CRISPR/Cas9: Principle, Applications, and Delivery Through Extracellular Vesicles
Total Page:16
File Type:pdf, Size:1020Kb

Load more
Recommended publications
-
Genetic Epidemiology
Received: 10 May 2019 | Revised: 31 July 2019 | Accepted: 28 August 2019 DOI: 10.1002/gepi.22260 RESEARCH ARTICLE Population‐wide copy number variation calling using variant call format files from 6,898 individuals Grace Png1,2,3 | Daniel Suveges1,4 | Young‐Chan Park1,2 | Klaudia Walter1 | Kousik Kundu1 | Ioanna Ntalla5 | Emmanouil Tsafantakis6 | Maria Karaleftheri7 | George Dedoussis8 | Eleftheria Zeggini1,3* | Arthur Gilly1,3,9* 1Wellcome Sanger Institute, Wellcome Genome Campus, Hinxton, United Abstract Kingdom Copy number variants (CNVs) play an important role in a number of human 2Department of Medical Genetics, diseases, but the accurate calling of CNVs remains challenging. Most current University of Cambridge, Cambridge, approaches to CNV detection use raw read alignments, which are computationally United Kingdom intensive to process. We use a regression tree‐based approach to call germline CNVs 3Institute of Translational Genomics, Helmholtz Zentrum München—German from whole‐genome sequencing (WGS, >18x) variant call sets in 6,898 samples Research Center for Environmental across four European cohorts, and describe a rich large variation landscape Health, Neuherberg, Germany comprising 1,320 CNVs. Eighty‐one percent of detected events have been previously 4European Bioinformatics Institute, ‐ ‐ Wellcome Genome Campus, Hinxton, reported in the Database of Genomic Variants. Twenty three percent of high quality United Kingdom deletions affect entire genes, and we recapitulate known events such as the GSTM1 5William Harvey Research Institute, Barts and RHD gene deletions. We test for association between the detected deletions and and The London School of Medicine and 275 protein levels in 1,457 individuals to assess the potential clinical impact of the Dentistry, Queen Mary University of London, London, United Kingdom detected CNVs. -
Identification of the Binding Partners for Hspb2 and Cryab Reveals
Brigham Young University BYU ScholarsArchive Theses and Dissertations 2013-12-12 Identification of the Binding arP tners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non- Redundant Roles for Small Heat Shock Proteins Kelsey Murphey Langston Brigham Young University - Provo Follow this and additional works at: https://scholarsarchive.byu.edu/etd Part of the Microbiology Commons BYU ScholarsArchive Citation Langston, Kelsey Murphey, "Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins" (2013). Theses and Dissertations. 3822. https://scholarsarchive.byu.edu/etd/3822 This Thesis is brought to you for free and open access by BYU ScholarsArchive. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of BYU ScholarsArchive. For more information, please contact [email protected], [email protected]. Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston A thesis submitted to the faculty of Brigham Young University in partial fulfillment of the requirements for the degree of Master of Science Julianne H. Grose, Chair William R. McCleary Brian Poole Department of Microbiology and Molecular Biology Brigham Young University December 2013 Copyright © 2013 Kelsey Langston All Rights Reserved ABSTRACT Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactors and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston Department of Microbiology and Molecular Biology, BYU Master of Science Small Heat Shock Proteins (sHSP) are molecular chaperones that play protective roles in cell survival and have been shown to possess chaperone activity. -
Pooled CRISPR-Activation Screening Coupled with Single-Cell RNA-Seq in Mouse Embryonic Stem Cells
ll OPEN ACCESS Protocol Pooled CRISPR-activation screening coupled with single-cell RNA-seq in mouse embryonic stem cells Celia Alda-Catalinas, Melanie A. Eckersley-Maslin, Wolf Reik celia.x.aldacatalinas@gsk. com (C.A.-C.) [email protected]. uk (W.R.) Highlights Protocol for CRISPRa screens with single- cell readout to interrogate gene function Detailed description of CRISPRa screening procedures in mouse embryonic stem cells Detailed steps on how to construct derived single-cell sgRNA amplicon libraries CRISPR/Cas9 screens are a powerful approach to identify key regulators of biological processes. By combining pooled CRISPR/Cas9 screening with a single-cell RNA-sequencing readout, individual perturbations can be assessed in parallel both comprehensively and at scale. Importantly, this allows gene function and regulation to be interrogated at a cellular level in an unbiased manner. Here, we present a protocol to perform pooled CRISPR-activation screens in mouse embryonic stem cells using 103 Genomics scRNA-seq as a readout. Alda-Catalinas et al., STAR Protocols 2, 100426 June 18, 2021 ª 2021 The Authors. https://doi.org/10.1016/ j.xpro.2021.100426 ll OPEN ACCESS Protocol Pooled CRISPR-activation screening coupled with single-cell RNA-seq in mouse embryonic stem cells Celia Alda-Catalinas,1,4,7,* Melanie A. Eckersley-Maslin,1,5,6 and Wolf Reik1,2,3,8,* 1Epigenetics Programme, Babraham Institute, Cambridge CB22 3AT, UK 2Wellcome Trust Sanger Institute, Hinxton, Cambridge CB10 1SA, UK 3Centre for Trophoblast Research, University of -
A CRISPR Activation and Interference Toolkit for Industrial Saccharomyces Cerevisiae Strain KE6‑12 Elena Cámara, Ibai Lenitz & Yvonne Nygård*
www.nature.com/scientificreports OPEN A CRISPR activation and interference toolkit for industrial Saccharomyces cerevisiae strain KE6‑12 Elena Cámara, Ibai Lenitz & Yvonne Nygård* Recent advances in CRISPR/Cas9 based genome editing have considerably advanced genetic engineering of industrial yeast strains. In this study, we report the construction and characterization of a toolkit for CRISPR activation and interference (CRISPRa/i) for a polyploid industrial yeast strain. In the CRISPRa/i plasmids that are available in high and low copy variants, dCas9 is expressed alone, or as a fusion with an activation or repression domain; VP64, VPR or Mxi1. The sgRNA is introduced to the CRISPRa/i plasmids from a double stranded oligonucleotide by in vivo homology‑directed repair, allowing rapid transcriptional modulation of new target genes without cloning. The CRISPRa/i toolkit was characterized by alteration of expression of fuorescent protein‑encoding genes under two diferent promoters allowing expression alterations up to ~ 2.5‑fold. Furthermore, we demonstrated the usability of the CRISPRa/i toolkit by improving the tolerance towards wheat straw hydrolysate of our industrial production strain. We anticipate that our CRISPRa/i toolkit can be widely used to assess novel targets for strain improvement and thus accelerate the design‑build‑test cycle for developing various industrial production strains. Te yeast Saccharomyces cerevisiae is one of the most commonly used microorganisms for industrial applications ranging from wine and beer fermentations to the production of biofuels and high-value metabolites1,2. How- ever, some of the current production processes are compromised by low yields and productivities, thus further optimization is required3. -
Advances in Genomics for Drug Development
G C A T T A C G G C A T genes Review Advances in Genomics for Drug Development Roberto Spreafico , Leah B. Soriaga, Johannes Grosse, Herbert W. Virgin and Amalio Telenti * Vir Biotechnology, Inc., San Francisco, CA 94158, USA; Rspreafi[email protected] (R.S.); [email protected] (L.B.S.); [email protected] (J.G.); [email protected] (H.W.V.) * Correspondence: [email protected] Received: 24 July 2020; Accepted: 13 August 2020; Published: 15 August 2020 Abstract: Drug development (target identification, advancing drug leads to candidates for preclinical and clinical studies) can be facilitated by genetic and genomic knowledge. Here, we review the contribution of population genomics to target identification, the value of bulk and single cell gene expression analysis for understanding the biological relevance of a drug target, and genome-wide CRISPR editing for the prioritization of drug targets. In genomics, we discuss the different scope of genome-wide association studies using genotyping arrays, versus exome and whole genome sequencing. In transcriptomics, we discuss the information from drug perturbation and the selection of biomarkers. For CRISPR screens, we discuss target discovery, mechanism of action and the concept of gene to drug mapping. Harnessing genetic support increases the probability of drug developability and approval. Keywords: druggability; loss-of-function; CRISPR 1. Introduction For over 20 years, genomics has been used as a tool for accelerating drug development. Various conceptual approaches and techniques assist target identification, target prioritization and tractability, as well as the prediction of outcomes from pharmacological perturbations. These basic premises are now supported by a rapid expansion of population genomics initiatives (sequencing or genotyping of hundreds of thousands of individuals), in-depth understanding of disease and drug perturbation at the tissue and single-cell level as measured by transcriptome analysis, and by the capacity to screen for loss of function or activation of genes, genome-wide, using CRISPR technologies. -
Supplementary Information Integrative Analyses of Splicing in the Aging Brain: Role in Susceptibility to Alzheimer’S Disease
Supplementary Information Integrative analyses of splicing in the aging brain: role in susceptibility to Alzheimer’s Disease Contents 1. Supplementary Notes 1.1. Religious Orders Study and Memory and Aging Project 1.2. Mount Sinai Brain Bank Alzheimer’s Disease 1.3. CommonMind Consortium 1.4. Data Availability 2. Supplementary Tables 3. Supplementary Figures Note: Supplementary Tables are provided as separate Excel files. 1. Supplementary Notes 1.1. Religious Orders Study and Memory and Aging Project Gene expression data1. Gene expression data were generated using RNA- sequencing from Dorsolateral Prefrontal Cortex (DLPFC) of 540 individuals, at an average sequence depth of 90M reads. Detailed description of data generation and processing was previously described2 (Mostafavi, Gaiteri et al., under review). Samples were submitted to the Broad Institute’s Genomics Platform for transcriptome analysis following the dUTP protocol with Poly(A) selection developed by Levin and colleagues3. All samples were chosen to pass two initial quality filters: RNA integrity (RIN) score >5 and quantity threshold of 5 ug (and were selected from a larger set of 724 samples). Sequencing was performed on the Illumina HiSeq with 101bp paired-end reads and achieved coverage of 150M reads of the first 12 samples. These 12 samples will serve as a deep coverage reference and included 2 males and 2 females of nonimpaired, mild cognitive impaired, and Alzheimer's cases. The remaining samples were sequenced with target coverage of 50M reads; the mean coverage for the samples passing QC is 95 million reads (median 90 million reads). The libraries were constructed and pooled according to the RIN scores such that similar RIN scores would be pooled together. -
Improving Treatment of Genetic Diseases with Crispr-Cas9 Rna-Guided Genome Editing
Sanchez 3:00 Team R06 Disclaimer: This paper partially fulfills a writing requirement for first-year (freshmen) engineering students at the University of Pittsburgh Swanson School of Engineering. This paper is a student paper, not a professional paper. This paper is not intended for publication or public circulation. This paper is based on publicly available information, and while this paper might contain the names of actual companies, products, and people, it cannot and does not contain all relevant information/data or analyses related to companies, products, and people named. All conclusions drawn by the authors are the opinions of the authors, first- year (freshmen) students completing this paper to fulfill a university writing requirement. If this paper or the information therein is used for any purpose other than the authors' partial fulfillment of a writing requirement for first-year (freshmen) engineering students at the University of Pittsburgh Swanson School of Engineering, the users are doing so at their own--not at the students', at the Swanson School's, or at the University of Pittsburgh's--risk. IMPROVING TREATMENT OF GENETIC DISEASES WITH CRISPR-CAS9 RNA-GUIDED GENOME EDITING Arijit Dutta [email protected] , Benjamin Ahlmark [email protected], Nate Majer [email protected] Abstract—Genetic illnesses are among the most difficult to treat as it is challenging to safely and effectively alter DNA. INTRODUCTION: THE WHAT, WHY, AND DNA is the basic code for all hereditary traits, so any HOW OF CRISPR-CAS9 alteration to DNA risks fundamentally altering the way someone’s genes are expressed. This change could lead to What Is CRISPR-Cas9? unintended consequences for both the individual whose DNA was altered and any offspring they may have in the future, CRISPR-Cas9 is an acronym that stands for “Clustered compounding the risk. -
CRISPR/Cas9: Tools and Applications for Eukaryotic Genome Editing
CRISPR/Cas9: Tools and Applications for Eukaryotic Genome Editing Fei Ann Ran Broad Institute Cambridge, Massachusetts [email protected] I will provide some background on the CRISPR/Cas9 technology, some of the rationale for how we came to develop and use this tool, and I will address immediate questions concerning the specificity of the technology. I will also discuss some of the more interest- ing applications. Figure 1 reflects how the cost of DNA sequencing has decreased dramatically over the past two decades due to technological progress. As a result, there has been an explo- sion of data, not only in the sequences of different species, but in sequence differences between individuals within species, between cell types and between diseased and healthy cells. It suffices to say that this is an exciting time to be working in the field of genome engineering. Genome Engineering Typically, genome engineering is achieved by leveraging the cell’s own repair machinery. This can come from the error-prone NHEJ pathway that leads to insertion/deletion (in- del) mutations, which can be used to knock out genes, or, alternatively, we can supply a repair template to overwrite the site of a double-stranded break (DSB) for more-precise genome engineering via the HDR pathway (Figure 2). Figure 1. Advances in DNA-sequencing technologies. (Stratton MR et al., 2009) When we started working on CRISPR/Cas technology1, several well developed tools were already being used—and still are being used—to achieve impressive results in bio- technology, medicine, agriculture, and other fields. At the outset, we were interested in developing an alternative technology to make cloning easier at lower cost with greater scalability. -
Supplementary Table S2
1-high in cerebrotropic Gene P-value patients Definition BCHE 2.00E-04 1 Butyrylcholinesterase PLCB2 2.00E-04 -1 Phospholipase C, beta 2 SF3B1 2.00E-04 -1 Splicing factor 3b, subunit 1 BCHE 0.00022 1 Butyrylcholinesterase ZNF721 0.00028 -1 Zinc finger protein 721 GNAI1 0.00044 1 Guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 GNAI1 0.00049 1 Guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 PDE1B 0.00069 -1 Phosphodiesterase 1B, calmodulin-dependent MCOLN2 0.00085 -1 Mucolipin 2 PGCP 0.00116 1 Plasma glutamate carboxypeptidase TMX4 0.00116 1 Thioredoxin-related transmembrane protein 4 C10orf11 0.00142 1 Chromosome 10 open reading frame 11 TRIM14 0.00156 -1 Tripartite motif-containing 14 APOBEC3D 0.00173 -1 Apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D ANXA6 0.00185 -1 Annexin A6 NOS3 0.00209 -1 Nitric oxide synthase 3 SELI 0.00209 -1 Selenoprotein I NYNRIN 0.0023 -1 NYN domain and retroviral integrase containing ANKFY1 0.00253 -1 Ankyrin repeat and FYVE domain containing 1 APOBEC3F 0.00278 -1 Apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3F EBI2 0.00278 -1 Epstein-Barr virus induced gene 2 ETHE1 0.00278 1 Ethylmalonic encephalopathy 1 PDE7A 0.00278 -1 Phosphodiesterase 7A HLA-DOA 0.00305 -1 Major histocompatibility complex, class II, DO alpha SOX13 0.00305 1 SRY (sex determining region Y)-box 13 ABHD2 3.34E-03 1 Abhydrolase domain containing 2 MOCS2 0.00334 1 Molybdenum cofactor synthesis 2 TTLL6 0.00365 -1 Tubulin tyrosine ligase-like family, member 6 SHANK3 0.00394 -1 SH3 and multiple ankyrin repeat domains 3 ADCY4 0.004 -1 Adenylate cyclase 4 CD3D 0.004 -1 CD3d molecule, delta (CD3-TCR complex) (CD3D), transcript variant 1, mRNA. -
Development and Applications of CRISPR-Cas9 for Genome Engineering
Leading Edge Review Development and Applications of CRISPR-Cas9 for Genome Engineering Patrick D. Hsu,1,2,3 Eric S. Lander,1 and Feng Zhang1,2,* 1Broad Institute of MIT and Harvard, 7 Cambridge Center, Cambridge, MA 02141, USA 2McGovern Institute for Brain Research, Department of Brain and Cognitive Sciences, Department of Biological Engineering, Massachusetts Institute of Technology, Cambridge, MA 02139, USA 3Department of Molecular and Cellular Biology, Harvard University, Cambridge, MA 02138, USA *Correspondence: [email protected] http://dx.doi.org/10.1016/j.cell.2014.05.010 Recent advances in genome engineering technologies based on the CRISPR-associated RNA- guided endonuclease Cas9 are enabling the systematic interrogation of mammalian genome function. Analogous to the search function in modern word processors, Cas9 can be guided to specific locations within complex genomes by a short RNA search string. Using this system, DNA sequences within the endogenous genome and their functional outputs are now easily edited or modulated in virtually any organism of choice. Cas9-mediated genetic perturbation is simple and scalable, empowering researchers to elucidate the functional organization of the genome at the systems level and establish causal linkages between genetic variations and biological phenotypes. In this Review, we describe the development and applications of Cas9 for a variety of research or translational applications while highlighting challenges as well as future directions. Derived from a remarkable microbial defense system, Cas9 is driving innovative applications from basic biology to biotechnology and medicine. Introduction of the genome and its functions. In biotechnology, precise The development of recombinant DNA technology in the 1970s manipulation of genetic building blocks and regulatory machin- marked the beginning of a new era for biology. -
Mir-17-92 Fine-Tunes MYC Expression and Function to Ensure
ARTICLE Received 31 Mar 2015 | Accepted 22 Sep 2015 | Published 10 Nov 2015 DOI: 10.1038/ncomms9725 OPEN miR-17-92 fine-tunes MYC expression and function to ensure optimal B cell lymphoma growth Marija Mihailovich1, Michael Bremang1, Valeria Spadotto1, Daniele Musiani1, Elena Vitale1, Gabriele Varano2,w, Federico Zambelli3, Francesco M. Mancuso1,w, David A. Cairns1,w, Giulio Pavesi3, Stefano Casola2 & Tiziana Bonaldi1 The synergism between c-MYC and miR-17-19b, a truncated version of the miR-17-92 cluster, is well-documented during tumor initiation. However, little is known about miR-17-19b function in established cancers. Here we investigate the role of miR-17-19b in c-MYC-driven lymphomas by integrating SILAC-based quantitative proteomics, transcriptomics and 30 untranslated region (UTR) analysis upon miR-17-19b overexpression. We identify over one hundred miR-17-19b targets, of which 40% are co-regulated by c-MYC. Downregulation of a new miR-17/20 target, checkpoint kinase 2 (Chek2), increases the recruitment of HuR to c- MYC transcripts, resulting in the inhibition of c-MYC translation and thus interfering with in vivo tumor growth. Hence, in established lymphomas, miR-17-19b fine-tunes c-MYC activity through a tight control of its function and expression, ultimately ensuring cancer cell homeostasis. Our data highlight the plasticity of miRNA function, reflecting changes in the mRNA landscape and 30 UTR shortening at different stages of tumorigenesis. 1 Department of Experimental Oncology, European Institute of Oncology, Via Adamello 16, Milan 20139, Italy. 2 Units of Genetics of B cells and lymphomas, IFOM, FIRC Institute of Molecular Oncology Foundation, Milan 20139, Italy. -
Recombinant S. Pyogenes CRISPR-Cas9 Catalog Number: 9957-C9
Recombinant S. pyogenes CRISPR-Cas9 Catalog Number: 9957-C9 DESCRIPTION Source E. coli-derived s. pyogenes CRISPR-Cas9 protein S. pyogenes CRISPR-Cas9 KRPAATKKAGQAKK- APKKKRKVGIHGVPAA (Asp2-Asp1368) HHHHHH KKGYGRKKRRQRRRG Accession # Q99ZW2 N-terminus C-terminus N-terminal Sequence Ala Analysis Predicted Molecular 164 kDa Mass SPECIFICATIONS SDS-PAGE 133 kDa, reducing conditions Activity Measured by its ability to cleave a targeted DNA substrate. S. pyogenes CRISPR-Cas9 achieves >80% substrate cleavage, as measured under the described conditions. Endotoxin Level <0.10 EU per 1 μg of the protein by the LAL method. Purity >95%, by SDS-PAGE visualized with Silver Staining and quantitative densitometry by Coomassie® Blue Staining. Formulation Supplied as a 0.2 μm filtered solution in Tris, NaCl, EDTA, Glycerol and TCEP. See Certificate of Analysis for details. Activity Assay Protocol Materials Assay Buffer: 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 µg/mL BSA, pH 7.9 Recombinant Streptococcus pyogenes CRISPR-Cas9 (rS. pyogenes Cas9) (Catalog # 9957-C9) PBR322 vector (NEB, Catalog # N3033S) digested with EcoRI-HF (NEB, Catalog # R3101S)* Dharmacon synthetic sgRNA, targeting sequence: GAGGCAGACAAGGTATAGGG Ethidium Bromide, 10 mg/mL (Amresco, Catalog # X328) Ultrapure DNase/RNase-Free Distilled Water (Invitrogen, Catalog # 10977015), to prepare Assay Buffer DNA gel *Digest was gel purified using gel purification kit and eluted in EB buffer (10 mM Tris-HCl, pH 8.5). Assay 1. Prepare RNP Complex: a. 600 nM sgRNA (6 µL addition from 3 µM stock prepared in Assay Buffer) b. 0.25 μg rS. pyogenes Cas9 c. Add Assay Buffer for a final RNP Complex volume of 26.5 µL d.