DOCSLIB.ORG

Mitochondrial DNA Variation Among <I>Muscidifurax</I> Spp

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mitochondrial DNA Variation Among <I>Muscidifurax</I> Spp University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Faculty Publications: Department of Entomology Entomology, Department of 1997 Mitochondrial DNA Variation among Muscidifurax spp. (Hymenoptera: Pteromalidae), Pupal Parasitoids of Filth Flies (Diptera) David B. Taylor University of Nebraska-Lincoln, [email protected] Richard D. Peterson II University of Nebraska-Lincoln, [email protected] Allen L. Szalanski University of Nebraska-Lincoln James J. Petersen University of Nebraska-Lincoln Follow this and additional works at: https://digitalcommons.unl.edu/entomologyfacpub Part of the Entomology Commons Taylor, David B.; Peterson, Richard D. II; Szalanski, Allen L.; and Petersen, James J., "Mitochondrial DNA Variation among Muscidifurax spp. (Hymenoptera: Pteromalidae), Pupal Parasitoids of Filth Flies (Diptera)" (1997). Faculty Publications: Department of Entomology. 206. https://digitalcommons.unl.edu/entomologyfacpub/206 This Article is brought to you for free and open access by the Entomology, Department of at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Faculty Publications: Department of Entomology by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. Mitochondrial DNA Variation Among Muscidifurax spp. (Hymenoptera: Pteromalidae) ,Pupal Parasitoids of Filth Flies (Diptera) DAVID B. TAYLOR, RICHARD D, PETERSON 11, ALLEN L. SZALANSKI,' A~DJAMES J. PETERSEN Midwest Livestock Insects Research Laboratory. USDA-ARS, Department of Entomology, University of Nebraska, Lincoln. NE 68583 Ann. Entomol. Soc. Am. W(6): 814-824 (1997) ABSTRACT Polymerase chain reaction-restriction fragment length polymorphism (PCR- RFLP) and sequencing analyses were used to characterize an amplicon of -625 bp in 4 of the 5 nominate species of Muscidifim Girault & Sanders, pupal parasitoids of muscoid flies. A single polymorphic nucleotide site was observed among 2 samples of M. mptor Girault Br Sanders. No sequence variation was observed among 3 samples of M. rqh-ellur Kogan & Legner. The sequence of M. uniraptor Kogan & Legner was identical to that of M. raptwellw. Nucleotide divergence among the Muscidijmnx spp. ranged from 0.14 to 0.18 substitutions per nucleotide. Muscidifitm urraptor Kogan & Legner exhibited multiple haplotypes, 2 of which were char- acterized by sequencing and 4 others by PCR-RFLP. The sequenced haplotypes differed by 0.08 nucleotide substitutions per site. Restriction site analysis indicated that nucleotide divergence ranged from 0.03 to 0.10 among all 6 haplotypes. Analysis of progeny from individual females indicated that the observed variation in M. mraptor was caused by multiple haplotypes within individuals rather than differentiation among individuals. These results bring to question the specific status of M.unimptorand indicate that the genus is native to the Western Hemisphere, and not introduced with their primary host, Murcn domestics L,as previously proposed. Heteroplasmy and translocation of aportion of the mitochondrial genome to the nuclear genome are discussed as possible causes for the variation observed in M. zamptw. KEY WORDS Muscidifimx, polymerase chain reaction-restriction fragment length polymor- phism, mitochondrial DNA, phylogeny WASEm TAF, genus Musddifirax are pupal parasi- species known only from the island of Puerto Rico toids of muscoid flies, especially the house fly, Mu~cn (Kogan and Legner 1970). domtica L., and the stable fly, Stmnoxys colcitrm The geographic origins and phylogenetic rela- (L.),and are among the most promising biological tionships of Muscidifirrax are unclear. Kogan and control agents for these flies in the confined live- Leper (1970) proposed 2 alternatives for the ori- stock environment (Miller and Rutz 1990, Petersen gins of the genus. First, they originated in the Ethi- et al. 1990). Murcidifirax includes 5 species. Mus- opian region and wereintroduced to the New World cidifirax mptor Girault & Sanders, the most wide- along with house flies, or 2nd, they are native to the spread, is found throughout the temperate and semi- New World and have secondarily adapted to house tropical regions of the world (Kogan and Legner flies. Kogan and Legner conclude that the "remark- 1970). The remaining 4 species are limited to the able preference of Musctdifirax spp. for house flies New World. Muscidifurax zaraptor Kogan & Legner as compared to native Nearctic flies" indicates an is found sympatrically with M. raptor in western Old World origin for the genus. Legner (1983)in- North America (Kogan and Legner 1970, Lysyk dicates that the dependence of Musctdifirax upon 1995), M. raptoroides Kogan & Legner and M.rup- the "barnyard" environment outside of Africa is torellus Kogan & Legner are found allopatrically in further evidence that the genus was not native to the Central and South America, respectively (Kogan New World. However, to accept an Old World or- and Legner 1970).Two forms of M. raptorellus have igin of the genus and account for the 4 species been reported, one solitary and the other gregarious endemic to the New World, one must accept a very (Kogan and Legner 1970, Legner 1988). MuPcidi- rapid rate of speciation following their introduction. &rax mtraptw Kogan & Legner is a parthenogenic Despite the interest in these species for biological control of filth flies and the questions concerning their geographic origin, little work has been done on "~spartrnmt of Plant Pathology, University of Nebmkq Lin- the population genetics and genetic structure of coln, NE 68583. Muscidifirax. Ropp (1986) used allozymes to ex- November I997 TAYLOREX AL.: mtDNA VARIATIONLY M~cidifimxSPP. 815 Date Source* Species Orldn inllected . raptor Nebraska I995 MLIRL New York Unknown Cornell University . mp~IlwChile Unknown Legner via MLIRL Nebraska 1991 MLIRL Peru Unknown Leper ria MLlRL M.miaptor Puerto Rico Unknown Rochester University M. zamptor Nebraska 1991-1993 MLIRL Nebraska 1995 hu.lRL 'MLEU+ Midwest Livestock Inrect Research Irpboratory. USDA-ARS, Lincoln. NE; Legner via MLIRL,originally collected by E. F. Leper and transferred to MLlRL in 1989. amine several populations of M. raptor and M.zarap- tor. He found relatively low levels of differentiation among geographic isolates of the 2 species, but a high level of differentiation was observed between species. Antolin et al. (1996) used RAPD-PCR to examine 3 Muscidifiraz spp. They were able to dif- ferentiate the species and associate the gregarious North American Muscidifurox sp. with M.ruptorel- Ius, but indicated they were unable to explore phy- logenetic relationships because of the nature of the RAPD-PCR data. The purpose of this study was to develop molec- Fig. 1. Intact amplicon from 4 Muscidifirrax spp., A. ular diagnostic characters and examine genetic dif- mellifera, and C. macelloria on 2.5% Metaphor agarosc gel. ferentiation among Muscidifumx spp. A region of Primers werc 5' ATACCTCGACG'ITA?TCACA 3' and 5' the mitochondria1genome, =625 bp, including parts TCAATATCA'ITCATCACCMT 3'. of the cytochrome oxidase I (COI) and I1 (COII) genes as well as the entire tRNA leucine (~RNA''~) gene was examined by polymerase chain reaction- extracted with thc chloroform-phenol tcchniquc as restriction fragment length polymorphism (PCR- outlined in Taylor ct al. (1996). RFLP) and sequencing. Representative samples of A region of mtDNA, -625 bp long, was amplified 4 of the 5 species in the genus (samples of M. using thc primcrs 5' ATACCTCGACGTTATC- raptomides were not available) were included in ACA 3' (= S2792; Bogdanowicz ct al. 1993) and 5' this study. TCAATATCATTGATGACCAAT 3' (K. Prucss, personal communication). Thc 5' ends of thcric primcrs wcrc located at bp 2773 and 3400 of the Materials and Methods Drosghila yakuba mtDNA map (Clary and Wol- SampIes. Mumidifirax samples were obtained stenholme 1985), respcctivcly. from established colonies (Table 1).The Chile and For amplification, 1 p1 of sample DNA was added Nebraska samples of M. raptorellus represented gre- to a reaction mixture containing 2.5 p1 of reaction garious populations and the Peru sample was soli- buffer (Perkin-Elmer, Norwalk, CT), 2 p1 of dNTP tary. The Apis mellifera lingustica L control sample mix (10 mM each-dATP, $ITP, dCTP and dCTP), was collected from an apiary in Lincoln, NE, and the 1pl of each primer (20 mM). 1.0 unit of Taq poly- Cochliomyia naacellaria (F.) samples were from a merase (Perkin-Elmer) and deionized water to a laboratory colony originating in Fargo, ND. Mus- volume of 25 pl. Amplifications were donc in a cidifcnvlx colonies were maintained on freeze-killed Perkin Elmer Cetus Model 9600 therrnocycler pro- M. rlomestica pupae (Petersen and Matthews 1984). grammed for 35 cycles of 92°C for 1 min, 55°C for 1 Isofemale lines were initiated by isolating indi- min, and 72OC for 1or 2 min. Amplification products vidual females (presumably mated) from the main were stored at 4OC. colony and placing them in small plastic cups (2 cm Restriction Endonuclease Digests. Twenty-seven diameter, 2 cm high) with -150 freeze-killed fly restriction enzymes-Alu I, Apo I, Ase I, Ava I. Ban pupae. Progeny emerged in 3 wk. Specimens were Zl, Bfa I, Bsr I, Dde I, Dpn 11, Dra I, EcoR I, EcoR V, stored at -80%. Hae Ill, Hinc 11, Hind Ill. Hinf 1, Hpa I, Mse I, Msp I, Voucher specimens from each of the Murcidifimx Puu 11, Rsa I, Sac I, Sau96 I, ScrF I, SJ~I, Taq I, and samples have been placed in the collection of the Xba I-were screened. Digests for polyacrylamide University of Nebraska State Museum, Lincoln. gel electrophoresis (PAGE) were done using 1.5 p1 DNA Extraction and Amplification. Pools of 5-25 of PCR product, 0.2 p1 enzyme (New England Bio- wasps were used for each DNA extraction. DNA was labs, Beverly, MA), 1X buffer (New England Bio- ANNALS OF THE E@STOMOUX:ICALSOCIEN OF AMERICA Vol. 90, no. 6 50 bp SSP ladder frag Apo I ssp I Fis 2. Apo I and Ssp I digests of Mutddifumx spp. on 2.5%Metaphor agarose gels. labs) and water to bring the volume to 5 pl in 200-pl onto a 10% acrylamide gel (1X Tris:borate:EDTA tubes.
Load more

Recommended publications
  • Integrated Pest Management: Current and Future Strategies
    Integrated Pest Management: Current and Future Strategies Council for Agricultural Science and Technology, Ames, Iowa, USA Printed in the United States of America Cover design by Lynn Ekblad, Different Angles, Ames, Iowa Graphics and layout by Richard Beachler, Instructional Technology Center, Iowa State University, Ames ISBN 1-887383-23-9 ISSN 0194-4088 06 05 04 03 4 3 2 1 Library of Congress Cataloging–in–Publication Data Integrated Pest Management: Current and Future Strategies. p. cm. -- (Task force report, ISSN 0194-4088 ; no. 140) Includes bibliographical references and index. ISBN 1-887383-23-9 (alk. paper) 1. Pests--Integrated control. I. Council for Agricultural Science and Technology. II. Series: Task force report (Council for Agricultural Science and Technology) ; no. 140. SB950.I4573 2003 632'.9--dc21 2003006389 Task Force Report No. 140 June 2003 Council for Agricultural Science and Technology Ames, Iowa, USA Task Force Members Kenneth R. Barker (Chair), Department of Plant Pathology, North Carolina State University, Raleigh Esther Day, American Farmland Trust, DeKalb, Illinois Timothy J. Gibb, Department of Entomology, Purdue University, West Lafayette, Indiana Maud A. Hinchee, ArborGen, Summerville, South Carolina Nancy C. Hinkle, Department of Entomology, University of Georgia, Athens Barry J. Jacobsen, Department of Plant Sciences and Plant Pathology, Montana State University, Bozeman James Knight, Department of Animal and Range Science, Montana State University, Bozeman Kenneth A. Langeland, Department of Agronomy, University of Florida, Institute of Food and Agricultural Sciences, Gainesville Evan Nebeker, Department of Entomology and Plant Pathology, Mississippi State University, Mississippi State David A. Rosenberger, Plant Pathology Department, Cornell University–Hudson Valley Laboratory, High- land, New York Donald P.
    [Show full text]
  • International Conference Integrated Control in Citrus Fruit Crops
    IOBC / WPRS Working Group „Integrated Control in Citrus Fruit Crops“ International Conference on Integrated Control in Citrus Fruit Crops Proceedings of the meeting at Catania, Italy 5 – 7 November 2007 Edited by: Ferran García-Marí IOBC wprs Bulletin Bulletin OILB srop Vol. 38, 2008 The content of the contributions is in the responsibility of the authors The IOBC/WPRS Bulletin is published by the International Organization for Biological and Integrated Control of Noxious Animals and Plants, West Palearctic Regional Section (IOBC/WPRS) Le Bulletin OILB/SROP est publié par l‘Organisation Internationale de Lutte Biologique et Intégrée contre les Animaux et les Plantes Nuisibles, section Regionale Ouest Paléarctique (OILB/SROP) Copyright: IOBC/WPRS 2008 The Publication Commission of the IOBC/WPRS: Horst Bathon Luc Tirry Julius Kuehn Institute (JKI), Federal University of Gent Research Centre for Cultivated Plants Laboratory of Agrozoology Institute for Biological Control Department of Crop Protection Heinrichstr. 243 Coupure Links 653 D-64287 Darmstadt (Germany) B-9000 Gent (Belgium) Tel +49 6151 407-225, Fax +49 6151 407-290 Tel +32-9-2646152, Fax +32-9-2646239 e-mail: [email protected] e-mail: [email protected] Address General Secretariat: Dr. Philippe C. Nicot INRA – Unité de Pathologie Végétale Domaine St Maurice - B.P. 94 F-84143 Montfavet Cedex (France) ISBN 978-92-9067-212-8 http://www.iobc-wprs.org Organizing Committee of the International Conference on Integrated Control in Citrus Fruit Crops Catania, Italy 5 – 7 November, 2007 Gaetano Siscaro1 Lucia Zappalà1 Giovanna Tropea Garzia1 Gaetana Mazzeo1 Pompeo Suma1 Carmelo Rapisarda1 Agatino Russo1 Giuseppe Cocuzza1 Ernesto Raciti2 Filadelfo Conti2 Giancarlo Perrotta2 1Dipartimento di Scienze e tecnologie Fitosanitarie Università degli Studi di Catania 2Regione Siciliana Assessorato Agricoltura e Foreste Servizi alla Sviluppo Integrated Control in Citrus Fruit Crops IOBC/wprs Bulletin Vol.
    [Show full text]
  • Irreversible Thelytokous Reproduction in Muscidifurax Uniraptor
    Entomologia Experimentalis et Applicata 100: 271–278, 2001. 271 © 2001 Kluwer Academic Publishers. Printed in the Netherlands. Irreversible thelytokous reproduction in Muscidifurax uniraptor Yuval Gottlieb∗ & Einat Zchori-Fein Department of Entomology, Faculty of Agricultural, Food and Environmental Quality Sciences, The Hebrew Uni- versity of Jerusalem, P.O.Box 12, Rehovot 76100, Israel; ∗Current address: The University of Chicago, Department of Organismal Biology and Anatomy, 1027 E 57th St. Chicago, IL 60637, USA (Phone: 1 (773) 834-0264; Fax: 1 (773) 834-3028; E-mail: [email protected]) Accepted: May 1, 2001 Key words: thelytoky, Wolbachia, Muscidifurax uniraptor, symbiosis, reproductive barriers Abstract Vertically transmitted bacteria of the genus Wolbachia are obligatory endosymbionts known to cause thelytokous (asexual) reproduction in many species of parasitic Hymenoptera. In these species production of males can be induced, but attempts to establish sexual lines have failed in all but one genus. We have found three reproductive barriers between antibiotic-induced males and conspecific females of Muscidifurax uniraptor Kogan and Legner (Hymenoptera: Pteromalidae): males do not produce mature sperm, females are reluctant to mate, and a major muscle is absent from the spermatheca. These findings suggest that Wolbachia-induced thelytokous reproduction in M. uniraptor is irreversible, and are consistent with the idea that since sexual reproduction has ceased, selection on sexual traits has been removed leading to the disappearance or reduction in these traits. Because under these circumstances asexual reproduction is irreversible, the host has become totally dependent on the symbiont for reproduction. Introduction more than 16% of all the insects surveyed (For review, see Stouthamer et al., 1999).
    [Show full text]
  • To Control House Flies in Confined Animal Facilities Using
    E-224 12-04 Using Parasitoids to Control House Flies in Confi ned Animal Facilities Confi ned a lt fl ies emerge once their can use biologica House fl ies’ natural enemies keep house fl ies at les and mites that feed on eggs are part of integrated eral parasitoid wasp species that designed to (1) avoid, pr and (2) minimize environm are unlike most parasitic insects caused by misuse of pesticide y usually kill their hosts. Adult parasitoids pest control alternative. iving; only their immature stages are parasitic, Biological controls use pests’ nat g on or inside their hosts. The most common suppress them, reducing both pest num use fl y parasitoids belong to the family Pteromalidae damage. Using biological controls in CA (Hymenoptera), a large group of benefi cial wasps basic knowledge about the pest’s biology an that will not sting people. Some of these parasitoid enemies in order to evaluate commercially ava species are native to Texas, and many are available biological control agents and select the best one. This commercially for purchase and release. fact sheet will update managers about using biological The female parasitoid wasp seeks out house fl y control practices in their CAFs to combat house fl ies. pupae. Using her ovipositor, she probes the pupa and feeds on it, then deposits one or more eggs inside the House Flies and Their Parasitoid Enemies pupal shell. (An ovipositor is a stinger-like appendage Like all insects, house fl ies, Musca domestica, used to lay eggs.) The female wasp’s probing kills the undergo metamorphosis.
    [Show full text]
  • Stablefly Bibliography
    United States Department of Agriculture A Century and a Half of Agricultural Research Research on the Stable Service ARS-173 Fly, Stomoxys calcitrans July 2012 (L.) (Diptera: Muscidae), 1862-2011: An Annotated Bibliography United States Department of A Century and a Half of Agriculture Agricultural Research on the Stable Fly, Research Service Stomoxys calcitrans (L.) ARS-173 (Diptera: Muscidae), 1862-2011: July 2012 An Annotated Bibliography K.M. Kneeland, S.R. Skoda, J.A. Hogsette, A.Y. Li, J. Molina-Ochoa, K.H. Lohmeyer, and J.E. Foster _____________________________ Kneeland, Molina-Ochoa, and Foster are with the Department of Entomology, University of Nebraska, Lincoln, NE. Molina-Ochoa also is the Head of Research and Development, Nutrilite SRL de CV, El Petacal, Jalisco, Mexico. Skoda is with the Knipling-Bushland U.S. Livestock Insects Research Laboratory (KBUSLIRL), Screwworm Research Unit, USDA Agricultural Research Service, Kerrville, TX. Hogsette is with the Center for Medical, Agricultural and Veterinary Entomology, USDA Agricultural Research Service, Gainesville, FL. Li and Lohmeyer are with KBUSLIRL, Tick and Biting Fly Research Unit, USDA Agricultural Research Service, Kerrville, TX. Abstract • sustain a competitive agricultural economy; • enhance the natural resource base and the Kneeland, K.M., S.R. Skoda, J.A. Hogsette, environment; and A.Y. Li, J. Molina-Ochoa, K.H. Lohmeyer, • provide economic opportunities for rural and J.E. Foster. 2012. A Century and a Half of citizens, communities, and society as a Research on the Stable Fly, Stomoxys whole. calcitrans (L.) (Diptera: Muscidae), 1862- 2011: An Annotated Bibliography. ARS-173. Mention of trade names or commercial U.S.
    [Show full text]
  • 8 March 2013, 381 P
    See discussions, stats, and author profiles for this publication at: http://www.researchgate.net/publication/273257107 Mason, P. G., D. R. Gillespie & C. Vincent (Eds.) 2013. Proceedings of the Fourth International Symposium on Biological Control of Arthropods. Pucón, Chile, 4-8 March 2013, 381 p. CONFERENCE PAPER · MARCH 2013 DOWNLOADS VIEWS 626 123 3 AUTHORS, INCLUDING: Peter Mason Charles Vincent Agriculture and Agri-Food Canada Agriculture and Agri-Food Canada 96 PUBLICATIONS 738 CITATIONS 239 PUBLICATIONS 1,902 CITATIONS SEE PROFILE SEE PROFILE Available from: Charles Vincent Retrieved on: 13 August 2015 The correct citation of this work is: Peter G. Mason, David R. Gillespie and Charles Vincent (Eds.). 2013. Proceedings of the 4th International Symposium on Biological Control of Arthropods. Pucón, Chile, 4-8 March 2013, 380 p. Proceedings of the 4th INTERNATIONAL SYMPOSIUM ON BIOLOGICAL CONTROL OF ARTHROPODS Pucón, Chile March 4-8, 2013 Peter G. Mason, David R. Gillespie and Charles Vincent (Eds.) 4th INTERNATIONAL SYMPOSIUM ON BIOLOGICAL CONTROL OF ARTHROPODS Pucón, Chile, March 4-8, 2013 PREFACE The Fourth International Symposium on Biological Control of Arthropods, held in Pucón – Chile, continues the series of international symposia on the biological control of arthropods organized every four years. The first meeting was in Hawaii – USA during January 2002, followed by the Davos - Switzerland meeting during September 2005, and the Christchurch – New Zealand meeting during February 2009. The goal of these symposia is to create a forum where biological control researchers and practitioners can meet and exchange information, to promote discussions of up to date issues affecting biological control, particularly pertaining to the use of parasitoids and predators as biological control agents.
    [Show full text]
  • Sex Determination in the Hymenoptera: a Review of Models and Evidence
    Heredity 71 (1993) 421—435 Received 10 March 1993 Genetical Society of Great Britain Sex determination in the Hymenoptera: a review of models and evidence JAMES M. COOK Department of Genetics & Human Variation, La Trobe University, Bun doora 3083, Victoria, Australia Thehaploid males and diploid females of Hymenoptera have all chromosomes in the same proportions. This rules out most familiar sex-determining mechanisms, which rely on dosage differences at sex determination loci. Two types of model —genicbalance and complementary sex determination (CSD) —havebeen invoked for Hymenoptera. Experimental studies provide no good evidence for genic balance models, which are contradicted by the detection of diploid males in 33 disparate species. Furthermore, recent advances have shown that sex determination in the best- studied diploid animals does not depend on genic balance, removing the original justification for hymenopteran genic balance models. Instead, several Hymenoptera have single-locus CSD. In this system, sex locus heterozyotes are female while homozygotes and hemizygotes are male. Single- locus CSD does not apply to several inbreeding species and this probably reflects selection against the regular production of diploid males, which are sterile. A multilocus CSD model, in which heterozygosity at any one of several sex loci leads to female development has also been proposed. To date, multilocus CSD has not been demonstrated but several biases against its detection must be considered. CSD can apply to thelytokous races as long as the cytogenetic mechanism permits retention of sex locus heterozygosity. However, some thelytokous races clearly do not have CSD. The distribution of species with and without CSD suggests that this form of sex determination may be ancestral in the Hymenoptera.
    [Show full text]
  • Giornale Di Zoologia
    ISSN 0370 - 4327 GIORNALE DI ZOOLOGIA PUBLISHED Consiglio per la ricerca in agricoltura e l’analisi dell’economia agraria CREA Research Centre for Plant Protection and Certification Volume CI 101TERZA SERIE Rerum natura nusquam magis quam in minimis tota. PLINIO F I R E N Z E - 2 0 1 8 TIPOGRAFIA COPPINI I - Blank Page II - Blank Page ISSN 0370 - 4327 GIORNALE DI ZOOLOGIA PUBLISHED Consiglio per la ricerca in agricoltura e l’analisi dell’economia agraria CREA Research Centre for Plant Protection and Certification Volume CI 101TERZA SERIE Rerum natura nusquam magis quam in minimis tota. PLINIO F I R E N Z E - 2 0 1 8 TIPOGRAFIA COPPINI Journal of Zoology Founded by Antonio Berlese, Firenze, 1903 Published by CREA Research Centre for Plant Protection and Certification (formerly: Istituto Sperimentale per la Zoologia Agraria, Firenze) Consiglio per la ricerca in agricoltura e l’analisi dell’economia agraria Editor-in-Chief Roberto Nannelli Firenze, Italy Associate Editors Sauro Simoni Pio Federico Roversi Firenze, Italy Firenze, Italy Managing Editor Donatella Goggioli Firenze, Italy Editorial Board Ramon Albajes Giacinto Germinara Hervé Jactel Peter Schausberger Lleida, Spain Foggia, Italy Cestas, France Vienna, Austria Miguel Angel Altieri Andrew Paul Gutierrez Mariusz Lewandowski Stephan Scheurer Berkeley, USA Berkeley, USA Warszawa, Poland Berlin, Germany Sebastiano Barbagallo Keith M. Harris Francois Lieutier Thomas Schröder Catania, Italy Ripley, Woking, England Orleans, France Braunschweig, Germany Andrea Binazzi Sherif Hassan Evert E. Lindquist Ward Strong Firenze, Italy Darmstat, Germany Ottawa, Canada Veron, Canada Stefano Colazza Axel Hausmann Pietro Luciano Eustachio Tarasco Palermo, Italy München, Germany Sassari, Italy Bari, Italy Piero Cravedi Claudio Ioriatti Manuel Mota Stefano Turillazzi Piacenza, Italy S.
    [Show full text]
  • CURRICULUM VITAE (Effective: February 2009)
    CURRICULUM VITAE (Effective: February 2009) Name Aldemaro Romero Academic Fields Integrative Biology, Environmental Studies. Academic Address Department of Biological Sciences Arkansas State University P.O. Box 599 State University, AR 72467, USA [email protected] Ph.: (870) 972-3082 Fax: (870) 972-2638 Current Position Chair and Professor Universities Attended University Location, Dates Degree Universidad de Oriente Cumaná, Venezuela 1/70-6/70 Universidad de Barcelona Barcelona, Spain Licenciado Biología 9/70-6/77 University of Miami Coral Gables, FL Ph. D. 1/81-8/84 Pennsylvania State University University Park, PA Certificate, 11/87-12/87 Management for Managers in Natural Resources University and Administrative Experience 2003 – Present: Chair and Professor, Department of Biological Sciences, Arkansas State University, Jonesboro, AR. 1998-2003: Associate Professor and Director of the Environmental Studies Program, Macalester College, St. Paul, MN. 1996-1998: Assistant Professor of Biology, Florida Atlantic University, Davie, FL. 1994-1996: Adjunct (Research) Associate Professor, University of Miami, FL. 1986-1994: Executive Director and CEO, BIOMA, The Venezuelan Foundation for the Conservation of Biodiversity, Caracas, Venezuela. 1985-1986: Country Program Director, The Nature Conservancy, Washington, D.C. 2 Grants, University Scholarships, Fellowships, and Prizes A) Research Grants: 1981 - Peter Nikolic Fellowship in Animal Behavior and Charles Tobach Fund award. Amount: $330. Project Title: The evolution of behavior in surface (eyed), cave (blind), and intermediate forms of Astyanax mexicanus (Pisces: Characidae). 1982 - Organization for Tropical Studies post-course award. Amount: $1,500. Project Title: Genetic basis of behavior and phenotypic variability in Astyanax fasciatus (Cuvier) (Pisces: Characidae) in different environments of Costa Rica.
    [Show full text]
  • (Hymenoptera: Pteromalidae) at Different Temperatures
    Biological Control 26 (2003) 1–7 www.elsevier.com/locate/ybcon Development of microsporidia-infected Muscidifurax raptor (Hymenoptera: Pteromalidae) at different temperatures Carl K. Boohene,a Christopher J. Geden,b,* and James J. Becnelb a Department of Entomology and Nematology, University of Florida Gainesville, FL, USA b USDA-ARS-Center for Medical, Agricultural and Veterinary Entomology, P.O. Box 14565, Gainesville, FL 32604, USA Received 24 October 2001; accepted 21 June 2002 Abstract Muscididfurax raptor, a pupal parasitoid of house flies and other filth flies, is commonly infected with the microsporidium Nosema muscidifuracis. To determine the effects of infection on developmental time, uninfected and infected adult M. raptor were allowed to parasitize pupae of the house fly (Musca domestica) for 24 h. Exposed pupae of the two groups (infected and uninfected) were held at 15, 20, 25, 30, 32, and 34 °C with 75–80% relative humidity. Development of infected M. raptor was significantly longer at all temperatures than that of uninfected parasitoids, resulting in approximately 7% extensions of developmental times. Uninfected fe- males completed development in 14.6, 19.6, and 30.4 days at 30, 25, and 20 °C, respectively, compared with 15.8, 20.7, and 32.3 days for infected females at these temperatures. The differences in developmental times provided narrow windows for isolating large proportions of uninfected M. raptor females for disease management programs. This window was greatest at 20 °C; 61% of the uninfected females emerged by day 30, at which time only 10% of the infected females had emerged. Published by Elsevier Science (USA).
    [Show full text]
  • Differences in the Reliance on Cuticular Hydrocarbons As Sexual Signaling and Species Discrimination Cues in Parasitoid Wasps Jan Buellesbach1,4,5*† , Sebastian G
    Buellesbach et al. Frontiers in Zoology (2018) 15:22 https://doi.org/10.1186/s12983-018-0263-z RESEARCH Open Access Differences in the reliance on cuticular hydrocarbons as sexual signaling and species discrimination cues in parasitoid wasps Jan Buellesbach1,4,5*† , Sebastian G. Vetter2,4† and Thomas Schmitt3,4,5 Abstract Background: Cuticular hydrocarbons (CHC) have been documented to play crucial roles as species- and sex- specific cues in the chemical communication systems of a wide variety of insects. However, whether they are sufficient by themselves as the sole cue triggering sexual behavior as well as preference of con- over heterospecific mating partners is rarely assessed. We conducted behavioral assays in three representative species of parasitoid wasps (Hymenoptera: Pteromalidae) to determine their reliance on CHC as species-specific sexual signaling cues. Results: We found a surprising degree of either unspecific or insufficient sexual signaling when CHC are singled out as recognition cues. Most strikingly, the cosmopolitan species Nasonia vitripennis, expected to experience enhanced selection pressure to discriminate against other co-occurring parasitoids, did not discriminate against CHC of a partially sympatric species from another genus, Trichomalopsis sarcophagae. Focusing on the latter species, in turn, it became apparent that CHC are even insufficient as the sole cue triggering conspecific sexual behavior, hinting at the requirement of additional, synergistic sexual cues particularly important in this species. Finally, in the phylogenetically and chemically most divergent species Muscidifurax uniraptor, we intriguingly found both CHC-based sexual signaling as well as species discrimination behavior intact although this species is naturally parthenogenetic with sexual reproduction only occurring under laboratory conditions.
    [Show full text]
  • Next‐Generation Biological Control: the Need for Integrating Genetics And
    Biol. Rev. (2020), pp. 000–000. 1 doi: 10.1111/brv.12641 Next-generation biological control: the need for integrating genetics and genomics Kelley Leung1* , Erica Ras2, Kim B. Ferguson3 , Simone Ariëns4, Dirk Babendreier5 , Piter Bijma6 , Kostas Bourtzis2 , Jacques Brodeur7 , Margreet A. Bruins3, Alejandra Centurión4, Sophie R. Chattington4 , Milena Chinchilla-Ramírez8 , Marcel Dicke9 , Nina E. Fatouros10 , Joel González-Cabrera11 , Thomas V. M. Groot12, Tim Haye5 , Markus Knapp12 , Panagiota Koskinioti2,13 , Sophie Le Hesran9,12, Manolis Lyrakis14,15 , Angeliki Paspati8 , Meritxell Pérez-Hedo8 , Wouter N. Plouvier16 , Christian Schlötterer14 , Judith M. Stahl5,17 , Andra Thiel4 , Alberto Urbaneja8 , Louis van de Zande1 , Eveline C. Verhulst9 , Louise E. M. Vet9,18 , Sander Visser19,20 , John H. Werren21 , Shuwen Xia6 , Bas J. Zwaan3 , Sara Magalh~aes22 , Leo W. Beukeboom1 and Bart A. Pannebakker3 1Groningen Institute for Evolutionary Life Sciences, University of Groningen, PO Box 11103, 9700 CC, Groningen, The Netherlands 2Insect Pest Control Laboratory, Joint FAO/IAEA Division of Nuclear Techniques in Food and Agriculture, Vienna International Centre, P.O. Box 100, 1400, Vienna, Austria 3Laboratory of Genetics, Wageningen University & Research, Droevendaalsesteeg 1, 6708 PB, Wageningen, The Netherlands 4Group for Population and Evolutionary Ecology, FB 02, Institute of Ecology, University of Bremen, Leobener Str. 5, 28359, Bremen, Germany 5CABI, Rue des Grillons 1, 2800, Delémont, Switzerland 6Animal Breeding and Genomics, Wageningen
    [Show full text]