WO 2017/184082 Al 26 October 2017 (26.10.2017) W !P O PCT

Home , Talin (protein)

(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2017/184082 Al 26 October 2017 (26.10.2017) W !P O PCT

(51) International Patent Classification: 639798 (SG). SOMARAJU, Madhavi Latha; c/o Nanyang A61K 31/712 (2006.01) A61P 35/00 (2006.01) Technological University, 50 Nanyang Avenue, Singapore C12N 15/113 (2010.01) A61P 37/00 (2006.01) 639798 (SG). LOW, Jian Hui; c/o Nanyang Technological University, 50 Nanyang Avenue, Singapore 639798 (SG). (21) International Application Number: KELLEHER, Dermot; c/o The University Of British C o PCT/SG20 17/050221 lumbia, 103-6190 Agronomy Road, Vancouver, BC V6T (22) International Filing Date: 1Z3 Canada and//, c/o Nanyang Technological University, 20 April 2017 (20.04.2017) 50 Nanyang Avenue Singapore 639798 (SG). (25) Filing Language: English (74) Agent: YUSARN AUDREY; 24 Raffles Place, #27-01 Clifford Centre, Singapore 048621 (SG). (26) Publication Language: English (81) Designated States (unless otherwise indicated, for every (30) Priority Data: kind of national protection available): AE, AG, AL, AM, 22 April 2016 (22.04.2016) 10201603208W SG AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, BZ, (71) Applicants: NANYANG TECHNOLOGICAL CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, UNIVERSITY [SG/SG]; 50 Nanyang Avenue, Singa DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, pore 639798 (SG). THE UNIVERSITY OF BRITISH HR, HU, ID, IL, IN, IR, IS, JP, KE, KG, KH, KN, KP, KR, COLUMBIA [CA/CA]; 103-6190 Agronomy Road, Van KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, MG, couver, British Columbia V6T 1Z3 (CA). MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, SC, (72) Inventors: VERMA, Navin Kumar; c/o Nanyang Tech SD, SE, SG, SK, SL, SM, ST, SV, SY,TH, TJ, TM, TN, TR, nological University, 50 Nanyang Avenue, Singapore TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. 639798 (SG). FAZIL, Mobashar Hussain Urf Turabe; c/ o Nanyang Technological University, 50 Nanyang Avenue, (84) Designated States (unless otherwise indicated, for every Singapore 639798 (SG). ONG, Seow Theng; c/o Nanyang kind of regional protection available): ARIPO (BW, GH, Technological University, 50 Nanyang Avenue, Singapore GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, TZ,

(54) Title: A LYMPHOCYTE PERMEATING CHIMERIC OLIGONUCLEOTIDE, METHODS AND USES THEREOF (57) Abstract: The present invention relates to short antisense lymphocyte-permeable Figure 1 locked nucleic acid (LNA)-modified gapmer oligonucleotides that target mRNA encod ing proteins and methods for effectively inhibiting the expression of target proteins in hard-to-transfect lymphocytes such as primary and cultured human T-cells, leading to the 1, r t : v r reduced expression of targeted proteins such as CG-NAP, Talin CD 1 1a, PKCe or Stath- min. In a specific embodiment, said oligonucleotide is used to knockdown the expression of CG-NAP/AKAP450 protein in primary T cells and cutaneous T cell-lymphoma cell line (CTCL); HuT78 and suppressed T-cell migration. The invention is further directed to the use of said LNA-modified oligonucleotides to treat autoimmune diseases and cancers such as lymphomas having Sezary Syndrome or Mycosis Fungoides.

∞ o 00

¾ ϊ ¾ >β Ι o o

[Continued on nextpage] WO 2017/184082 Al llll II II 11III I II I II I II III 111III II I II

UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, LV, MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, KM, ML, MR, NE, SN, TD, TG).

Declarations under Rule 4.17: — as to applicant's entitlement to apply for and be granted a patent (Rule 4.1 7( )) — of inventorship (Rule 4.17(iv)) Published: — with international search report (Art. 21(3)) — with sequence listing part of description (Rule 5.2(a)) A lymphocyte permeating chimeric oligonucleotide, methods and uses thereof

[001 ] . F IELD OF INVENTION

[002]. The present invention generally relates to chimeric oligonucleotide including locked nucleic acids and methods of use in lymphocytes.

[003]. BACKGROUND

[004]. The following discussion of the background to the invention is intended to facilitate an understanding of the present invention. However, it should be

appreciated that the discussion is not an acknowledgment or admission that any of the material referred to was published, known or part of the common general

knowledge in any jurisdiction as at the priority date of the application .

[005]. Lymphocytes are a subtype of white blood cells in all vertebrate immune systems. They can be further divided into T-cells, B-cells and natural Killer cells. T- lymphocytes are the principal effector cells of the adaptive immune system . To better

understand the biology of lymphocytes such as T-cells in health and their role in human diseases such as chronic inflammation, autoimmunity and cancers such as lymphoid cancers, it becomes imperative to perform specific knockdown of target

genes in lymphocytes such as primary T-cells under various experimental conditions.

In addition, specific modulation of T-cell functions by silencing genes of interest in purified T-cell subsets is an attractive approach to augment immunity for cancer adoptive cellular therapies. However, understanding of many intracellular signalling

pathways involved in the regulation of lymphocytes function such as human T-cell functions and development of gene silencing-based immunotherapeutics have been hampered due to problems associated with delivering of inhibitory constructs.

[006]. Post-transcriptional gene silencing holds great promise in discovery research for addressing intricate biological questions and as therapeutics. However, dissection of many intracellular signaling pathways involved in the regulation of human lymphocytes such as T-cell functions has been hampered due to problems associated with delivering of inhibitory constructs. While various gene silencing approaches, such as siRNA and CRISPR-Cas9 techniques, are available, these cannot be effectively applied to "hard-to-transfect" lymphocytes such as primary T- lymphocytes. CRISPR-Cas9 causes knockout at the genomic DNA level in nucleus. In some cases, mammalian cells respond similarly to knockdown or knockout, but in others there may be significant differences in phenotypes that result from transient silencing of gene expression compared to complete null genotype.

[007]. The RNA interference (RNAi) is an evolutionarily conserved gene silencing mechanism, and this technique is increasingly used for targeted post-transcriptional gene silencing in a diverse range of primary and cultured mammalian cells. Use of methods such as RNAi has been employed for targeted gene silencing in a diverse range of primary and cultured mammalian cells. However, the exploitation of this powerful tool for biological/ molecular research or for therapeutic purposes in lymphocytes such as T-cells has been hampered by the fact that lymphocytes are conventionally "hard-to-transfect" (Yin et al., J. Immunol. Methods 3 1 , 1- 11, 2006), that is lymphocytes are resistant to transfection reagents (e.g. cationic lipids and polymers) and also possibly they lack efficient RNAi machinery (Oberdoerffer et al., Mol. Cell Biol, 25, 3896-3905, 2005).

[008]. Antisense molecules or small interfering RNA (siRNA) can be transduced into lymphocytes such as T-cells by electroporation or nucleofection in vitro (Freeley et al., J. Immunol. Methods 396, 116-1 27, 201 3 ; Mantei et al., Eur. J. Immunol. 38, 261 6-2625, 2008), but the high electrical pulses that are applied to transiently permeabilize the cell membrane in these methods typically result in significant loss of cell viability. Other gene silencing techniques that have been applied in lymphocytes such as T-cells include viral-, nanoparticle- and aptamer-based interfering RNA delivery systems (Sakib Hossain et al. , Ther. Deliv. 6 , 1-4, 201 5) and Accell-modified siRNAs (Freeley et al. , J. Biomol. Screen , 20, 943-956, 201 5), but the above methods yield low transfection efficiency. In addition, siRNAs and CRISPR-Cas9 have poor stability and/or can have off-target effects (Jackson et al., Nat. Rev. Drug Discov. 9 , 57-67,201 0), and/or may trigger an unwanted immune response

(Whitehead et al., Annu . Rev. Chem . Biomol. Eng. 2 , 77-96, 201 1) .

[009]. Nucleotides are known to stimulate the immune system and can initiate lymphoproliferative response. It is for this reason that organ transplant recipients are often given a nucleotide free diet during transplantation and recovery (Van Buren C. et al. Transplant Proc. 19-57(9), 1987). As lymphocytes are primarily involved with the immune system this appears to make them unsuitable for gene silencing mechanisms that involve nucleotides such siRNA. [001 0]. Moreover, gene silencing based on siRNA uses double-stranded RNA (dsRNA), which has been shown to cause interferon-induced non-specific RNA degradation (Elbashir et. al. , Nature 4 11,494-498, 2001 ) . The interferon-induced off- target cellular response usually reduces the specific gene silencing effects of siRNA and may cause cytotoxic killing effects to the transfected cells. In mammalian cells, it has been noted that siRNA-mediated gene silencing is repressed by the interferon- induced RNA degradation when the dsRNA size is larger than 30 base-pairs or its concentrations are more than 10 nM (Elbashir et. al., 2001 ) . The above limitations are critical to the use of siRNA for therapeutic purposes. Furthermore, it is practically difficult to deliver siRNA molecule in vivo due to the high RNase activities of subjects.

[001 1] . . Various strategies have been suggested to check the potential off-target effects of gene silencing, such as in silico prediction, gene expression analysis and rescue experiments (Jackson et al., Nat. Rev. Drug Disc. 9 , 57-67, 201 0). However, these methods are only partially effective and have as-yet unproven efficacies on a genome-wide scale (Jackson et al. 201 0).

[001 2]. Locked nucleic acid (LNA)-conjugated chimeric single-strand antisense oligonucleotides called 'GapmeR' are an emerging new class of molecules, which can knockdown a target gene of interest with precise specificity through a post- transcriptional gene silencing mechanism (Stein et al., Nucleic Acids Res. 38, e3, 201 0; Nishina et al. , Nat. Commun. 6 , 7969,201 5). Typically, these molecules contain 2-5 chemically modified LNA residues as 'wings' at each terminus flanking a central 'gap' of 5-1 0 base single- strand antisense DNA. The combination of both chemistry and structural modifications provide the modified GapmeR-oligonucleotides with high binding affinity for the target mRNA, confers resistance to nucleases imparting improved stability in biological serum and cell culture medium , (Kurreck et al. , Nucleic

Acids Res. 30, 19 1 1- 19 18 , 2002; Straarup et al., Nucleic Acids Res. 38, 7 100-71 11, 201 0). Once the GapmeR-oligonucleotide construct enters the cell , the central antisense DNA stretch of the construct binds to the endogenous mRNA resulting in a DNA:m RNA duplex. The DNA:m RNA duplex is recognized by the cellular enzyme RNase H , which degrades the targeted mRNA and thus inhibits specific gene expression (Stein et al. , 201 0; Soiferet et al. , Methods Mol. Biol. 8 15 , 333-346, 201 2).

[001 3]. Reversibly inhibiting the expression of proteins of interest in lymphocytes such as T-cells would have important implications for functional studies, as well as for developing novel approaches to treat immune-mediated and many other diseases, such as cancer, cardiac, gastric and dermatological diseases.

[001 4]. There is a need for a reliable and/or effective method for down-regulating target gene expression in lymphocytes such as primary and cultured human T-cells, which are among the hard-to transfect cell types. In particular, there is a need for a cell friendly method that is non-cytotoxic and/or easy to deliver.

[001 5]. There is a need for alternative methods and molecules to ameliorate at least one of the problems mentioned above.

[001 6]. SUMMARY

[001 7]. It is an object of the present invention to provide a lymphocyte permeating chimeric oligonucleotide and methods of using the chimeric oligonucleotides to inhibit protein expression in a lymphocyte.

[001 8]. Accordingly, an aspect of the invention includes a lymphocyte permeating chimeric oligonucleotide for inhibiting protein expression in a lymphocyte comprising a sequence of formula I:

Ln-Xm-Lo,

Wherein L comprises a locked nucleic acid;

X comprises a sequence of a deoxyribonucleic acids complementary to a section of a target messenger ribonucleic acid ; n and o are independently 2 or 3 ; and m is 8 to 10 .

[001 9]. Another aspect of the invention includes use of a lymphocyte permeating chimeric oligonucleotide comprising a sequence of formula I:

Ln-Xm-Lo,

Wherein L comprises a locked nucleic acid;

X comprises a sequence of a deoxyribonucleic acids complementary to a section of a target messenger ribonucleic acid ; n and o are independently 2 or 3 ; and m is 8 to 10 , for inhibiting protein expression of the target messenger ribonucleic acid in a lymphocyte.

[0020]. Another aspect of the invention includes a method for inhibiting protein expression in a lymphocyte comprising ; providing to the lymphocyte a lymphocyte permeating chimeric oligonucleotide comprising a sequence of formula I:

Ln-Xm-Lo,

Wherein L comprises a locked nucleic acid;

X comprises a sequence of a deoxyribonucleic acids complementary to a section of a target messenger ribonucleic acid ; n and o are independently 2 or 3 ; and m is 8 to 10 , whereby the lymphocyte permeating chimeric oligonucleotide binds to the complementary section of target messenger ribonucleic acid thereby inhibiting protein expression of the target messenger ribonucleic acid.

[0021 ] . Another aspect of the invention includes a process for inhibiting lymphocyte migration comprising ; providing to the lymphocyte a lymphocyte permeating chimeric oligonucleotide comprising a sequence of formula I:

Ln-Xm-Lo,

Wherein L comprises a locked nucleic acid;

X comprises a sequence of a deoxyribonucleic acids complementary to a section of a target messenger ribonucleic acid ; n and o are independently 2 or 3 ; and m is 8 to 10 ; and inhibiting expression of the target messenger ribonucleic acid, wherein the target messenger ribonucleic acid expresses a protein involved in lymphocyte migration.

Another aspect of the invention includes use of a lymphocyte permeating chimeric oligonucleotide comprising a sequence of formula I:

Ln-Xm-Lo,

Wherein L comprises a locked nucleic acid;

X comprises a sequence of a deoxyribonucleic acids complementary to a section of a target messenger ribonucleic acid ; n and o are independently 2 or 3 ; and m is 8 to 10 in the manufacture of a medicament for the treatment of an immune- mediated disease, preferably autoimmune disease.

Another aspect of the invention includes use of a lymphocyte permeating chimeric oligonucleotide comprising a sequence of formula I:

Ln-Xm-Lo,

Wherein L comprises a locked nucleic acid;

[0022]. Other aspects of the invention will become apparent to those of ordinary skill in the art upon review of the following description of specific embodiments of the invention in conjunction with the accompanying figures.

[0023]. BRI EF DESCRI PTION OF DRAWINGS

[0024]. The present invention will now be described, by way of illustrative example only, with reference to the accompanying drawings, of which : [0025]. Figure 1: Schematic representation of the chimeric oligonucleotide design , cellular internalization leading to specific gene silencing, including chimeric oligonucleotide structure, experimental work-flow for chimeric oligonucleotide gymnotic delivery, cellular uptake mechanism and gene silencing in human T-cells.

[0026]. Figure 2 : Primary human T-cells were incubated with 100 nM, 250 nM or 500 nM non-targeting FAM-oligonucleotides for 6 h , 24 h, 48 h or 72 h and then their cellular uptake was analysed by flow cytometry. (A) Results show dose- and time- dependent cellular internalization of oligonucleotides. (B) Both primary human T-cells and HuT78 cells were incubated separately with 500 nM FAM-GapmeR for up to 72 h and GapmeR cellular uptake was analysed by flow cytometry. Results (mean ± SEM) showed comparable rate of GapmeR internalization in HuT78 and primary T-cells. (C) flow cytometry analysis.

[0027]. Figure 3 : HuT78 T-cells were incubated with 10 nM, 50 nM, 100 nM, 250 nM or 500 nM FAM-GapmeR oligonucleotides to allow direct uptake (A) or transfected through nucleofection (B) After 48 h , oligonucleotide cellular uptake was analysed by flow-cytometry. Results show dose-dependent cellular internalization of GapmeR oligonucleotides. (C) In separate studies, HuT78 T-cells were transfected with 500 nM FAM-GapmeR by direct uptake or nucleofection for 6 h, 24 h , 48 h or 72 h and oligonucleotide cellular uptake was analysed by flow cytometry. Data represent at least three independent experiments.

[0028]. Figure 4 : Both primary human T-cells and HuT78 cells were incubated separately with 500 nM FAM-GapmeR to allow cellular internalization for up to 72 h . Oligonucleotide cellular uptake was analysed by flow cytometry. Results show comparable rate of oligonucleotide cellular targeting in HuT78 and primary human T- cells.

[0029]. Figure 5 : Primary human T-cells (A) or HuT78 cells (B-C) were incubated with 500 nM FAM-GapmeR oligonucleotides to allow their direct cellular uptake (A-B) or transfected through nucleofection (C). After 48 h , cells were fixed and counter stained with Phalloidin-Rhodamine (to visualize cells, red) and Hoechst (to visualized nuclei , blue). Oligonucleotide cellular localization was analysed by Zeiss 7 10 confocal microscope, 63X oil objective. Images clearly show cytoplasmic and nuclear localization of FAM-GapmeR. [0030]. Figure 6 : Time-dependent cellular localization of GapmeR-oligonucleotides in primary human T-cells (left panel) or HuT78 T-cells (right panel) delivered through direct uptake was quantified by HCA and presented. Data represent at least three independent experiments. Differences in nuclear/cell intensities between 24 h and 48 h treatments were non-significant (Λ/S) ; * p < 0.05.

[0031 ] . Figure 7 : (A) Primary human T-cells were incubated with 1 µΜ non-targeting GapmeR-oligonucleotides to allow direct cellular uptake or transfected by nucleofection . After 48 h , percentage cell viability was determined and presented (mean ± SD). Data represent at least three independent experiments. * p < 0.05 with respect to corresponding controls. (B-E) Human primary T-cells were incubated with 100, 250 or 500 nM non-targeting GapmeR for 24 h . Cells were left untreated {NT) or treated with phytohemagglutinin (PHA) as negative and positive controls. After centrifugation, supernatant culture media were collected and secreted levels of cytokines IL-2 (B), IL-4 (C), IL-5 (D) and IFN-γ (E) were analysed by ELISA. Data (mean ± SEM) represent three independent experiments using T-cells purified from at least 3 different donors, * p < 0.05.

[0032]. Figure 8 : Effect of endocytosis inhibitors on GapmeR cellular internalization in human T-cells. Primary human T-cells were untreated (A, control) or pre-treated with amiloride [0.5 mM (B), 1.0 mM (C), 2.0 mM (D), 3.0 mM (E), 4.0 mM (F) or 5.0 mM (G)], 1 µ g/ml filipin (H), 10 µ M chlorpromazine (I), 10 mM cytochalasin D (J) for 30 min. Cells were then incubated with 500 nM FAM-GapmeR for 24 h to allow gymnosis. Cellular internalization of GapmeR was analysed by flow cytometry. Results show dose-dependent inhibition of FAM-GapmeR cellular uptake in cells treated with amiloride (K) but not with other three inhibitors. Data represent at least three independent experiments using T-cells purified from at least 3 different donors, * p < 0.05.

[0033]. Figure 9 : Super-resolution microscopy of GapmeR co-localization with SNX5 in human T-cells. HuT78 T-cells were incubated with 500 nM non-targeting FAM- GapmeR (green) for 6 h, fixed and counter-stained with manti-SNX5/Alexa Fluor® 568 (red) and Phalloidin-Alexa Fluor® 647 (light blue) and imaged by super- resolution microscopy. Insets (middle and right panels) are zoomed-in images and arrows show clear co-localization of GapmeR with SNX5.

[0034]. Figure 10 : GapmeR-mediated gene silencing in human primary T-cells. Primary human T-cells were incubated separately with 500 nM GapmeR targeted against CG-NAP, Talinl , CD1 1a , PKCE, Stathmin or control non-targeting (NT)

GapmeR for 48 h . (A) The mRNA levels of CG-NAP, Talinl , CD1 1a , PKCE or Stathm in were analysed by RT-qPCR. Data are fold change relative to GAPDH

(mean ± SEM) of three independent experiments performed in triplicates. *p < 0.05 with respect to corresponding controls. (B) Cells were lysed and cellular lysates were analysed for the expression of above-mentioned proteins by Western immunoblotting. All the blots were re-probed with GAPDH as a loading control.

Relative densitometric analysis of the individual protein band in terms of % knockdown is presented. Data (mean ± SEM) represent at least three independent experiments using T-cells purified from at least 3 different donors, *p < 0.05 with respect to corresponding controls. (C) The specificity of GapmeR-mediated knockdown in primary T-cells was determined by nanoString gene expression analysis. The scattered plot shows correlation between the expression levels of individual gene in GapmeR treated samples versus untreated control.

[0035]. Figure 11: (A) HuT78 T-cells were incubated with 500 nM antisense GapmeR-oligonucleotides targeted against CG-NAP/AKAP450 (CG-NAP GapmeR-3) or non-targeting control to allow direct cellular uptake for 24 or 48 h . Cells were then lysed and cellular lysates were analysed for the expression of CG-NAP/AKAP450 by Western immunobloting. (B) Non-targeting or CG-NAP-targeting antisense GapmeR- oligonucleotide construct or siRNA (500 nM each) was delivered to HuT78 cells through nucleofection or direct cellular uptake. After 48 h, cells were lysed and cellular lysates were analysed for the expression of CG-NAP/AKAP450 by Western immunobloting. (C) Primary human T-cells were incubated with 500 nM non-targeting control GapmeR-oligonucleotides, CG-NAP targeting antisense oligonucleotide GapmeR-3 or siRNA targeted against CG-NAP to allow direct cellular uptake through pinocytosis for 24 or 48 h . Cells were then lysed and cellular lysates were analysed for the expression of CG-NAP/AKAP450 by Western immunobloting. All the blots were separately re-probed with GAPDH as a loading and specificity control . Data represent at least three independent experiments.

[0036]. Figure 12 : Functional effect of GapmeR-mediated gene silencing of CG-NAP,

Talin l , CD1 1a , PKCE or Stathmin on T-cell migration. (A) Control or GapmeR treated primary human T-cells (2 χ 104 cells in 100 µ I medium) were loaded in triplicates onto rlCAM-1 -Fc pre-coated 96-well tissue culture plates and allowed to migrate at

37 ° for 4 h . Resting T-cells were incubated on poly L-lysine (PZ-^-coated plates and cells pretreated with nocodazole were used as migration inhibitory control. T-cell migratory phenotypes were then automatically quantified using HCA system (cell 1/form-factor) and presented as a heatmap. (B) Control or GapmeR treated primary human T-cells ( 1 χ 105 cells in 100 µ I medium) were loaded in triplicates onto the upper chamber of rlCAM-1 -Fc pre-coated CIM-Plate 16 transwell inserts. T-cell transwell migration towards SDF-1 a enriched medium was automatically recorded in real-time at every 5 min interval for up to 6 h using an impedance-based detection system and quantified as "Baseline Cell Index". Data represent at least three independent experiments using T-cells purified from at least 3 different donors.

[0037]. Figure 13 : Cells ( 1 χ 105 cells in 100 µ Ι medium) were loaded in triplicates onto the upper chamber of rlCAM-1 -Fc pre-coated C IM-Plate 16 transwell inserts. T- cell transwell migration through the membranes towards SDF-1 a enriched medium was automatically recorded in real-time every 5 min interval for up to 12 h using an impedance-based detection system and quantified as "Baseline Cell Index". Data are representative of three independent experiments (mean ± SD). *p < 0.05 with respect to corresponding controls.

[0038]. Figure 14 : Western immunoblot analysis for the relative expression of

AKAP450/CG-NAP protein in various immune cell subtypes, monocytes, NK-cells, B- cells, CD4 + T-cells, CD8 + T-cells, activated PBL T-cells and HuT78 T-cell line. GAPDH was used as a loading control.

[0039]. Figure 15 : (A) HuT78 T-cells (untreated control) were treated with non specific (NS) GapmeR or AKAP450/CG-NAP-targeting GapmeR for 48 h and lysed. Cellular lysates were analysed by Western immunoblotting for the knockdown of AKAP450/CG-NAP. GAPDH was used as a loading control. Bar graph was obtained by densitometric analysis of the Western blots for AKAP450/CG-NAP vs GAPDH (Mean ± S.D. , n=4 independent experiments; ***p<0.001 . (B) Under similar conditions of knockdown , HuT78 cells were seeded on poly-l-lysine (PLL, resting control) or on rlCAM-1 -coated 96-well plates. Cells were fluorescently stained with Rhodamine-Phallodin (red), Alexa Fluor 488 conjugated anti-a-tubulin (green) and Hoechst 33342 (blue), imaged using an automated microscope. T-cell migratory phenotypes were analysed by HCA. Data is representative of three independent experiments, bar diagram is Mean ± S.D., ***p<0.001 . (C) Migratory potential of control and AKAP450/CG-NAP knockdown (KD) PBL T-cells towards the chemokine SDF-1 a was examined in real-time by trans-well migration assay using xCELLigence monitoring system. Cells migration without SDF-1 a was taken as control.

[0040]. Figure 16 : (A,B) Western blots and densitometry bar graphs show that knockdown of AKAP450/CG-NAP causes decrease in the expression levels of pericentrin, γ-tubulin, GM1 30 and TGN46 proteins. Data represent Mean ± S.D from three independent experiments. * * p<0.01 .

[0041 ] . Figure 17 : AKAP450/CG-NAP knockdown in T-cells interferes with a-tubulin post-translational modifications. Control and AKAP450/CG-NAP knockdown (CG- NAP KD) HuT78 T-cells were either unstimulated (resting) or stimulated via LFA- 1/ICAM-1 for 1 h (LFA-1 -stimulated) and fixed. Cells were co-immunostained with antibodies against CG-NAP/AKAP450 (red) and acetylated- a-tubulin (green) and analysed by confocal microscopy. Scale bar: 5 µιη .

[0042]. Figure 18 : Analysis of PKA substrates in T-cells. (A) HuT78 cells were serum starved for 4 h and then treated with DMSO (control) or 30 µΜ forskolin for 30 min and lysed. Protein lysates were immunoprecipitated (IP) using either phospho-PKA substrate antibody (p-PKA substrate) or control IgG. Immunoprecipitates were resolved on SDS-PAGE and subjected to Western blotting with anti-AKAP450/CG- NAP, pericentrin and dynein antibodies. (B) Unstimulated (ICAM-1 ) or LFA-1 - stimulated (+ICAM-1 , 1 h stimulation) HuT78 cells were lysed and protein lysates were immunoprecipitated using either anti-PKARI Ia antibody or control IgG. Immunoprecipitates were resolved on SDS-PAGE and subjected to Western blotting with anti-PKARI Ia, pericentrin and dynein antibodies. (C) Control or AKAP450/CG- NAP knockdown (KD) HuT78 cells were treated with 30 µΜ forskolin for 30 min and protein lysates were immunoprecipitated using either phospho-PKA substrate antibody or control IgG. Immunoprecipitates were resolved on SDS-PAGE and subjected to Western blotting with anti-pericentrin and anti-dynein antibodies. Data represent at least three independent experiments. Whole cell lysates (WCL, 10 µg each) were used as input controls for Western immunoblots; gel lanes indicated by "X" are empty lanes, i.e. no protein loaded.

[0043]. Figure 19 : A schematic representation of the mechanism by which AKAP450/CG-NAP serves as a docking platform for PKA signalling and regulates microtubule nucleation in migrating T-cells including regulation of centrosomal and non-centrosomal microtubule architecture in motile T-cells. [0044]. The accompanying drawings are not to be understood as superseding the generality of the preceding description of the invention .

[0045]. DETAILED DESCRI PTION

[0046]. It is demonstrated herein that specifically designed antisense oligonucleotide constructs are able to penetrate human primary T-cells in the absence of transfection reagents or electroporation and perform target gene silencing with precise specificity.

This invention is also directed to gene silencing-based functional screening in T-cells or other lymphocyte cells and for translational outcomes. The identified oligonucleotide antagonist compounds could be useful for developing therapeutic approaches for several human diseases where the expression of specific proteins is up-regulated in lymphocytes such as T-cells.

[0047]. Disclosed, is a method wherein specifically designed antisense oligonucleotides can efficiently penetrate lymphocytes such as human primary and cultured T-cells without any transfection reagents or electroporation and perform target gene silencing with precise specificity. Until the present disclosure, high-affinity modifications of short cell-permeable antisense oligonucleotide compounds for modulating the expression of target proteins have not been reported in human T- cells. The present disclosure demonstrates that specifically designed compounds comprising high-affinity nucleotide modifications containing short antisense constructs of 8-1 0 nucleotide bases in length conjugated with 3-bases of locked nucleic acids at both the terminus (called GapmeR) are surprisingly able to effectively penetrate lymphocytes, both primary human T-cells and the T-cell line HuT78. The present disclosure also demonstrates the cellular targeting of modified GapmeR- oligonucleotides applied directly to T-cells (without the use of any transfecting reagent) is comparable to that transfected through the nucleofection technique.

[0048]. Accordingly, an aspect of the invention includes a lymphocyte permeating chimeric oligonucleotide for inhibiting protein expression in a lymphocyte comprising a sequence of formula I:

Ln-Xm-Lo,

Wherein L comprises a locked nucleic acid; X comprises a sequence of a deoxyribonucleic acids complementary to a section of a target messenger ribonucleic acid ; n and o are independently 2 or 3 ; and m is 8 to 10 .

[0049]. Despite the difficulty of using nucleotide based mechanisms to silence protein expression in lymphocytes the chimeric oligonucleotide described herein were able to permeate lymphocytes and inhibit protein expression of several target proteins. Without being limited to any theory it is speculated that the modification of the nucleic acids in forming the locked nucleic acid at both ends of the oligonucleotide minimizes any immune response or lymphoproliferative response.

[0050]. As used herein the term lymphocyte permeating chimeric oligonucleotide refers to an oligonucleotide that is able to permeate or enter a lymphocyte. Preferably the oligonucleotide is able to permeate or enter a lymphocyte passively in a naked state without the use of physical or chemical stimulation of the lymphocyte that is traditionally used to enhance permeability of the lymphocyte. In various embodiments the chimeric oligonucleotide permeates or enters a lymphocyte via pinocytosis. In various embodiments the lymphocyte permeating chimeric oligonucleotide is referred to as a GapmeR. In various embodiments the lymphocyte permeating chimeric oligonucleotide is made by any nucleic acid synthesising method known in the art including with a DNA synthesizer such as a Pharmacia DNA synthesizer. The lymphocyte permeating chimeric oligonucleotide is a better alternative to the conventional siRNA-based gene knockdown and can be applied to various other hard-to-transfect lymphocytes.

[0051 ] . As used herein a locked nucleic acid (LNA) refers to a nucleoside analogue with a modified ribose used in the formation of synthetic oligonucleotides. Methods of synthesising LNA with bicyclonucleoside immobilized conformation of the ribose are known in the art. Examples of synthesising LNA nucleoside analogue including guanidine, thymine, adenine, cytosine uridine or derivatives thereof can be found in the art. Any method known in the art for forming LNA may be used in for synthesising the LNA used in the chimeric oligonucleotide described herein. In various embodiments the LNA may include any one of the following; ( 1 S, 3R, 4R, 7S) - 7- hydroxy-1 -hydroxymethyl-2,5-dioxabicyclo[2.2. 1]heptane uracil ; ( 1S, 3R, 4R, 7S)-7- hydroxy-1 -hydroxymethyl-(thymin-1 -yl)-2,5-dioxabicyclo[2.2. 1]heptane; ( 1 S, 3R, 4R, 7S-7-hydroxy-1 -hydroxymethyl-2,5-dioxabicyclo[2. .1]heptane thymine; ( 1 S, 3R, 4R,

7S-7-hydroxy-1 -hydroxymethyl-2,5-dioxabicyclo[2.2. 1]heptane adenine; ( 1 S, 3R, 4R, 7S-7-hydroxy-1 -hydroxymethyl-2,5-dioxabicyclo[2.2. 1]heptane cytosine;(1 S, 3R, 4R,

7S-7-hydroxy-1 -hydroxymethyl-2,5-dioxabicyclo[2.2. 1]heptane guanidine; ( 1 R , 3R, 4S, 7S)-7-hydroxy-1 -hydroxymethyl-3-(thymin-1 -yl)-2,5-dioxabicyclo[2.2.1 ]heptane;

( 1 R , 3R, 4S, 7S)-7-hydroxy-1 -hydroxymethyl-3-(2-N-isobutyrylguanin-9yl)-2,5- dioxabicyclo[2.2. 1]heptane; ( 1 R , 3R, 4S, 7S)-7-hydroxy-1 -hydroxymethyl-3-(6-N- benzoyladenin-9-yl)-2,5-dioxabicyclo[2.2. 1]heptane; ( 1S, 3R, 4R, 7S)-7-Benzyloxy-1 - methanesulfonyloxymethyl-3-(6-N-benzoyl-adenine-9-yl)-2,5- dioxabocyclo[2.2. 1]heptane; ( 1 R,3R, 4R, 7S)-3-(6-N-Benzoyladenine-9-yl)-1 -(4,4'-

Dimethoxytrityloxymethyl)-7-Hydroxy-2,5-dioxabicyclo[2.2.1 ]heptane; ( 1S, 3R, 4R, 7S)-7-Benzyloxy-1 -hydroxymethyl-3-(adenine-9-yl)-2,5-dioxabicyclo[2.2. 1]heptane; or any other LNA known in the art.

[0052]. As used herein the term complementary refers to an anti-sense strand whereby under normal physiological conditions each base will hybridise to a section of the target mRNA. Generally a nucleic acid containing an adenine base or derivative thereof will hybridise to a nucleic acid containing either a thymine base or derivative thereof or a uridine base or derivative thereof. Similarly, a nucleic acid containing a cytosine base or derivative thereof will hybridise to a nucleic acid containing a guanidine base or derivative thereof.

[0053]. In various embodiments there are no miss matched bases between the complementary sequence of deoxyribonucleic acids and the section of the target mRNA however provided the chimeric oligonucleotide is able to bind to the section of the target mRNA it may be possible to have one or more mismatched bases between the complementary sequence of deoxyribonucleic acids and the section of the target mRNA.

[0054]. As used herein the term target refers to a protein target that is to be inhibited and a target messenger ribonucleic acid (m RNA) is the messenger RNA that translates into the expression of the target or protein target. A gene or polynucleotide is said to "encode" a target polypeptide or protein target if, in its native state or when manipulated by methods well known to those skilled in the art, it can be transcribed and/or translated to produce the target mRNA for and/or the target polypeptide or protein target thereof. The complementary sequence of deoxyribonucleic acids or anti-sense strand in this case is the complement of a section of such an mRNA nucleic acid sequence, and can be deduced therefrom or from the gene or polynucleotide that transcribes the mRNA or from the polypeptide or protein expressed or translated by the mRNA. In various embodiments the section of the target mRNA may be selected to achieve high target affinity, or to be specific, or for biological stability such as a conserved region, or a combination of all of these and other properties of the target protein .

[0055]. Here, it is demonstrated that the chimeric oligonucleotide internalize into lymphocytes such as human primary T-cells through macropinocytosis-like endocytic mechanism i.e. in the absence of transfection reagents or electroporation . Internalized chimeric oligonucleotide molecules can associate with SNX5-positive macropinosomes in lymphocytes such as T-cells, as detected by super-resolution microscopy. The present disclosure also demonstrates a novel mechanism by which the chimeric oligonucleotide internalize into lymphocytes such as T-cells, called pinocytosis. The present disclosure also demonstrates that the gene silencing method described in the present invention can be utilized to knockdown any genes of interest with precise specificity in diverse range of lymphocytes including primary as well as cultured lymphocytes, in addition to T-cells, for therapeutic purposes. A wide range of specifically designed chimeric oligonucleotide could silence target genes of interest in human primary T-cells with precise specificity and high efficiency.

[0056]. In various embodiments a 5 prime end of the lymphocyte permeating chimeric oligonucleotide comprises a locked nucleic acid with an adenine base or derivative thereof.

[0057]. In various embodiments a 3 prime end of the lymphocyte permeating chimeric oligonucleotide comprises a locked nucleic acid with an adenine base or derivative thereof.

[0058]. In various embodiments the locked nucleic acid with an adenine base or derivative thereof may be selected from any one of ( 1 S, 3R, 4R, 7S-7-hydroxy-1 - hydroxymethyl-2,5-dioxabicyclo[2.2. 1]heptane adenine; ( 1 R , 3R, 4S, 7S)-7-hydroxy-

1-hydroxymethyl-3-(6-N- benzoyladenin-9-yl)-2,5-dioxabicyclo[2.2. 1]heptane; ( 1 S, 3R, 4R, 7S)-7-Benzyloxy-1 -methanesulfonyloxymethyl-3-(6-N-benzoyl-adenine-9-yl)-

2,5-dioxabocyclo[2.2.1 ]heptane; ( 1 R,3R, 4R, 7S)-3-(6-N-Benzoyladenine-9-yl)-1 -

(4,4'-Dimethoxytrityloxymethyl)-7-Hydroxy-2,5-dioxabicyclo[2.2. 1]heptane; ( 1S, 3R, 4R, 7S)-7-Benzyloxy-1 -hydroxymethyl-3-(adenine-9-yl)-2,5- dioxabicyclo[2.2. 1]heptane; or any other LNA with an adenine base or derivative thereof known in the art

[0059]. It was observed that the chimeric oligonucleotides that had one or more locked nucleic acid with an adenine base or derivative thereof at either the 5' or 3' ends of the oligonucleotide demonstrated an enhanced uptake of the chimeric oligonucleotides and was able to better inhibit protein expression of the target. Without being limited to any theory it is speculated that as pinocytosis is an ATP dependent process that a locked nucleic acid with an adenine base or derivative thereof may initiate the process of pinocytosis by somewhat mimicking an ATP. At least two GapmeR designs were generated for each of the five target genes selected for silencing in this study. It is of general consensus that some of the antisense sequences work better than others in gene silencing, depending on the regions and accessibility of the target mRNA. In this regard, at least two GapmeR designs located in distinct regions of the target gene were chosen and tested separately. The flow cytometry and an automated microscopy-based high content analysis data confirm that fluorescently-labelled non-targeting GapmeR molecules internalize effectively into mammalian cells, including human primary T cells, depending on concentration and time (reaching nearly 100% efficiency) . Some of the GapmeR designs in this study did not work as well as others (data not shown).

[0060]. In various embodiments the sequence of formula I is any one of the nucleic acid sequences selected from the group identified by SEQ ID NOS. 1 to 10 .

[0061 ] . In various embodiments SEQ ID NO. 1 is ACTAGCCTGTAATTG and is complementary to a section of the mRNA translating the CG-NAP/AKAP450 protein .

[0062]. In various embodiments SEQ ID NO. 2 is GGATGCAATGCTCTTA and is complementary to a section of the mRNA translating the CG-NAP/AKAP450 protein .

[0063]. In various embodiments SEQ ID NO. 3 is TTGGCAGTAGGATTGG and is complementary to a section of the mRNA translating the Tailinl protein .

[0064]. In various embodiments SEQ ID NO. 4 is CAGAGTGTCAAAGTCA and is complementary to a section of the mRNA translating the Tailinl protein .

[0065]. In various embodiments SEQ ID NO. 5 is GATGGTAGTGGCTGAG and is complementary to a section of the mRNA translating the CD1 1a protein. [0066]. In various embodiments SEQ ID NO. 6 is ACGTCAATCATTAAAC and is complementary to a section of the mRNA translating the CD1 1a protein.

[0067]. In various embodiments SEQ ID NO. 7 is TAGGATGAAACTGGAA and is complementary to a section of the mRNA translating the ΡΚΟε protein.

[0068]. In various embodiments SEQ ID NO. 8 is and is AAGCAGCAGTAGAGTT complementary to a section of the mRNA translating the ΡΚΟε protein.

[0069]. In various embodiments SEQ ID NO. 9 is AGGTAATCAATGCAGA and is complementary to a section of the mRNA translating the Stathmin protein.

[0070]. In various embodiments SEQ ID NO. 10 is AGGTAATCATTGCAGA and is complementary to a section of the mRNA translating the Stathmin protein.

[0071 ] . The sequence of the DNA antisense and the flanking LNAs can be carefully designed using available gene sequence database and bioinformatics tools to achieve high target affinity, sequence specificity, biological stability, and favourable pharmacokinetic and tissue-penetrating properties. The present disclosure demonstrates that carefully designed antisense chimeric-oligonucleotide constructs targeted against any one of a panel of 5 different genes significantly suppressed the expression of corresponding molecules with specificity in lymphocytes such as primary T-cells as well as in HuT78 cells.

[0072]. In various embodiments the target messenger ribonucleic acid is selected from the group of nucleic acid sequences identified by SEQ ID NOS. 12 to 16 .

[0073]. In various embodiments the target mRNA is SEQ ID NO. 12 or GenBank accession numbers NM_005751 , NM_1 471 66, NM_1 471 7 1 , or NM_1 471 85 representing a nucleic acid that translates the CG-NAP/AKAP450 protein.

[0074]. In various embodiments the target mRNA is SEQ ID NO. 13 or GenBank accession number NM_006289 representing a nucleic acid that translates the Tailinl protein .

[0075]. In various embodiments the target mRNA is SEQ ID NO. 14 or GenBank accession numbers NM_001 114380 or NM_002209 representing a nucleic acid that translates the CD1 1a protein. [0076]. In various embodiments the target mRNA is SEQ ID NO. 15 or GenBank accession number NM_005400 representing a nucleic acid that translates the ΡΚΟε protein .

[0077]. In various embodiments the target mRNA is SEQ ID NO. 16 or GenBank accession numbers NM_203401 , NM_001 145454, NM_005563, NM_1 52497 or

NM_203399 representing a nucleic acid that translates the Stathm in protein .

[0078]. In various embodiments the target mRNA may translate any protein in a lymphocyte involved in lymphocyte migration.

[0079]. In various embodiments the lymphocyte comprises a T-cell.

[0080]. In various embodiments the oligonucleotide is suitable for use in treating immune-mediated disease, preferably autoimmune disease. Chronic inflammatory diseases and autoimmune disorders are characterized by unregulated trafficking of T lymphocytes within the affected tissue sites leading to self-tissue destruction. Inhibiting or regulating the migration of T cells is an effective way to control or treat autoimmune diseases and LFA-1 (CD1 1a) inhibitor has been effective in clinical trials. It is anticipated that inhibiting the expression of LFA-1 , Talinl or CG-NAP would regulate T cell migration and would have therapeutic value in such conditions.

Given that GapmeR-mediated knock down of CG-NAP in human T-cells severely hampers the ability of T-cells to move (Figures 12 , 13 and 15), these oligonucleotide designs will be useful as potential therapeutics in autoimmune diseases.

[0081 ] . As used herein the term "autoimmune disease" may refer to any disease that is shown to be based on the existence and/or action of autoreactive cells. Autoimmune disease may include Hashimoto's thyroiditis, Graves' disease, Systemic lupus erythematosus, Sjogren's syndrome, Antiphospholipid syndrome-secondary, Primary biliary cirrhosis, Autoimmune hepatitis, Scleroderma, Rheumatoid arthritis, Antiphospholipid syndrome-primary, Autoimmune thrombocytopenic purpura (ITP), Multiple sclerosis, Myasthenia gravis, juvenile idiopathic arthritis, acute disseminated encephalomyelitis, Addison's disease, Agammaglobulinemia, Alopecia areata, Amyotrophic lateral sclerosis, Ankylosing spondylitis, Autoimmune cardiomyopathy, Autoimmune hemolyticanem ia, Autoimmune inner ear disease, Autoimmune lymphoproliferative syndrome, Autoimmune peripheral neuropathy, Autoimmune pancreatitis, Autoimmune progesterone dermatitis, Autoimmune polyendocrine syndrome, Autoimmune thrombocytopenic purpura, Autoimmune urticaria, Autoimmune uveitis, Behcets disease, celiac disease, cold agglutinin disease, Crohn's disease, Dermatomyositis, Diabetes mellitus type I, Eosinophilic fasciitis, Gastrointestinal pemphigoid, Good pastures syndrome, Guillain-Barre syndrome, Hashimoto's encephalopathy, mixed connective tissue disease, Morphea, Nacolepsy, pemphigus vulgaris, polymyositis, primary biliary cirrhosis, relapsing polychondritis, Psoriasis, Psoriatic arthritis, Rheumatic fever, Temporal arteritis, Transverse myelitis, Ulcerative colitis, undifferentiated connective tissue disease, vasculitis, Wegeners granulomatosis or any known or suspected autoimmune disease known in the art.

[0082]. In various embodiments the autoimmune disease is selected from rheumatoid arthritis, juvenile idiopathic arthritis and multiple sclerosis. In various embodiments the autoimmune disease is rheumatoid arthritis. In various other embodiments the autoimmune disease is juvenile idiopathic arthritis. In various other embodiments the autoimmune disease is multiple sclerosis.

[0083]. In various embodiments the oligonucleotide is suitable for use in treating cancer. An increasing number of reports suggests that Talin l , PKC€ and Stathmin are important targets for cancer and cancer metastasis (Kang et al., 201 5 ,

Oncotarget, 6:27239-51 ; Fife et al., 201 7 , Oncogene,36:501 -51 1; Biaoxue et al., 201 6 , J Transl Med 14:279; Fang et al. , 201 6 , BMC Cancer, 16:45; Chen et al. , 201 7 ,

Oncotarget, 8:1 3003-1 301 4 ; Werner et al. , 201 4 , PLoS One, 9:e901 4 1; Akhtar et al.,

201 3 , J Transl Med. , 11:21 2 ; Liu et al. , 201 5 , Int J Clin Exp Med, 8:6502-6509; Pan et al., 2005, Cancer Res, 65:8366-8371 ; Grossoni et al., 2009, Cancer Res Treat,

118:469-480; Jain and Basu, 201 4 , Cancers (Basel), 6:860-878). In this case, blocking the expression of Talinl , PKC€ or Stathmin using chimeric oligonucleotides described herein provides a novel approach to treat cancer.

[0084]. In various embodiments the cancer comprises tumours of the hematopoietic and lymphoid tissue.

[0085]. In various embodiments the cancer is lymphoma or leukaemia.

[0086]. In various embodiments the lymphoma comprises Sezary Syndrome, or Mycosis Fungoides.

[0087]. Another aspect of the invention includes use of a lymphocyte permeating chimeric oligonucleotide comprising a sequence of formula I: Ln-Xm-Lo,

Wherein L comprises a locked nucleic acid;

[0088]. Like terms described herein for other embodiments have the same meaning. The various embodiments described for one aspects of the invention may also be used with other aspects of the invention.

[0089]. In various embodiments a 5 prime end of the lymphocyte permeating chimeric oligonucleotide comprises a locked nucleic acid with an adenine base or derivative thereof.

[0090]. In various embodiments a 3 prime end of the lymphocyte permeating chimeric oligonucleotide comprises a locked nucleic acid with an adenine base or derivative thereof.

[0091 ] . In various embodiments the sequence of formula I is any one of the nucleic acid sequences selected from the group identified by SEQ ID NOS. 1 to 10 .

[0092]. In various embodiments the target messenger ribonucleic acid is selected from the group of nucleic acid sequences identified by SEQ ID NOS. 12 to 16 .

[0093]. In various embodiments the target mRNA may translate any protein in a lymphocyte involved in lymphocyte migration.

[0094]. In various embodiments the lymphocyte comprises a T-cell.

[0095]. Another aspect of the invention includes a method for inhibiting protein expression in a lymphocyte comprising ; providing to the lymphocyte a lymphocyte permeating chimeric oligonucleotide comprising a sequence of formula I:

Ln-Xm-Lo, Wherein L comprises a locked nucleic acid;

X comprises a sequence of a deoxyribonucleic acids complementary to a section of a target messenger ribonucleic acid ; n and o are independently 2 or 3 ; and m is 8 to 10 , whereby the lymphocyte permeating chimeric oligonucleotide binds to the complementary section of target messenger ribonucleic acid thereby inhibits protein expression of the target messenger ribonucleic acid.

[0096]. Like terms described herein for other embodiments have the same meaning. The various embodiments described for one aspects of the invention may also be used with other aspects of the invention.

[0097]. In various embodiments the method is an in vitro method.

[0098]. In various embodiments the method is an in vivo method. As used herein in vivo may also include in situ methods.

[0099]. In various embodiments the method further comprises selecting the section of the target mRNA and to form the deoxyribonucleic acids complementary thereto. The selection of the sequence of the DNA antisense and the flanking LNAs can be carefully done using available gene sequence database and bioinformatics tools to achieve high target affinity, sequence specificity, biological stability, and favourable pharmacokinetic, tissue-penetrating properties and low cross reactivity.

[001 ] . In various embodiments a 5 prime end of the lymphocyte permeating chimeric oligonucleotide comprises a locked nucleic acid with an adenine base or derivative thereof.

[001 00]. In various embodiments a 3 prime end of the lymphocyte permeating chimeric oligonucleotide comprises a locked nucleic acid with an adenine base or derivative thereof.

[001 0 1] . In various embodiments the sequence of formula I is any one of the nucleic acid sequences selected from the group identified by SEQ ID NOS. 1 to 10 . [001 02]. In various embodiments the target messenger ribonucleic acid is selected from the group of nucleic acid sequences identified by SEQ ID NOS. 1 to 16 .

[001 03]. In various embodiments the target mRNA may translate any protein in a lymphocyte involved in lymphocyte migration .

[001 04]. In various embodiments the lymphocyte comprises a T-cell.

[001 05]. In various embodiments the method further comprising administering the lymphocyte permeating chimeric oligonucleotide to a subject in need of treatment of a lymphocyte migration related disease.

[001 06]. In various embodiments the lymphocyte permeating chimeric oligonucleotide may be administered by direct injection . In various embodiments the lymphocyte permeating chimeric oligonucleotide may be formulated for parenteral , intramuscular, intravenous, subcutaneous, intraocular, oral or transdermal administration.

[001 07]. As used herein the term 'subject' refers to a vertebrate animal such as a mammal that is suspected of having or suffering from a lymphocyte migration related disease. In various embodiments this may include a subject at risk of having an autoimmune disease, a subject that has an autoimmune disease or a subject that has had an autoimmune disease in the past. In various embodiments this may include a subject at risk of having cancer, a subject that has cancer or a subject that has had cancer in the past. In various embodiments the subject comprises a human.

[001 08]. In various embodiments the lymphocyte migration related disease is an autoimmune disease as described herein .

[001 09]. In various embodiments the lymphocyte migration related disease is cancer as described herein.

[001 10]. In various embodiments the cancer comprises tumours of the hematopoietic and lymphoid tissue. In various embodiments the lymphocyte migration related disease is tumours of the hematopoietic and lymphoid tissue. [001 11] . In various embodiments the cancer is lymphoma or leukaemia. In various embodiments the lymphocyte migration related disease is lymphoma or leukaemia.

[001 12]. In various embodiments the lymphoma comprises Sezary Syndrome, or Mycosis Fungoides.

[001 13]. This methodology was further applied to silence a number of target genes in human peripheral blood lymphocyte T-cells, and it was identified that the inhibition of CG-NAP/AKAP450 expression in human T-cells suppresses T-cell migration , which could be utilized for regulating immune functions in various autoimmune conditions and exploited as a novel target for therapeutic interventions.

[001 14]. Further functional analysis confirms CG-NAP and Stathmin as regulators of T-cell motility. Thus, in addition to screening, identifying or verifying critical roles of various proteins lymphocytes functioning such as T-cell functioning, this study provides novel opportunities to silence individual or multiple genes in a subset of purified human primary T-cells that would be exploited as future therapeutics.

[001 15]. The present disclosure also demonstrates that specific knockdown of the adaptor protein CG-NAP/AKAP450 expression significantly inhibits T-cells migration and chemotaxis.

[001 16]. Another aspect of the invention includes a process for inhibiting lymphocyte migration comprising; providing to the lymphocyte a lymphocyte permeating chimeric oligonucleotide comprising a sequence of formula I:

Ln-Xm-Lo,

Wherein L comprises a locked nucleic acid;

[001 17]. Like terms described herein for other embodiments have the same meaning. The various embodiments described for one aspects of the invention may also be used with other aspects of the invention.

[001 18]. In various embodiments the process is an in vitro process.

[001 19]. In various embodiments the process is an in vivo process. As used herein in vivo may also include in situ process.

[001 20]. In various embodiments a 5 prime end of the lymphocyte permeating chimeric oligonucleotide comprises a locked nucleic acid with an adenine base or derivative thereof.

[001 2 1] . In various embodiments a 3 prime end of the lymphocyte permeating chimeric oligonucleotide comprises a locked nucleic acid with an adenine base or derivative thereof.

[001 22]. In various embodiments the sequence of formula I is any one of the nucleic acid sequences selected from the group identified by SEQ ID NOS. 1 to 10 .

[001 23]. In various embodiments the target messenger ribonucleic acid is selected from the group of nucleic acid sequences identified by SEQ ID NOS. 12 to 16 .

[001 24]. In various embodiments the target mRNA may translate any protein in a lymphocyte involved in lymphocyte migration .

[001 25]. In various embodiments the lymphocyte comprises a T-cell.

[001 26]. In various embodiments the process further comprising administering the lymphocyte permeating chimeric oligonucleotide to a subject in need of treatment of a lymphocyte migration related disease as described herein.

[001 27]. In various embodiments the lymphocyte migration related disease is an autoimmune disease as described herein . [001 28]. In various embodiments the lymphocyte migration related disease is cancer as described herein.

[001 29]. In various embodiments the cancer is lymphoma or leukaemia as described herein.

[001 30]. In various embodiments the lymphoma comprises Sezary Syndrome, or Mycosis Fungoides as described herein.

[001 3 1] . Another aspect of the invention includes use of a lymphocyte permeating chimeric oligonucleotide as described above in the manufacture of a medicament for the treatment of an immune-mediated disease, preferably autoimmune disease.

[001 32]. Another aspect of the invention includes use of a lymphocyte permeating chimeric oligonucleotide as described above in the manufacture of a medicament for the treatment of cancer.

[001 33]. In various embodiments the cancer is lymphoma or leukaemia.

[001 34]. In various embodiments the lymphoma comprises Sezary Syndrome, or Mycosis Fungoides.

[001 35]. Although antisense oligonucleotides have been used for post- transcriptional gene silencing in various cell types and appear to offer a potential avenue for inhibiting gene expression, they have not been demonstrated to work well in primary T-cells; therefore, the widespread use of antisense oligonucleotides in modulating immune functions is still not clear.

[001 36]. While the conventional delivery or transfection technologies like lipofection, electroporation and nucleofection have their own set of limitations to be implemented in T-cells, which include transfection issues, toxicity and off-target effects, the idea of gene silencing using Gapmer-oligonucleotide molecules offers crucial and unparalleled benefits in such cells, which include:

1. High transfection efficiency in T-cells.

2 . Sequence specific gene silencing. 3 . Carrier/delivery/vehicle-independent cellular uptake and targeting in T-cells (unlike conventional techniques that have several undesirable effects, such as cytoxicity).

4 . Absence of cytotoxicity, immunogenicity and off-target effects.

5 . The knockdown efficiency can be stably maintained for longer time periods and repeated dosing.

6 . The method can be exploited for developing topical gene silencing drug formulations as new generation therapies.

[001 37]. EXAMPLES

[001 38]. It is demonstrated herein that specifically designed chimeric GapmeR molecules can internalize into human primary T-cells through macropinocytosis and induce target-specific gene silencing. GapmeR-mediated gene silencing method described here is a simple and effective non-invasive approach for post- transcriptional gene silencing in human primary T-cells (Fig. 1) . Chimeric oligonucleotide antisense GapmeR molecules knockdown targeted gene(s) at the RNA level inhibiting protein expression .

[001 39]. Lymphocyte Cell culture

[001 40]. Human PBL T-cells and other immune cell subtypes such as Primary human peripheral blood lymphocyte T-cells were purified/expanded from buffy coat blood samples of healthy volunteers (obtained from the National University Hospital Systems, Singapore) using a density gradient centrifugation method. Experiments respected institutional guidelines and were approved by the Institutional Review

Board of Nanyang Technological University, Singapore. All the experiments in the study were reviewed and approved by the Institutional Review Board (IRB) of Nanyang Technological University (#I RB-201 4-09-007) and National University

Hospital Singapore. All the methods were carried out in accordance with the relevant guidelines and regulations. In brief, buffy coat blood (-20 ml) was diluted with an equal volume of sterile phosphate buffered saline (PBS). The diluted blood was carefully overlaid on an equal volume of Lymphoprep™ (STEMCELL Singapore Pte

Ltd.) in 50 ml tubes and centrifuged at 1200xg for 20 min without brakes. Peripheral blood mononuclear cells were then removed from the liquid/Lymphoprep™ interface and washed three times in PBS. Cells were then re-suspended in Gibco™ RPMI 1640 medium containing 10% fetal bovine serum and antibiotics Pen-Strep (all from Thermo Fisher Scientific Inc.) and incubated in Nunc™ T-175 cm2 tissue culture flasks for 2 h in a humidified incubator at 37 ° containing 5% C0 2. Non-adherent cells were collected and incubated in T-175 cm2 flasks for additional 2 h as above to remove monocytes. Finally, non-adherent cells were collected, re-suspended at 2 χ 106 cells/ml and stimulated with 2 µg/ml phytohemagglutinin for 72 h at 37°C. The cells were then washed three times and cultured with 20 ng/ml recombinant human IL-2 (Peprotech) for 5-7 days. Fresh IL-2 was added every 2-3 days and cell density was maintained between 2 χ 106 to 4 χ 106 cells/ml. This protocol results in > 98% CD3+ T-cells, with the proportion of T-cell subsets reported as 83% CD4+, 15% CD8+ and < 1% CD4+/CD8 + cells (Lefort and Kim , J. Vis. Exp. 40, 201 0).

[001 4 1] . The human T-cell line HuT78 was obtained from the American Type Culture Collection (ATCC) and cultured as described previously (Ong et al., J. Biol.

Chem. 284, 12349-1 2362, 201 4) and used. Briefly, cells were cultured in Gibco™ RPMI 1640 medium containing 10% fetal bovine serum , 2 mm L-glutamine and antibiotics Pen-Strep (all from Thermo Fisher Scientific Inc.) in a humidified chamber at 37°C containing 5% C0 2.

[001 42]. Chimeric oligonucleotides (GapmeR molecules) are self-internalized by primary human T-cells

[001 43]. Cellular targeting of GapmeR-oligonucleotides: Initially, primary human T-cells were incubated with various concentrations of FAM-labelled non- targeting oligonucleotide GapmeR construct ( 1 00 nM, 250 nM or 500 nM) for various time points (6 h , 24 h , 48 h or 72 h). At the end of treatment periods, oligonucleotide cellular uptake was analysed using flow-cytometery. Data clearly showed dose- and time-dependent cellular internalization of GapmeR oligonucleotides through direct uptake "gymnosis" and -60% T-cells were transfected with 100 nM FAM-GapmeR in 24 h (Fig. 2). At 500 nM concentration , FAM-GapmeR showed close to 100% transfection efficiency even at 6 h that sustained for up to 72 h (Fig. 2).

[001 44]. Flow cytometry

[001 45]. The delivery efficiency of GapmeR into T-cells was determined using fluorescently (FAM)-labelled non-targeting GapmeR molecules (AACACGTCTATACGC, 5' to 3') and quantified by flow cytometry. Cells were harvested at indicated time-points and washed in PBS by centrifugation. Cells with FAM-GapmeR were analysed using BD LSR Fortessa X-20 flow cytometer equipped with BD FACSDiva™ software (BD Biosciences).

[001 46]. Similar results on cellular uptake of FAM-GapmeR were obtained in HuT78 T-cells incubated with various concentrations of FAM-GapmeR ranging from 10 nM to 500 nM (gymnotic delivery) or transfected through nucleofection (Fig. 3). As observed above (Fig. 2), dose-dependent cellular uptake of oligonucleotides was registered in HuT78 T-cells when cells were incubated with various concentrations of FAM- GapmeR ranging from 10 nM to 500 nM through direct cellular uptake (Fig. 3A) or after transfection using a nucleofection method (Fig. 3B, C).

[001 47]. Comparable amount of GapmeR cellular uptake through gymnosis was evident in both primary human T-cells and HuT78 cells following incubation with 500 nM FAM-GapmeR for various time-points ranging from 6 to 72 h (Fig. 2 , 3 and 4). Comparable amount of cellular targeting of GapmeR-oligonucleotides through direct cellular uptake was evident in both primary human T-cells and HuT78 T-cells following incubation with 500 nM FAM-GapmeR for various time-points ranging from 6 to 72 h (Fig. 4).

[001 48]. Cellular localization of short-oligonucleotides:

[001 49]. Confocal microscopy of primary human T-cells or HuT78 cells treated with 500 nM FAM-GapmeR oligonucleotides through direct delivery showed their localization in the cytoplasm as well as in the nucleus (Fig. 5). To further detect cellular internalization of GapmeR in T-cells, confocal, super-resolution and 3D Structured Illumination Microscopy (3D-SIM) of FAM-GapmeR treated T-cells was performed. Confocal microscopic images of primary T-cells or HuT78 cells incubated with 500 nM FAM-GapmeR for 48 h showed GapmeR localization in the cytoplasm as well as in the nucleus (Fig. 5). Super-resolution and 3D-SIM microscopy of HuT78 T-cells treated with 500 nM FAM-GapmeR molecules further confirmed their cellular targeting. Interestingly, internalized GapmeR molecules displayed "doughnut- shaped" vesicular-like structures within the cell (data not shown). High Content Analysis of primary T-cells and HuT78 cells showed time-dependent increase in the internalization of GapmeR in both cytoplasm as well as nucleus (Fig. 5) . Similar results on the cellular uptake of FAM-GapmeR were obtained with other cell-types, including primary human dermal fibroblasts, lung epithelial carcinoma cell line A549 and hepatocellular carcinoma cell line HepG2, as visualized by confocal microscopy (data not shown).

[001 50]. Confocal and super-resolution microscopy

[001 5 1] . Following treatment with fluorescently (FAM)-labelled non-targeting

GapmeR molecules (AACACGTCTATACGC, 5' to 3'), T-cells were fixed in 4% (v/v) formaldehyde. Cells were stained with Rhodamine-Phalloidin (Molecular Probes, Thermo Fisher Scientific Inc.) to visualize the cellular morphology or immuno-stained and Hoechst 33258 (Sigma-Aldrich) to visualize the nucleus. Cells were then placed on glass slides and mounted with coverslips using FluoromountTM (Sigma-Aldrich) or VECTASHIELD ® H-1 000 (Vector Laboratories). Confocal imaging was carried out by a laser scanning microscope using a Plan-Apochromat 63X/1 .40 Oil DIC objective lens and excitation wavelengths 405, 488, 561 and 640 nm (Zeiss LSM 800, Carl Zeiss). At least 20 different microscopic fields were analysed for each sample using Zen imaging software (Carl Zeiss). To determine GapmeR co-localization with specific proteins (SNX5, Rab5a and Caveolin l ) , GapmeR-treated HuT78 T-cells were immuno-stained with primary and corresponding labelled secondary antibodies. Cells were then imaged and processed using Leica TCS SP8 optical 3X super- resolution microscope equipped with HyVolution software (Leica). Some of the images as indicated in the relevant figure legends were acquired using wide-field or 3D-SIM on a DeltaVision OMX v4 Blaze microscope (GE Healthcare) that gives a 2- fold increase in resolution in all 3-axes (xyz) which equates to 110 nm laterally and -300 nm axially. The 3D-SIM technique is based upon the interaction of a structured pattern of illumination with the structures inherently present within the sample. This gives rise to Moire fringes which are subsequently used to computationally reconstruct a super-resolved image. When compared to other super-resolution microscopy techniques, 3D-SIM has the advantages of working with samples that have been prepared in a conventional way (using common fluorophores, fixation and mounting techniques) and offer 3D images of samples over a range of - 16 µιη37. Imaris software (Andor-Bitplane, Zurich) was used to perform 3D reconstruction and to generate movies.

[001 52]. Further, High Content Analysis (HCA) of primary human T-cells and

HuT78 cells showed time-dependent increase in the internalization of GapmeR oligonucleotides in both cytoplasm as well as nucleus (Fig. 5D and 6). [001 53]. High Content Analysis (HCA)

[001 54]. A High Content Analysis protocol for T-cell migration and phenotypic analysis has been optimized and established as described previously (Fazil et al., 201 6 , Sci Rep, 6:37721 ; Ong et al. , 201 4 , J Biol Chem 289:1 9420-34). For T-cell migration assay, cells (2 χ 104 cells in 100 µ Ι medium) pre-activated in activation buffer containing 50 mM MgCl2 and 15 mM EGTA to induce the high-affinity form of the LFA-1 integrin receptor were loaded in triplicates onto rlCAM-1 -Fc pre-coated 96- well tissue culture plates (flat bottom , Nunc™) and incubated in 5% C0 2 at 37°C for 4 h. Control resting T-cells were incubated on poly L-lysine (PLL) coated plates and cells pre-treated with taxol were used as positive control for migration inhibition. To quantify the amount of GapmeR in cellular cytoplasm or nuclei, cells were incubated with 500 nM FAM-GapmeR for up to 72 h . At the end of the treatments, cells were transferred into PLL pre-coated 96-well flat bottom plates. Cells were then fixed with

4% (v/v) formaldehyde in PBS, and fluorescently stained with Rhodamine-Phalloidin (Molecular Probes, Thermo Fisher Scientific Inc.) to visualize cytoplasm and Hoechst

33258 (Sigma-Aldrich) to visualize nuclei . Plates were scanned ( 1 6 randomly selected fields/well at 20X magnification) using the IN Cell Analyzer 2200 (GE Healthcare). The acquired images were automatically analysed by IN Cell Investigator software using multi-target analysis bio-application module (GE Healthcare) for nuclear and cell intensity. To quantify T-cell migratory phenotypes, cell shapes were automatically quantified into cell 1/form-factor values. A complete round shaped cells has cell 1/form-factor value = 1, whereas a polarised, migrating cell has a cell 1/form-factor value > 1 . The normalised values were converted into a heatmap using Spotfire© for better visualization (TIBCO Software Inc).

[001 55]. Chimeric oligonucleotides (GapmeR molecules) do not interfere with cell viability and are non-immunogenic

[001 56]. Cell viability assays

[001 57]. Cell viability was determined using CellTiter 96® AQueous One solution according to the manufacturer's instructions (Promega) . The absorbance was measured at 490 nm using a microplate reader (Infinite M200 Pro, Tecan) and then percentage cell viability was calculated.

[001 58]. There was no appreciable loss in cell viability due to the incubation of T-cells with as high as 1 µΜ non-targeting GapmeR for 24 h (Fig. 7A, light grey bars) ; however, nucleofection procedure alone caused significant loss in cell viability (Fig. 7A, dark grey bars) .

[001 59]. ELISA assay

[001 60]. Primary human T-cells were incubated with 100 nM, 250 nM, or 500 nM non-targeting GapmeR for 24 h . Cells were treated with PHA as a positive control. After centrifugation, supernatant culture media were collected and secreted levels of cytokines IL-2 IL-4 IL-5 and IFN-γ were analysed by human Ready-SET- Go® ELISA kits (eBioscience). The absorbance was measured at 490 nm using a microplate reader (Infinite M200 Pro, Tecan) and the amounts of secreted cytokines were calculated based on the standard curve.

[001 6 1] . Moreover, GapmeR treatment did not induce any unwanted immunogenic response in human primary T-cells i.e. there was no detectable secretion of IL-2, IL-4, IL-5 or IFN-γ due to non-targeting GapmeR (Fig. 7B-E). GapmeR-oligonucleotides do not induce immunogenic responses by T-cells: Treatment of primary human T-cells with up to 500 nM concentrations of GapmeR- oligonucleotides did not induce any unwanted immunogenic responses in vitro i.e. there was no detectable secretion of IL-2, IL-4, IL-5 or IFN-γ due to non-targeting oligonucleotides in primary human T-cells (Fig. 7B-E) .

[001 62]. Chimeric oligonucleotides (GapmeR molecules) internalizes to T-cells through macropinocytosis mechanism

[001 63]. There are many possible ways by which small molecules, such as GapmeR, could be internalized into mammalian cells. These include pinocytosis, phagocytosis, clathrin-mediated endocytosis or caveolae-mediated uptake process. To investigate the mechanism of GapmeR cellular uptake in primary human T-cells, cells were separately with specific endocytosis pathway inhibitors, including amiloride (pinocytosis inhibitor), cytochalasin D (phagocytosis inhibitor), filipin (caveolae- mediated uptake inhibitor), or chlorpromazine (clathrin-mediated endocytosis inhibitor). Pre-treatment of T-cells with increasing concentrations of amiloride (0.5 to 5 mM), prior to incubation with FAM-GapmeR, showed dose-dependent inhibition of GapmeR internalization, with >95% inhibition at 5 mM concentration (Fig. 8A-G, K).

However, presence of inhibitory concentrations of filipin ( 1 µ /ιηΙ) , chlorpromazine ( 1

µΜ) , or cytochalasin D ( 10 mM) had no significant effect on GapmeR cellular uptake (Fig. 8H-J). Please note that the higher concentrations of filipin , chlorpromazine, or cytochalasin D than indicated above were found to be cytotoxic (data not shown) .

These results suggest that direct cellular uptake of GapmeR-oligonucleotides in T- cells occurs mainly through pinocytosis.

[001 64]. To further validate macropinocytosis-mediated internalization of

GapmeR molecules in T-cells, FAM-GapmeR treated HuT78 cells were immunostained for SNX5 protein (a marker of macropinosome body) and imaged using super-resolution microscopy. Co-localization of FAM-GapmeR with SNX5-positive macropinosome bodies was clearly detectable in the cytoplasm of GapmeR-treated cells (Fig. 9). Of note, co-localization between GapmeR and Rab5 or Caveolinl vesicles was not detected (data not shown). These results confirm that GapmeR cellular internalization in T-cells occurs mainly through macropinocytosis.

[001 65]. The GapmeR macropinocytosis is a better alternative to the conventional siRNA-based gene knockdown and can be applied to various other hard-to-transfect cell types, including na 've and effector T-cells. Use of GapmeR- mediated gene silencing will permit substantial advances in the understanding of lymphocyte biology, open-up new avenues for interactive-genomics and large-scale screening of signalling events in T-cells and contribute to the development of novel therapeutic approaches for human diseases. Specific GapmeR molecules targeted against immune checkpoint proteins coupled to the ease of delivery could potentially be used to boost the capacity of T-cells to fight against malignant diseases. In this context, the study provides exciting opportunities with regards to novel patient- friendly therapy options. GapmeR-based therapeutics could also bypass issues associated with other delivery vehicles such as toxicity and off target effects. This appears to be the first report establishing GapmeR cellular internalization through macropinocytosis and GapmeR-mediated gene silencing in human T-cells. The data positions GapmeR as a valuable tool for basic research, target screening, potential immunotherapeutic and for future gene therapy applications.

[001 66]. Specific chimeric oligonucleotide (GapmeR molecules) can effectively knockdown targeted genes of interest.

[001 67]. It was next determined if the macropinocytosis of GapmeR in human T-cells could be translated into effective gene silencing. For this purpose, specific chimeric oligonucleotide molecules were designed and synthesized. A panel of specific oligonucleotide GapmeR molecules targeted against 5 randomly selected genes representing a wide range of molecular weight proteins namely (i) a 450 kDa adaptor protein CG-NAP/AKAP450 (also called AKAP9), (ii) a 220 kDa cytoskeletal protein Talin l , (iii) a 180 kDa integrin receptor CD1 1a , (iv) a 80 kDa serine/threonine kinase ΡΚΟε isoform and (v) a highly conserved 18 kDa ubiquitous phosphoprotein Stathm in. Primary T-cells or HuT78 cells were incubated directly with the individual

GapmeR molecule to allow cellular uptake for up to 48 h . After the treatment periods, the efficacy of gene silencing was determined by both RT-qPCR as well as Western immunoblotting. Macropinocytosis-mediated cellular delivery of specific GapmeR targeting the candidate proteins CG-NAP, Talinl , CD1 1a , ΡΚΟε or Stathmin (Table

1) , effectively and significantly suppressed the expression of corresponding mRNA and proteins with specificity in primary T-cells (Fig. 10A,B, Fig. 11) . Moreover, the expression level of CG-NAP protein remained diminished for up to 12 days in actively proliferating T-cells that have been treated with CG-NAP GapmeR at the time of activation via PHA and IL-2 (data not shown). These data suggest that the transient gene silencing effect of GapmeR may last for about two weeks in actively proliferating T-cells. The maintenance of a minimum dosage of GapmeR by repeated treatments may be required to suppress gene expression for longer periods of time. Notably, nucleofection of HuT78 T-cells with CG-NAP -targeting GapmeR showed comparable gene silencing that was observed using specific CG-NAP-siRNA (Fig. 11B, left panel). Intriguingly, direct incubation (gymnotic delivery) of CG-NAP- GapmeR, but not CG-NAP-siRNA, could substantially knockdown the expression of CG-NAP protein (Fig. 11B, C ; right panels). The inability of naked siRNA delivered directly to cells to efficiently knockdown target gene could be due to modulations within the endosomes that can alter the efficiency of siRNAs by which they perform gene silencing.

[001 68]. Western immunoblot analysis

[001 69]. At the end of the particular experiments, T-cells were washed with ice- cold PBS and lysed in the lysis buffer containing Triton X-1 00 ( 1%) and protease inhibitors as described previously. The protein content of the cell lysates was determined by the Bio-Rad Protein Assay. Equal amount of cell lysates (20 µg each) were resolved on SDS-PAGE gels and subsequently transferred onto PVDF membranes. After blocking in 5% milk powder in TBS-0.05% Tween 20 (TBST) for 1 h at room temperature, the membranes were washed three times in TBST. The membranes were then incubated overnight at 4°C with diluted primary antibodies in TBST with gentle rocking. After three washes in TBST, the membranes were incubated with HRP-conjugated secondary antibodies for 2 h at room temperature. Primary antibodies - mouse anti-CD1 1a (clone MEM-83, Monosan), mouse monoclonal anti-CG-NAP/AKAP9 (BD Biosciences), mouse monoclonal anti-CTLA4 (Abeam), rabbit monoclonal anti-STAT3, rabbit polyclonal anti-talin-1 , rabbit anti-

Stathm in and rabbit anti-GAPDH (Cell Signaling Technology). Secondary antibodies - horseradish-peroxidise-conjugated anti-rabbit and anti-mouse IgG (Cell Signaling Technology). The immunoreactive bands were visualized using the LumiGLO® chemiluminescent detection system (Cell Signalling Technology) and subsequent exposure to CL-XPosureTM light sensitive film (Thermo Scientific). Densitometric analyses of the Western blots were performed by using ImageJ software.

[001 70]. In the present study, nanoString RNA expression profiling technology platform was employed that accurately measures the expression levels of multiple genes based on counting individual mRNA molecules with high specificity and sensitivity. Using a panel of 192 unique genes, high specificity of GapmeR-mediated gene silencing was observed with no significant off-target effects. Of note, reduced expression of CG-NAP detected in Talin-1 depleted T-cells suggests a potential role of Talinl in the regulation or maintenance of CG-NAP expression and needs further detail investigation.

[001 7 1] . nanoString gene expression analysis

[001 72]. Total RNA was extracted from untreated or GapmeR treated (48 h) primary T-cells using PureLink® RNA Mini Kit according to manufacturer's instructions (Thermo Fisher Scientific). The concentration of RNA in each samples was determined using NanoDrop 2000c Spectrophotometer (Thermo Scientific).

Further quality control analysis of RNA samples was performed by Agilent 2 100 Bioanalyzer (Agilent Technologies). Gene expression analysis was performed using nanoString nCounter Vantage™ RNA Intracellular Signalling Panel comprising of 192 different genes, including 12 housekeeping genes as controls. A nanoString nCounter Digital Analyzer (NanoString Technologies) was used to count the digital barcodes representing the number of transcripts. The raw counts were automatically normalised by the total counts of all the tested samples and housekeeping genes in order to compensate for variations introduced by experimental procedures and counts were averaged between replicates using nSolver Analysis software, log2- transformed and presented as a scatter plot. [001 73]. The specificity of targeting is an essential criteria for the application of RNAi molecules in functional gene silencing. Although GapmeR design algorithm and in silico analysis comprehensively screen oligonucleotide sequences to avoid potential off-target effects, additional experiments were performed to rule out any potential off-target alterations in gene expressions due to GapmeR. Using nanoString nCounter gene expression analysis, the expression levels of 192 different genes in human primary T-cells that were treated with 500 nM non-targeting GapmeR or GapmeR targeted against CG-NAP, Talin l or CD1 1a for 48 h was determined. A strong correlation (R2 >0.97) was observed for the overall gene expression profile in

T-cells treated with GapmeR molecules in comparison to that with untreated cells (Fig. 10C). Moreover, GapmeR-mediated depletion of CG-NAP or Talin-1 in primary or HuT78 T-cells showed no major effect on the expression levels of several other unrelated proteins as determined by Western immunoblot analysis (data not shown).

Notably, reduced expression of CG-NAP protein in Talin-1 knockdown T-cells was detected (data not shown), suggesting that CG-NAP is a potential downstream target of Talin-1 or this adaptor protein may have undergone proteolytic degradation in the absence of Talinl .

[001 74]. Specific GapmeR molecules against 5 selected gene targets representing a wide range of molecular weight proteins:- (i) CG-NAP, (ii) Talin l , (iii) CD1 1a , (iv) Protein Kinase C (PKC) ε , and (v) Stathmin were designed using available genome-sequence database and Exiqon's empirically developed in-house algorithm "Design tool" to achieve high target affinity, specificity, biological stability, and favourable pharmacokinetic and tissue-penetrating properties. Potential off- targets in the human transcriptomes were further examined using TagScan (http://www.isrec. isb-sib.ch/tagger), a web tool providing genome searches for short oligonucleotide sequences. Antisense oligonucleotide sequences with none or least number of potential off-targets based on predicted Tm, target accessibility and no similarity with other spliced transcriptome at 0 mismatch were selected as lead GapmeR. Selected GapmeR molecules. The chimeric oligonucleotides were then synthesized by methods known in the art.

[001 75]. Direct delivery of naked GapmeR-oligonucleotide compounds into primary human T-cells and HuT78 cells was performed by incubating 5 χ 105 cells in

500 µ Ι medium with various concentrations of oligonucleotides ( 1 0 nM to 1000 nM, as indicated in the text and corresponding figure legends) in culture medium for 6 to 72 h , depending on experimental conditions. Utilizing the intrinsic self-internalizing capability of GapmeR, significant and specific depletion (>70%) of the expression of

5 different endogenous proteins with varying molecular weights ( 1 8kDa Stathmin, 80kDa ΡΚΟε, 180kDa CD1 1a , 220kDa Talinl and 450kDa CG-NAP/AKAP450) was demonstrated in human primary and cultured T-cells.

[001 76]. Design and synthesis of antisense GapmeR-oligonucleotide constructs: Using analysis of genome-sequence database to achieve high target affinity, specificity, biological stability, and favorable pharmacokinetic and tissue- penetrating properties, specific antisense GapmeR-oligonucleotide constructs were designed. A panel of specific antisense GapmeR-oligonucleotide constructs targeted against 5 randomly selected genes representing a wide range of molecular weight proteins namely (i) a 450 kDa adaptor protein CG-NAP/AKAP450, (ii) a 220 kDa cytoskeletal protein Talinl , (iii) a 180 kDa integrin receptor CD1 1a , (iv) a 80 kDa serine/threonine kinase ΡΚΟε isoform and (v) a highly conserved 18 kDa ubiquitous phosphoprotein Stathmin (Table 1) was then synthesized commercially.

[001 77]. Table 1. The nucleotide sequence of the antisense constructs used in the present study. LNA are denoted by a * after the nucleotide base that has been modified.

Seq ID. No. Target proteins Chimeric Oligonucleotide Constructs (5' to 3') 1. CG-NAP/AKAP450 A*C* T* AGCCTGTAAT *T* G* 2 CG-NAP/AKAP450 G* G* A*TGCAATGCTCT *T*A* 3 Talinl T* T* G* GCAGTAGGATT * G* G* 4 Talinl C* A*G* AGTGTCAAAGT * C* A* 5 CD1 1a G* A*T* GGTAGTGGCTG * A*G* 6 CD1 1a A*C* G* TCAATCATTAA *A*C*

7 PKCE T* A*G* GATGAAACTGG * A*A*

8 PKCE A*A*G* CAGCAGTAGAG * T* T* 9 Stathmin A*G* G* TAATCAATGCA*G * A* 10 Stathmin A*G* G* TAATCATTGCA*G *A* 11 Non-targeting control A*A*C*ACGTCTATAC * G* C*

[001 78]. Specifically designed antisense GapmeR-oligonucleotides applied to

T-cells through direct uptake are effective in targeted gene silencing : Primary human T-cells and HuT78 cells were incubated directly with the individual antisense

GapmeR-oligonucleotide construct to allow cellular uptake for 48 h . All the constructs tested effectively and significantly suppressed the expression of corresponding molecules with specificity in primary T-cells (Fig. 10).

[001 79]. As observed above with primary T-cells (Fig. 10), antisense GapmeR- oligonucleotide constructs targeted against CG-NAP/AKAP450 could effectively knockdown CG-NAP/AKAP450 protein in HuT78 T-cells when incubated directly for 24 h or 48 h (Fig. 11A). Notably, nucleofection of HuT78 T-cells with CG-NAP- targeting antisense GapmeR-oligonucleotides was equally effective in gene silencing that was observed using specific CG-NAP-siRNA constructs (Fig. 11B). Intriguingly, direct delivery of CG-NAP-GapmeR in primary T-cells or HuT78 T-cells, but not CG- NAP-si RNA, could substantially knockdown the expression of CG-NAP/AKAP450 protein (Fig. 1B,C) . The inability of naked siRNA delivered directly to cells to efficiently knockdown target gene could be due to modulations within the endosomes that can alter the efficiency of siRNAs by which they perform gene silencing

[001 80]. Chimeric oligonucleotides (GapmeR)-mediated gene silencing identifies CG-NAP/AKAP9 and Stathmin as novel regulators of T-cell migration and chemotaxis

[001 8 1] . Finally, to examine the functional influence of GapmeR-mediated gene silencing of the above 5 molecules in human primary T-cells, a well-established T-cell migration assays was performed (Verma et al. , J. Biol. Chem . 287, 27204-2721 6 , 201 2 the method is included herein by reference). Human primary T-cells depleted with the individual proteins (CG-NAP/AKAP9, Talin l , CD1 1a , PKCE or Stathmin using specific GapmeR molecules) were allowed to migrate through LFA-1/rlCAM-1 cross-linking for 4 h, as described previously. High Content Analysis of the cells showed significant inhibition of T-cell migratory phenotypes due to the silencing of either of the above genes, including CG-NAP/AKAP9 and Stathmin (Fig. 12A). In addition, specific depletion of the selected 5 proteins individually inhibited T-cell transwell migration through ICAM-1 -coated membranes towards the chemokine SDF1 a , as analysed using a real-time impedance-based detection system (Fig. 12B).

[001 82]. Real-time quantitative PCR (RT-qPCR)

[001 83]. Total RNA was extracted from primary T-cells following incubation with gene specific or non-targeting GapmeR (48 h treatment) as above. A one-step RT-qPCR was performed using QuantiNovaTM SYBR Green RT-PCR Kit following manufacturer's protocol (Qiagen) . PrimeTime® qPCR Primers for RT-qPCR assay were purchased from Integrated DNA Technologies as follows -

[001 84]. CG-NAP, SEQ ID NO. 17 5OATCCGACTGAGCTTTTCTTTG3' and SEQ ID NO. 18 5TTTCCTTTCTATCCCCAACCAC3';

[001 85]. Talin l , SEQ ID NO. 19 5'GTTCTCCAGATCACTTTCCCC3' and SEQ ID NO. 20 5OACCATCCTAACCGTCACTG3';

[001 86]. CD1 1a , SEQ ID NO. 2 1 5'ACCTGGTACATGTGCTTGAC3' and SEQ ID NO. 22 5'GACAACTCAGCCACTACCATC3';

[001 87]. ΡΚΟε, SEQ ID NO. 23 5TACTTTGGCGATTCCTCTGG3' and SEQ ID NO. 24 5OCTACCTTCTGCGATCACTG3'; and

[001 88]. Stathmin, SEQ ID NO. 25 5TTCAAGACCTCAGCTTCATGG3' and SEQ ID NO. 26 5'AGCCCTCGGTCAAAAGAATC3'.

[001 89]. Reactions in triplicates were analysed on a StepOnePlus™ Real-Time PCR System (Applied Biosystems™) using standard mode cycle conditions: 48°C for

30 min, 95°C for 10 min, followed by 40 cycles at 5 °C for 15 sec and 6 °C for 1 min. Expression levels of individual mRNA (fold change) were automatically calculated against GAPDH.

[001 90]. T-cell transwell migration assay

[001 9 1] . Real-time transwell T-cell migration monitoring was performed at 37 °C using the CIM-Plate 16 and xCELLigence system (ACEA Biosciences). Briefly, membranes of the transwell inserts were pre-coated with 1 µg/m l rlCAM-1 -Fc at 4 ° overnight and blocked with 5% (w/v) BSA for 1 h at 37°C. Untreated of GapmeR- treated (48 h treatment) human primary T-cells in triplicates were loaded in the upper χ chambers of CIM-Plate 16 ( 1 105 cells in 100 µ Ι medium). Cells pre-treated with taxol were used for the purpose of positive control. The upper chamber was then placed on the lower chamber of the CIM-Plate 16 containing 50 ng/ml SDF-1 a enriched medium in the appropriate lower wells as an attractant. T-cells transmigrating through the membranes were automatically monitored by xCELLigence impedance-based detection system and recorded in real-time every 5 min interval for up to 6 h . [001 92]. Unlabelled or fluorescently (FAM)-labelled non-targeting GapmeR molecules (AACACGTCTATACGC, 5' to 3') were used as controls. Human primary T-cells or HuT78 cells (5 χ 105 cells in 500 µ Ι medium) were mixed directly with various concentrations of individual GapmeR molecule ( 1 0 nM to 1000 nM, as indicated in the text and corresponding figure legends) and incubated for 6 to 72 h , depending on experimental conditions. For evaluating the effect of endocytosis inhibitors on cellular uptake of GapmeR, cells were pre-treated with various concentrations of amiloride, cytochalasin D, filipin or chlorpromazine (Sigma-Aldrich) for 30 min before adding FAM-GapmeR. In some of the experiments, cells were transfected with GapmeR or siRNA (SMARTpool, Thermo Scientific Dharmacon) through necleofection using Nucleofection® Kit and 4D Nucleofector® (Lonza) as per the manufacturer's protocol.

[001 93]. Following specific knockdown of the CG-NAP/AKAP450 protein, and migration assay detailed above. High Content Analysis the cells showed significant inhibition of T-cell migratory phenotypes due to the silencing of CG-NAP/AKAP450 gene expression (Fig. 12).

[001 94]. Further, specific depletion of CG-NAP/AKAP450 protein inhibited T- cell transwell migration through ICAM-1 -coated membranes towards the chemokine SDF1 a , as analysed using a real-time impedance-based detection system (Fig. 13).

[001 95]. While the role of Talinl , CD1 1a and PKCs in T-cell migration is well- established, in this study CG-NAP/AKAP9 and Stathmin have been defined as critical regulators of T-cell motility, which require further investigation. It is expected that this adaptor protein CG-NAP/AKAP9 may have a crucial role in T-cell migration. Since

Stathm in is a regulator of the microtubule network, it is possible that depletion of

Stathm in in T-cells affected microtubule stability and dynamics ultimately resulting into reduced motility. Indeed, T-cells lacking Stathmin in Stathmin-/- mice showed delayed microtubule organising centre polymerization, decreased PKC0 polarization , decreased microtubule growth rates (Filbert et al. , J. Immunol. 188, 5421 -5427, 201 2).

[001 96]. The gene silencing method described in the present invention can be utilized to knockdown any genes of interest with precise specificity in mammalian primary as well as cultured cells, in addition to T-cells. In other words, a method for delivery of inhibitory RNA technologies in humans is described. A crucial role of CG- NAP/AKAP450 in T-cell migration has been identified. This information as well as GapmeR-oligonucleotide mediated gene silencing technique can be exploited for therapeutically targeting T-cell motility in many disease conditions, such as human inflammatory disease and autoimmunity, in addition to cancer, genetic diseases and cardiac diseases. For example, tunable targeting of CG-NAP functioning in T-cells using this approach could provide a new strategy for modulating local inflammatory responses. The antagonistic compounds, method of gene silencing and approach in this invention is broadly applicable to a wide range of signalling molecules including for example kinases, phosphatases, other enzymes, transcription factors and receptors. The method can be used in gene silencing-based functional screening and the development of therapeutic approaches for diseases where the expression of specific proteins is up-regulated in T-cells or other tissues. This gene silencing method can be applied to treat various cancers including lymphomas, for example Sezary Syndrome (SS) and Mycosis Fungoides (MF) and also for developing drug formulations for topical applications. The approach has application in diverse range of human cells and not just T-cells from therapeutic viewpoint.

[001 97]. Knock down of target protein AKAP450/CG-NAP using a specific chimeric oligonucleotide identified the role of the protein .

[001 98]. AKAP450/CG-NAP is a cytosolic scaffolding protein involved in targeted positioning of multiple signalling molecules, which are critical for cellular functioning. AKAP450/CG-NAP is predominantly expressed in human primary T- lymphocytes, co-localizes with a-tubulin, pericentrin and GM1 30 in centrosomal regions and serves as a docking platform for Protein Kinase A (PKA). Chimeric oligonucleotide (GapmeR)-mediated knockdown of AKAP450/CG-NAP inhibits LFA- 1-induced T-cell migration and impairs T-cell chemotaxis towards the chemokine SDF-1 a . Depletion of AKAP450/CG-NAP interferes with the expression of centrosomal proteins γ -tubulin and pericentrin, disrupts centrosomal and non- centrosomal microtubule nucleation, causes Golgi fragmentation and impedes a- tubulin tyrosination and acetylation, which are important for microtubule dynam ics and stability in migrating T-cells. In addition, AKAP450/CG-NAP is not only a substrate of PKA, but it facilitates PKA-mediated phosphorylation of pericentrin and dynein in T-cells. Overall, these findings provide critical insights into the roles of AKAP450/CG-NAP in regulating cytoskeletal architecture and T-cell migration. [001 99]. The migration of T-lymphocytes, i.e. their homing to lymphoid organs, recruitment to inflamed tissue sites and mounting an adaptive immune response against infection, is a complex but precisely regulated physiological process. This requires coordinated signal transduction pathways that culminate in dynamic reorganization of the cytoskeletal systems and active T-cell locomotion. In contrast to other cell types, the migratory polarity and structural asymmetry of motile T-cells are unique in the way that the nucleus occupies the front region ; whereas, the centrosome and Golgi complex remain close to the nucleus at the back. The generally accepted model about motile T-lymphocytes is that centrosome serves as a site for microtubule nucleation i.e. microtubule-organizing center (MTOC). The minus ends of microtubule networks are anchored at the centrosome. Radial arrays of highly dynam ic microtubule plus ends extend from centrosome toward the cell periphery that ensures regulated signal transduction and rapid cell migration.

[00200]. A-Kinase Anchoring Proteins (AKAPs) are a family of functionally related proteins that coordinate discrete signalling events by simultaneously interacting with multiple enzymes, such as kinases or phosphatases, and facilitating the phosphorylation of specific molecular substrates. AKAP450, one of the members of the AKAP family (also called Centrosome- and Golgi-localized protein kinase N-Associated Protein , CG-NAP, AKAP350 or AKAP9), is a critical integrating component of the integrin LFA-1 -induced signalling complex in the human

T-cell line HuT783. However, the functional implications of AKAP450/CG-NAP in primary T-lymphocytes and the mechanism by which this protein regulates T-cell motility are not fully understood.

[00201 ] . Here, strong evidence is provided that microtubule nucleation in motile T-cells occurs at both centrosomal and non-centrosomal regions. The adaptor protein AKAP450/CG-NAP serves as a docking platform for the microtubule nucleation at the centrosomal and non-centrosomal regions. Further, AKAP450/CG-NAP is shown to be one of the substrates of protein kinase A (PKA) and facilitates PKA-mediated phosphorylation of pericentrin and dynein in T-cells. The results thus provide a novel molecular mechanism by which AKAP450/CG-NAP mediates LFA-1 signalling and T- cell migration .

[00202]. AKAP450/CG-NAP is abundantly expressed in human peripheral T- cells and plays a crucial role in their motility. [00203]. To evaluate the relative expression of AKAP450/CG-NAP in human primary immune cell subtypes, Western immunoblot analysis of cellular lysates from freshly isolated monocytes, CD56+ NK-cells, CD1 9+ B-cells, na 've CD4+ and CD8+ T-cells, activated peripheral blood lymphocyte (PBL) T-cells and the T-cell line HuT78 was performed. Substantial expression of 450 kDa protein AKAP450/CG-NAP was detected in the various subtypes of T-cells and NK-cells, but not in monocytes or B-cells (Fig. 14). The expression levels of AKAP450/CG-NAP in HuT78 T-cells possessing activated T-cell lymphoblast phenotypes was comparable to that of primary T-cells (Fig. 14). Confocal microscopy showed that the majority of endogenous AKAP450/CG-NAP protein was localized at the centrosomal region as distinct spots in both resting and LFA-1 -stimulated PBL T-cells with some amount of the protein in the cytoplasm and also on the membrane (data not shown). Super- resolution 3D-structured illumination microscopy (3D-SIM) revealed co-localization and adjacency of AKAP450/CG-NAP with the centrosomal marker protein γ-tubulin as well as the cis-Golgi protein GM1 30 in LFA-1 -stimulated migrating PBL T-cells (data not shown). These observations confirmed that AKAP450/CG-NAP is mainly localized at the centrosomal site in motile primary T-cells.

[00204]. To determine whether the expression of AKAP450/CG-NAP is essential for T-cell migration the expression of AKAP450/CG-NAP protein in HuT78 T-cells (>90% knockdown) using specific chimeric oligonucleotide (GapmeR)- mediated gene silencing technique described above (Fig. 15A). AKAP450/CG-NAP knockdown did not interfere with T-cell proliferation or viability (Fig. 7). However, the depletion of AKAP450/CG-NAP in HuT78 T-cells significantly impaired their ability to migrate following LFA-1/ICAM-1 stimulation (Fig. 15B) . Quantification of the migratory phenotypes by High Content Analysis (HCA) showed significant decrease in cell 1/form-factor from 2.08 in control migrating T-cells to 1.58 in AKAP450/CG- NAP- Knock down cells (Fig. 15B). Furthermore, significantly reduced trans-well migration of AKAP450/CG-NAP-depleted PBL T-cells through rlCAM-1 -coated membrane towards the chemokine SDF1 a was observed (Fig. 15C).

[00205]. Knock down of AKAP450/CG-NAP interferes with centrosomal protein expression and the Golgi architecture

[00206]. To gain insight into the specific role of AKAP450/CG-NAP in the maintenance of centrosome and Golgi architecture in motile T-cells, resting and LFA- 1/ICAM-1 stimulated T-cells were co-immunostained for endogenous AKAP450/CG- NAP and centrosomal marker proteins (pericentrin, γ-tubulin), cis-Golgi marker GM1 30 or trans-Golgi marker protein TGN46. Confocal microscopy analysis showed strong adjacent localization of AKAP450/CG-NAP with pericentrin, γ-tubulin, GM1 30 and TGN46 in both resting as well as in LFA-1 -stim ulated migrating HuT78 T-cells (data not shown). Similar results were obtained with PBL T-cells (data not shown).

While both pericentrin and γ-tubulin proteins remained intact at the centrosome in AKAP450/CG-NAP Knock down HuT78 T-cells, their expression levels were reduced in AKAP450/CG-NAP Knock down cells in comparison to control cells (Fig. 16A). A marginal decrease in GM1 30 and a significant decrease in TGN46 protein levels were also observed in AKAP450/CG-NAP depleted HuT78 T-cells (Fig. 16B). Interestingly, it was detected that AKAP450/CG-NAP knockdown caused substantial breakdown of cis- and trans-Golgi structures in LFA-1 -stimulated HuT78 cells (Data not shown). Sim ilar disruption of Golgi architecture and inhibition of LFA-1 stimulated cell migration were also observed in HuT78 cells pre-treated with Nocodazole or Brefeldin A (data not shown). These results suggest that AKAP450/CG-NAP is required for the maintenance of centrosome and Golgi structures.

[00207]. Co-immunoprecipitation protein-protein interaction assay

[00208]. HuT78 or PBL T-cells were induced to migrate on ICAM- coated 6-well plate (4.5 χ 106 cells/sample) and then lysed in cell lysis buffer at 4°C for 20 min as described previously41 . Cellular lysates were centrifuged at 10,000 rpm for 10 min at

° and the supernatant fraction was used for immunoprecipitation overnight using 2 µg of the required antibody or normal IgG as a control antibody. Protein A G plus agarose beads (25 µ Ι/sample) were added to the cell lysates for another 2 h at 4°C. The beads containing immune complexes were washed five times using the wash buffer (20 mM HEPES pH 7.4, 0.1 % Triton X-1 00, 130 mM NaCI, 10% glycerol, 1 mM PMSF, 10 mM sodium fluoride, 2 mM sodium vanadate and protease inhibitor cocktail), and then boiled in sample buffer for 5 min. The immune-complex samples were resolved on SDS-PAGE and transferred to a nitrocellulose membrane for Western immunoblot analysis.

[00209]. AKAP450/CG-NAP is vital for microtubule distribution and oc-tubulin post-translational modifications in migrating T-cells

[0021 0]. oc-Tubulin-Golgi interaction plays a crucial role in the stability of microtubule networks and positioning of the Golgi5. In addition, it has previously been demonstrated that post-translational modifications of oc-tubulin are functionally important for T-cell migration6. While control resting HuT78 cells showed radial arrays of oc-tubulin distribution (data not shown), LFA-1 -induced migratory T-cells showed distinct distribution of microtubule arrays nucleating from the MTOC towards both leading edge and uropod (data not shown) . In contrast, oc-tubulin network appeared collapsed in AKAP450/CG-NAP depleted HuT78 cells (Fig. 17). Acetylated oc-tubulin networks were found to be radiating from the centrosome in both resting and migrating control cells (data not shown) , but were absent in AKAP450/CG-NAP knock down HuT78 T-cells (Fig. 17). Similarly, detyrosinated oc-tubulin was localized as a compact MTOC structure in AKAP450/CG-NAP knockdown HuT78 cells unlike control cells that displayed intense staining emanating from the MTOC (data not shown).

[0021 1] . AKAP450/CG-NAP plays a crucial role in centrosomal and non- centrosomal microtubule nucleation in motile T-cells

[0021 2]. Microtubule regrowth assay was next performed to examine the recovery pattern of microtubules in control and AKAP450/CG-NAP-knock down HuT78 T-cells following LFA-1 stimulation . In this assay, microtubule networks were first depolymerised by incubating cells at 4SC for 40 min . Cells were then allowed to recover at 37SC for up to 60 sec, fixed, co-immunostained for oc-tubulin and AKAP450/CG-NAP together with γ-tubulin, pericentrin or GM1 30 and imaged by confocal microscopy and 3D-SI M . It was detected that the microtubule networks were completely depolymerized due to 4SC cold treatment (data not shown). The initiation of microtubule regrowth i.e. centrosomal microtubule asters originating from the protein complexes consisting of AKAP450/CG-NAP, γ-tubulin and pericentrin could be seen after 10 sec recovery from 4SC cold treatment in both resting and migrating control HuT78 T-cells (data not shown). These microtubule arrays further extended at 20 sec leading to a complete microtubule network formation by the end of 60 sec.

However, microtubule networks failed to regrow in AKAP450/CG-NAP knockdown cells (data not shown) . These results suggested that AKAP450/CG-NAP is crucial for anchoring γ-tubulin and pericentrin at the centrosome for microtubule nucleation in T- cells.

[0021 3]. Microtubule regrowth assay [0021 4]. Control or AKAP450/CG-NAP depleted T-cells were seeded on rlCAM-1 - or Poly-L-Lysine-coated coverslips and incubated at 37°C for 2 h as described above. Microtubules were depolymerized by incubating cells at 4°C in RPMI for additional 40 min . Cells were washed with RPMI and incubated at 37°C for various time points [0 (control) 10 , 20 and 60 sec] depending on the experiments to allow microtubule regrowth. Cells were then fixed after recovery in 4% formaldehyde and processed for immunofluorescence microscopy.

[0021 5]. Notably, apart from the centrosomal region defined by the presence of

γ-tubulin and pericentrin, it was observed that AKAP450/CG-NAP localization at the majority of the non-centrosomal microtubule nucleation sites in both resting and LFA- 1-stimulated T-cells. Microtubule depolymerisation disassembled the centrosomal localization of AKAP450/CG-NAP and a substantial amount of this protein appeared as punctuate structures dispersed throughout the cytoplasm in addition to the centrosome. In contrast to earlier studies with the immortalised human pigment epithelial cells hTERT-RPE1 , which showed that cold treatment did not affect the

Golgi structures, dispersal of GM1 30 staining pattern in HuT78 T-cells was observed. Further, it was observed that 4SC cold treatment of control resting or LFA-1 - stimulated T-cells could also fragment pericentrin and γ-tubulin localization into 3 - 5 distinct structures, but they remained associated with AKAP450/CG-NAP (data not shown). Sim ilar observations were also recorded in primary PBL T-cells (data not shown). These data confirmed a crucial role of AKAP450/CG-NAP in maintaining the intactness or architecture of centrosomal proteins.

[0021 6]. AKAP450/CG-NAP is essential for the localization of PKARI Ia at the microtubule nucleation sites in migrating T-cells

[0021 7]. AKAP450/CG-NAP was shown to interact with the regulatory subunit of PKA (PKARIIa) in epithelial cell line HeLa and fibroblast-like cell line COS78, suggesting a role for this protein in coordinating the localization and enzyme activity of PKA towards its substrates at centrosome and Golgi apparatus. In both resting and migrating HuT78 T-cells, co-localization of AKAP450/CG-NAP and PKARI Ia was detected; whereas AKAP450/CG-NAP knockdown caused loss of centrosomal localization of PKARI Ia(data not shown). Co-immunoprecipitation experiments further confirmed a strong interaction between AKAP450/CG-NAP and PKARI Ia proteins in resting and migrating PBL T-cells (data not shown). [0021 8]. To investigate if AKAP450/CG-NAP regulates the centrosomal and Golgi localization of PKARI Ia, resting and LFA-1 -stimulated control or AKAP450/CG-NAP knockdown HuT78 cells were co-immunostained for PKARI Ia and pericentrin , γ-tubulin or GM1 30. In control resting as well as LFA-stimulated HuT78 T-cells, a strong colocalization of PKARIIa with the above-mentioned three organelle markers was observed (data not shown). In contrast, knockdown of

AKAP450/CG-NAP expression in HuT78 T-cells profoundly disturbed PKARIIa localization and also interrupted its colocalization with pericentrin, γ-tubulin or GM1 30 (data not shown). Furthermore, microtubule regrowth experiments using wild-type or AKAP450/CG-NAP knockdown HuT78 cells showed that AKAP450/CG-NAP was strongly associated with PKARI Ia at microtubule nucleation sites in both resting and LFA-1 -stimulated T-cells (data not shown). These results confirm the requirement of AKAP450/CG-NAP for PKA localization at centrosome, Golgi and microtubule nucleation sites.

[0021 9]. AKAP450/CG-NAP, pericentrin and dynein are potential substrates of

PKA in T-cells

[00220]. It was investigated if AKAP450/CG-NAP is a substrate of PKA in T- lymphocytes. For this purpose, T-cells were serum starved for 4 h followed by treatment with forskolin, a potent activator of adenylyl cyclase that elevates cAMP- dependent PKA activity, at a concentration of 30 µΜ for 30 min . Cellular lysates of untreated or forskolin pre-treated T-cells were pulled down using phospho-PKA substrate antibody and analyzed by Western immunoblotting. In addition to pericentrin and dynein as PKA substrates under control conditions, AKAP450/CG-

NAP was identified as a new phosphorylation candidate of PKA in T-cells (Fig. 18A). Co-immunoprecipitation studies with anti-PKARIIa antibody further showed that

PKARI Ia interacts with pericentrin in both resting and migrating T-cells, with stronger interaction in migrating T-cells than in resting T-cells (Fig. 18B). A strong interaction between PKARI Ia with dynein was also detected although there was no difference in the levels of interaction between resting and migrating T-cells (Fig. 18B).

[00221 ] . It was next determined if AKAP450/CG-NAP co-ordinates PKA- mediated phosphorylation of pericentrin and dynein in T-cells. For this purpose, control or AKAP450/CG-NAP-knock down T-cells were treated with forskolin and immunoprecipitated with phospho-PKA substrate antibody. Interestingly, while control T-cells showed a distinct phosphorylated form of dynein and pericentrin, loss of

AKAP450/CG-NAP expression resulted in substantially decreased levels of phosphorylation of dynein and pericentrin (Fig. 18C). These data suggest critical involvement of AKAP450/CG-NAP as a scaffold for the phosphorylation of dynein and pericentrin by PKA in T-cells.

[00222]. Antibodies and reagents

[00223]. Anti-AKAP450/CG-NAP and anti-GM1 30 mouse monoclonal antibodies were purchased from BD Biosciences. Rabbit polyclonal anti-GM1 30 was from MBL International. Anti-Dynein IC and GAPDH mouse antibodies were from Merck Millipore. Anti-PKARI Ia monoclonal and polyclonal antibodies were purchased from Santa Cruz Biotechnology. Rabbit polyclonal anti-pericentrin and anti-TGN46 antibodies were procured from Abeam. FITC conjugated anti-a-tubulin , rabbit polyclonal detyrosinated a-tubulin antibody and Nocodazole were from Sigma. Rabbit polyclonal anti-acetylated a-tubulin antibody and Forskolin were from Cell Signalling Technologies. Secondary antibodies included anti-rabbit and anti-mouse Alexa Fluor 568, Alexa Fluor 488 and Alexa Fluor 633 (Molecular probes). Rhodamine-phalloidin, Alexa Fluor 488 conjugated anti-a-tubulin and Hoechst 33342 were from Life Technologies. Brefeldin-A was from Calbiochem . Recombinant human IL-2 and SDF-1 a were from Peprotech.

[00224]. In this study, clear and strong evidence is provided that the adaptor protein AKAP450/CG-NAP regulates centrosomal and non-centrosomal microtubule nucleation in migrating T-cells. This giant 450 kDa adaptor protein is abundantly expressed in human T-cells and predominantly localized to the centrosomal regions, where it directly interacts with pericentrin and γ-tubulin. AKAP450/CG-NAP also co- localizes with GM1 30 and TGN46 at the cis- and trans-Golgi respectively (Fig. 19). Thus, AKAP450/CG-NAP is not only a classical component of the cytoskeleton but it also localizes in the vicinity of centrioles or outside the centrosome in the cytoplasm as "pericentriolar satellites'Or "centriolar satellites". The distinct localization of AKAP450/CG-NAP at the microtubule nucleating organelles and pericentriolar satellites in human T-cells clearly indicate its crucial involvement in T-cell migration and other functions.

[00225]. The indispensability of AKAP450/CG-NAP for microtubule nucleation in T-cells was also demonstrated in the present study by the fact that knock down of this protein led to the loss of non-centrosomal microtubule nucleation at the cell surface with only limited centrosomal microtubule nucleation.

[00226]. Knockdown of AKAP450/CG-NAP expression in T-cells also disrupted microtubule assembly, affected oc-tubulin posttranslational modifications and interfered with microtubule nucleation at the Golgi that ultimately inhibited T-cell motility. The observation that AKAP450/CG-NAP knockdown decreased the expression levels of centrosomal proteins, pericentrin and γ -tubulin, without substantially interfering their localization suggests a possible role for AKAP450/CG-

NAP in transcription regulation. AKAP450/CG-NAP knockdown did not affect the ability of activated T-cells to secrete IL-2 or IF N -γ (Fig.7B and 7E. The observed loss of centrosomal and non-centrosomal microtubule nucleation in AKAP450/CG-NAP- depleted T-cells could be due to the recruitment of γ -tubulin and other proteins required for MT nucleation at the MTOCs. Notably, AKAP450/CG-NAP knockdown fragmented localisation of cis- and trans-Golgi proteins, GM1 30 and TGN46 suggesting that the adaptor protein is essential for the structural maintenance of the Golgi apparatus.

[00227]. Using the chimeric oligonucleotide specific to knock down AKAP450/CG-NAP mRNA it was determined that AKAP450/CG-NAP plays a central role as a downstream effector of LFA-1 signalling by i) regulating microtubule nucleation and anchoring of microtubule filaments, ii) maintaining centrosomal architecture and iii) recruiting and co-ordinating multi-protein complexes, which are essential for the active and highly dynamic process of T-cell motility.

[00228]. Statistical Analysis

[00229]. Statistical significance of differences among two experimental groups was analyzed by two-tailed unpaired Student's t test. The level of significance was shown at 3 levels, viz. , *0.05, **0.01 and ***0.001 .

[00230].

[00231 ] . Throughout this document, unless otherwise indicated to the contrary, the terms "comprising", "consisting of", "having" and the like, are to be construed as non-exhaustive, or in other words, as meaning "including, but not limited to". [00232]. Furthermore, throughout the specification, unless the context requires otherwise, the word "include" or variations such as "includes" or "including" will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers.

[00233]. As used in the specification, the singular form "a", "an" and "the" include plural references unless the context clearly dictates otherwise.

[00234]. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by a skilled person to which the subject matter herein belongs.

[00235]. It should be further appreciated by the person skilled in the art that variations and combinations of features described above, not being alternatives or substitutes, may be combined to form yet further embodiments falling within the intended scope of the invention. Claims:

1. A lymphocyte permeating chimeric oligonucleotide for inhibiting protein expression in a lymphocyte comprising a sequence of formula I:

Ln-Xm-Lo,

Wherein L comprises a locked nucleic acid;

X comprises a sequence of a deoxyribonucleic acids complementary to a section of a target messenger ribonucleic acid ; n and o are independently 2 or 3 ; and m is 8 to 10 .

2 . The oligonucleotide according to claim 1, wherein a 5 prime end of the oligonucleotide comprises a locked nucleic acid with an adenine base or derivative thereof.

3 . The oligonucleotide according to claim 1, wherein a 3 prime end of the oligonucleotide comprises an adenine base a locked nucleic acid with an adenine base or derivative thereof..

4 . The oligonucleotide according to claim 1, wherein the sequence of formula I is any one of the nucleic acid sequences selected from the group identified by SEQ ID NOS. 1 to 10 .

5 . The oligonucleotide according to any one of claims 1-3, wherein the target messenger ribonucleic acid is selected from the group of nucleic acid sequences identified by SEQ ID NOS. 12 to 16 .

6 . The oligonucleotide according to any one of claims 1-5, wherein the lymphocyte comprises a T-cell.

7 . The oligonucleotide according to any one of claims 4 to 6 for use in treating immune- mediated disease, preferably autoimmune disease.

8 . The oligonucleotide according to any one of claims 4 to 6 for use in treating cancer.

9 . The oligonucleotide for use according to claim 8 , wherein the cancer is lymphoma or leukaemia. 10 . The oligonucleotide for use according to claim 9 , wherein the lymphoma comprises Sezary Syndrome, or Mycosis Fungoides.

11. Use of a lymphocyte permeating chimeric oligonucleotide comprising a sequence of formula I:

Wherein L comprises a locked nucleic acid;

1 . The use according to claim 11, wherein a 5 prime end of the oligonucleotide comprises a locked nucleic acid with an adenine base or derivative thereof.

13 . The use according to claim 11, wherein a 3 prime end of the oligonucleotide comprises an adenine base a locked nucleic acid with an adenine base or derivative thereof.

14 . The use according to claim 11, wherein the sequence of formula I is any one of the nucleic acid sequences selected from the group identified by SEQ ID NOS. 1 to 10 .

15 . The use according to any one of claims 11- 13 , wherein the target messenger ribonucleic acid is selected from the group of nucleic acid sequences identified by SEQ ID NOS. 12 to 16 .

16 . The use according to any one of claims 11- 15 , wherein the lymphocyte comprises a T-cell.

17 . A method for inhibiting protein expression in a lymphocyte comprising; providing to the lymphocyte a lymphocyte permeating chimeric oligonucleotide comprising a sequence of formula I:

Ln-Xm-Lo,

Wherein L comprises a locked nucleic acid; X comprises a sequence of a deoxyribonucleic acids complementary to a section of a target messenger ribonucleic acid ;

n and o are independently 2 or 3 ; and

m is 8 to 10 , whereby the lymphocyte permeating chimeric oligonucleotide binds to the complementary section of target messenger ribonucleic acid thereby inhibiting protein expression of the target messenger ribonucleic acid.

18 . The method according to claim 17 , wherein the method is in vitro.

19 . The method according to claim 17 , wherein the method is in vivo.

20. The method according to any one of claims 17 to 19 , further comprises selecting the section of the target mRNA and to form the deoxyribonucleic acids complementary thereto.

2 1. The method according to any one of claims 17 to 19 , wherein a 5 prime end of the oligonucleotide comprises a locked nucleic acid with an adenine base or derivative thereof.

22. The method according to any one of claims 17 to 19 , wherein a 3 prime end of the oligonucleotide comprises an adenine base a locked nucleic acid with an adenine base or derivative thereof.

23. The method according to any one of claims 17 to 19 , wherein the sequence of formula I is any one of the nucleic acid sequences selected from the group identified by SEQ ID NOS. 1 to 10 .

24. The method according to any one of claims 17 to 22, wherein the target messenger ribonucleic acid is selected from the group of nucleic acid sequences identified by SEQ ID NOS. 12 to 16 .

25. The method according to any one of claims 17to 24, wherein the lymphocyte comprises a T-cell.

26. The method according to any one of claims 19 to 25, further comprising administering the lymphocyte permeating chimeric oligonucleotide to a subject in need of treatment of a lymphocyte migration related disease. 27. The method according to claim 26, wherein the lymphocyte migration related disease is an autoimmune disease.

28. The method according to claim 26, wherein the lymphocyte migration related disease is cancer.

29. The method according to claim 28, wherein the cancer is lymphoma or leukaemia.

30. The method according to claim 29, wherein the lymphoma comprises Sezary Syndrome, or Mycosis Fungoides.

3 1. A process for inhibiting lymphocyte migration comprising;

providing to the lymphocyte a lymphocyte permeating chimeric oligonucleotide comprising a sequence of formula I:

Ln-Xm-Lo,

Wherein L comprises a locked nucleic acid;

X comprises a sequence of a deoxyribonucleic acids complementary to a section of a target messenger ribonucleic acid ;

n and o are independently 2 or 3 ; and

m is 8 to 10 ; and

inhibiting expression of the target messenger ribonucleic acid, wherein the target messenger ribonucleic acid expresses a protein involved in lymphocyte migration .

32. The process according to claim 3 1, wherein the process is in vitro.

33. The process according to claim 3 1, wherein the process is in vivo.

34. The process according to any one of claims 3 1 to 33, wherein a 5 prime end of the oligonucleotide comprises a locked nucleic acid with an adenine base or derivative thereof.

35. The process according to any one of claims 3 1 to 34, wherein a 3 prime end of the oligonucleotide comprises an adenine base a locked nucleic acid with an adenine base or derivative thereof. 36. The process according to any one of claims 3 1 to 33, wherein the sequence of formula I is any one of the nucleic acid sequences selected from the group identified by SEQ ID NOS. 1 to 10 .

37. The process according to any one of claims 3 1 to 36, wherein the target messenger ribonucleic acid is selected from the group of nucleic acid sequences identified by SEQ ID NOS. 1 to 16 .

38. The process according to any one of claims 3 1 to 37, wherein the lymphocyte comprises a T-cell.

39. The process according to any one of claims 3 1 to 38, further comprising administering the lymphocyte permeating chimeric oligonucleotide to a subject in need of treatment of a lymphocyte migration related disease.

40. The process according to claim 39, wherein the lymphocyte migration related disease is an autoimmune disease.

4 1. The process according to claim 40, wherein the lymphocyte migration related disease is cancer.

42. The process according to claim 4 1, wherein the cancer is lymphoma or leukaem ia.

43. The process according to claim 42, wherein the lymphoma comprises Sezary Syndrome, or Mycosis Fungoides.

44. Use of a lymphocyte permeating chimeric oligonucleotide according to any one of claims 1 to 6 in the manufacture of a medicament for the treatment of an immune-mediated disease, preferably autoimmune disease.

45. Use of a lymphocyte permeating chimeric oligonucleotide according to any one of claims 1 to 6 in the manufacture of a medicament for the treatment of cancer.

46. The use according to claim 45, wherein the cancer is lymphoma or leukaemia.

47. The use according to claim 46, wherein the lymphoma comprises Sezary Syndrome, or Mycosis Fungoides.

n erna ona app ca on o. PCT/SG201 7/050221

A. CLASSIFICATION OF SUBJECT MATTER

A61K 31/712 (2006.01) C12N 15/113 (2010.01) A61P 35/00 (2006.01) A61P 37/00 (2006.01) According to International Patent Classification (IPC)

B. FIELDS SEARCHED

Minimum documentation searched (classification system followed by classification symbols)

Documentation searched other than minimum documentation to the extent that such documents are included in the fields searched

Electronic data base consulted during the international search (name of data base and, where practicable, search terms used)

DATABASES: EPODOC, WPI, FAMPAT, BIOSIS, EMBASE, MEDLINE SEARCH TERMS: LOCKED NUCLEIC ACID, LNA, GAPMER, LYMPHOCYTES, B CELL, T CELL, CG-NAP, AKAP450, TALIN 1 , CD1 1a , PKCE, STATHMIN AND RELATED TERMS

C. DOCUMENTS CONSIDERED TO BE RELEVANT Category* I Citation of document, with indication, where appropriate, of the relevant passages I Relevant to claim No.

W O 201 3/1 23451 A 1 (ENZON PHARMACEUTICALS, INC. AND DANA- FARBER CANCER INSTITUTE, INC.) 22 August 201 3 Paragraphs [0046]-[0055], [001 0], [0083], [0099], [01 93]-[01 96], [0236]; Examples, 6 , 8 , 10 , 12 ; Figures 2C, 5B, 6C; Table 3 ; SEQ ID NO: 26 and 30

US 201 0/0323967 A 1 (HANSEN J.B.R. AND HOG A.M.) 23 December 201 0 Paragraphs [0096], [01 37], [01 69]-[01 73], [0291 ] , [0257]-[0267], [0270], [0288]; Example 4 , 10 , 12 ; Figure 18 ; Table 2 ; SEQ ID NO: 20 and 2 1

W O 201 4/1 88001 A 1 (SANTARIS PHARMA A/S) 27 November 201 4 Page 2 , Paragraphs 3-4; Page 3 , Paragraph 2 ; Page 36, Paragraph 5 ; Page 48, Paragraph 2 ; Examples 1-3, 5 ; Table 2

S Further documents are listed in the continuation of Box C. See patent family annex.

*Special categories of cited documents: "A" document defining the general state of the art which is not "T" later document published after the international filing date or considered to be of particular relevance priority date and not in conflict with the application but cited to understand the principle or theory underlying the invention Έ " earlier application or patent but published on or after the international filing date "X" document of particular relevance; the claimed invention cannot be considered novel or cannot be considered to "L" document which may throw doubts on priority claim(s) or involve an inventive step when the document is taken alone which is cited to establish the publication date of another citation or other special reason (as specified) "Y" document of particular relevance; the claimed invention cannot be considered to involve an inventive step when the Ό " document referring to an oral disclosure, use, exhibition or document is combined with one or more other such other means documents, such combination being obvious to a person "P" document published prior to the international filing date but skllled the art later than the priority date claimed "& document member of the same patent family

Date of the actual completion of the international search Date of mailing of the international search report

06/07/201 7 (day/month/year) 24/07/201 7 (day/month/year)

Name and mailing address of the ISA/SG Authorized officer Intellectual Property Office of Singapore 1 ras asahRoad ! OS Terence Tan (Dr) #01-01 Manulife Centre Singapore 189554 Email: [email protected] IPOS Customer Service Tel. No.: (+65) 6339 861 6

Form PCT/ISA/21 0 (second sheet) (January 201 5) n erna ona app ca on o. PCT/SG201 7/050221

C (Continuation). DOCUMENTS CONSIDERED TO BE RELEVANT

Category* Citation of document, with indication, where appropriate, of the relevant passages Relevant to claim No.

W O 201 0/1 20861 A 1 (ENZON PHARMACEUTICALS, INC. AND SANTARIS 1-26, 28-39, 4 1-47 PHARMA A/S) 2 1 October 201 0 Paragraphs [0048], [0082]-[0092]; Examples 4 , 10 , 11; Tables 3 , 5-7; SEQ ID NO: 145, 148, 15 1

EP 2225376 B 1 (SANTARIS PHARMA A/S) 8 January 201 4 1-26, 28-39, 4 1-47 Paragraphs [01 52]-[01 59], [0230]-[0232]; Examples 3-1 5 ; Table 3 ; SEQ ID NO: 32, 36

YAMAMOTO T . ET AL. , Evaluation of multiple-turnover capability of locked 1-25, 3 1-38 nucleic acid antisense oligonucleotides in cell-free RNase H-mediated antisense reaction and in mice. Nucleic Acid Ther. , 23 April 201 4 , Vol. 24, No. 4 , pages 283-290 [Retrieved on 201 7-07-06] Table 1

TURABE F. ET AL. , YIA-BSTR-03: A Novel Approach for Gene Silencing in 1-47 Human T-Lymphocytes with Therapeutic Implications. Annals of the Academy of Medicine Singapore, October 201 5 , Vol. 44, No. Suppl. 1, page S41 [Retrieved on 201 7-07-06] Abstract

W O 201 4/1 97826 A 1 (RANA THERAPEUTICS, INC.) 11 December 201 4 1-27, 3 1-40, 44 Page 2 , Lines 1- 12 ; Pages 48-50, Page 63, Lines 24-Page 64, Line 5 ; Examples 3 , 5 ; Figures 17-1 9 ; Tables 4 and 8 ; SEQ ID NO: 4571 4

P,X FAZIL M.H.U.T. ET AL. , GapmeR cellular internalization by macropinocytosis 1-47 induces sequence-specific gene silencing in human primary T-cells. Sci Rep. , 24 November 201 6 , Vol. 6 , pages 37721 : 1- 13 [Retrieved on 201 7-07-06] Whole document especially Table 1

P,X TURABE F.M.H.U. ET AL, Poster P886: Cell-penetrating antisense GapmeR for 1-47 functional gene silencing in human primary T-lymphocytes. Molecular Biology of the Cell, December 201 6 , Vol. 27, No. 25, pages 4802-4803 [Retrieved on 201 7-07-06] Abstract

P,X W O 201 6/091 747 A 1 (TASSONE P. ET AL.) 16 June 201 6 1-26, 28-39, 4 1-47 Page 10 , Paragraphs 1-2; Example 6 ; Figures 6 , 10 ; Table 1

Form PCT/ISA/21 0 (continuation of second sheet (2)) (January 201 5) n erna ona app ca on o. Information on patent family members PCT/SG201 7/050221

Note: This Annex lists known patent family members relating to the patent documents cited in this International Search Report. This Authority is in no way liable for these particulars which are merely given for the purpose of information.

Patent document Publication date Patent family Publication date cited in search report member(s)

WO 201 3 123451 A 1 22/08/201 3 US 201 6024495 A 1 28/01 /201 6

US 201 0323967 A 1 23/1 2/201 0 A U 2007306361 A 1 17/04/2008

A U 2008228243 A 1 25/09/2008

A U 200824421 1 A 1 06/1 1/2008

A U 2008250033 A 1 20/1 1/2008

A U 2008292091 A 1 05/03/2009

A U 2008329327 A 1 04/06/2009

AU200833371 4 A 1 11/06/2009

A U 201 1326034 A 1 02/05/201 3

BRPI 0820892 A2 04/1 1/201 4

CA 26661 9 1 A 1 17/04/2008

CA 2681 406 A 1 25/09/2008

CA 2685444 A 1 06/1 1/2008

CA 2686908 A 1 20/1 1/2008

CA 2697970 A 1 05/03/2009

CA 2701 895 A 1 09/04/2009

CA 270571 4 A 1 04/06/2009

CA 2707539 A 1 11/06/2009

CN 10 1842483 A 22/09/201 0

CN 10 1849007 A 29/09/201 0

CN 10 1932709 A 29/1 2/201 0

CN 10 1939429 A 05/01 /201 1

DK 2 149605 T3 30/09/201 3

DK 2 152879 T3 18/02/201 3

DK 2225377 T3 07/04/201 4

WO 201 4 188001 A 1 27/1 1/201 4 CA 2907694 A 1 27/1 1/201 4

CN 105247052 A 13/01 /201 6

EP 3004352 A 1 13/04/201 6

HK 12 13595 A 1 08/07/201 6

JP 201 652031 0 A 14/07/201 6

KR 201 6001 3 1 10 A 03/02/201 6

MX 201 501 5564 A 05/02/201 6

US 201 6 130582 A 1 12/05/201 6

WO 201 0 120861 A 1 2 1/ 10/201 0 A R 076053 A 1 18/05/201 1

CA 2758005 A 1 2 1/ 10/201 0

CN 102395374 A 28/03/201 2

Form PCT/ISA/21 0 (patent family annex) (January 201 5) n erna ona app ca on o. Information on patent family members PCT/SG201 7/050221

Patent document Publication date Patent family Publication date cited in search report member(s)

EA 201 17 1244 A 1 30/05/201 2

EP 241 9 1 10 A 1 22/02/201 2

JP 201 2524096 A 11/ 10/201 2

KR 201 4001 4367 A 06/02/201 4

TW 201 03661 9 A 16/1 0/201 0

EP 2225376 A2 08/09/201 0 A U 2007306361 A 1 17/04/2008

A U 2008228243 A 1 25/09/2008

A U 200824421 1 A 1 06/1 1/2008

A U 2008250033 A 1 20/1 1/2008

A U 2008292091 A 1 05/03/2009

A U 2008329327 A 1 04/06/2009

A U 200833371 4 A 1 11/06/2009

A U 201 1326034 A 1 02/05/201 3

BRPI 0820892 A2 04/1 1/201 4

CA 26661 9 1 A 1 17/04/2008

CA 2681 406 A 1 25/09/2008

CA 2685444 A 1 06/1 1/2008

CA 2686908 A 1 20/1 1/2008

CA 2697970 A 1 05/03/2009

CA 2701 895 A 1 09/04/2009

CA 270571 4 A 1 04/06/2009

CA 2707539 A 1 11/06/2009

CN 10 1842483 A 22/09/201 0

CN 10 1849007 A 29/09/201 0

CN 10 1932709 A 29/1 2/201 0

CN 10 1939429 A 05/01 /201 1

DK 2 149605 T3 30/09/201 3

DK 2 152879 T3 18/02/201 3

DK 2225377 T3 07/04/201 4

WO 201 4 197826 A 1 11/ 12/201 4 A U 201 4274730 A 1 2 1/01 /201 6

CA 291 4536 A 1 11/ 12/201 4

EP 3004354 A 1 13/04/201 6

JP 201 6521 556 A 25/07/201 6

KR 201 60027968 A 10/03/201 6

US 201 6 122760 A 1 05/05/201 6

WO 201 6091 747 A 1 16/06/201 6 NONE

Form PCT/ISA/21 0 (patent family annex) (January 201 5)