DOCSLIB.ORG

Mouse Pkd2l1 Knockout Project (CRISPR/Cas9)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mouse Pkd2l1 Knockout Project (CRISPR/Cas9) https://www.alphaknockout.com Mouse Pkd2l1 Knockout Project (CRISPR/Cas9) Objective: To create a Pkd2l1 knockout Mouse model (C57BL/6N) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Pkd2l1 gene (NCBI Reference Sequence: NM_181422 ; Ensembl: ENSMUSG00000037578 ) is located on Mouse chromosome 19. 15 exons are identified, with the ATG start codon in exon 1 and the TAG stop codon in exon 15 (Transcript: ENSMUST00000042026). Exon 3~14 will be selected as target site. Cas9 and gRNA will be co-injected into fertilized eggs for KO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Mice homozygous for a knock-out allele exhibit decreased chorda tympani nerve response to sour tastants. Exon 3 starts from about 15.35% of the coding region. Exon 3~14 covers 82.98% of the coding region. The size of effective KO region: ~8612 bp. The KO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 3 4 5 6 7 8 9 10 11 12 13 14 15 Legends Exon of mouse Pkd2l1 Knockout region Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot (up) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section upstream of Exon 3 is aligned with itself to determine if there are tandem repeats. Tandem repeats are found in the dot plot matrix. The gRNA site is selected outside of these tandem repeats. Overview of the Dot Plot (down) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 604 bp section downstream of Exon 14 is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis. Page 3 of 8 https://www.alphaknockout.com Overview of the GC Content Distribution (up) Window size: 300 bp Sequence 12 Summary: Full Length(2000bp) | A(29.9% 598) | C(21.8% 436) | T(24.8% 496) | G(23.5% 470) Note: The 2000 bp section upstream of Exon 3 is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Overview of the GC Content Distribution (down) Window size: 300 bp Sequence 12 Summary: Full Length(604bp) | A(27.81% 168) | C(20.36% 123) | T(28.81% 174) | G(23.01% 139) Note: The 604 bp section downstream of Exon 14 is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Page 4 of 8 https://www.alphaknockout.com BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 2000 1 2000 2000 100.0% chr19 - 44157765 44159764 2000 browser details YourSeq 156 971 1433 2000 93.4% chr4 - 128501333 128906317 404985 browser details YourSeq 71 1364 1434 2000 100.0% chr14 - 46115664 46115734 71 browser details YourSeq 70 1364 1433 2000 100.0% chr5 - 101518608 101518677 70 browser details YourSeq 70 1364 1433 2000 100.0% chr19 - 53211615 53211684 70 browser details YourSeq 70 1364 1433 2000 100.0% chr15 - 54395292 54395361 70 browser details YourSeq 70 1364 1433 2000 100.0% chr1 - 31447503 31447572 70 browser details YourSeq 70 1364 1433 2000 100.0% chr19 + 10647746 10647815 70 browser details YourSeq 70 1364 1433 2000 100.0% chr11 + 10463802 10463871 70 browser details YourSeq 70 1364 1433 2000 100.0% chr11 + 10463808 10463877 70 browser details YourSeq 69 1362 1433 2000 98.7% chr14 - 61872176 61872251 76 browser details YourSeq 69 1364 1432 2000 100.0% chr1 - 188377430 188377498 69 browser details YourSeq 47 346 418 2000 82.2% chr17 + 36282250 36282322 73 Note: The 2000 bp section upstream of Exon 3 is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 604 1 604 604 100.0% chr19 - 44148549 44149152 604 browser details YourSeq 23 107 132 604 96.0% chr13 + 107926621 107926655 35 Note: The 604 bp section downstream of Exon 14 is BLAT searched against the genome. No significant similarity is found. Page 5 of 8 https://www.alphaknockout.com Gene and protein information: Pkd2l1 polycystic kidney disease 2-like 1 [ Mus musculus (house mouse) ] Gene ID: 329064, updated on 8-Oct-2019 Gene summary Official Symbol Pkd2l1 provided by MGI Official Full Name polycystic kidney disease 2-like 1 provided by MGI Primary source MGI:MGI:1352448 See related Ensembl:ENSMUSG00000037578 Gene type protein coding RefSeq status VALIDATED Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Also known as PCL; Pkdl; PKD2L; TRPP3; BC046386; B830002B15 Expression Biased expression in testis adult (RPKM 2.9), cerebellum adult (RPKM 1.0) and 3 other tissues See more Orthologs human all Genomic context Location: 19 C3; 19 36.91 cM See Pkd2l1 in Genome Data Viewer Exon count: 26 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) 19 NC_000085.6 (44147637..44248328, complement) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) 19 NC_000085.5 (44222127..44266932, complement) Chromosome 19 - NC_000085.6 Page 6 of 8 https://www.alphaknockout.com Transcript information: This gene has 2 transcripts Gene: Pkd2l1 ENSMUSG00000037578 Description polycystic kidney disease 2-like 1 [Source:MGI Symbol;Acc:MGI:1352448] Gene Synonyms PCL, PKD2L, Pkdl, TRPP3, polycystin-L Location Chromosome 19: 44,147,637-44,192,442 reverse strand. GRCm38:CM001012.2 About this gene This gene has 2 transcripts (splice variants), 195 orthologues, 10 paralogues, is a member of 1 Ensembl protein family and is associated with 2 phenotypes. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Pkd2l1-201 ENSMUST00000042026.4 3321 760aa ENSMUSP00000045675.4 Protein coding CCDS29846 A2A259 TSL:1 GENCODE basic APPRIS P1 Pkd2l1-202 ENSMUST00000161357.1 3529 No protein - Retained intron - - TSL:2 64.81 kb Forward strand 44.14Mb 44.16Mb 44.18Mb 44.20Mb Contigs AC125101.3 > Genes < Bloc1s2-204protein coding (Comprehensive set... < Bloc1s2-201protein coding < Bloc1s2-203lncRNA < Pkd2l1-201protein coding < Bloc1s2-205lncRNA < Bloc1s2-202lncRNA < Pkd2l1-202retained intron Regulatory Build 44.14Mb 44.16Mb 44.18Mb 44.20Mb Reverse strand 64.81 kb Regulation Legend CTCF Open Chromatin Promoter Promoter Flank Transcription Factor Binding Site Gene Legend Protein Coding Ensembl protein coding merged Ensembl/Havana Non-Protein Coding RNA gene processed transcript Page 7 of 8 https://www.alphaknockout.com Transcript: ENSMUST00000042026 < Pkd2l1-201protein coding Reverse strand 44.81 kb ENSMUSP00000045... Transmembrane heli... PDB-ENSP mappings MobiDB lite Low complexity (Seg) Coiled-coils (Ncoils) Superfamily SSF81324 EF-hand domain pair Prints Polycystic kidney disease type 2 protein Pfam Polycystin cation channel, PKD1/PKD2 PF18109 PROSITE profiles EF-hand domain PANTHER PTHR10877:SF114 PTHR10877 Gene3D 1.10.287.70 1.10.238.10 1.20.5.340 Voltage-dependent channel domain superfamily All sequence SNPs/i... Sequence variants (dbSNP and all other sources) Variant Legend stop gained missense variant synonymous variant Scale bar 0 80 160 240 320 400 480 560 640 760 We wish to acknowledge the following valuable scientific information resources: Ensembl, MGI, NCBI, UCSC. Page 8 of 8.
Load more

Recommended publications
  • Cryo-EM Structure of the Polycystic Kidney Disease-Like Channel PKD2L1
    ARTICLE DOI: 10.1038/s41467-018-03606-0 OPEN Cryo-EM structure of the polycystic kidney disease-like channel PKD2L1 Qiang Su1,2,3, Feizhuo Hu1,3,4, Yuxia Liu4,5,6,7, Xiaofei Ge1,2, Changlin Mei8, Shengqiang Yu8, Aiwen Shen8, Qiang Zhou1,3,4,9, Chuangye Yan1,2,3,9, Jianlin Lei 1,2,3, Yanqing Zhang1,2,3,9, Xiaodong Liu2,4,5,6,7 & Tingliang Wang1,3,4,9 PKD2L1, also termed TRPP3 from the TRPP subfamily (polycystic TRP channels), is involved 1234567890():,; in the sour sensation and other pH-dependent processes. PKD2L1 is believed to be a non- selective cation channel that can be regulated by voltage, protons, and calcium. Despite its considerable importance, the molecular mechanisms underlying PKD2L1 regulations are largely unknown. Here, we determine the PKD2L1 atomic structure at 3.38 Å resolution by cryo-electron microscopy, whereby side chains of nearly all residues are assigned. Unlike its ortholog PKD2, the pore helix (PH) and transmembrane segment 6 (S6) of PKD2L1, which are involved in upper and lower-gate opening, adopt an open conformation. Structural comparisons of PKD2L1 with a PKD2-based homologous model indicate that the pore domain dilation is coupled to conformational changes of voltage-sensing domains (VSDs) via a series of π–π interactions, suggesting a potential PKD2L1 gating mechanism. 1 Ministry of Education Key Laboratory of Protein Science, Tsinghua University, Beijing 100084, China. 2 School of Life Sciences, Tsinghua University, Beijing 100084, China. 3 Beijing Advanced Innovation Center for Structural Biology, Tsinghua University, Beijing 100084, China. 4 School of Medicine, Tsinghua University, Beijing 100084, China.
    [Show full text]
  • Function and Regulation of Polycystin-2 and Epithelial Sodium Channel
    Function and Regulation of Polycystin-2 and Epithelial Sodium Channel by Qian Wang A thesis submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Physiology University of Alberta © Qian Wang, 2016 ABSTRACT Polycystin-2, encoded by the PKD2 gene, is mutated in ~15% of autosomal dominant polycystic kidney disease, and functions as a Ca2+ permeable non-selective cation channel. It is mainly localized on the endoplasmic reticulum membrane, and is also present on the plasma membrane and primary cilium. Polycystin-2 is critical for cellular homeostasis and thus a tight regulation of its expression and function is needed. In Chapter 2, filamin-A, a large cytoskeletal actin-binding protein, was identified as a novel polycystin-2 binding partner. Their physical interaction was confirmed by different molecular biology techniques, e.g., yeast two-hybrid, GST pull-down, and co-immunoprecipitation. Filamin-A C terminal fragment (FLNAC) mediates the interaction with both N- and C- termini of polycystin-2. Functional study in lipid bilayer reconstitution system showed that filamin substantially inhibits polycystin-2 channel activity. This study indicates that filamin is an important regulator of polycystin-2 channel function, and further links actin cytoskeletal dynamics to the regulation of this channel. In Chapter 3, further effect of filamin on polycystin-2 stability was studied using filamin-deficient and filamin-A replete human melanoma cells, as well other human cell lines together with filamin-A siRNA/shRNA knockdown. Filamin-A was found to repress polycystin-2 degradation and enhance its total expression and plasma membrane targeting.
    [Show full text]
  • New Approach for Untangling the Role of Uncommon Calcium-Binding Proteins in the Central Nervous System
    brain sciences Review New Approach for Untangling the Role of Uncommon Calcium-Binding Proteins in the Central Nervous System Krisztina Kelemen * and Tibor Szilágyi Department of Physiology, Doctoral School, Faculty of Medicine, George Emil Palade University of Medicine, Pharmacy, Science, and Technology of Targu Mures, 540142 Târgu Mures, , Romania; [email protected] * Correspondence: [email protected]; Tel.: +40-746-248064 Abstract: Although Ca2+ ion plays an essential role in cellular physiology, calcium-binding proteins (CaBPs) were long used for mainly as immunohistochemical markers of specific cell types in different regions of the central nervous system. They are a heterogeneous and wide-ranging group of proteins. Their function was studied intensively in the last two decades and a tremendous amount of informa- tion was gathered about them. Girard et al. compiled a comprehensive list of the gene-expression profiles of the entire EF-hand gene superfamily in the murine brain. We selected from this database those CaBPs which are related to information processing and/or neuronal signalling, have a Ca2+- buffer activity, Ca2+-sensor activity, modulator of Ca2+-channel activity, or a yet unknown function. In this way we created a gene function-based selection of the CaBPs. We cross-referenced these findings with publicly available, high-quality RNA-sequencing and in situ hybridization databases (Human Protein Atlas (HPA), Brain RNA-seq database and Allen Brain Atlas integrated into the HPA) and created gene expression heat maps of the regional and cell type-specific expression levels of the selected CaBPs. This represents a useful tool to predict and investigate different expression patterns and functions of the less-known CaBPs of the central nervous system.
    [Show full text]
  • Structural Basis for Ca2+ Activation of the Heteromeric PKD1L3/PKD2L1
    ARTICLE https://doi.org/10.1038/s41467-021-25216-z OPEN Structural basis for Ca2+ activation of the heteromeric PKD1L3/PKD2L1 channel ✉ ✉ Qiang Su 1,2,5 , Mengying Chen3,5, Yan Wang4,5, Bin Li4,5, Dan Jing1,2, Xiechao Zhan1,2, Yong Yu 4 & ✉ Yigong Shi 1,2,3 The heteromeric complex between PKD1L3, a member of the polycystic kidney disease (PKD) protein family, and PKD2L1, also known as TRPP2 or TRPP3, has been a prototype for 1234567890():,; mechanistic characterization of heterotetrametric TRP-like channels. Here we show that a truncated PKD1L3/PKD2L1 complex with the C-terminal TRP-fold fragment of PKD1L3 retains both Ca2+ and acid-induced channel activities. Cryo-EM structures of this core hetero- complex with or without supplemented Ca2+ were determined at resolutions of 3.1 Å and 3.4 Å, respectively. The heterotetramer, with a pseudo-symmetric TRP architecture of 1:3 stoi- chiometry, has an asymmetric selectivity filter (SF) guarded by Lys2069 from PKD1L3 and Asp523 from the three PKD2L1 subunits. Ca2+-entrance to the SF vestibule is accompanied by a swing motion of Lys2069 on PKD1L3. The S6 of PKD1L3 is pushed inward by the S4-S5 linker of the nearby PKD2L1 (PKD2L1-III), resulting in an elongated intracellular gate which seals the pore domain. Comparison of the apo and Ca2+-loaded complexes unveils an unprecedented Ca2+ binding site in the extracellular cleft of the voltage-sensing domain (VSD) of PKD2L1-III, but not the other three VSDs. Structure-guided mutagenic studies support this unconventional site to be responsible for Ca2+-induced channel activation through an allosteric mechanism.
    [Show full text]
  • Transcriptional Maturation of the Mouse Auditory Forebrain
    Transcriptional maturation of the mouse auditory forebrain The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Hackett, Troy A., Yan Guo, Amanda Clause, Nicholas J. Hackett, Krassimira Garbett, Pan Zhang, Daniel B. Polley, and Karoly Mirnics. 2015. “Transcriptional maturation of the mouse auditory forebrain.” BMC Genomics 16 (1): 606. doi:10.1186/s12864-015-1709-8. http:// dx.doi.org/10.1186/s12864-015-1709-8. Published Version doi:10.1186/s12864-015-1709-8 Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:21462360 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Hackett et al. BMC Genomics (2015) 16:606 DOI 10.1186/s12864-015-1709-8 RESEARCH ARTICLE Open Access Transcriptional maturation of the mouse auditory forebrain Troy A. Hackett1,8*, Yan Guo4, Amanda Clause2, Nicholas J. Hackett3, Krassimira Garbett5, Pan Zhang4, Daniel B. Polley2 and Karoly Mirnics5,6,7,8 Abstract Background: The maturation of the brain involves the coordinated expression of thousands of genes, proteins and regulatory elements over time. In sensory pathways, gene expression profiles are modified by age and sensory experience in a manner that differs between brain regions and cell types. In the auditory system of altricial animals, neuronal activity increases markedly after the opening of the ear canals, initiating events that culminate in the maturation of auditory circuitry in the brain.
    [Show full text]
  • Transcriptional Profile of Human Anti-Inflamatory Macrophages Under Homeostatic, Activating and Pathological Conditions
    UNIVERSIDAD COMPLUTENSE DE MADRID FACULTAD DE CIENCIAS QUÍMICAS Departamento de Bioquímica y Biología Molecular I TESIS DOCTORAL Transcriptional profile of human anti-inflamatory macrophages under homeostatic, activating and pathological conditions Perfil transcripcional de macrófagos antiinflamatorios humanos en condiciones de homeostasis, activación y patológicas MEMORIA PARA OPTAR AL GRADO DE DOCTOR PRESENTADA POR Víctor Delgado Cuevas Directores María Marta Escribese Alonso Ángel Luís Corbí López Madrid, 2017 © Víctor Delgado Cuevas, 2016 Universidad Complutense de Madrid Facultad de Ciencias Químicas Dpto. de Bioquímica y Biología Molecular I TRANSCRIPTIONAL PROFILE OF HUMAN ANTI-INFLAMMATORY MACROPHAGES UNDER HOMEOSTATIC, ACTIVATING AND PATHOLOGICAL CONDITIONS Perfil transcripcional de macrófagos antiinflamatorios humanos en condiciones de homeostasis, activación y patológicas. Víctor Delgado Cuevas Tesis Doctoral Madrid 2016 Universidad Complutense de Madrid Facultad de Ciencias Químicas Dpto. de Bioquímica y Biología Molecular I TRANSCRIPTIONAL PROFILE OF HUMAN ANTI-INFLAMMATORY MACROPHAGES UNDER HOMEOSTATIC, ACTIVATING AND PATHOLOGICAL CONDITIONS Perfil transcripcional de macrófagos antiinflamatorios humanos en condiciones de homeostasis, activación y patológicas. Este trabajo ha sido realizado por Víctor Delgado Cuevas para optar al grado de Doctor en el Centro de Investigaciones Biológicas de Madrid (CSIC), bajo la dirección de la Dra. María Marta Escribese Alonso y el Dr. Ángel Luís Corbí López Fdo. Dra. María Marta Escribese
    [Show full text]
  • Shaimaa Abdelrazik Hussein
    Functional Characterization of the TRP-Type Channel PKD2L1 by Shaimaa Abdelrazik Hussein A thesis submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Physiology University of Alberta ©Shaimaa Abdelrazik Hussein, 2015 ABSTRACT Polycystic kidney disease (PKD) protein 2 Like 1 (PKD2L1), also called transient receptor potential polycystin-3 (TRPP3), regulates Ca 2+ -dependent hedgehog signalling in primary cilia, intestinal development and sour tasting but with an unclear mechanism. PKD2L1 is a Ca 2+ -permeable cation channel that is activated by extracellular Ca 2+ (on-response) in Xenopus oocytes. PKD2L1, co-expressed with PKD protein 1 Like 3 (PKD1L3) receptor protein, exhibits acid-induced off-response activation (i.e., activation occurs only after the removal of an acidic solution). Whether PKD1L3 participates in acid sensing and what is the exact mechanism of PKD2L1 channel function remain unclear. In Chapter 2, we provided an answer for the first question. By using the two-microelectrode voltage-clamp, site directed mutagenesis, Western blotting, reverse transcriptase-polymerase chain reaction (RT- PCR) and immunofluorescence, we showed that PKD2L1 expressed alone in oocytes exhibits sustained off-response currents in the absence of PKD1L3. PKD1L3 co- expression augmented the PKD2L1 plasma membrane localization but did not alter the observed properties of the off-response. PKD2L1 off-response was inhibited by an increase in intracellular Ca 2+ . We also identified two intra-membrane residues aspartic acid 349 (D349) and glutamic acid 356 (E356) in the third transmembrane domain that are critical for PKD2L1 channel function. Our study suggests that PKD2L1 may itself sense acids and defines off-response properties in the absence of PKD1L3.
    [Show full text]
  • Download Validation Data
    PrimePCR™Assay Validation Report Gene Information Gene Name polycystic kidney disease 2-like 1 Gene Symbol PKD2L1 Organism Human Gene Summary This gene encodes a member of the polycystin protein family. The encoded protein contains multiple transmembrane domains and cytoplasmic N- and C-termini. The protein may be an integral membrane protein involved in cell-cell/matrix interactions. This protein functions as a calcium-regulated nonselective cation channel. Two transcript variants encoding different isoforms have been found for this gene. Gene Aliases PCL, PKD2L, PKDL, TRPP3 RefSeq Accession No. NC_000010.10, NT_030059.13 UniGene ID Hs.159241 Ensembl Gene ID ENSG00000107593 Entrez Gene ID 9033 Assay Information Unique Assay ID qHsaCIP0031731 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENST00000318222, ENST00000338519, ENST00000353274, ENST00000339977 Amplicon Context Sequence CAGTGTCTGATGGAGTATGTAAGAAGAGCTCAGACATCACTTTGGTGTAGTAATA AGCACTGGAGCTTGTCATTCCATAGGTCAGTAGACAGATGTCCACCAGGAACAC AATATATACCAACAGCTCCCTCAGGGTGGTCTTGATATAAAGTTCCCGGTTCTCA GCTGTG Amplicon Length (bp) 140 Chromosome Location 10:102059392-102089053 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 97 R2 0.9991 cDNA Cq 33.12 cDNA Tm (Celsius) 81.5 Page 1/5 PrimePCR™Assay Validation Report gDNA Cq 36.16 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report PKD2L1, Human
    [Show full text]
  • Table S2) Are Shown with the Promoter for CCL18 (Table 1 and Fig
    Supporting Information Canaan et al. 10.1073/pnas.0911676106 SI Text pooled scores from several arrays were averaged for each gene Tissue Culture. The human B cell lymphoma line, BJAB, and the and accepted if Ͼ2 for up-regulated genes or Ͻ0.5 for down- ϩ BJAB/EBNA1 cell lines, were kindly provided by the lab of Elliott regulated genes, because the scores of EBNA1 samples were Kieff (Harvard University). EBNA1 expression phenotype was superimposed on their cell line counterpart. verified by Western blot analysis before these studies and was reconfirmed by QRT-PCR while confirming microarray data. Quantitative Real-Time PCR (QRT-PCR). To verify and evaluate the Excluding the expression of EBNA1 gene, the cell lines in this study cDNA microarray data, samples were run using two independent are EBV-negative cell lines. The human epithelial cell line 293 and RNA preparations for BJAB and one RNA preparation for 293. the 293/EBNA1 were originated at the laboratory of Lawrence S. These samples were then reverse transcribed in triplicate, while Young (Institute for Cancer Studies, University of Birmingham each cDNA was analyzed in a single QRT-PCR. QRT-PCR Medical School, U.K.). reactions were run in ABI PRISM 7000 Sequence Detection System. The following oligo sequence pairs were used in the cDNA-Microarray Slides. The Peter MacCallum Cancer Institute QRT-PCR assays, sequences shown from 5Ј to 3Ј ends: Hs.833: (PMCI) microarrays used in this report contain approximately CAGCTCCATGTCGGTGTCAG and CCAATCTTCTGGGT- 10,500 cDNA clones representing 9,389 unique clones (UniGene GATCTGC; Hs.82396: CTATGCTTGGGAGCGAGGG and build 144) (25).
    [Show full text]
  • Musculoskeletal Aging Reveals That Spine, Hip and Knee Age at Different Rates, and Are Associated with Different Genetic and Non-Genetic Factors
    medRxiv preprint doi: https://doi.org/10.1101/2021.06.14.21258896; this version posted June 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. It is made available under a CC-BY-NC 4.0 International license . Using deep learning to analyze the compositeness of musculoskeletal aging reveals that spine, hip and knee age at different rates, and are associated with different genetic and non-genetic factors Alan Le Goallec1,2, Samuel Diai1, Sasha Collin1, Théo Vincent1, Chirag J. Patel1* 1Department of Biomedical Informatics, Harvard Medical School, Boston, MA, 02115, USA 2Department of Systems, Synthetic and Quantitative Biology, Harvard University, Cambridge, MA, 02118, USA *Corresponding author Contact information: Chirag J Patel [email protected] Abstract With age, the musculoskeletal system undergoes significant changes, leading to diseases such as arthritis and osteoporosis. Due to the aging of the world population, the prevalence of such diseases is therefore expected to starkly increase in the coming decades. While numerous biological age predictors have been developed to assess musculoskeletal aging, it remains unclear whether these different approaches and data capture a single aging process, or if the diverse joints and bones in the body age at different rates. In the following, we leverage 42,000 full body, spine, hip and knee X-ray images and musculoskeletal biomarkers from the UK Biobank and use artificial intelligence to build the most accurate musculoskeletal aging predictor to date (RMSE=2.65±0.01 years; R-Squared=87.6±0.1%).
    [Show full text]
  • Molecular Biology and Basic Research
    Summary of Research Activities by Key Approach and Resource Molecular Biology and Basic Research Over 30 years ago, the introduction of recombinant DNA technology as a tool for basic biological research revolutionized the study of life. Molecular cloning allowed the study of individual genes of living organisms; however, this technique was dependent on obtaining relatively large quantities of pure DNA. This problem was solved by the development of the polymerase chain reaction (PCR), which produced large quantities of a specific DNA sequence from a complex DNA mixture. Because of its simplicity and elegance, PCR transformed the way in which almost all studies requiring the manipulation of DNA fragments were performed. As described by Kary Mullis, who was awarded the Nobel Prize for Chemistry in 1993 for inventing PCR, the technique “lets you pick the piece of DNA you're interested in and have as much as you want.” Because of its simplicity and ability to create hundreds of thousands of copies of a specific DNA sequence of interest, PCR allows for the routine yet highly efficient performance of most major molecular biology techniques including sequencing, cloning, and identifying variations in genes, including gene mutations that cause disease8. Introduction Basic research is a major force driving progress across the biomedical and behavioral sciences, making it possible to understand the causes and progression of disease, intervene to prevent disease from occurring, develop better and more precise diagnostic devices and tests, and discover new treatments and cures. Basic research leads to fundamental insights that, on the surface, might not have an immediate or apparent application to human health, but are essential to understanding basic human biology and behavior in their normal and diseased states.
    [Show full text]
  • Musculoskeletal Aging Reveals That Spine, Hip and Knee Age at Different Rates, and Are Associated with Different Genetic and Non-Genetic Factors
    medRxiv preprint doi: https://doi.org/10.1101/2021.06.14.21258896; this version posted June 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. It is made available under a CC-BY-NC 4.0 International license . NICK JACOBS 7/27/21 JOURNAL CLUB Using deep learning to analyze the compositeness of musculoskeletal aging reveals that spine, hip and knee age at different rates, and are associated with different genetic and non-genetic factors Alan Le Goallec1,2, Samuel Diai1, Sasha Collin1, Théo Vincent1, Chirag J. Patel1* 1Department of Biomedical Informatics, Harvard Medical School, Boston, MA, 02115, USA 2Department of Systems, Synthetic and Quantitative Biology, Harvard University, Cambridge, MA, 02118, USA *Corresponding author Contact information: Chirag J Patel [email protected] Abstract With age, the musculoskeletal system undergoes significant changes, leading to diseases such as arthritis and osteoporosis. Due to the aging of the world population, the prevalence of such diseases is therefore expected to starkly increase in the coming decades. While numerous biological age predictors have been developed to assess musculoskeletal aging, it remains unclear whether these different approaches and data capture a single aging process, or if the diverse joints and bones in the body age at different rates. In the following, we leverage 42,000 full body, spine, hip and knee X-ray images and musculoskeletal biomarkers from the UK Biobank and use artificial intelligence to build the most accurate musculoskeletal aging predictor to date (RMSE=2.65±0.01 years; R-Squared=87.6±0.1%).
    [Show full text]