 9, or consecutive base pairs long. In some embodiments the TCGTCGTTTTA, (SEO ID NO : 53) GC-rich stem includes at least 2, 3, or 4 G-C base pairs. 0210. In one embodiment an “inverted repeat capable of CGGCGCCGTGCCG, (SEQ ID NO:54) forming a hairpin or stem-loop structure' as used herein CGGCGTCGTGCCG, (SEO ID NO : 55) refers to a sequence of nucleotides that forms an AT-rich stem or hairpin that is 2 to 10 consecutive base pairs long, and TCGTCGTTTTACGGCGCCGTGCCG, (SEO ID NO. 56) includes at least one unmatched or mismatched base. In indi TCGTCGTTTTACGGCGTCGTGCCG, (SEO ID NO : 57) vidual embodiments the AT-rich stem is 2,3,4,5,6,7,8,9, or 10 consecutive base pairs long. In some embodiments the 0217. The invention in one aspect involves the finding that AT-rich stem includes at least 2, 3, or 4 A-T base pairs. a specific Sub-class of C-class CpG immunostimulatory oli 0211. In some instances the at least one unmatched or gonucleotides having a chimeric backbone is highly effective mismatched base bridges the ends of the stem or hairpin. This in mediating immune stimulatory effects. These CpG oligo may allow the formation of the secondary structure by pro nucleotides are useful therapeutically and prophylactically viding a flexible point in the molecule for the stems to base for stimulating the immune system to treat cancer, infectious pair and form a hairpin. Alternatively the unmatched or mis diseases, allergy, asthma, autoimmune disease, and other dis matched base(s) may be within the stem. Preferably if the orders and to help protect against opportunistic infections mismatched base is within the stem, then the stem is at least 3 following cancer chemotherapy. The strong yet balanced, basepairs long. The unmatched or mismatched bases(s) may cellular and humoral immune responses that result from CpG be any nucleotide. In some embodiments the unmatched or stimulation reflect the body's own natural defense system mismatched base is a T. Unmatched nucleotides at the end of against invading pathogens and cancerous cells. double-strands are also known as overhanging nucleotides or 0218. The invention involves, in one aspect, the discovery dangling ends which can significantly stabilize duplex for that a Subset of CpG immunostimulatory oligonucleotides mation or hairpin formation. Freier S Metal. (1983) Effects have improved immune stimulatory properties and reduced of 3' dangling end stacking on the stability of GGCC and renal inflammatory effect. In some instances, renal inflam CCGG double helixes. Biochemistry 22:6198-206. mation has been observed in subjects that have been admin US 2009/0137519 A1 May 28, 2009 istered a completely phosphorothioate oligonucleotide. It is believed that the chimeric oligonucleotides described herein - Continued produce less renal inflammation than fully phosphorothioate oligonucleotides. Additionally these oligonucleotides are (SEQ NO: highly effective in stimulating an immune response. Thus, the phosphodiester region of the molecule did not reduce it’s (SEQ NO: affectivity. 0219. The preferred CpG immunostimulatory oligonucle (SEQ NO: otides fall within one of the following 7 general formulas: TCGTCGTTCGGCGCGCCG 0220, 5' TTC GXC GNX GXC GTT 3' (SEQ ID NO. 24) wherein N is 1-3 nucleotides in length with N (SEQ NO: referring to any nucleotide, X is a pyrimidine, X and X are TCGTCGTCGTTCGGCGCGCGCCG any nucleotide. (SEQ NO: (0221) 5’ TTC GTC GTTTX, GTC GTT 3' (SEQ ID TCGTCGACGATCGGCGCGCGCCG NO. 25), wherein X is a pyrimidine. (SEQ NO: TTCGTCGTTTTGTCGTT (SEQ ID NO. : 25) (SEQ NO: 5 T. T. C. G. T. CT. T. T+x, G4T C G*T* T 3 , TTTCGTCGTTTCGTCGTT wherein X is a pyrimidine. TCGTCGTC 0222 5' TC GXC G XN XC GNCG 3' (SEQ ID NO.: 26), wherein N is 0-3 nucleotides in length, N is 0-9 nucleotides in length with N referring to any nucleotide and GTCGTCGT X, X, and X are any nucleotide. 0223) 5’ TC GTC GTNTC GGCGCNGCCG 3' (SEQ TCGTCGTT ID NO. 27), wherein N is 0-3 nucleotides in length. CGTCGTTC GTCGTTCG TCGTTCGG wherein N is 0-3 nucleotides in length. CGTTCGGC 0224) 5’ TC G X, C G XC G XTC GGCGC G. N.3" (SEQ ID NO.: 28), wherein N is 1-5 nucleotides in length GTTCGGCG with N referring to any nucleotide and X, X, and X are any TTCGGCGC nucleotide. 0225 Optionally, when specified in the formula, 5' refers TCGGCGCG to the free 5' end of the oligonucleotide and 3' refers to the free 3' end of the oligonucleotide. CGGCGCGC 0226. The symbol * used in the formulas refers to the GGCGCGCG presence of a stabilized internucleotide linkage. The symbol in these structures refers to the presence of a phosphodiester GCGCGCGC internucleotide linkage. The internucleotide linkages not CGCGCGCC marked with an * may be stabilized or unstabilized, as long as the oligonucleotide includes at least 2-3 phosphodiester or GCGCGCCG. phosphodiester like internucleotide linkages. In some embodiments it is preferred that the oligonucleotides include 3-6 phosphodiester orphosphodiester like linkages. In some cases the linkages between the CG motifs are phosphodiester and in other cases they are phosphorothioate or other stabi lized linkages. 0227. In some embodiment the oligonucleotide has one of the following structures: (SEQ ID NO : 3) T: C G + T C G + T + T C G+G+C+G+C+G+C+C+ G (SEQ ID NO : 4) TC GTC GAC GATC GGCGC GCGCCG (SEQ ID NO : 4) T k C G kT k C. G*A* C G k Ark T K C G kG kick G+C G kick G+C kick G US 2009/0137519 A1 May 28, 2009 15 0234 c) the replacement of a sugar phosphate unit from the Sugar phosphate backbone by another unit, 0235 d) the replacement of a B-D-ribose unit by a modi fied Sugar unit, and 0236 e) the replacement of a natural nucleotide base by a modified nucleotide base. 0237 More detailed examples for the chemical modifica tion of an oligonucleotide are as follows. 0238 A phosphodiester internucleotide bridge located at 0228. The terms “nucleic acid' and "oligonucleotide' also the 3' and/or the 5' end of a nucleotide can be replaced by a encompass nucleic acids or oligonucleotides with Substitu modified internucleotide bridge, wherein the modified inter tions or modifications, such as in the bases and/or Sugars. For nucleotide bridge is for example selected from phospho example, they include oligonucleotides having backbone rothioate, phosphorodithioate, NR'R''-phosphoramidate, Sugars that are covalently attached to low molecular weight boranophosphate, C-hydroxybenzyl phosphonate, phos organic groups other than a hydroxyl group at the 2' position phate-(C-C)—O-alkyl ester, phosphate-(C-C)aryl and other than a phosphate group or hydroxy group at the 5' (C-C)—O-alkylester, (C-C)alkylphosphonate and/or position. Thus modified oligonucleotides may include a 2'-O- (C-C)arylphosphonate bridges, (C7-C)-O-hydroxym alkylated ribose group. In addition, modified oligonucle ethyl-aryl (e.g., disclosed in WO95/01363), wherein (C- otides may include Sugars such as arabinose or 2'-fluoroara C.)aryl, (C-C)aryl and (C-C)aryl are optionally sub binose instead of ribose. Thus the oligonucleotides may be stituted by halogen, alkyl, alkoxy, nitro, cyano, and where R' heterogeneous in backbone composition thereby containing and Rare, independently of each other, hydrogen, (C-Cls)- any possible combination of polymer units linked together alkyl, (C-C)-aryl, (C-C)-aryl-(C-Cs)-alkyl, preferably Such as peptide-nucleic acids (which have an amino acid hydrogen, (C-C)-alkyl, preferably (C-C)-alkyl and/or backbone with nucleic acid bases). methoxyethyl, or R' and R form, together with the nitrogen 0229. Nucleic acids also include substituted purines and atom carrying them, a 5-6-membered heterocyclic ring which pyrimidines such as C-5 propyne pyrimidine and 7-deaza-7- can additionally contain a further heteroatom from the group substituted purine modified bases. Wagner RW et al. (1996) O, S and N. Nat Biotechnol 14:840-4. Purines and pyrimidines include 0239. The replacement of a phosphodiester bridge located but are not limited to adenine, cytosine, guanine, thymine, at the 3' and/or the 5' end of a nucleotide by a dephospho 5-methylcytosine, 5-hydroxycytosine, 5-fluorocytosine, bridge (dephospho bridges are described, for example, in 2-aminopurine, 2-amino-6-chloropurine, 2,6-diaminopurine, Uhlmann E and Peyman A in “Methods in Molecular Biol hypoxanthine, and other naturally and non-naturally occur ogy”, Vol. 20, “Protocols for Oligonucleotides and Analogs”. ring nucleobases, Substituted and unsubstituted aromatic S. Agrawal, Ed., Humana Press, Totowa 1993, Chapter 16, pp. moieties. Other such modifications are well knownto those of 355 ff), wherein a dephospho bridge is for example selected skill in the art. from the dephospho bridges formacetal, 3'-thioformacetal, 0230. The immunostimulatory oligonucleotides of the methylhydroxylamine, oxime, methylenedimethyl-hydrazo, instant invention can encompass various chemical modifica dimethylenesulfone and/or silyl groups. tions and Substitutions, in comparison to natural RNA and 0240 A Sugarphosphate unit (i.e., a 3-D-ribose and phos DNA, involving a phosphodiester internucleotide bridge, a phodiester internucleotide bridge together forming a Sugar B-D-ribose unit and/or a natural nucleotide base (adenine, phosphate unit) from the Sugar phosphate backbone (i.e., a guanine, cytosine, thymine, uracil). Examples of chemical Sugar phosphate backbone is composed of Sugar phosphate modifications are known to the skilled person and are units) can be replaced by another unit, wherein the other unit described, for example, in Uhhlmann E et al. (1990) Chem is for example suitable to build up a “morpholino-derivative' Rev 90:543; “Protocols for Oligonucleotides and Analogs' oligomer (as described, for example, in Stirchak EP et al. Synthesis and Properties & Synthesis and Analytical Tech (1989) Nucleic Acids Res 17:6129-41), that is, e.g., the niques, S. Agrawal, Ed, Humana Press, Totowa, USA 1993; replacement by a morpholino-derivative unit; or to build up a Crooke STetal. (1996) Annu Rev Pharmacol Toxicol 36:107 polyamide nucleic acid (“PNA'; as described for example, in 129; and Hunziker J et al. (1995) Mod Synth Methods 7:331 Nielsen PE et al. (1994) Bioconjug Chem 5:3-7), that is, e.g., 417. An oligonucleotide according to the invention may have the replacement by a PNA backbone unit, e.g., by 2-amino one or more modifications, wherein each modification is ethylglycine. located at a particular phosphodiester internucleotide bridge 0241 AP-ribose unit or a B-D-2'-deoxyribose unit can be and/or at a particular B-D-ribose unit and/or at a particular replaced by a modified Sugar unit, wherein the modified Sugar natural nucleotide base position in comparison to an oligo unit is for example selected from B-D-ribose, C-D-2'-deox nucleotide of the same sequence which is composed of natu yribose, L-2'-deoxyribose, 2'-F-2'-deoxyribose, 2'-F-arabi ral DNA or RNA. nose. 2'-O (C-C)alkyl-ribose, preferably 2'-O (C-C) 0231. For example, the invention relates to an oligonucle alkyl-ribose is 2'-O-methylribose, 2'-O (C-C)alkenyl otide which may comprise one or more modifications and ribose, 2'-O (C-C)alkyl-O (C-C)alkyl-ribose, wherein each modification is independently selected from: 2 NH-2'-deoxyribose, B-D-xylo-furanose, a-arabinofura 0232 a) the replacement of a phosphodiester internucle nose, 2,4-dideoxy-B-D-erythro-hexo-pyranose, and carbocy otide bridge located at the 3' and/or the 5' end of a nucle clic (described, for example, in Froehler J (1992) Am Chem otide by a modified internucleotide bridge, SoC 114:8320) and/or open-chain Sugar analogs (described, 0233 b) the replacement of phosphodiester bridge located for example, in Vandendriessche et al. (1993) Tetrahedron at the 3' and/or the 5' end of a nucleotide by a dephospho 49:7223) and/or bicyclosugar analogs (described, for bridge, example, in Tarkov Metal. (1993) Helv Chim Acta 76:481). US 2009/0137519 A1 May 28, 2009 0242. In some preferred embodiments the sugar is 2'-O- 0246. It recently has been reported that CpG oligonucle methylribose, particularly for one or both nucleotides linked otides appear to exert their immunostimulatory effect through by a phosphodiester or phosphodiester-like internucleotide interaction with Toll-like receptor 9 (TLR9). Hemmi Het al. linkage. (2000) Nature 408.740-5.TLR9 signaling activity thus can be measured in response to CpG oligonucleotide or other immu 0243 A modified base is any base which is chemically nostimulatory oligonucleotide by measuring NF-KB, NF-kB distinct from the naturally occurring bases typically found in related signals, and Suitable events and intermediates DNA and RNA such as T, C, G, A, and U, but which share upstream or downstream of NF-kB. basic chemical structures with these naturally occurring 0247 For use in the instant invention, the oligonucleotides bases. The modified nucleotide base may be, for example, of the invention can be synthesized de novo using any of a selected from hypoxanthine, uracil, dihydrouracil, pseudou number of procedures well known in the art. For example, the racil, 2-thiouracil, 4-thiouracil, 5-aminouracil, S-(C-C)- b-cyanoethyl phosphoramidite method (Beaucage, S. L., and alkyluracil, 5-(C-C)-alkenyluracil, 5-(C-C)-alkynylu Caruthers, M. H., Tet. Let. 22:1859, 1981); and nucleotide racil, 5-(hydroxymethyl)uracil, 5-chlorouracil, H-phosphonate method (Garegg et al., Tet. Let. 27:4051 5-fluorouracil, 5-bromouracil, 5-hydroxycytosine, 5-(C- 4054, 1986; Froehler et al., Nucl. Acid. Res. 14:5399-5407, C)-alkylcytosine, 5-(C-C)-alkenylcytosine, 5-(C-C)- 1986, Garegget al., Tet. Let. 27:4055-4058, 1986, Gaffney et alkynylcytosine, 5-chlorocytosine, 5-fluorocytosine, 5-bro al., Tet. Let. 29:2619-2622, 1988). These chemistries can be mocytosine, N-dimethylguanine, 2,4-diamino-purine, performed by a variety of automated nucleic acid synthesizers 8-azapurine, a substituted 7-deazapurine, preferably 7-deaza available in the market. These oligonucleotides are referred to 7-substituted and/or 7-deaza-8-substituted purine, 5-hy as Synthetic oligonucleotides. An isolated oligonucleotide droxymethylcytosine, N4-alkylcytosine, e.g., N4-ethylcy generally refers to an oligonucleotide which is separated from tosine, 5-hydroxydeoxycytidine, components which it is normally associated within nature. As 5-hydroxymethyldeoxycytidine, N4-alkyldeoxycytidine, an example, an isolated oligonucleotide may be one which is e.g., N4-ethyldeoxycytidine, 6-thiodeoxyguanosine, and separated from a cell, from a nucleus, from mitochondria or deoxyribonucleotides of nitropyrrole, C5-propynylpyrimi from chromatin. dine, and diaminopurine e.g., 2,6-diaminopurine, inosine, 0248. The oligonucleotides are partially resistant to deg 5-methylcytosine, 2-aminopurine, 2-amino-6-chloropurine, radation (e.g., are stabilized). A “stabilized oligonucleotide hypoxanthine or other modifications of a natural nucleotide molecule' shall mean an oligonucleotide that is relatively bases. This list is meant to be exemplary and is not to be resistant to in vivo degradation (e.g. via an exo- or endo interpreted to be limiting. nuclease). Nucleic acid stabilization can be accomplished via 0244. The oligonucleotides may have one or more acces backbone modifications. Oligonucleotides having phospho sible 5' ends. It is possible to create modified oligonucleotides rothioate linkages provide maximal activity and protect the having two such 5' ends. This may be achieved, for instance oligonucleotide from degradation by intracellular exo- and by attaching two oligonucleotides through a 3'-3' linkage to endo-nucleases. Other modified oligonucleotides include generate an oligonucleotide having one or two accessible 5' phosphodiester modified oligonucleotides, combinations of ends. The 3'3'-linkage may be a phosphodiester, phospho phosphodiester and phosphorothioate oligonucleotide, meth rothioate or any other modified internucleotide bridge. Meth ylphosphonate, methylphosphorothioate, phosphorodithio ods for accomplishing Such linkages are known in the art. For ate, p-ethoxy, and combinations thereof. instance, such linkages have been described in Seliger, H., et 0249 Modified backbones such as phosphorothioates al., Oligonucleotide analogs with terminal 3'-3'- and 5'-5'- may be synthesized using automated techniques employing internucleotidic linkages as antisense inhibitors of viral gene either phosphoramidate or H-phosphonate chemistries. Aryl expression, Nucleotides & Nucleotides (1991), 10(1-3), 469 and alkyl-phosphonates can be made, e.g., as described in 77 and Jiang, et al., Pseudo-cyclic oligonucleotides: in vitro U.S. Pat. No. 4,469,863; and alkylphosphotriesters (in which and in vivo properties, Bioorganic & Medicinal Chemistry the charged oxygen moiety is alkylated as described in U.S. (1999), 7(12), 2727-2735. Pat. No. 5,023,243 and European Patent No. 092.574) can be 0245 Additionally,3'3'-inked oligonucleotides where the prepared by automated Solid phase synthesis using commer linkage between the 3'-terminal nucleotides is not a phos cially available reagents. Methods for making other DNA phodiester, phosphorothioate or other modified bridge, can be backbone modifications and substitutions have been prepared using an additional spacer. Such as tri- or tetra described (e.g., Uhlmann, E. and Peyman, A., Chem. Rev. ethylenglycol phosphate moiety (Durand, M. et al. Triple 90:544, 1990; Goodchild, J., Bioconjugate Chem. 1:165, helix formation by an oligonucleotide containing one (dA)12 1990). and two (dT)12 sequences bridged by two hexaethylene gly 0250 Other stabilized oligonucleotides include: nonionic colchains, Biochemistry (1992), 31(38),9197-204, U.S. Pat. DNA analogs, such as alkyl- and aryl-phosphates (in which No. 5,658,738, and U.S. Pat. No. 5,668,265). Alternatively, the charged phosphonate oxygen is replaced by an alkyl or the non-nucleotidic linker may be derived from ethanediol, aryl group), phosphodiester and alkylphosphotriesters, in propanediol, or from an abasic deoxyribose (dSpacer) unit which the charged oxygen moiety is alkylated. Oligonucle (Fontanel, Marie Laurence et al., Sterical recognition by T4 otides which contain diol. Such as tetraethyleneglycol or polynucleotide kinase of non-nucleosidic moieties 5'-at hexaethyleneglycol, at either or both termini have also been tached to oligonucleotides; Nucleic Acids Research (1994), shown to be substantially resistant to nuclease degradation. 22(11), 2022-7) using standard phosphoramidite chemistry. 0251. It has been discovered according to the invention The non-nucleotidic linkers can be incorporated once or mul that the Subsets of CpG immunostimulatory oligonucleotides tiple times, or combined with each other allowing for any have dramatic immune stimulatory effects on human cells desirable distance between the 3'-ends of the two ODNs to be Such as PBMC cells, suggesting that these CpG immuno linked. stimulatory oligonucleotides are effective therapeutic agents US 2009/0137519 A1 May 28, 2009 for human vaccination, cancer immunotherapy, asthma Both types of allergic rhinitis involve a type 1 (IgE-mediated) immunotherapy, general enhancement of immune function, hypersensitivity that leads to inflammation. This inflamma enhancement of hematopoietic recovery following radiation tion is thought to be caused by an excessive degranulation of or chemotherapy, autoimmune disease and other immune mast cells and of blood-borne basophils in response to certain modulatory applications. It has also been demonstrated that allergens. This leads to increased IgE levels and the concomi the Subsets of CpG immunostimulatory oligonucleotides are tant release of inflammatory mediators, such as histamine, useful in vivo for the treatment of asthma and allergic rhinitis. and of chemotactic factors, such as cytokines, prostaglandins 0252) A subject having an allergy is a subject that has or is and leukotrienes, that result in a localized inflammatory reac at risk of developing an allergic reaction in response to an tion. allergen. An allergy refers to acquired hypersensitivity to a 0257 The immunostimulatory oligonucleotides may be Substance (allergen). Allergic conditions include but are not administered as stand alone therapy without an additional limited to eczema, allergic rhinitis or coryza, hay fever, con anti-allergy/asthma medicament ortherapy or in combination junctivitis, bronchial asthma, urticaria (hives) and food aller with Such a therapy or medicament. Typical anti allergy/ gies, and other atopic conditions. asthma medicaments and therapies include the use of intra 0253 Allergies are generally caused by IgE antibodygen nasal vasoconstrictors, intranasal and systemic antihista eration against harmless allergens. The cytokines that are mines, intranasal glucocorticoids, mast cell stabilizers, such induced by Systemic or mucosal administration of CpG as cromolyn compounds, and oral decongestants. immunostimulatory oligonucleotides are predominantly of a 0258 An allergen refers to a substance (antigen) that can class called Th1 (examples are IL-12, IP-10. IFN-O. and IFN induce an allergic or asthmatic response in a Susceptible Y) and these induce both humoral and cellular immune Subject. The list of allergens is enormous and can include responses. The other major type of immune response, which pollens, insect venoms, animal dander dust, fungal spores and is associated with the production of IL-4 and IL-5 cytokines, drugs (e.g. penicillin). Examples of natural, animal and plant is termed a Th2 immune response. In general, it appears that allergens include but are not limited to proteins specific to the allergic diseases are mediated by Th2 type immune following genuses: Canine (Canis familiaris); Dermatopha responses. Based on the ability of the CpG immunostimula goides (e.g. Dermatophagoides farinae); Felis (Felis domes tory oligonucleotides to shift the immune response in a Sub ticus); Ambrosia (Ambrosia artemisfolia, Lolium (e.g. ject from a predominant Th2 (which is associated with pro Lolium perenne or Lolium multiflorum); Cryptomeria (Cryp duction of IgE antibodies and allergy) to a balanced Th2/Th1 tomeria japonica); Alternaria (Alternaria alternata); Alder, response (which is protective against allergic reactions), an Alnus (Alnus guiltinoasa); Betula (Betula verrucosa); Outer effective dose for inducing an immune response of a CpG cus (Ouercus alba); Olea (Olea europa); Artemisia (Artemi immunostimulatory oligonucleotide as a standalone therapy sia vulgaris); Plantago (e.g. Plantago lanceolata); Parietaria without allergen or in combination with allergen can be (e.g. Parietaria officinalis or Parietaria judaica); Blattella administered to a subject to treat or prevent asthma and (e.g. Blattella germanica): Apis (e.g. Apis multiflorum); allergy. Cupressus (e.g. Cupressus sempervirens, Cupressus ari 0254 Thus, the CpG immunostimulatory oligonucle zonica and Cupressus macrocarpa); Juniperus (e.g. Junipe otides have significant therapeutic utility in the treatment of rus Sabinoides, Juniperus virginiana, Juniperus communis allergic conditions such as asthma and allergic rhinitis. Th2 and Juniperus ashei); Thuya (e.g. Thuya Orientalis); cytokines, especially IL-4 and IL-5 are elevated in the air Chamaecyparis (e.g. Chamaecyparis obtusa); Periplaneta ways of asthmatic Subjects. These cytokines promote impor (e.g. Periplaneta americana); Agropyron (e.g. Agropyron tant aspects of the asthmatic inflammatory response, includ repens); Secale (e.g. Secale cereale); Triticum (e.g. Triticum ing IgE isotope Switching, eosinophil chemotaxis and aestivum); Dactylis (e.g. Dactylis glomerata); Festuca (e.g. activation and mast cell growth. Th1 cytokines, especially Festuca elation); Poa (e.g. Poa pratensis or Poa compressa); IFN-Y and IL-12, can suppress the formation of Th2 clones Avena (e.g. Avena sativa); Holcus (e.g. Holcus lanatus); and production of Th2 cytokines. Asthma refers to a disorder Anthoxanthum (e.g. Anthoxanthum Odoratum); Arrhen of the respiratory system characterized by inflammation, nar atherum (e.g. Arrhenatherum elatius); Agrostis (e.g. Agrostis rowing of the airways and increased reactivity of the airways alba); Phleum (e.g. Phleum pratense); Phalaris (e.g. to inhaled agents. Asthma is frequently, although not exclu Phalaris arundinacea); Paspalum (e.g. Paspalum notatum); sively associated with atopic or allergic symptoms. Sorghum (e.g. Sorghum halepensis); and Bromus (e.g. Bro 0255 Asthma may be exacerbated by viral infections. The mus inermis). combination of asthma and viral infections significantly 0259. The oligonucleotides are also useful for redirecting worsens the symptoms in a Subject. The oligonucleotides an immune response from a Th2 immune response to a Th1 used herein provide significant benefits for the treatment of immune response. This results in the production of a rela viral induced exacerbation of asthma. Several examples of tively balanced Th1/Th2 environment. Redirection of an Such therapy are presented below. immune response from a Th2 to a Th1 immune response can 0256 Allergic rhinitis is a disorder resulting in inflamma be assessed by measuring the levels of cytokines produced in tion of the nasal mucosa caused by allergens Such as pollen or response to the nucleic acid (e.g., by inducing monocytic cells dust. The term includes rhinitis medicamentosa, rhinitis and other cells to produce Th1 cytokines, including IL-12, sicca, and atrophic rhinitis. There are two general types of IFN-Y and GM-CSF). The redirection or rebalance of the allergic rhinitis, seasonal and perennial. Seasonal allergic immune response from a Th2 to a Th1 response is particularly rhinitis is normally referred to as hay fever and is usually useful for the treatment or prevention of asthma. For instance, caused by mould or pollen. Perennial allergic rhinitis is usu an effective amount for treating asthma can be that amount; ally caused by an inherent sensitivity to one or more types of useful for redirecting a Th2 type of immune response that is allergen. This condition generally continues throughout the associated with asthma to a Th1 type of response or a bal year or for as long as the patient is exposed to the allergen. anced Th1/Th2 environment. Th2 cytokines, especially IL-4 US 2009/0137519 A1 May 28, 2009 and IL-5 are elevated in the airways of asthmatic subjects. The disease, as used herein, is a disease arising from the presence CpG immunostimulatory oligonucleotides of the invention of a foreign microorganism in the body. It is particularly cause an increase in Th1 cytokines which helps to rebalance important to develop effective vaccine strategies and treat the immune system, preventing or reducing the adverse ments to protect the body's mucosal Surfaces, which are the effects associated with a predominately Th2 immune primary site of pathogenic entry. response. 0264. A Subject having a cancer is a subject that has detect 0260 The CpG immunostimulatory oligonucleotides are able cancerous cells. The cancer may be a malignant or non also useful in Some aspects of the invention as a vaccine for malignant cancer. Cancers or tumors include but are not lim the treatment of a Subject at risk of developing an infection ited to biliary tract cancer, brain cancer, breast cancer, with an infectious organism or a cancer in which a specific cervical cancer, choriocarcinoma; colon cancer, endometrial cancer antigen has been identified, in addition to allergy or cancer, esophageal cancer, gastric cancer, intraepithelial neo asthma. The CpG immunostimulatory oligonucleotides can plasms; lymphomas; liver cancer; lung cancer (e.g. Small cell also be given without the antigen or allergen for protection and non-Small cell); melanoma; neuroblastomas; oral cancer, against infection, allergy or cancer, and in this case repeated ovarian cancer, pancreas cancer, prostate cancer, rectal can doses may allow longer term protection. A Subject at risk as cer; sarcomas; skin cancer, testicular cancer, thyroid cancer, used herein is a Subject who has any risk of exposure to an and renal cancer, as well as other carcinomas and sarcomas. In infection causing pathogen or a cancer oran allergen or a risk one embodiment the cancer is hairy cell leukemia, chronic of developing cancer. For instance, a subject at risk may be a myelogenous leukemia, cutaneous T-cell leukemia, multiple Subject who is planning to travel to an area where a particular myeloma, follicular lymphoma, malignant melanoma, squa type of infectious agent is found or it may be a Subject who mous cell carcinoma, renal cell carcinoma, prostate carci through lifestyle or medical procedures is exposed to bodily noma, bladder cell carcinoma, or colon carcinoma. fluids which may contain infectious organisms or directly to 0265 A subject shall mean a human or vertebrate animal the organism or even any subject living in an area where an including but not limited to a dog, cat, horse, cow, pig, sheep, infectious organism or an allergen has been identified. Sub goat, turkey, chicken, primate, e.g., monkey, and fish (aquac jects at risk of developing infection also include general ulture species), e.g. salmon. Thus, the invention can also be populations to which a medical agency recommends vacci used to treat cancer and tumors, infections, and allergy/ nation with a particular infectious organism antigen. If the asthma in non human Subjects. Cancer is one of the leading antigen is an allergen and the Subject develops allergic causes of death in companion animals (i.e., cats and dogs). responses to that particular antigen and the subject may be 0266. As used herein, the term treat, treated, or treating exposed to the antigen, i.e., during pollen season, then that when used with respect to an disorder Such as an infectious Subject is at risk of exposure to the antigen. A Subject at risk disease, cancer, allergy, or asthma refers to a prophylactic of developing an allergy to asthma includes those Subjects treatment which increases the resistance of a subject to devel that have been identified as having an allergy or asthma but opment of the disease (e.g., to infection with a pathogen) or, that don't have the active disease during the CpG immuno in other words, decreases the likelihood that the subject will stimulatory oligonucleotide treatment as well as Subjects that develop the disease (e.g., become infected with the pathogen) are considered to be at risk of developing these diseases as well as a treatment after the subject has developed the because of genetic or environmental factors. disease in order to fight the disease (e.g., reduce or eliminate 0261) A subject at risk of developing a cancer is one who the infection) or prevent the disease from becoming worse. has a high probability of developing cancer. These Subjects 0267 In the instances when the CpG oligonucleotide is include, for instance, Subjects having a genetic abnormality, administered with an antigen, the Subject may be exposed to the presence of which has been demonstrated to have a cor the antigen. As used herein, the term exposed to refers to relative relation to a higher likelihood of developing a cancer either the active step of contacting the Subject with an antigen and Subjects exposed to cancer causing agents such as or the passive exposure of the Subject to the antigen in vivo. tobacco, asbestos, or other chemical toxins, or a subject who Methods for the active exposure of a Subject to an antigen are has previously been treated for cancer and is in apparent well-known in the art. In general, an antigen is administered remission. When a subject at risk of developing a cancer is directly to the Subject by any means Such as intravenous, treated with an antigen specific for the type of cancerto which intramuscular, oral, transdermal, mucosal, intranasal, the Subject is at risk of developing and a CpG immunostimu intratracheal, or Subcutaneous administration. The antigen latory oligonucleotide, the subject may be able to kill the can be administered systemically or locally. Methods for cancer cells as they develop. If a tumor begins to form in the administering the antigen and the CpG immunostimulatory Subject, the Subject will develop a specific immune response oligonucleotide are described in more detail below. A subject against the tumor antigen. is passively exposed to an antigen if an antigen becomes 0262. In addition to the use of the CpG immunostimula available for exposure to the immune cells in the body. A tory oligonucleotides for prophylactic treatment, the inven Subject may be passively exposed to an antigen, for instance, tion also encompasses the use of the CpG immunostimulatory by entry of a foreign pathogen into the body or by the devel oligonucleotides for the treatment of a Subject having an opment of a tumor cell expressing a foreign antigen on its infection, an allergy, asthma, or a cancer. Surface. 0263. A subject having an infection is a subject that has 0268. The methods in which a subject is passively exposed been exposed to an infectious pathogen and has acute or to an antigen can be particularly dependent on timing of chronic detectable levels of the pathogen in the body. The administration of the CpG immunostimulatory oligonucle CpG immunostimulatory oligonucleotides can be used with otide. For instance, in a subject at risk of developing a cancer or without an antigento mountanantigen specific systemic or or an infectious disease or an allergic or asthmatic response, mucosal immune response that is capable of reducing the the subject may be administered the CpG immunostimulatory level of or eradicating the infectious pathogen. An infectious oligonucleotide on a regular basis when that risk is greatest, US 2009/0137519 A1 May 28, 2009 i.e., during allergy season or after exposure to a cancer caus anti-microbial agent, as used herein, refers to a naturally ing agent. Additionally the CpG immunostimulatory oligo occurring or synthetic compound which is capable of killing nucleotide may be administered to travelers before they travel or inhibiting infectious microorganisms. The type of anti to foreign lands where they are at risk of exposure to infec microbial agent useful according to the invention will depend tious agents. Likewise the CpG immunostimulatory oligo upon the type of microorganism with which the Subject is nucleotide may be administered to soldiers or civilians at risk infected or at risk of becoming infected. Anti-microbial of exposure to biowarfare to induce a systemic or mucosal agents include but are not limited to anti-bacterial agents, immune response to the antigen when and if the Subject is anti-viral agents, anti-fungal agents and anti-parasitic agents. exposed to it. Phrases such as “anti-infective agent”, “anti-bacterial agent'. 0269. An antigen as used herein is a molecule capable of 'anti-viral agent”, “anti-fungal agent”, “anti-parasitic agent' provoking an immune response. Antigens include but are not and “parasiticide” have well-established meanings to those of limited to cells, cell extracts, proteins, polypeptides, peptides, ordinary skill in the art and are defined in standard medical polysaccharides, polysaccharide conjugates, peptide and texts. Briefly, anti-bacterial agents kill or inhibit bacteria, and non-peptide mimics of polysaccharides and other molecules, include antibiotics as well as other synthetic or natural com Small molecules, lipids, glycolipids, carbohydrates, viruses pounds having similar functions. Antibiotics are low molecu and viral extracts and multicellular organisms such as para lar weight molecules which are produced as secondary sites and allergens. The term antigen broadly includes any metabolites by cells, such as microorganisms. In general, type of molecule which is recognized by a host immune antibiotics interfere with one or more bacterial functions or system as being foreign. Antigens include but are not limited structures which are specific for the microorganism and to cancer antigens, microbial antigens, and allergens. which are not present in host cells. Anti-viral agents can be 0270. A cancer antigenas used herein is a compound. Such isolated from natural sources or synthesized and are useful for as a peptide or protein, associated with a tumor or cancer cell killing or inhibiting viruses. Anti-fungal agents are used to Surface and which is capable of provoking an immune treat Superficial fungal infections as well as opportunistic and response when expressed on the Surface of an antigen pre primary systemic fungal infections. Anti-parasite agents kill senting cell in the context of an MHC molecule. Cancer or inhibit parasites. antigens can be prepared from cancer cells either by preparing 0274 Examples of anti-parasitic agents, also referred to as crude extracts of cancer cells, for example, as described in parasiticides useful for human administration include but are Cohen, et al., 1994, Cancer Research, 54:1055, by partially not limited to albendazole, amphotericin B, benznidazole, purifying the antigens, by recombinant technology, or by de bithionol, chloroquine HCl, chloroquine phosphate, clinda novo synthesis of known antigens. Cancer antigens include mycin, dehydroemetime, diethylcarbamazine, diloxanide but are not limited to antigens that are recombinantly furoate, eflornithine, furazolidaone, glucocorticoids, halo expressed, an immunogenic portion of, or a whole tumor or fantrine, iodoquinol, ivermectin, mebendazole, mefloquine, cancer. Such antigens can be isolated or prepared recombi meglumine antimoniate, melarsoprol, metrifonate, metron nantly or by any other means known in the art. idazole, niclosamide, nifurtimox, oxaminiquine, paromomy 0271. A microbial antigen as used herein is an antigen of a cin, pentamidine isethionate, piperazine, praziquantel, pri microorganism and includes but is not limited to virus, bac maquine phosphate, proguanil, pyrantel pamoate, teria, parasites, and fungi. Such antigens include the intact pyrimethanmine-Sulfonamides, pyrimethanmine-Sulfadox microorganism as well as natural isolates and fragments or ine, quinacrine HCl, quinine Sulfate, quinidine gluconate, derivatives thereof and also synthetic compounds which are spiramycin, Stibogluconate sodium (Sodium antimony glu identical to or similar to natural microorganism antigens and conate), Suramin, tetracycline, doxycycline, thiabendazole, induce an immune response specific for that microorganism. tinidazole, trimethroprim-sulfamethoxazole, and tryparsa A compound is similar to a natural microorganism antigen if mide some of which are used alone or in combination with it induces an immune response (humoral and/or cellular) to a others. natural microorganism antigen. Such antigens are used rou 0275 Antibacterial agents kill or inhibit the growth or tinely in the art and are well known to those of ordinary skill function of bacteria. A large class of antibacterial agents is in the art. antibiotics. Antibiotics, which are effective for killing or 0272. The term substantially purified as used herein refers inhibiting a wide range of bacteria, are referred to as broad to a polypeptide which is substantially free of other proteins, spectrum antibiotics. Other types of antibiotics are predomi lipids, carbohydrates or other materials with which it is natu nantly effective against the bacteria of the class gram-positive rally associated. One skilled in the art can purify viral or or gram-negative. These types of antibiotics are referred to as bacterial polypeptides using standard techniques for protein narrow spectrum antibiotics. Other antibiotics which are purification. The substantially pure polypeptide will often effective against a single organism or disease and not against yield a single major band on a non-reducing polyacrylamide other types of bacteria, are referred to as limited spectrum gel. In the case of partially glycosylated polypeptides or those antibiotics. Antibacterial agents are sometimes classified that have several start codons, there may be several bands on based on their primary mode of action. In general, antibacte a non-reducing polyacrylamide gel, but these will form a rial agents are cell wall synthesis inhibitors, cell membrane distinctive pattern for that polypeptide. The purity of the viral inhibitors, protein synthesis inhibitors, nucleic acid synthesis or bacterial polypeptide can also be determined by amino or functional inhibitors, and competitive inhibitors. terminal amino acid sequence analysis. Other types of anti 0276 Antiviral agents are compounds which prevent gens not encoded by a nucleic acid vector Such as polysac infection of cells by viruses or replication of the virus within charides, Small molecule, mimics etc are included within the the cell. There are many fewer antiviral drugs than antibacte invention. rial drugs because the process of viral replication is so closely 0273. The oligonucleotides of the invention may be related to DNA replication within the host cell, that non administered to a Subject with an anti-microbial agent. An specific antiviral agents would often be toxic to the host. US 2009/0137519 A1 May 28, 2009 20 There are several stages within the process of viral infection immidazoles, such as clotrimazole, sertaconzole, flucona which can be blocked or inhibited by antiviral agents. These Zole, itraconazole, ketoconazole, miconazole, and Voricona Stages include, attachment of the virus to the host cell (immu cole, as well as FK 463, amphotericin B, BAY 38-9502, MK noglobulin or binding peptides), uncoating of the virus (e.g. 991, pradimicin, UK292, butenafine, and terbinafine. Other amantadine), synthesis or translation of viral mRNA (e.g. anti-fungal agents function by breaking down chitin (e.g. interferon), replication of viral RNA or DNA (e.g. nucleotide chitinase) or immunosuppression (501 cream). analogues), maturation of new virus proteins (e.g. protease 0281 CpG immunostimulatory oligonucleotides can be inhibitors), and budding and release of the virus. combined with other therapeutic agents such as adjuvants to (0277 Nucleotide analogues are synthetic compounds enhance immune responses. The CpG immunostimulatory which are similar to nucleotides, but which have an incom oligonucleotide and other therapeutic agent may be adminis plete or abnormal deoxyribose or ribose group. Once the tered simultaneously or sequentially. When the other thera nucleotide analogues are in the cell, they are phosphorylated, peutic agents are administered simultaneously they can be producing the triphosphate formed which competes with nor administered in the same or separate formulations, but are mal nucleotides for incorporation into the viral DNA or RNA. administered at the same time. The other therapeutic agents Once the triphosphate form of the nucleotide analogue is are administered sequentially with one another and with CpG incorporated into the growing nucleic acid chain, it causes immunostimulatory oligonucleotide, when the administra irreversible association with the viral polymerase and thus tion of the other therapeutic agents and the CpG immuno chain termination. Nucleotide analogues include, but are not stimulatory oligonucleotide is temporally separated. The limited to, acyclovir (used for the treatment of herpes simplex separation in time between the administration of these com virus and varicella-zoster virus), gancyclovir (useful for the pounds may be a matter of minutes or it may be longer. Other treatment of cytomegalovirus), idoxuridine, ribavirin (useful therapeutic agents include but are not limited to adjuvants, for the treatment of respiratory syncitial virus), dideoxyi cytokines, antibodies, antigens, etc. nosine, dideoxycytidine, Zidovudine (azidothymidine), imi 0282. The compositions of the invention may also be quimod, and resimiquimod. administered with non-nucleic acid adjuvants. A non-nucleic 0278. The interferons are cytokines which are secreted by acid adjuvant is any molecule or compound except for the virus-infected cells as well as immune cells. The interferons CpG immunostimulatory oligonucleotides described herein function by binding to specific receptors on cells adjacent to which can stimulate the humoral and/or cellular immune the infected cells, causing the change in the cell which pro response. Non-nucleic acid adjuvants include, for instance, tects it from infection by the virus. C, and B-interferon also adjuvants that create a depo effect, immune stimulating adju induce the expression of Class I and Class II MHC molecules Vants, and adjuvants that create a depo effect and stimulate the on the surface of infected cells, resulting in increased antigen immune system. presentation for host immune cell recognition. C. and f-inter (0283) The CpG immunostimulatory oligonucleotides are ferons are available as recombinant forms and have been used also useful as mucosal adjuvants. It has previously been dis for the treatment of chronic hepatitis Band C infection. At the covered that both systemic and mucosal immunity are dosages which are effective for anti-viral therapy, interferons induced by mucosal delivery of CpG oligonucleotides. Thus, have severe side effects such as fever, malaise and weight the oligonucleotides may be administered in combination loss. with other mucosal adjuvants. 0279 Anti-viral agents useful in the invention include but 0284. Immune responses can also be induced or aug are not limited to immunoglobulins, amantadine, interferons, mented by the co-administration or co-linear expression of nucleotide analogues, and protease inhibitors. Specific cytokines (Bueler & Mulligan, 1996; Chow et al., 1997: Gei examples of anti-virals includebut are not limited to Aceman ssler et al., 1997: Iwasaki et al., 1997: Kim et al., 1997) or B-7 nan: Acyclovir, Acyclovir Sodium: Adefovir; Alovudine: co-stimulatory molecules (Iwasaki et al., 1997: Tsuji et al., Alvircept Sudotox: Amantadine Hydrochloride; Aranotin: 1997) with the CpG immunostimulatory oligonucleotides. Arildone; Atevirdine Mesylate: Avridine: Cidofovir, Cipam The term cytokine is used as a generic name for a diverse fylline; Cytarabine Hydrochloride; Delavirdine Mesylate: group of soluble proteins and peptides which act as humoral Desciclovir, Didanosine; Disoxaril: Edoxudine; Enviradene: regulators at nano- to picomolar concentrations and which, Enviroxime; Famciclovir. Famotine Hydrochloride; Fiacit either under normal or pathological conditions, modulate the abine; Fialuridine; Fosarilate; Foscarnet Sodium; Fosfonet functional activities of individual cells and tissues. These Sodium; Ganciclovir, Ganciclovir Sodium; Idoxuridine: proteins also mediate interactions between cells directly and Kethoxal; Lamivudine; Lobucavir; Memotine Hydrochlo regulate processes taking place in the extracellular environ ride; Methisazone; Nevirapine; Penciclovir; Pirodavir; Rib ment. Examples of cytokines include, but are not limited to avirin; Rimantadine Hydrochloride; Saquinavir Mesylate: IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-10, IL-12, IL-15, IL-18, Somantadine Hydrochloride: Sorivudine: Statolon: Stavu granulocyte-macrophage colony stimulating factor (GM dine; Tilorone Hydrochloride; Trifluridine; Valacyclovir CSF), granulocyte colony stimulating factor (G-CSF), inter Hydrochloride; Vidarabine; Vidarabine Phosphate: Vidara feron-Y (Y-IFN), IFN-O, tumor necrosis factor (TNF), TGF-B, bine Sodium Phosphate; Viroxime; Zalcitabine; Zidovudine: FLT-3 ligand, and CD40 ligand. and Zinviroxime. 0285) The oligonucleotides are also useful for improving 0280 Anti-fungal agents are useful for the treatment and Survival, differentiation, activation and maturation of den prevention of infective fungi. Anti-fungal agents are some dritic cells. The CpG immunostimulatory oligonucleotides times classified by their mechanism of action. Some anti have the unique capability to promote cell survival, differen fungal agents function as cell wall inhibitors by inhibiting tiation, activation and maturation of dendritic cells. glucose synthase. These include, but are not limited to, basi 0286 CpG immunostimulatory oligonucleotides also ungin/ECB. Other anti-fungal agents function by destabiliz increase natural killer cell lytic activity and antibody depen ing membrane integrity. These include, but are not limited to, dent cellular cytotoxicity (ADCC). ADCC can be performed US 2009/0137519 A1 May 28, 2009 using a CpG immunostimulatory oligonucleotide in combi dine, Fluorouracil (5-FU), Flutamide, Hydroxyurea (hy nation with an antibody specific for a cellular target. Such as droxycarbamide), Ifosfamide, Interferon Alfa-2a, Alfa-2b, a cancer cell. When the CpG immunostimulatory oligonucle Leuprolide acetate (LHRH-releasing factor analogue), otide is administered to a subject in conjunction with the Lomustine (CCNU), Mechlorethamine HCl (nitrogen mus antibody the subject's immune system is induced to kill the tard), Mercaptopurine, Mesna, Mitotane (op'-DDD), Mitox tumor cell. The antibodies useful in the ADCC procedure antrone HCl, Octreotide, Plicamycin, Procarbazine HCl, include antibodies which interact with a cell in the body. Streptozocin, Tamoxifen citrate. Thioguanine. Thiotepa, Vin Many such antibodies specific for cellular targets have been blastine sulfate, Amsacrine (m-AMSA), Azacitidine, Erthro described in the art and many are commercially available. poietin, Hexamethylmelamine (HMM), Interleukin 2, 0287. The CpG immunostimulatory oligonucleotides may MitoguaZone (methyl-GAG; methyl glyoxal bis-guanylhy also be administered in conjunction with an anti-cancer drazone: MGBG), Pentostatin (2'deoxycoformycin), Semus therapy. Anti-cancer therapies include cancer medicaments, tine (methyl-CCNU), Teniposide (VM-26) and Vindesine radiation and Surgical procedures. As used herein, a "cancer Sulfate. In an important embodiment, the cancer medicament medicament” refers to a agent which is administered to a is taxol. In another embodiment the cancer medicament is a Subject for the purpose of treating a cancer, AS used herein, combination of carboplatin and paclitaxel. “treating cancer includes preventing the development of a cancer, reducing the symptoms of cancer, and/or inhibiting 0289. In another embodiment, the cancer medicament is the growth of an established cancer. In other aspects, the an immunotherapeutic agent selected from the group consist cancer medicament is administered to a Subject at risk of ing of Ributaxin, Herceptin, Quadramet, Panorex, IDEC developing a cancer for the purpose of reducing the risk of Y2B8, BEC2, C225, Oncolym, SMART M195, ATRAGEN, developing the cancer. Various types of medicaments for the Ovarex, Bexxar, LDP-03, iortó, MDX-210, MDX-11, MDX treatment of cancer are described herein. For the purpose of 22, OV103, 3622W94, anti-VEGF, Zenapax, MDX-220, this specification, cancer medicaments are classified as che MDX-447, MELIMMUNE-2, MELIMMUNE-1, motherapeutic agents, immunotherapeutic agents, cancer CEACIDE, Pretarget, NovoMAb-G2, TNT, Gliomab-H, vaccines, hormone therapy, and biological response modifi GNI-250, EMD-72000, LymphoCide, CMA 676, Monop CS. harm-C, 4B5, ior egfr3, ior c5, BABS, anti-FLK-2, MDX 0288. In one embodiment, the cancer medicament is a 260, ANA Ab, SMART 1D10 Ab, SMART ABL 364 Ab and chemotherapeutic agent selected from the group consisting of ImmuRAITCEA. methotrexate, Vincristine, adriamycin, cisplatin, non-sugar 0290. Additionally, the methods of the invention are containing chloroethylnitrosoureas, 5-fluorouracil, mitomy intended to embrace the use of more than one cancer medi cin C, bleomycin, doxorubicin, dacarbazine, taxol, fragyline, cament along with the CpG immunostimulatory oligonucle Meglamine GLA, Valrubicin, carmustaine and poliferposan, otides. As an example, where appropriate, the CpG immuno MM1270, BAY 12-9566, RAS farnesyltransferase inhibitor, stimulatory oligonucleotides may be administered with both farnesyl transferase inhibitor, MMP, MTA/LY231514, a chemotherapeutic agent and an immunotherapeutic agent. LY2646.18Lometexol, Glamolec, CI-994, TNP-470, Hycam Alternatively, the cancer medicament may embrace an immu tin/Topotecan, PKC412, Valspodar/PSC833, Novantrone/ notherapeutic agent and a cancer vaccine, or a chemothera Mitroxantrone, Metaret/Suramin, Batimastat, E7070, BCH peutic agent and a cancer vaccine, or a chemotherapeutic 4556, CS-682, 9-AC, AG3340, AG3433, Incel/VX-710, agent, an immunotherapeutic agent and a cancer vaccine all VX-853, ZD0101, ISI641, ODN 698, TA 2516/Marmistat, administered to one subject for the purpose of treating a BB2516/Marmistat, CDP845, D2163, PD183805, DX8951f. Subject having a cancer or at risk of developing a cancer. Lemonal DP 2202, FK317, Picibanil/OK-432, AD 32/Valru 0291. The use of CpG immunostimulatory oligonucle bicin, Metastron/strontium derivative, Temodal/Temozolo otides in conjunction with immunotherapeutic agents such as mide, Evacet/liposomal doxorubicin, Yew taxan/Placlitaxel, monoclonal antibodies is able to increase long-term Survival Taxol/Paclitaxel, Xeload/Capecitabine. Furtulon/Doxifluri through a number of mechanisms including significant dine, Cyclopax/oral paclitaxel, Oral Taxoid, SPU-077/Cispl enhancement of ADCC (as discussed above), activation of atin, HMR 1275/Flavopiridol, CP-358 (774)/EGFR, CP-609 natural killer (NK) cells and an increase in IFNC. levels. The (754)/RAS oncogene inhibitor, BMS-182751/oral platinum, oligonucleotides when used in combination with monoclonal UFT (Tegafur/Uracil), Ergamisol/Levamisole, Eniluracil/ antibodies serve to reduce the dose of the antibody required to 776C85/5FU enhancer, Campto/Levamisole, Camptosar/ achieve a biological result. Irinotecan, TumodeX/Ralitrexed, Leustatin/Cladribine, 0292. As used herein, the terms "cancer antigen’ and Paxex/Paclitaxel, Doxil/liposomal doxorubicin, Caelyx/lipo "tumor antigen” are used interchangeably to refer to antigens somal doxorubicin, Fludara/Fludarabine, Pharmarubicin/ which are differentially expressed by cancer cells and can Epirubicin, DepoCyt, ZD1839, LU79553/Bis-Naphthalim thereby be exploited in order to target cancer cells. Cancer ide, LU 103793/Dolastain, Caetyx/liposomal doxorubicin, antigens are antigens which can potentially stimulate appar Gemzar/Gemcitabine, ZD 0473/Anormed, YM 116, Iodine ently tumor-specific immune responses. Some of these anti seeds, CDK4 and CDK2 inhibitors, PARP inhibitors, D4809/ gens are encoded, although not necessarily expressed, by Dexifosamide, Ifes/MesneX/Ifosamide, Vumon/Teniposide, normal cells. These antigens can be characterized as those Paraplatin/Carboplatin, Plantinol/cisplatin, Vepeside/Etopo which are normally silent (i.e., not expressed) in normal cells, side, ZD 9331, Taxotere?Docetaxel, prodrug of guanine ara those that are expressed only at certain stages of differentia binoside, Taxane Analog, nitrosoureas, alkylating agents tion and those that are temporally expressed such as embry Such as melphelan and cyclophosphamide, Aminoglutethim onic and fetal antigens. Other cancer antigens are encoded by ide, Asparaginase, BuSulfan, Carboplatin, Chlorombucil, mutant cellular genes, such as oncogenes (e.g., activated ras Cytarabine HCl, Dactinomycin, Daunorubicin HCl, Estra oncogene), Suppressor genes (e.g., mutant p53), fusion pro mustine phosphate sodium, Etoposide (VP16-213), Floxuri teins resulting from internal deletions or chromosomal trans US 2009/0137519 A1 May 28, 2009 22 locations. Still other cancer antigens can be encoded by viral specific innate immune activation as used herein refers to the genes such as those carried on RNA and DNA tumor viruses. activation of immune cells other than B cells and for instance 0293. The CpG immunostimulatory oligonucleotides are can include the activation of NK cells, T cells or other also useful for treating and preventing autoimmune disease. immune cells that can respond in an antigen independent Autoimmune disease is a class of diseases in which a subject's fashion or some combination of these cells. Abroad spectrum own antibodies react with host tissue or in which immune resistance to infectious challenge is induced because the effector T cells are autoreactive to endogenous self peptides immune cells are in active form and are primed to respond to and cause destruction of tissue. Thus an immune response is any invading compound or microorganism. The cells do not mounted against a subject's own antigens, referred to as self have to be specifically primed against a particular antigen. antigens. Autoimmune diseases include but are not limited to This is particularly useful in biowarfare, and the other cir rheumatoid arthritis, Crohn's disease, multiple Sclerosis, sys cumstances described above such as travelers. temic lupus erythematosus (SLE), autoimmune encephalo 0297. The CpG immunostimulatory oligonucleotides may myelitis, myasthenia gravis (MG), Hashimoto's thyroiditis, be directly administered to the subject or may be adminis Goodpasture's syndrome, pemphigus (e.g., pemphigus Vul tered in conjunction with a nucleic acid delivery complex. A garis), Grave's disease, autoimmune hemolytic anemia, nucleic acid delivery complex shall mean a nucleic acid mol autoimmune thrombocytopenic purpura, Scleroderma with ecule associated with (e.g. ionically or covalently bound to; or anti-collagen antibodies, mixed connective tissue disease, encapsulated within) a targeting means (e.g. a molecule that polymyositis, pernicious anemia, idiopathic Addison's dis results in higher affinity binding to target cell. Examples of ease, autoimmune-associated infertility, glomerulonephritis nucleic acid delivery complexes include nucleic acids asso (e.g., crescentic glomerulonephritis, proliferative glomerulo ciated with a sterol (e.g. cholesterol), a lipid (e.g. a cationic nephritis), bullous pemphigoid, Sjögren's syndrome, insulin lipid, Virosome or liposome), or a target cell specific binding resistance, and autoimmune diabetes mellitus. agent (e.g. a ligand recognized by target cell specific recep 0294. A “self-antigen” as used herein refers to an antigen tor). Preferred complexes may be sufficiently stable in vivo to of a normal host tissue. Normal host tissue does not include prevent significant uncoupling prior to internalization by the cancer cells. Thus an immune response mounted against a target cell. However, the complex can be cleavable under self-antigen, in the context of an autoimmune disease, is an appropriate conditions within the cell so that the oligonucle undesirable immune response and contributes to destruction otide is released in a functional form. and damage of normal tissue, whereas an immune response 0298 Delivery vehicles or delivery devices for delivering mounted against a cancer antigen is a desirable immune antigen and oligonuclotides to surfaces have been described. response and contributes to the destruction of the tumor or The CpG immunostimulatory oligonucleotide and/or the cancer. Thus, in Some aspects of the invention aimed at treat antigen and/or other therapeutics may be administered alone ing autoimmune disorders it is not recommended that the (e.g., in Saline or buffer) or using any delivery vehicles known CpG immunostimulatory oligonucleotides be administered in the art. with self antigens, particularly those that are the targets of the 0299 The term effective amount of a CpG immunostimu autoimmune disorder. latory oligonucleotide refers to the amount necessary or Suf 0295. In other instances, the CpG immunostimulatory oli ficient to realize a desired biologic effect. For example, an gonucleotides may be delivered with low doses of self-anti effective amount of a CpG immunostimulatory oligonucle gens. A number of animal studies have demonstrated that otide administered with an antigen for inducing mucosal mucosal administration of low doses of antigen can result in immunity is that amount necessary to cause the development a state of immune hyporesponsiveness or “tolerance.” The of IgA in response to an antigen upon exposure to the antigen, active mechanism appears to be a cytokine-mediated immune whereas that amount required for inducing systemic immu deviation away from a Th1 towards a predominantly Th2 and nity is that amount necessary to cause the development of IgG Th3 (i.e., TGF-B dominated) response. The active suppres in response to an antigen upon exposure to the antigen. Com sion with low dose antigen delivery can also Suppress an bined with the teachings provided herein, by choosing among unrelated immune response (bystander Suppression) which is the various active compounds and weighing factors such as of considerable interest in the therapy of autoimmune dis potency, relative bioavailability, patient body weight, severity eases, for example, rheumatoid arthritis and SLE. Bystander of adverse side-effects and preferred mode of administration, Suppression involves the secretion of Th1-counter-regulatory, an effective prophylactic or therapeutic treatment regimen Suppressor cytokines in the local environment where proin can be planned which does not cause Substantial toxicity and flammatory and Th1 cytokines are released in either an anti yet is entirely effective to treat the particular subject. The gen-specific or antigen-nonspecific manner. "Tolerance' as effective amount for any particular application can vary used herein is used to refer to this phenomenon. Indeed, oral depending on Such factors as the disease or condition being tolerance has been effective in the treatment of a number of treated, the particular CpG immunostimulatory oligonucle autoimmune diseases in animals including: experimental otide being administered the size of the subject, or the severity autoimmune encephalomyelitis (EAE), experimental of the disease or condition. One of ordinary skill in the art can autoimmune myasthenia gravis, collagen-induced arthritis empirically determine the effective amount of a particular (CIA), and insulin-dependent diabetes mellitus. In these CpG immunostimulatory oligonucleotide and/orantigen and/ models, the prevention and Suppression of autoimmune dis or other therapeutic agent without necessitating undue ease is associated with a shift in antigen-specific humoral and experimentation. cellular responses from a Th1 to Th21Th3 response. 0300 Subject doses of the compounds described herein 0296. The invention also includes a method for inducing for mucosal or local delivery typically range from about 0.1 antigen non-specific innate immune activation and broad ug to 10 mg per administration, which depending on the spectrum resistance to infectious challenge using the CpG application could be given daily, weekly, or monthly and any immunostimulatory oligonucleotides. The term antigen non other amount of time there between. More typically mucosal US 2009/0137519 A1 May 28, 2009 or local doses range from about 10 ug to 5 mg per adminis dragees, capsules, liquids, gels, syrups, slurries, Suspensions tration, and most typically from about 100 ug to 1 mg, with and the like, for oral ingestion by a subject to be treated. 2-4 administrations being spaced days or weeks apart. More Pharmaceutical preparations for oral use can be obtained as typically, immune stimulant doses range from 1 Jug to 10 mg Solid excipient, optionally grinding a resulting mixture, and per administration, and most typically 10 ug to 1 mg, with processing the mixture of granules, after adding Suitableaux daily or weekly administrations. Subject doses of the com iliaries, if desired, to obtain tablets or dragee cores. Suitable pounds described herein for parenteral delivery for the pur excipients are, in particular, fillers such as Sugars, including pose of inducing an antigen-specific immune response, lactose, Sucrose, mannitol, or Sorbitol; cellulose preparations wherein the compounds are delivered with an antigen but not Such as, for example, maize starch, wheat starch, rice starch, another therapeutic agent are typically 5 to 10,000 times potato starch, gelatin, gum tragacanth, methyl cellulose, higher than the effective mucosal dose for vaccine adjuvant or hydroxypropylmethyl-cellulose, sodium carboxymethylcel immune stimulant applications, and more typically 10 to lulose, and/or polyvinylpyrrolidone (PVP). If desired, disin 1,000 times higher, and most typically 20 to 100 times higher. tegrating agents may be added, such as the cross-linked poly Doses of the compounds described herein for parenteral vinyl pyrrolidone, agar, oralginic acid or a salt thereofsuch as delivery for the purpose of inducing an innate immune Sodium alginate. Optionally the oral formulations may also be response or for increasing ADCC or for inducing an antigen formulated in saline or buffers, i.e. EDTA for neutralizing specific immune response when the CpG immunostimulatory internal acid conditions or may be administered without any oligonucleotides are administered in combination with other carriers. therapeutic agents or in specialized delivery vehicles typi 0305 Also specifically contemplated are oral dosage cally range from about 0.1 ug to 10 mg per administration, forms of the above component or components. The compo which depending on the application could be given daily, nent or components may be chemically modified so that oral weekly, or monthly and any other amount of time there delivery of the derivative is efficacious. Generally, the chemi between. More typically parenteral doses for these purposes cal modification contemplated is the attachment of at least range from about 10 ug to 5 mg per administration, and most one moiety to the component molecule itself, where said typically from about 100 ug to 1 mg, with 2-4 administrations moiety permits (a) inhibition of proteolysis; and (b) uptake being spaced days or weeks apart. In some embodiments, into the blood stream from the stomach or intestine. Also however, parenteral doses for these purposes may be used in desired is the increase in overall stability of the component or a range of 5 to 10,000 times higher than the typical doses components and increase in circulation time in the body. described above. Examples of such moieties include: polyethylene glycol, 0301 For any compound described herein the therapeuti copolymers of ethylene glycol and propylene glycol, car cally effective amount can be initially determined from ani boxymethyl cellulose, dextran, polyvinyl alcohol, polyvinyl mal models. A therapeutically effective dose can also be pyrrolidone and polyproline. Abuchowski and Davis, 1981, determined from human data for CpG oligonucleotides which “Soluble Polymer-Enzyme Adducts' In: Enzymes as Drugs, have been tested in humans (human clinical trials have been Hocenberg and Roberts, eds., Wiley-Interscience, New York, initiated) and for compounds which are known to exhibit N.Y., pp. 367-383: Newmark, et al., 1982, J. Appl. Biochem. similar pharmacological activities, such as other adjuvants, 4:185-189. Other polymers that could be used are poly-1,3- e.g., LT and other antigens for vaccination purposes. Higher dioxolane and poly-1,3,6-tioxocane. Preferred for pharma doses may be required for parenteral administration. The ceutical usage, as indicated above, are polyethylene glycol applied dose can be adjusted based on the relative bioavail moieties. ability and potency of the administered compound. Adjusting 0306 For the component the location of release may be the the dose to achieve maximal efficacy based on the methods stomach, the Small intestine (the duodenum, the jejunum, or described above and other methods as are well-known in the the ileum), or the large intestine. One skilled in the art has art is well within the capabilities of the ordinarily skilled available formulations which will not dissolve in the stomach, artisan. yet will release the material in the duodenum or elsewhere in 0302. The formulations of the invention are administered the intestine. Preferably, the release will avoid the deleterious in pharmaceutically acceptable solutions, which may rou effects of the stomach environment, either by protection of tinely contain pharmaceutically acceptable concentrations of the oligonucleotide or by release of the biologically active salt, buffering agents, preservatives, compatible carriers, material beyond the stomach environment, such as in the adjuvants, and optionally other therapeutic ingredients. intestine. 0303 For use in therapy, an effective amount of the CpG 0307 To ensure full gastric resistance a coating imperme immunostimulatory oligonucleotide can be administered to a able to at least pH 5.0 is essential. Examples of the more subject by any mode that delivers the oligonucleotide to the common inertingredients that are used as enteric coatings are desired Surface, e.g., mucosal, systemic. Administering the cellulose acetate trimellitate (CAT), hydroxypropylmethyl pharmaceutical composition of the present invention may be cellulosephthalate (HPMCP), HPMCP50, HPMCP 55, poly accomplished by any means known to the skilled artisan. vinyl acetate phthalate (PVAP), Eudragit L30D, Aquateric, Preferred routes of administration include but are not limited cellulose acetate phthalate (CAP), Eudragit L., Eudragit S, to oral, parenteral, intramuscular, intranasal, Sublingual, and Shellac. These coatings may be used as mixed films. intratracheal, inhalation, ocular, vaginal, and rectal. 0308. A coating or mixture of coatings can also be used on 0304 For oral administration, the compounds (i.e., CpG tablets, which are not intended for protection against the immunostimulatory oligonucleotides, antigens and other stomach. This can include Sugar coatings, or coatings which therapeutic agents) can be formulated readily by combining make the tablet easier to Swallow. Capsules may consist of a the active compound(s) with pharmaceutically acceptable hard shell (such as gelatin) for delivery of dry therapeutic i.e. carriers well known in the art. Such carriers enable the com powder; for liquid forms, a softgelatin shell may be used. The pounds of the invention to be formulated as tablets, pills, shell material of cachets could be thick starch or other edible US 2009/0137519 A1 May 28, 2009 24 paper. For pills, lozenges, molded tablets or tablet triturates, castor oil 10, 50 and 60, glycerol monostearate, polysorbate moist massing techniques can be used. 40, 60, 65 and 80, sucrose fatty acid ester, methyl cellulose 0309 The therapeutic can be included in the formulation and carboxymethyl cellulose. These surfactants could be as fine multi-particulates in the form of granules or pellets of present in the formulation of the oligonucleotide orderivative particle size about 1 mm. The formulation of the material for either alone or as a mixture in different ratios. capsule administration could also be as a powder, lightly 0317 Pharmaceutical preparations which can be used compressed plugs or even as tablets. The therapeutic could be orally include push-fit capsules made of gelatin, as well as prepared by compression. soft, sealed capsules made of gelatin and a plasticizer, Such as 0310 Colorants and flavoring agents may all be included. glycerol or Sorbitol. The push-fit capsules can contain the For example, the oligonucleotide may be formulated (such as active ingredients in admixture with filler Such as lactose, by liposome or microsphere encapsulation) and then further binders such as starches, and/or lubricants such as talc or contained within an edible product, such as a refrigerated magnesium Stearate and, optionally, stabilizers. In soft cap beverage containing colorants and flavoring agents. Sules, the active compounds may be dissolved or Suspended in 0311. One may dilute or increase the volume of the thera Suitable liquids, such as fatty oils, liquid paraffin, or liquid peutic with an inert material. These diluents could include polyethylene glycols. In addition, stabilizers may be added. carbohydrates, especially mannitol, a-lactose, anhydrous lac Microspheres formulated for oral administration may also be tose, cellulose, Sucrose, modified dextrans and starch. Certain used. Such microspheres have been well defined in the art. All inorganic salts may be also be used as fillers including cal formulations for oral administration should be in dosages cium triphosphate, magnesium carbonate and Sodium chlo Suitable for Such administration. ride. Some commercially available diluents are Fast-Flo, 0318 For buccal administration, the compositions may Emdex, STA-RX 1500, Emcompress and Avicell. take the form of tablets or lozenges formulated in conven 0312 Disintegrants may be included in the formulation of tional manner. the therapeutic into a solid dosage form. Materials used as 0319 For administration by inhalation, the compounds for disintegrates include but are not limited to starch, including use according to the present invention may be conveniently the commercial disintegrant based on starch, Explotab. delivered in the form of an aerosol spray presentation from Sodium starch glycolate, Amberlite, sodium carboxymethyl pressurized packs or a nebulizer, with the use of a suitable cellulose, ultramylopectin, Sodium alginate, gelatin, orange propellant, e.g., dichlorodifluoromethane, trichlorofluo peel, acid carboxymethyl cellulose, natural sponge and ben romethane, dichlorotetrafluoroethane, carbon dioxide or tonite may all be used. Another form of the disintegrants are other suitable gas. In the case of a pressurized aerosol the the insoluble cationic exchange resins. Powdered gums may dosage unit may be determined by providing a valve to deliver be used as disintegrants and as binders and these can include a metered amount. Capsules and cartridges of e.g. gelatin for powdered gums such as agar, Karaya or tragacanth. Alginic use in an inhaler or insufflator may be formulated containing acid and its Sodium salt are also useful as disintegrants. a powder mix of the compound and a suitable powder base 0313 Binders may be used to hold the therapeutic agent Such as lactose or starch. together to form a hard tablet and include materials from 0320 Also contemplated herein is pulmonary delivery of natural products such as acacia, tragacanth, starch and gela the oligonucleotides (or derivatives thereof). The oligonucle tin. Others include methyl cellulose (MC), ethyl cellulose otide is delivered to the lungs of a mammal while inhaling and (EC) and carboxymethyl cellulose (CMC). Polyvinyl pyrroli traverses across the lung epithelial lining to the blood stream. done (PVP) and hydroxypropylmethyl cellulose (HPMC) Other reports of inhaled molecules include Adjei et al., 1990, could both be used in alcoholic solutions to granulate the Pharmaceutical Research, 7:565-569; Adjei et al., 1990, therapeutic. International Journal of Pharmaceutics, 63:135-144 (leupro 0314. An anti-frictional agent may be included in the for lide acetate); Braquet et al., 1989, Journal of Cardiovascular mulation of the therapeutic to prevent sticking during the Pharmacology, 13(suppl. 5): 143-146 (endothelin-1); Hub formulation process. Lubricants may be used as a layer bard et al., 1989, Annals of Internal Medicine, Vol. III, pp. between the therapeutic and the die wall, and these can 206-212 (al-antitrypsin); Smith et al., 1989, J. Clin. Invest. include but are not limited to; Stearic acid including its mag 84:1145-1146 (a-1-proteinase); Oswein et al., 1990, Aero nesium and calcium salts, polytetrafluoroethylene (PTFE), solization of Proteins’. Proceedings of Symposium on Res liquid paraffin, vegetable oils and waxes. Soluble lubricants piratory Drug Delivery II, Keystone, Colo., March, (recom may also be used such as sodium lauryl Sulfate, magnesium binant human growth hormone); Debs et al., 1988, J. lauryl Sulfate, polyethylene glycol of various molecular Immunol. 140:3482-3488 (interferon-g and tumor necrosis weights, Carbowax 4000 and 6000. factor alpha) and Platz et al., U.S. Pat. No. 5,284.656 (granu 0315 Glidants that might improve the flow properties of locyte colony stimulating factor). A method and composition the drug during formulation and to aid rearrangement during for pulmonary delivery of drugs for systemic effect is compression might be added. The glidants may include described in U.S. Pat. No. 5,451,569, issued Sep. 19, 1995 to starch, talc, pyrogenic silica and hydrated silicoaluminate. Wong et al. 0316 To aid dissolution of the therapeutic into the aque 0321 Contemplated for use in the practice of this inven ous environment a surfactant might be added as a wetting tion are a wide range of mechanical devices designed for agent. Surfactants may include anionic detergents such as pulmonary delivery of therapeutic products, including but not Sodium lauryl Sulfate, dioctyl sodium SulfoSuccinate and dio limited to nebulizers, metered dose inhalers, and powder ctyl Sodium sulfonate. Cationic detergents might be used and inhalers, all of which are familiar to those skilled in the art. could include benzalkonium chloride or benzethomium chlo 0322. Some specific examples of commercially available ride. The list of potential non-ionic detergents that could be devices suitable for the practice of this invention are the included in the formulation as Surfactants are lauromacrogol Ultravent nebulizer, manufactured by Mallinckrodt, Inc., St. 400, polyoxyl 40 stearate, polyoxyethylene hydrogenated Louis, Mo.; the Acorn II nebulizer, manufactured by Mar US 2009/0137519 A1 May 28, 2009 quest Medical Products, Englewood, Colo.; the Ventolin 0329. Alternatively, a plastic squeeze bottle with an aper metered dose inhaler, manufactured by Glaxo Inc., Research ture or opening dimensioned to aerosolize an aerosol formu Triangle Park, N.C.; and the Spinhaler powder inhaler, manu lation by forming a spray when Squeezed. The opening is factured by Fisons Corp., Bedford, Mass. usually found in the top of the bottle, and the top is generally 0323 All such devices require the use of formulations tapered to partially fit in the nasal passages for efficient suitable for the dispensing of oligonucleotide (or derivative). administration of the aerosol formulation. Preferably, the Typically, each formulation is specific to the type of device nasal inhaler will provide a metered amount of the aerosol employed and may involve the use of an appropriate propel formulation, for administration of a measured dose of the lant material, in addition to the usual diluents, adjuvants drug. and/or carriers useful in therapy. Also, the use of liposomes, 0330. The compounds, when it is desirable to deliver them microcapsules or microspheres, inclusion complexes, or systemically, may be formulated for parenteral administra other types of carriers is contemplated. Chemically modified tion by injection, e.g., by bolus injection or continuous infu oligonucleotide may also be prepared in different formula Sion. Formulations for injection may be presented in unit tions depending on the type of chemical modification or the dosage form, e.g., in ampoules or in multi-dose containers, type of device employed. with an added preservative. The compositions may take Such 0324 Formulations suitable for use with a nebulizer, forms as Suspensions, solutions or emulsions in oily or aque either jet or ultrasonic, will typically comprise oligonucle ous vehicles, and may contain formulatory agents such as otide dissolved in water at a concentration of about 0.1 to 25 Suspending, stabilizing and/or dispersing agents. mg of biologically active oligonucleotide per mL of solution. 0331 Pharmaceutical formulations for parenteral admin The formulation may also include a buffer and a simple Sugar istration include aqueous solutions of the active compounds (e.g., for oligonucleotide stabilization and regulation of in water-soluble form. Additionally, suspensions of the active osmotic pressure). The nebulizer formulation may also con compounds may be prepared as appropriate oily injection tain a Surfactant, to reduce or prevent Surface induced aggre suspensions. Suitable lipophilic solvents or vehicles include gation of the oligonucleotide caused by atomization of the fatty oils such as sesame oil, or synthetic fatty acid esters, Solution in forming the aerosol. Such as ethyl oleate or triglycerides, or liposomes. Aqueous 0325 Formulations for use with a metered-dose inhaler injection Suspensions may contain Substances which increase device will generally comprise a finely divided powder con the Viscosity of the Suspension, Such as Sodium carboxym taining the oligonucleotide Suspended in a propellant with the ethyl cellulose, sorbitol, or dextran. Optionally, the suspen aid of a surfactant. The propellant may be any conventional sion may also contain suitable stabilizers or agents which material employed for this purpose, such as a chlorofluoro increase the solubility of the compounds to allow for the carbon, a hydrochlorofluorocarbon, a hydrofluorocarbon, or a preparation of highly concentrated Solutions. hydrocarbon, including trichlorofluoromethane, dichlorodif 0332 Alternatively, the active compounds may be in pow luoromethane, dichlorotetrafluoroethanol, and 1,1,1,2-tet der form for constitution with a suitable vehicle, e.g., sterile rafluoroethane, or combinations thereof. Suitable surfactants pyrogen-free water, before use. include sorbitan trioleate and soya lecithin. Oleic acid may 0333. The compounds may also be formulated in rectal or also be useful as a Surfactant. vaginal compositions such as Suppositories or retention 0326 Formulations for dispensing from a powder inhaler enemas, e.g., containing conventional Suppository bases Such device will comprise a finely divided dry powder containing as cocoa butter or other glycerides. oligonucleotide and may also include a bulking agent, such as 0334. In addition to the formulations described previously, lactose, Sorbitol. Sucrose, or mannitol in amounts which the compounds may also be formulated as a depot prepara facilitate dispersal of the powder from the device, e.g., 50 to tion. Such long acting formulations may be formulated with 90% by weight of the formulation. The oligonucleotide Suitable polymeric or hydrophobic materials (for example as should most advantageously be prepared in particulate form an emulsion in an acceptable oil) or ion exchange resins, or as with an average particle size of less than 10 mm (or microns), sparingly soluble derivatives, for example, as a sparingly most preferably 0.5 to 5mm, for most effective delivery to the soluble salt. distal lung. 0335 The pharmaceutical compositions also may com 0327 Nasal delivery of a pharmaceutical composition of prise Suitable Solid or gel phase carriers or excipients. the present invention is also contemplated. Nasal delivery Examples of Such carriers or excipients include but are not allows the passage of a pharmaceutical composition of the limited to calcium carbonate, calcium phosphate, various present invention to the blood stream directly after adminis Sugars, starches, cellulose derivatives, gelatin, and polymers tering the therapeutic product to the nose, without the neces Such as polyethylene glycols. sity for deposition of the product in the lung. Formulations for 0336 Suitable liquid or solid pharmaceutical preparation nasal delivery include those with dextran or cyclodextran. forms are, for example, aqueous or saline Solutions for inha 0328. For nasal administration, a useful device is a small, lation, microencapsulated, encochleated, coated onto micro hard bottle to which a metered dose sprayer is attached. In one scopic gold particles, contained in liposomes, nebulized, embodiment, the metered dose is delivered by drawing the aerosols, pellets for implantation into the skin, or dried onto a pharmaceutical composition of the present invention Solution sharp object to be scratched into the skin. The pharmaceutical into a chamber of defined volume, which chamber has an compositions also include granules, powders, tablets, coated aperture dimensioned to aerosolize and aerosol formulation tablets, (micro)capsules, suppositories, syrups, emulsions, by forming a spray when a liquid in the chamber is com Suspensions, creams, drops or preparations with protracted pressed. The chamber is compressed to administer the phar release of active compounds, in whose preparation excipients maceutical composition of the present invention. In a specific and additives and/or auxiliaries Such as disintegrants, binders, embodiment, the chamber is a piston arrangement. Such coating agents, Swelling agents, lubricants, flavorings, Sweet devices are commercially available. eners or solubilizers are customarily used as described above. US 2009/0137519 A1 May 28, 2009 26 The pharmaceutical compositions are Suitable for use in a variety of drug delivery systems. For a brief review of meth - Continued ods for drug delivery, see Langer, Science 249:1527-1533, 1990, which is incorporated herein by reference. SEQ 0337 The CpG immunostimulatory oligonucleotides and ID optionally other therapeutics and/or antigens may be admin NO. Sequence istered per se (neat) or in the form of a pharmaceutically acceptable salt. When used in medicine the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare phar maceutically acceptable salts thereof. Such salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, Sulphuric, nitric, phosphoric, maleic, acetic, salicylic, p-toluene Sulphonic, tartaric, citric, methane Sulphonic, formic, malonic, Succinic, naphthalene 2-sulphonic, and benzene Sulphonic. Also, Such salts can be prepared as alkaline metal or alkaline earth salts, such as Sodium, potassium or calcium salts of the carboxylic acid 1o TCG TCG TTT TGA CGT TTT GTC GTT (all bonds k.) group. 0338 Suitable buffering agents include: acetic acid and a salt (1-2% w/v); citric acid and a salt (1-3% w/v); boric acid and a salt (0.5-2.5% w/v); and phosphoric acid and a salt (0.8-2% w/v). Suitable preservatives include benzalkonium chloride (0.003-0.03% w/v); chlorobutanol (0.3-0.9% w/v); parabens (0.01-0.25% w/v) and thimerosal (0.004-0.02% w/v). 0339. The pharmaceutical compositions of the invention contain an effective amount of a CpG immunostimulatory oligonucleotide and optionally antigens and/or other thera peutic agents optionally included in a pharmaceutically-ac ceptable carrier. The term pharmaceutically-acceptable car rier means one or more compatible Solid or liquid filler, diluents or encapsulating Substances which are suitable for administration to a human or other vertebrate animal. The term carrier denotes an organic or inorganic ingredient, natu ral or synthetic, with which the active ingredient is combined to facilitate the application. The components of the pharma Materials and Methods: ceutical compositions also are capable of being commingled Oligodeoxynucleotides (ODNs) with the compounds of the present invention, and with each other, in a manner Such that there is no interaction which 0342 ODNs were purchased from Biospring (Frankfurt, would substantially impair the desired pharmaceutical effi Germany) or Sigma-Ark (Darmstadt, Germany), and were ciency. controlled for identity and purity by Coley Pharmaceutical GmbH (Langenfeld, Germany). ODNs were diluted in phos 0340. The present invention is further illustrated by the phate-buffered saline (Sigma, Germany), and stored at -20° following Examples, which in no way should be construed as C. All dilutions were carried out using pyrogen-free reagents. further limiting. The entire contents of all of the references SEQ ID NO. 15-23 ODNs were synthesized by Trilink Bio (including literature references, issued patents, published technologies. patent applications, and co-pending patent applications) cited throughout this application are hereby expressly incorporated Cell Purification by reference. 0343 Peripheral blood buffy coat preparations from healthy male and female human donors were obtained from EXAMPLES the Blood Bank of the University of Düsseldorf (Germany) and from these, PBMC were purified by centrifugation over Oligodeoxynucleotides (ODNs) Ficoll-Hypaque (Sigma). The purified PBMC were either 0341 The following ODN are used in the examples. used freshly (for most assays) or were suspended in freezing medium and stored at -70° C. When required, aliquots of these cells were thawed, washed and resuspended in RPMI 1640 culture medium (BioWhittaker, Belgium) supple SEQ mented with 5% (v/v) heat inactivated human AB serum ID (BioWhittaker, Belgium) or 10% (v/v) heat inactivated FCS, NO. Sequence 2 mM L-glutamine (BioWhittaker), 100 U/ml penicillin and 100 g/ml streptomycin (Invitrogen (Karlsruhe, Germany)). Cytokine Detection 0344. Thawed or fresh PBMC were seeded on 48 well flat-bottom plates, or 96 well round-bottom plates, and incu US 2009/0137519 A1 May 28, 2009 27 bated with ODN in the concentrations as indicated in a antigen challenge and incidences of Sneezing and nasal rub humidified incubator at 37° C. Culture supernatants were bing were counted for a 10 minute period after challenge. collected and if not used immediately, were frozen at -20°C. until required. Amounts of cytokines in the Supernatants were Statistical Analysis assessed using commercially available ELISA Kits (Dia 0349 The Mann-Whitney test was used for comparison of clone, USA) or in-house ELISAs developed using commer data sets where the populations being compared were not cially available antibodies (from Becton Dickinson/Pharmin normal. The Dunnitt multiple comparisons test was used for gen or PBL). comparison of data sets to a single control. 0345 Studies for Example 13 were conducted as follows: Cytokine Induction in the Mouse In Vivo 0346 Spleens were removed from 6 mice (male, BALB/ c). The splenocytes from each spleen were separated by push 0350 Mice (male, BALB?c) were dosed with CpG ODNs ing gently through a cell sieve (70 um pore size), and were (0.1 and 1 mg/kg) or control vehicle (saline, 25 Jul) by intra then pooled. Splenocytes were added to wells of culture nasal instillation. Bronchoalveolar lavage fluid and serum plates. 1x107 cells in a volume of 900 ul medium were added (separated from blood obtained by cardiac puncture) were to each well. Medium was RPMI 1640 containing 10% fetal collected 8 hours and 15 hours after dosing. Cell numbers in bovine serum. 100 ul aliquots of CpG ODN solutions in bronchoalveolar lavage fluid were counted with an Advia medium were added to each well to give final concentrations automated cell counter. Concentrations of cytokines and in the wells of 0.01-10 ug/ml. After incubation for 36 hours chemokines in bronchoalveolar lavage fluid and serum were (37 C, 5% CO incubator), culture supernatants were col assayed using either ELISA (IFNC., IL-12p40) or the lected and assayed for cytokine concentrations using either Luminex cytokine multiplex system (IFNY, IP-10, IL-1C. the Luminex multiplex assay (IFNY, IP-10, IL-10, IL-6, IL-1B, IL-2, IL-4, IL-5, IL-6, IL-7, IL-9, IL-10, IL-13, IL-15. TNFo) or ELISA (IFNC). IL-17, GM-CSF, RANTES, TNFC). Minimum detectable concentrations were different for each analyte, but were in the Induction of Antigen-Induced Increase in Nasal Resistance in range 0.3-12 pg/ml. Guinea Pigs Influenza Virus Induction of Inflammation in Mouse Air 0347 Guinea pigs (male, Hartley) were sensitized with ways. antigen (ovalbumin, 5 mg both intraperitoneal and Subcuta 0351. Influenza virus (influenza type A, subtype H1N1, neous) on study day 0. A boost sensitization (5 mg, intraperi mouse adapted strain PR8) was a gift from David Wood toneal) was given on study day 4. Guinea pigs were antigen house, Trudeau Institute, Saranac Lake, N.Y. As a preliminary challenged by exposure to intranasally-administered antigen study to titrate influenza dose and determine time-course of twice each week for two consecutive weeks. The first chal infection, BALB/c mice (female) were infected with influ lenge was on study day 14. SEQID NO:7 (lot number AQE enza virus by intranasal instillation on study day 0. Mice 03J-001-M, 0.03-1 mg/kg in 15011/kg saline) was adminis received 50, 200 or 500 egg-infective doses (ED) so of virus in tered intranasally once each week, two days before the first 40 ul Saline. Airway inflammation was assessed 1, 3, 6, 9 and antigen challenge of the week. With the exception of the final 14 days after infection. challenge on study day 24, antigen challenge was with oval bumin (1.5 mg/kg in 150 ul/kg Saline). Animals were pre Intranasal Administration of CpG ODN and Measurement of treated with mepyramine (10 mg/kg, intraperitoneal) 30 min Airway Inflammation utes before challenge to protect against histamine-induced 0352 Mice receiveda CpGODN (0.03,0.3 or 3 mg/kg) by anaphylaxis. On study day 24, guinea pigs were anesthetized intranasal instillation in 25ul saline. Each mouse was dosed to allow measurement of nasal resistance using a Buxco res twice, 6 days and 2 days before infection with influenza virus piratory mechanics system and Software. The final antigen (200 EIDs intranasal). This virus dose was selected from the challenge was then made with ovalbumin (2.5 mg in 250 ul preliminary study. Airway inflammation and virus load in the saline) delivered into the nasopharynx. Animals were pre lung were assessed 6 days after virus infection. This time treated with mepyramine (3 mg/kg, intraperitoneal) 30 min point was selected from the preliminary study. Cells in air utes before challenge. Nasal resistance was measured for 40 ways were recovered by bronchoalveolar lavage. Total leu minutes after challenge. kocyte counts were made with an Advia automated cell counter (Adiva, Bayer Diagnostics, Zurich, Switzerland). Differential cell counts were made by light microscopy of Induction of Antigen-Induced Increase in Nasal Resistance in cytocentrifuge preparations stained with Wright-Giemza Mice stain. Lungs were removed and homogenized with 300 ul 0348 Mice (male BALB/c) were sensitized on study days sterile PBS. Supernatant was collected and virus load was 0 and 7 with antigen (ovalbumin, 100 ug, i.p.) with aluminum assayed using an enzyme immunoassay kit (Takara Biomedi hydroxide adjuvant (Pierce Alum i.p.). Mice were antigen cal, Shiga, Japan) used to manufacturer's instructions. This challenged daily by exposure to intranasally-administered assay utilizes a monoclonal antibody against influenza A antigen (1 mg in 10 Jul Saline). The first challenge was on study virus nuclear protein as Solid phase, and a polyclonal anti day 14. SEQ ID NO:7 was administered intranasally twice. influenza virus detection antibody. The first dose was given 2 days before the first antigen chal Example 1 lenge. The second dose was given 7 days later. Alternatively, budesonide (an anti-inflammatory, synthetic corticosteroid) Effects on IFN-O. Secretion by Human PBMC was administered intranasally daily. The first dose was given Treated with CpG ODN 2 days before the first antigen challenge. On each day, the 0353 Methods: Human peripheral blood mononuclear budesonide dose was administered intranasally 4 hours cells from either three (SEQID NO:4, SEQID NO:5, SEQID before intranasal antigen challenge. Endpoints were mea NO:6) or seven (SEQID NO:1, SEQIDNO:2, SEQID NO:3) sured on study day 26 (i.e. 7 days after the second dose of SEQ donors were incubated with CpG ODN for 48 hours at con ID NO: 7. Nasal tissues were taken for histopathological centrations indicated. Interferon-alpha secretion by human assessment of inflammation. Separate mice received a final PBMC was measured. US 2009/0137519 A1 May 28, 2009 28 0354 Results: FIG. 1 demonstrates increased production increases in nasal resistance in the guinea pigs guinea pigs of IFN-C. upon incubation with CpG ODN. Data represent the were sensitized with antigen, then antigen-challenged mean +/-SEM. Note that the absolute levels in pg/ml can not nasally. Nasal resistance was measured for 40 minutes after be compared directly, as PBMC from different donors were challenge. used and results from each donor are variable. Example 2 TABLE 2 Stimulation of TLR9-Transfected Cells In Vitro Summary of study protocol 0355 Methods: HEK 293 cells transfected with human Dose Dose TLR9 were incubated with SEQ ID NO:1, SEQ ID NO:2, with with SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID Antigen SEQID Antigen SEQID Antigen NO:6 for 16 hours. The signal was determined by a luciferase sensitize NO: 7 challenge NO: 7 challenge readout. 0356. Results: The results are shown in Table 1. The EC50 Day: 0 4 12 14 17 19 21 24 was calculated using Sigma Plot (SigmaPlot 2002 for Win Measure dows version 8.0). The maximal stimulation index (max SI) antigen-induced was calculated as the quotient between the highest value of all increase in nasal concentrations tested for any ODN and the medium control. resistance TABLE 1. 0358 Results: FIG. 2 demonstrates that antigen challenge caused a progressive increase in nasal resistance over 40 ODN EC50 max SI minutes that was significantly suppressed in guinea pigs that SEQID NO: 1 2320 22 had been treated with SEQID NO:7 (0.03-1 mg/kg). SEQID NO: 2 4730 2O SEQID NO:3 24OO 16 SEQID NO:4 3200 14 Example 4 SEQID NO: 5 4290 13 SEQID NO: 6 458O 11 Effects of CpG Oligonucleotide SEQID NO:7 in a Mouse Model of Allergic Rhinitis Example 3 0359 Methods: BALB/c mice were used to study the effects of SEQ ID NO:7 on symptoms of allergic rhinitis. Effects of the CpG Oligodeoxynucleotide SEQ ID After sensitization and antigen challenge, nasal tissues were NO:7 Against Antigen-Induced Increase in Nasal taken for histopathological assessment of inflammation. Resistance in Guinea Pigs Separate mice received a final antigen challenge and inci 0357 Methods: To investigate the effects of the CpG oli dences of Sneezing and nasal rubbing were counted for a 10 godeoxynucleotide SEQ ID NO:7 against antigen induced minute period after challenge. TABLE 3 Summary of study protocol: oligonucleotide-treated mice SEQID NO: 7 SEQ ID NO: 7 or SEQID NO: 8 Sensitize or SEQID NO: 8 Daily antigen challenges Day: O 7 12 13 14 15 16 17 18. 19 20 21 22 23 24 25 26 Endpoints TABLE 4 Summary of study protocol: budesonide-treated mice Daily doses with budesonide Sensitize Daily antigen challenges Day: 0 7 13 14 15 16 17 18. 19 20 21 22 23 24 25 26 Endpoints US 2009/0137519 A1 May 28, 2009 29 0360 Results: Antigen challenge caused sneezing and twice each week for two consecutive weeks. The first chal nasal rubbing. As demonstrated in FIG. 3 the incidences of lenge was on study day 21. CpG ODNs (1,10 and 100 ug/kg) both were suppressed in mice treated with SEQID NO:7. were administered intranasally once each week, two days before the first antigen challenge of the week. Example 5 0367 Airways inflammation was assessed 48 hours after the last antigen challenge. Cells in airways were recovered by Influenza Virus-Induced Airway Inflammation in bronchoalveolar lavage. Differential cell counts were made Mouse Lung: Effects of Class C CpG Oligodeoxy by an Advia automated cell counter. Numbers of T cells (Total nucleotides CD3+ cells, and CD3+ CD4+ cells) were counted by flow 0361 Introduction: CpG oligodeoxynucleotides (ODNs) cytometry. induce immune-modifying cytokines that should provide anti-asthma effects. Class C CpG ODNs induce higher titers TABLE 5 of IFNC than previous class B ODNs. Class C CpG ODNs may offer the additional benefit of Suppressing virus-induced Summary of study protocol exacerbations of asthma. This study investigated the ability of Dose Dose three class C CpG ODNs to suppress virus (influenza) load in with with mouse lungs and virus-induced airways inflammation. Antigen CpG Antigen CpG Antigen 0362 Methods: Influenza virus was used to induce airway sensitize ODN challenge ODN challenge inflammation in BALB/c mice. CpG ODNs were adminis tered intranasally and the protective effect was measured. Day: O 7 19 21 24 26 28 31 33 0363 Results: FIG. 4 shows that in a preliminary study to Assess airways titrate influenza dose and determine time-course of infection, inflammation influenza virus caused an accumulation of leukocytes in the airways. Peak inflammation was achieved after 6-9 days. Mice infected with 500 EID50 of virus showed marked weight loss after 6 days and were sacrificed. TABLE 6 0364 FIG. 5 demonstrates the protective effects of CpG CpG ODNs tested ODNs on virus load and virus-induced airways inflammation. SEQID NO: 7 Semi-soft class B Lot A25-O313-L1 Pretreatment with CpGODNs before infection with influenza SEQID NO: 1 Semi-soft class C Lot C44-1209-M1B virus (200 EID50) reduced virus load in the lung as assayed 6 SEQID NO: 2 Semi-soft class C Lot. C44-1209-M2D days after infection. FIG. 6 demonstrates that infection with SEQID NO:3 Semi-soft class C Lot C44-1209-M4B influenza virus caused an accumulation of leukocytes in the airways 6 days later. These were predominantly neutrophils and mononuclear cells (monocytes, macrophages and lym 0368 Results: Antigen challenge caused accumulations of phocytes). There wee very few eosinophils. Cell accumula eosinophils and T cells in the airways (FIGS. 7 and 8). There tion was significantly suppressed in mice pretreated with any was no accumulation of neutrophils. Each of the CpG ODNs of the CpG ODNs. caused a significant Suppression of eosinophil accumulation at the highest dose tested (100 mg/kg) (FIG. 7). Numbers of T Example 6 cells were also lower, although the reductions were not gen erally statistically significant (FIG. 8). Effects of class C CpG Oligodeoxynucleotides Against Antigen-Induced Airways Inflammation in Example 7 the Mouse Cytokine Induction by Class C CpG Oligodeoxy 0365. The activity of three class C CpG oligodeoxynucle nucleotides in the Mouse in Vivo otides (ODNs) was compared. The class BCpGODNSEQID NO:7 was included in the study for comparison. 0369. The activities of three class C CpG oligodeoxy 0366 Methods: Mice (male BALB?c) were sensitized on nucleotides (ODNs) were compared. The class B CpG ODN study days 0 and 7 with antigen (cockroach, 10ug, intraperi SEQID NO:7 was included in the study for comparison. toneal) with aluminum hydroxide adjuvant (Pierce Alum, 0370 Methods: Concentrations of cytokines and chemok intraperitoneal). Mice were antigen challenged by exposure ines in bronchoalveolar lavage fluid and serum were assayed to intranasally-administered antigen (10 ug in 40 ul Saline), as described in materials and methods. TABLE 7 Treatment groups Time points for Intranasal sample CpG oligodeoxynucleotide doses collection Vehicle 8, 15 hours SEQID NO: 7 Semi-soft class B Lot A25-0313-L1 0.1, 1 mg/kg 8, 15 hours ODNSEQID NO: 1 Semi-soft class C Lot C44-1209-M1B 0.1, 1 mg/kg 8, 15 hours ODNSEQID NO: 2 Semi-soft class C Lot C44-1209-M2D 0.1, 1 mg/kg 8, 15 hours ODNSEQID NO:3 Semi-soft class C Lot C44-1209-M4B 0.1, 1 mg/kg 8, 15 hours US 2009/0137519 A1 May 28, 2009 30 0371 Results: FIG. 9 shows cell numbers in bronchoal veolar lavage fluid. Intranasal instillation of each of the class TABLE 8-continued CODNs, especially at 1 mg/kg, showed a trend to causing a very mild accumulation of leukocytes in bronchoalveolar Treatment groups: lavage fluid. Sensitization Treatment l 0372 FIGS. 10-15 show cytokine concentrations in bron 9 Antigen SEQID NO: 7, 100 g/kg, i.p. 10 choalveolar lavage fluid. Intranasal instillation of each of the 10 Antigen SEQID NO: 7, 1000 g/kg, 10 CpG ODNs induced measurable titers of IFNC, IFNY, IP-10, i.p. IL-12p40, IL-6 and TNFC. in bronchoalveolar lavage fluid. Titers of the other analytes measured did not reach detectable concentrations or concentrations above background (typi TABLE 9 cally <20 pg/ml, data not shown). The class CODNs were Summary of study protocol each more potent than the class B ODN SEQ ID NO:7 as Immunize Immunize inducers of IFNC, IFNY, IP-10, IL-12p40, IL-6 and TNFC. ODN ODN ODN ODN The increased potency of the class CODNs was especially Day: -2 O 5 7 18 apparent at the 0.1 mg/kg dose level. Of particular interest Endpoints was the observation that only the class CODNs were able to induce any measurable titers of IFNC. and IFNY after dosing at 0375 Results: Antigen sensitization resulted in serum 0.1 mg/kg (FIG. 10). titers of antigen (ovalbumin)-specific IgE and IgG2a. The 0373 FIGS. 15-18 show cytokine concentrations in production of IgE was Suppressed in mice treated with either serum. Intranasal instillation of each of the CpG ODNs SEQ ID NO:2 or SEQ ID NO:7, while the production of induced measurable titers of IFNY, IL-6 and TNFC. in serum. IgG2a was potentiated (FIG. 19). Titers of the other analytes measured did not reach detectable 0376 Conclusions: The data of Example 8 demonstrates concentrations (typically <20 pg/ml, data not shown). When that SEQ ID NO:2 and SEQID NO:7 suppress Th2-associ compared with the class B CpG SEQ ID NO:7, each of the ated production of IgE in response to antigen sensitization, three class C ODNs were more potent inducers of the and potentiate Th1-associated IgG2a production. The results immune-modifying cytokines IFNC, IFNY, IP-10, IL-12p40, of this study provide further evidence that these CpG oligos IL-6 and TNFC. can Suppress a Th2-type response to antigen exposure in the OUS. Example 8 Example 9 Effects of CpG Oligodeoxynucleotides SEQID Effects of SEQID NO:2 Against Exacerbated Air NO:2 and SEQID NO:7 on Antigen-Induced IgE ways Inflammation Induced by Combined Influenza Production in the Mouse Infection and Antigen Challenge 0377 Introduction: The class C CpG oligodeoxynucle 0374 Methods: Mice (male BALB?c) were sensitized on otide SEQ ID NO:2 can suppress influenza virus load and study days 0 and 7 with antigen (ovalbumin, 10 ug, i.p.) and virus-induced airways inflammation in mice. The present aluminum hydroxide adjuvant Pierce Alum, i.p.). Mice study investigated the protective effects of SEQ ID NO:2 received SEQID NO:2 or SEQID NO:7 on study days-2, 0, against the exacerbated airways inflammation induced by 5 and 7 (i.e. two days before each sensitization and on the day combined influenza virus infection and antigen challenge. of sensitization). Mice were bled by cardiac puncture on 0378 Methods: Antigen and virus administrations: Mice study day 18. Serum was collected by centrifugation and (male BALB?c) were sensitized on study days 0 and 7 with assayed by ELISA for ovalbumin-specific IgE and IgG2a. antigen (cockroach, 10 ug, intraperitoneal) with aluminum hydroxide adjuvant (Pierce Alum). Mice were antigen chal TABLE 8 lenged by exposure to intranasally-administered antigen (10 ug in 40 ul Saline), twice each week for three consecutive Treatment groups: weeks. The first challenge was on study day 21. Mice were infected with influenza virus (influenza type A, subtype Sensitization Treatment l H1N1, mouse adapted strain PR8, 200 EIDs in 40 ul saline) by intranasal instillation on study day 34 (i.e. before the last 1 None None 5 pair of antigen challenges). Alternatively, separate groups of 2 Antigen Vehicle, i.p. 10 mice received antigen challenge alone or virus infection 3 Antigen SEQID NO: 2, 1 g/kg, i.p. 10 alone. 4 Antigen SEQID NO: 2, 10 g/kg, i.p. 10 0379 SEQID NO:2 (100 g/kg) was administered intra 5 Antigen SEQID NO: 2, 100 g/kg, i.p. 10 nasally once each week, two days before the first antigen 6 Antigen SEQID NO: 2, 1000 g/kg, 10 challenge of the week. Airways inflammation was assessed i.p. 48 hours after the last antigen challenge. Cells in airways Antigen SEQID NO: 7, 1 g/kg, i.p. 10 were recovered by bronchoalveolar lavage. Differential cell 8 Antigen SEQID NO: 7, 10 g/kg, i.p. 10 counts were made by light microscopy from cytocentrifuge preparations stained with Wright-GiemZa stain. US 2009/0137519 A1 May 28, 2009 31 TABLE 10 Summary of study protocol Antigen Antigen Antigen Antigen sensitize ODN challenge ODN challenge ODN Virus challenge Day: O 7 19 21 24 26 28 31 33 34 35 38 40 First Second Third Endpoints treatment week treatment week treatment week 0380 Results: FIG. 20 shows that infection with influenza aluminum hydroxide adjuvant. Guinea pigs were antigen virus alone or antigen challenge alone each caused an challenged by exposure to inhaled ovalbumin aerosol, twice increase in the total number of leukocytes in bronchoalveolar each week for two consecutive weeks. The first challenge was lavage fluid. In virus-infected mice, this cell accumulation on study day 13. CpG ODN or vehicle (saline, 20 Jul) were included a marked neutrophilia, whereas in antigen-chal administered intranasally once each week, two days before lenged mice, the accumulation included a marked eosino the first antigen challenge of the week. Airways hyperreac philia. When compared with mice that received antigen chal tivity was assessed 24 hours after the last antigen challenge by lenge alone, those that were antigen-challenged and virus measuring bronchoconstriction (increase in airway resis infected showed an exacerbated accumulation of leukocytes in bronchoalveolar lavage fluid. This increased accumulation tance) to intravenous methacholine. For each animal, a dose included both neutrophils and mononuclear cells. However, response curve to methacholine was obtained, and airway these mice showed reduced eosinophilia. Other researchers reactivity was quantified as the area under the curve. FIG. 21 have similarly shown that influenza infection can Suppress shows a schematic of the procedure. airways eosinophilia in antigen-challenged mice, and have hypothesized that this is a Th1-mediated effect (e.g. Wohlle Example 10b benet al., 2003). 0381 Treatment with SEQID NO:2 (100 g/kg) did not Effect of SEQID NO:7 on Airway Resistance and suppress the virus-induced neutrophilia (FIG. 20). This nega Lung Compliance in Guinea Pigs tive finding was expected since, in an earlier study a higher dose of 300 lug/kg was most desirable to show anti-virus 0385 Method: Guinea pigs were sensitized as described in effects. Furthermore, SEQID NO:2 (100 g/kg) did signifi Example 10. The first challenge was on study day 13. Guinea cantly Suppress antigen-induced eosinophilia. This positive pigs were given intranasally either carrier (Saline). OVA finding was in agreement with earlier studies. alone, of concentrations of SEQ ID NO:7 of 10 ul/kg, 30 0382 SEQID NO:2 (100 lug/kg) significantly suppressed ul/kg, 100 ul/kg, or 300 ul/kg, i.t. the exacerbated airways inflammation induced in mice that were both virus-infected and antigen-challenged. The exac (0386 Results: FIG.22 shows that SEQID NO:7 caused a erbated accumulations of neutrophils and mononuclear cells dose-dependent reduction in AUC-resistance. were both suppressed. In addition to exacerbated airways inflammation, mice that were both virus-infected and anti Example 10c gen-challenged showed a marked loss of body weight. This was significantly suppressed in mice treated with SEQ ID Statistical Analysis of the Effect of SEQID NO:7 on NO:2. Airway Resistance and Lung Compliance in Guinea 0383 Conclusions: In both children and adults with exist Pigs ing asthma, infections with respiratory tract viruses are important precipitants for airway obstruction and wheezing. 0387 Method: The Dunnett multiple comparisons test The inflammatory processes involved are complex. However, was used to analyze the data from the experiments in Example virus-induced neutrophil and mononuclear cell recruitment and activation are implicated in aggravating the airway 10b. The Dunnett multiple comparisons test allows compari obstruction that contributes to these asthma exacerbations Son of all samples to a single control group. (reviewed by Gern and Busse, Nature Immunology, 2002). (0388 Results: FIG. 23 shows that SEQID NO:7 caused a The data of Example 9 demonstrate that SEQID NO:2 mark dose-dependent reduction in AUC-resistance. edly suppresses the exacerbated accumulations of neutrophils and mononuclear cells induced in mice by combined virus Example 10d infection and antigen challenge. Effect of SEQID NO:2 on Airway Resistance and Example 10 Lung Compliance in Guinea Pigs Guinea Pig Studies Example 10a 0389 Method: Guinea pigs were sensitized as described in Example 10. The first challenge was on study day 13. Guinea Summary of Guinea Pig AHR Protocol pigs were given intranasally either carrier (Saline). OVA 0384 Male guinea pigs were sensitized on study days 0 alone, of concentrations of SEQ ID NO:2 of 10 ul/kg, 30 and 4 with antigen (ovalbumin, 0.5 ml, 1% OVA i.p./s.c.) with ul/kg, 100 ul/kg, or 300 ul/kg, i.t. US 2009/0137519 A1 May 28, 2009 32 0390 Results: FIG. 24 shows that SEQID NO:2 caused a FIGS. 36, 37, 40, and 41 the CpG oligonucleotides tested in dose-dependent reduction in AUC-resistance. the assays were able activate monocytes, as represented by the markers tested. In FIGS. 36 and 39 the CpG oligonucle Example 10e otides tested in the assays were able activate plasmacytoid Statistical Analysis of the effect of SEQID NO:2 on dendritic cells, as represented by the markers tested. Airway Resistance and Lung Compliance in Guinea 0398 All five ODN having a semi softbackbone that were Pigs tested in the assays showed an increased potency in the assays (IFN-alpha, IP-10, IL-10) compared to SEQID NO. 9 (fully 0391 Method: The Dunnett multiple comparisons test phosphorothioate backbone). The potency of these semi-soft was used to analyze the data from the experiments in Example ODN is also increased in: Monocyte activation (CD80, CD86 10d. The Dunnett multiple comparisons test allows compari expression), pIDC activation (CD86 expression), Intracellular Son of all samples to a single control group IP-10 (Monocytes and B cells), IL-6 secretion, and B cell 0392 Results: FIG. 25 shows that SEQID NO:2 caused a activation (CD80, CD86 expression). For instance, at dose-dependent reduction in AUC-resistance. approximately equivalent or lower concentrations most of the tested ODN resulted in better induction of the cell surface Example 11 markers than the fully phosphorothioate SEQID NO. 9. 0393 Levels of IL-10, TNF-alpha, interferon-gamma, and IL-6 (pg/ml) produced by human PBMC following exposure Example 13 of these cells to the CpG oligonucleotides described herein is 0399. The aim of this study was to investigate the biologi shown in the attached FIG. 27-31. The test oligonucleotides cal activity of selected fragments (putative metabolites) of shown in FIG. 27 include SEQID NOs: 10, 9, 13, 14, 1, and SEQ ID NO: 2. Activity was determined by measuring the 2. The concentration of oligonucleotide used to produce a ability of each fragment to induce secretion of TLR9-associ particular data point is depicted along the X-axis (LLM). ated cytokines from mouse splenocytes in vivo. 0394 As demonstrated in FIG. 27 each of the oligonucle 0400 Stimulation of cytokine secretion by fragments of otides tested in the assays were able to produce different SEQ ID NO. 2 is shown in the attached FIGS. 43-45. The levels and patterns of IL-10 secretion. Of those tested ODN oligonucleotides examined are depicted in the Figures by SEQID NO 1 and 2 resulted in dramatically higher induction SEQID NO and include SEQID NO: 15-23. The concentra of IL-10. tion of oligonucleotide used to produce a particular data point 0395 FIG. 28 depicts data relating to TNF-alpha, inter is depicted along the X-axis (ug/ml). feron-gamma, and IL-6 at three representative doses. More 04.01. As demonstrated in FIGS. 43-45 SEQID NO:2 and detailed graphs on these cytokines are depicted in FIGS. the fragments (putative metabolites, SEQ ID NOS:15-23) 29-31 with additional oligonucleotide dosages. tested all induced the TLR9-associated cytokines IFNC. IFNY, IP-0, IL-6, IL-10 and TNFC. from mouse splenocytes in Example 12 vitro (FIGS. 43.44 and 45). This data demonstrates that each 0396 Levels of B cell, plasmacytoid dendritic cell and of the fragments retained biological activity. monocyte activation following exposure of these cells to the 0402. The foregoing written specification is considered to CpG oligonucleotides described herein is shown in the be sufficient to enable one skilled in the art to practice the attached FIGS. 32-42. The oligonucleotides examined are invention. The present invention is not to be limited in scope depicted in the Figures by SEQID NO and included SEQID by examples provided, since the examples are intended as a NO: 9, 13, 10, 14, 2, 1, 11, 12, and 3. The concentration of single illustration of one aspect of the invention and other oligonucleotide used to produce a particular data point is functionally equivalent embodiments are within the scope of depicted along the X-axis (LM). the invention. Various modifications of the invention in addi 0397. As demonstrated in FIGS. 32, 34,35, 40, and 42 the tion to those shown and described herein will become appar CpG oligonucleotides tested in the assays were able activate ent to those skilled in the art from the foregoing description B cells, as represented by the markers tested. In FIGS. 32 and and fall within the scope of the appended claims. The advan 33 the CpG oligonucleotides tested in the assays were able tages and objects of the invention are not necessarily encom activate NK cells, as represented by the markers tested. In passed by each embodiment of the invention. SEQUENCE LISTING <16 Oc NUMBER OF SEO ID NOS: 68 <210 SEQ ID NO 1 <211 LENGTH: 23 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 1 togtogacgt toggcgc.gcg cc.g 23 US 2009/0137519 A1 May 28, 2009 33 - Continued <210 SEQ ID NO 2 <211 LENGTH: 23 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 2 23 <210 SEQ ID NO 3 <211 LENGTH: 18 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 3 18 <210 SEQ ID NO 4 <211 LENGTH: 23 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 4 23 <210 SEQ ID NO 5 <211 LENGTH: 17 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 5 titcgtcgttt tdtcqtt 17 <210 SEQ ID NO 6 <211 LENGTH: 18 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 6 titt.cgt.cgtt togtogtt 18 <210 SEQ ID NO 7 <211 LENGTH: 24 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 7 tcqtcqttitt gacgttttgt cqtt 24 <210 SEQ ID NO 8 <211 LENGTH: 24 US 2009/0137519 A1 May 28, 2009 34 - Continued &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 8 tcqtcqttitt gtcgttttgt cqtt 24 <210 SEQ ID NO 9 <211 LENGTH: 22 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 9 22 <210 SEQ ID NO 10 <211 LENGTH: 24 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 10 tcqtcqttitt gacgttttgt cqtt 24 <210 SEQ ID NO 11 <211 LENGTH: 2O &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 11 tccagg actt citcticaggitt <210 SEQ ID NO 12 <211 LENGTH: 22 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 12 22 <210 SEQ ID NO 13 <211 LENGTH: 21 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 13 21 <210 SEQ ID NO 14 <211 LENGTH: 2O &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide US 2009/0137519 A1 May 28, 2009 35 - Continued <4 OO SEQUENCE: 14 <210 SEQ ID NO 15 <211 LENGTH: 22 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 15 22 <210 SEQ ID NO 16 <211 LENGTH: 21 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 16 21 <210 SEQ ID NO 17 <211 LENGTH: 2O &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 17 <210 SEQ ID NO 18 <211 LENGTH: 19 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 18 19 <210 SEQ ID NO 19 <211 LENGTH: 18 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 19 18 <210 SEQ ID NO 2 O <211 LENGTH: 17 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 2O 17 US 2009/0137519 A1 May 28, 2009 36 - Continued <210 SEQ ID NO 21 <211 LENGTH: 22 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 21 tcgt.cgt.cgt toggcgc.gcg cc 22 <210 SEQ ID NO 22 <211 LENGTH: 17 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 22 tcgt.cgt.cgt toggcgc 17 <210 SEQ ID NO 23 <211 LENGTH: 21 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 23 tcgt.cgt.cgt toggcgc.gcg C 21 <210 SEQ ID NO 24 <211 LENGTH: 17 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (5) . . (5) <223> OTHER INFORMATION: where n is any nucleotide &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (8) ... (8) <223> OTHER INFORMATION: where n is any nucleotide &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (9) . . (10 <223> OTHER INFORMATION: where n is any nucleotide and where any one or more n can be present or absent &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (11) . . (11) <223> OTHER INFORMATION: where n is a pyrimidine &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (13) . . (13) <223> OTHER INFORMATION: where n is any nucleotide <4 OO SEQUENCE: 24 titcgncgnnn ngncgtt 17 <210 SEQ ID NO 25 <211 LENGTH: 17 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: US 2009/0137519 A1 May 28, 2009 37 - Continued <223> OTHER INFORMATION: Synthetic oligonucleotide &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (11) . . (11) <223> OTHER INFORMATION: where n is t or c <4 OO SEQUENCE: 25 titcgtcgttt ngtcgtt 17 <210 SEQ ID NO 26 <211 LENGTH: 24 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (4) ... (4) <223> OTHER INFORMATION: where n is any nucleotide &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (7) . . (7) <223> OTHER INFORMATION: where n is any nucleotide &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (8) ... (10) <223> OTHER INFORMATION: where n is any nucleotide and where any one or more n may be present or absent &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (11) . . (11) <223> OTHER INFORMATION: where n is any nucleotide &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (14) . . (22) <223> OTHER INFORMATION: where n is any nucleotide and where any one or more n may be present or absent <4 OO SEQUENCE: 26 tcqncginnnn incginnnnnnn nincg 24 <210 SEQ ID NO 27 <211 LENGTH: 24 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (8) ... (10 <223> OTHER INFORMATION: where n is any nucleotide and where any one or more n may be present or absent &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (18) ... (20) <223> OTHER INFORMATION: where n is any nucleotide and where any one or more n may be present or absent <4 OO SEQUENCE: 27 tcgt.cgtninn toggcgc.nnn gocg 24 <210 SEQ ID NO 28 <211 LENGTH: 23 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (4) ... (4) US 2009/0137519 A1 May 28, 2009 38 - Continued <223> OTHER INFORMATION: where n is any nucleotide &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (7) . . (7) <223> OTHER INFORMATION: where n is any nucleotide &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (10) ... (10) <223> OTHER INFORMATION: where n is any nucleotide &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (19) . . (19) <223> OTHER INFORMATION: where n is any nucleotide &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (2O) . . (23) <223> OTHER INFORMATION: where n is any nucleotide and where any one or more n may be present or absent <4 OO SEQUENCE: 28 tcgn.cgncgn toggcgcginn nnn 23 <210 SEQ ID NO 29 <211 LENGTH: 10 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 29 tcqtcqttitt 10 <210 SEQ ID NO 3 O <211 LENGTH: 10 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (9) . . (10) <223> OTHER INFORMATION: where n is an abasic linker <4 OO SEQUENCE: 30 tcqtcqttnin 10 <210 SEQ ID NO 31 <211 LENGTH: 10 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 31 tcgacgt.cga 10 <210 SEQ ID NO 32 <211 LENGTH: 10 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 32 tcgt.cgacga 10 US 2009/0137519 A1 May 28, 2009 39 - Continued <210 SEQ ID NO 33 <211 LENGTH: 10 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 33 tcgcgacgtt 10 <210 SEQ ID NO 34 <211 LENGTH: 10 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 34 10 <210 SEQ ID NO 35 <211 LENGTH: 12 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 35 caat attt at td 12 <210 SEQ ID NO 36 <211 LENGTH: 11 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 36 cc.gttttgttgg 11 <210 SEQ ID NO 37 <211 LENGTH: 13 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 37 13 <210 SEQ ID NO 38 <211 LENGTH: 14 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 38 cggcgc.cgitt gcc.g 14 <210 SEQ ID NO 39 <211 LENGTH: 12 &212> TYPE: DNA <213> ORGANISM: Artificial sequence US 2009/0137519 A1 May 28, 2009 40 - Continued &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (6) . . (7) <223> OTHER INFORMATION: where n is an abasic linker <4 OO SEQUENCE: 39 cggcgnincgc. c9 12 <210 SEQ ID NO 4 O <211 LENGTH: 13 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (6) ... (8) <223> OTHER INFORMATION: where n is an abasic linker <4 OO SEQUENCE: 40 cggcgnnntg cc.g 13 <210 SEQ ID NO 41 <211 LENGTH: 14 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (7) ... (8) <223> OTHER INFORMATION: where n is an abasic linker <4 OO SEQUENCE: 41 cggcgginnicc gcc.g 14 <210 SEQ ID NO 42 <211 LENGTH: 14 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 42 14 <210 SEQ ID NO 43 <211 LENGTH: 15 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 43 cgt.cgacggg acggg 15 <210 SEQ ID NO 44 <211 LENGTH: 15 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 44 US 2009/0137519 A1 May 28, 2009 41 - Continued cgt.cgacgtg acggg 15 <210 SEQ ID NO 45 <211 LENGTH: 15 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 45 gagagttggg Ctctic 15 <210 SEQ ID NO 46 <211 LENGTH: 11 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 46 gtcgaggagg t 11 <210 SEQ ID NO 47 <211 LENGTH: 12 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (6) . . (7) <223> OTHER INFORMATION: where n is an abasic linker <4 OO SEQUENCE: 47 taatant at ta. 12 <210 SEQ ID NO 48 <211 LENGTH: 12 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 48 taat at CC at ta. 12 <210 SEQ ID NO 49 <211 LENGTH: 12 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 49 taat attt at ta. 12 <210 SEQ ID NO 50 <211 LENGTH: 12 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 5 O US 2009/0137519 A1 May 28, 2009 42 - Continued ggcgc.gctgc C9 12 <210 SEQ ID NO 51 <211 LENGTH: 36 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (1) ... (1) <223> OTHER INFORMATION: where n is a purine &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (2) ... (2) <223> OTHER INFORMATION: where n is not c &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (5) . . (6) <223> OTHER INFORMATION: where n is a pyrimidine &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (6) ... (31) <223> OTHER INFORMATION: where one internucleotide linkage is a 3' to 3' linkage &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (7) . . (18) <223> OTHER INFORMATION: where n is any nucleotide and where any one or more n may be present or absent &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (18) ... (30) <223> OTHER INFORMATION: where n is any nucleotide and where any one or more n may be present or absent &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (31) ... (32) <223> OTHER INFORMATION: where n is a pyrimidine &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (35) . . (35) <223> OTHER INFORMATION: where n is not c &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (36) ... (36) <223> OTHER INFORMATION: where n is a purine <4 OO SEQUENCE: 51 nincginnnnnn nnnnnnnnnn nnnnnnnnnn ning.cnn. 36 <210 SEQ ID NO 52 <211 LENGTH: 48 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (4) . . (6) <223> OTHER INFORMATION: where 3 nucleotides may be present or absent &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (7) ... (9) <223> OTHER INFORMATION: where 3 nucleotides may be present or absent &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (10) ... (12) <223> OTHER INFORMATION: where feature may be present or absent &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (12) ... (37) US 2009/0137519 A1 May 28, 2009 43 - Continued <223> OTHER INFORMATION: where one internucleotide linkage is a 3' to 3' linkage &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (13) . . (24) <223> OTHER INFORMATION: where n is any nucleotide and where any one or more n may be present or absent &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (25) . . (36) <223> OTHER INFORMATION: where n is any nucleotide and where any one or more n may be present or absent &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (40) ... (42) <223> OTHER INFORMATION: where 3 nucleotides may be present or absent &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (43) . . (45) <223> OTHER INFORMATION: where 3 nucleotides may be present or absent &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (46) ... (48) <223> OTHER INFORMATION: where 3 nucleotides may be present or absent <4 OO SEQUENCE: 52 tcqtcqtcgt cqnnnnnnnn nnnnn.nnnnn nnnnnngctg. citgctgct 48 <210 SEQ ID NO 53 <211 LENGTH: 11 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 53 tcqtcqttitt a 11 <210 SEQ ID NO 54 <211 LENGTH: 13 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 54 cggcgc.cgt.g. CC9 13 <210 SEQ ID NO 55 <211 LENGTH: 13 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 55 cggcgt.cgt.g. CC9 13 <210 SEQ ID NO 56 <211 LENGTH: 24 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 56 tcgt.cgttitt acggcgc.cgit gcc.g 24 US 2009/0137519 A1 May 28, 2009 44 - Continued <210 SEQ ID NO 57 <211 LENGTH: 24 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 57 tcgt.cgttitt acggcgt.cgt gcc.g 24 <210 SEQ ID NO 58 <211 LENGTH: 12 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 58 12 <210 SEQ ID NO 59 <211 LENGTH: 12 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 59 12 <210 SEQ ID NO 60 <211 LENGTH: 12 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 60 cgacgatcgt. c9 12 <210 SEQ ID NO 61 <211 LENGTH: 12 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 61 cgacgtacgt. c9 12 <210 SEQ ID NO 62 <211 LENGTH: 12 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 62 12 <210 SEQ ID NO 63 <211 LENGTH: 12 US 2009/0137519 A1 May 28, 2009 45 - Continued &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 63 12 <210 SEQ ID NO 64 <211 LENGTH: 12 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 64 CCCCCC999g gg 12 <210 SEQ ID NO 65 <211 LENGTH: 12 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 65 gggggg.cccC CC 12 <210 SEQ ID NO 66 <211 LENGTH: 10 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 66 CCCCC9gggg 10 <210 SEQ ID NO 67 <211 LENGTH: 10 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide <4 OO SEQUENCE: 67 gggggcCCCC 10 <210 SEQ ID NO 68 <211 LENGTH: 10 &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: Synthetic oligonucleotide &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (3) ... (3) <223> OTHER INFORMATION: where n is inosine US 2009/0137519 A1 May 28, 2009 46 - Continued &220s FEATURE: <221 NAMEAKEY: misc feature <222> LOCATION: (6) . . (6) <223> OTHER INFORMATION: where n is inosine <4 OO SEQUENCE: 68 t cit citt tt 10 We claim: 13. The pharmaceutical composition of claim 12, wherein 1. An oligonucleotide comprising: the inhaler is a metered dose inhaler. 14. The pharmaceutical composition of claim 12, wherein the inhaler is a powder inhaler. TCGTCGTCGTTCGGCGCGCGCCG. (SEQ ID NO: 2) 15. The pharmaceutical composition of claim 10, wherein the pharmaceutically is acceptable carrier is formulated for 2. The oligonucleotide of claim 1, wherein the oligonucle Subcutaneous administration. otide comprises 5*T*C G*T*C G*T*C G*T*T*C 16. The pharmaceutical composition of claim 10, wherein G*G*C*G*C G*C*G*C*C*G 3'(SEQID NO:2), the pharmaceutically acceptable carrier is formulated for oral wherein * represents a stabilized internucleotide linkage and administration. represents phosphodiester or phosphodiester-like inter 17. The pharmaceutical composition of claim 10, wherein nucleotide linkage. the pharmaceutically acceptable carrier is formulated for 3. The oligonucleotide of claim 2, wherein 5' refers to the intranasal administration. free 5' end of the oligonucleotide and 3' refers to the free 3' end 18. A method for treating asthma, comprising administer of the oligonucleotide. ing to a Subject having or at risk of having asthma an oligo 4. The oligonucleotide of claim 2, wherein the phosphodi nucleotide of claim 1 in an effective amount to treat asthma. ester orphosphodiester-like internucleotide linkage is a phos 19. The method of treating allergy, comprising administer phodiester internucleotide linkage. ing to a subject having or at risk of having allergy an oligo 5. The oligonucleotide of claim 2, wherein the stabilized nucleotide of claim 1, in an effective amount to treat allergy. internucleotide linkage is a phosphorothioate linkage. 20. The method of claim 19, wherein the subject has aller 6. The oligonucleotide of claim 1, wherein the oligonucle gic rhinitis. otide has a length of less than 100 nucleotides. 21. A method for treating asthma exacerbated by viral 7. The oligonucleotide of claim 1, wherein the oligonucle infection, comprising administering to a subject having or at otide has a length of less than 40 nucleotides. risk of having asthma exacerbated by viral infection an oli 8. The oligonucleotide of claim 3, wherein the oligonucle gonucleotide of claim 1, in an effective amount to treat the otide consists essentially of 5' TC G*T*C G*T*C asthma. G*T*T*C G*G*C*G*C G*C*G*C*C*G 3' (SEQ ID NO: 22. The method of claim 21, wherein the oligonucleotide is 2). administered without an antigen to the Subject. 9. The oligonucleotide of claim 1, wherein the oligonucle 23. A method for treating airway remodeling, comprising otide consists of 5"T*C G*T*C G*T*C G*T*T*C administering to a Subject having or at risk of having airway G*G*C*G*C G*C*G*C*C*G 3'(SEQID NO:2), remodeling an oligonucleotide of claim 1, in an effective 10. A pharmaceutical composition comprising an oligo amount to treat the airway remodeling. nucleotide of claim 1 and a pharmaceutically acceptable car 24. The method of claim 18, wherein the oligonucleotide is 1. delivered by a route selected from the group consisting of 11. The pharmaceutical composition of claim 10, further oral, nasal, Sublingual, intravenous, Subcutaneous, mucosal, comprising a nebulizer. respiratory, direct injection, and dermally. 12. The pharmaceutical composition of claim 10, further comprising an inhaler. c c c c c