DOCSLIB.ORG

Glucose and Insulin Treatment of Insulinoma Cells Results In

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Glucose and Insulin Treatment of Insulinoma Cells Results In Glucose and Insulin Treatment of Insulinoma Cells Results in Transcriptional Regulation of a Common Set of Genes Mitsuru Ohsugi,1 Corentin Cras-Me´neur,1 Yiyong Zhou,1 Wesley Warren,2 Ernesto Bernal-Mizrachi,1 and M. Alan Permutt1 Glucose and insulin are important regulators of islet ␤-cell growth and function by activating signaling path- ways resulting in transcriptional changes that lead to ancreatic islet ␤-cells can be regulated by multi- adaptive responses. Several immediate early genes have ple stimuli, including nutrients and growth fac- been shown to be rapidly induced by glucose-activated tors. ␤-Cell proliferation and function are depolarization in islet ␤-cells. The current studies ad- controlled by plasma glucose concentration and dress aspects of glucose-regulated transcription: 1) the P by growth factors acting via multiple intracellular signal- number and characteristics of these genes, 2) if depo- larization is the major mechanism, and 3) if glucose- ing pathways (1). Changes in gene expression that result stimulated insulin secretion is responsible, because from the activation of these signaling pathways are likely insulin per se can activate transcription. Here, the responsible for the adaptation of ␤-cells to physiological expression profiles of glucose-responsive insulinoma and pathological states. However, large gaps in our knowl- cells 45 min after the addition of glucose, KCl to induce edge currently exist regarding the changes in gene expres- depolarization, or insulin were assessed by endocrine sion and the molecular mechanisms mediating these ␤-cell pancreas cDNA microarrays. Glucose activated more responses to nutrients and growth factors. than 90 genes, representing diverse gene ontology func- Some genes likely to be involved in chronic glucose tions, and most were not previously known to be glucose ␤ responsive. KCl activated 80% of these same glucose- regulation of islet -cell mass or function have been regulated genes and, along with the effects of pretreat- identified (2–6). We have focused on early signaling events ment with diazoxide, suggested that glucose signaling is initiated by glucose treatment of insulinoma cells that mediated primarily via depolarization. There were >150 result in rapid transient activation of a number of imme- genes activated by insulin, and remarkably 71% were diate early genes (IEGs). These include Egr1, Egr2, c-fos, also regulated by glucose. Preincubation with a phos- and c-jun, known to respond to growth factor stimulation phatidylinositol (PI) 3-kinase inhibitor resulted in al- in a number of other tissues (7). The signaling pathways most total inhibition of depolarization and insulin- for induction of IEGs exhibit considerable stimulus and activated transcriptional responses. Thus, through gene expression profiling, these data demonstrate that glu- tissue specificity and in general involve activation of cose and insulin rapidly activate a PI 3-kinase pathway, kinase/phosphatase cascades (8). Initial glucose-mediated resulting in transcription of a common set of genes. This signaling can represent the first step in elucidating long- is consistent with glucose activation of gene transcrip- term changes in gene expression and islet physiology. tion either directly or indirectly through a paracrine/ These signaling pathways, limited to the initial kinase/ autocrine effect via insulin release. These results phosphatase cascades, are critical for understanding how illustrate that expression gene profiling can contribute the ␤-cell responds to its environment. The events occur- ␤ to the elucidation of important -cell biological func- ring from the time the stimulus reaches the ␤-cell until the tions. Diabetes 53:1496–1508, 2004 signal is transmitted to the nucleus to activate or repress transcription of a particular set of genes may be crucial in understanding the defects in islet growth in diabetic From the 1Division of Endocrinology, Metabolism, and Lipid Research, subjects or the adverse consequences of glucose toxicity Department of Internal Medicine, Washington University School of Medicine, St. Louis, Missouri; and the 2Genome Sequencing Center, Washington Univer- on ␤-cell function. sity School of Medicine, St. Louis, Missouri. IEGs are often transcription factors that in turn activate Address correspondence and reprint requests to M. Alan Permutt, MD, Division of Endocrinology, Metabolism, and Lipid Research, Washington expression of downstream target genes, thus generating University School of Medicine, 660 S. Euclid Ave., Campus Box 8127, St. Louis, distinct biological responses by inducing specific long- MO 63110. E-mail: [email protected]. term programs of gene expression. In pancreatic ␤-cells, Received for publication 5 March 2004 and accepted 19 March 2004. M.O. and C.C.-M. contributed equally to this study. activation of expression of these IEGs was shown to ϩ Additional information for this article can be found in an online appendix at depend on depolarization activation of voltage-gated Ca2 http://diabetes.diabetesjournals.org. channels and subsequent influx of extracellular Ca2ϩ. This DMEM, Dulbecco’s modified Eagle’s medium; EPCon, Endocrine Pancreas 2ϩ Consortium; EST, expressed sequence tag; FBS, fetal bovine serum; GO, gene resulted in activation of Ca -regulated kinases, including ontology; IEG, immediate early gene; KATP channel, ATP-sensitive potassium calmodulin-dependent kinase IV and protein kinase A, channel; PI, phosphatidylinositol; qRT-PCR, quantitative RT-PCR; SSC, so- dium chloride–sodium citrate. leading to phosphorylation and activation of several tran- © 2004 by the American Diabetes Association. scription factors (cAMP-responsive element binding pro- 1496 DIABETES, VOL. 53, JUNE 2004 M. OHSUGI AND ASSOCIATES FIG. 1. A: Experimental scheme. MIN6 insulinoma cells were incubated in 5 mmol/l glucose, 5% FBS DMEM, for 18 h before stimulation. The “unstimulated” sample was harvested with- out any addition. Stimulated samples were harvested, and total RNA was extracted 45 min after addition of 25 mmol/l glucose, 50 mmol/l KCl, or 100 nmol/l insulin. B: Pairing scheme. RNA from four samples was labeled with either Cy3 or Cy5 fluorescent dye, and then a pair of samples was hybridized to a cDNA microarray. A graphic representation of the pairing scheme is shown here. An arrow indicates hybrid- ization to a cDNA microarray and RNA labeling with Cy3 or Cy5 fluorescent dye as indicated. Two double-sided arrows with different colors of arrowheads indicate dye-flip hybrid- ization. C: Distribution of the standard deviations for a “self-vs.-self” experiment derived from 9,700 cDNA probe as described in RESEARCH DESIGN AND (12 ؍ microarrays (n METHODS tein, serum response factor, and Elk-1) (9,10). The results the present experiments extend our knowledge of IEGs of these experiments defined the rapid glucose-signaling regulated by glucose, by KCl-induced depolarization, and pathways for a small number of IEGs whose transcription by insulin through use of high-resolution custom cDNA is rapidly activated by glucose, but the results now pose microarrays that contain clones from the Endocrine Pan- additional questions addressed by the current study. creas Consortium (EPCon: http://www.cbil.upenn.edu/ Animal models perfused with glucose for 4–5 days, or EPConDB). The arrays used for these experiments contain transgenic animals overexpressing a particular gene (11), up to 9,700 cDNAs with Ͼ3,000 novel clones not currently result in more readily measured physiological changes, yet available on commercial arrays (12–14). The results of this the sequence of molecular events leading to these physi- work suggest that glucose activation of IEGs is mediated ological changes are difficult to discern. This result high- primarily via depolarization and that glucose and insulin lights the desirability of beginning to dissect these activate an overlapping set of genes. Further, both of these mechanisms using other models. Thus, we designed ex- growth stimuli appear to activate transcription through a periments using insulinoma cells to elucidate early tran- phosphatidylinositol (PI) 3-kinase–dependent pathway. scriptional responses to islet growth factors. The results of These results further illustrate how monitoring expression DIABETES, VOL. 53, JUNE 2004 1497 1498 TABLE 1 GENE REGULATION IN PANCREATIC Gene regulation by glucose, ranked according to fold change, is compared with that by KCl-induced depolarization and with insulin treatment GenBank accession LocusLink G Ͼ U G Ͼ U K Ͼ U K Ͼ U I Ͼ U I Ͼ U number ID Name Symbol ratio 95% CI ratio 95% CI ratio 95% CI Top 50 glucose upregulated genes (54 clones including duplicates) AA537033 13653 Early growth response 1 Egr1 3.91 (2.55–5.99) 7.42 (4.86–11.33) 0.93 (0.77–1.12) AA958974 15936 Immediate early response 2 Ier2 2.92 (2.57–3.33) 7.89 (6.82–9.13) 0.99 (0.86–1.14) BI790969 15901 Inhibitor of DNA binding 1 Idb1 2.55 (2.36–2.76) 2.35 (2.07–2.68) 0.98 (0.88–1.09) AA869400 15936 Immediate early response 2 Ier2 2.54 (2.33–2.77) 6.68 (5.83–7.66) 0.94 (0.84–1.05) AI646026 15937 Immediate early response 3 Ier3 2.25 (2.13–2.39) 1.55 (1.41–1.7) 0.90 (0.84–0.96) AA119154 233895 cDNA sequence BC006909 BC006909 2.07 (1.83–2.35) 5.81 (4.5–7.5) 0.95 (0.88–1.02) W10821 1.84 (1.52–2.23) 3.77 (3.07–4.62) 0.93 (0.85–1.01) ␤ -CELLS BI319352 74155 RIKEN cDNA 1300002F13 gene 1300002F13Rik 1.69 (1.5–1.9) 1.42 (1.27–1.59) 1.09 (0.96–1.24) AA123373 15902 Inhibitor of DNA binding 2 Idb2 1.61 (1.52–1.71) 1.47 (1.4–1.55) 1.28 (1.23–1.32)
Load more

Recommended publications
  • Single-Cell RNA-Sequencing-Based Crispri Screening Resolves Molecular Drivers of Early Human Endoderm Development
    University of Massachusetts Medical School eScholarship@UMMS Open Access Articles Open Access Publications by UMMS Authors 2019-04-16 Single-Cell RNA-Sequencing-Based CRISPRi Screening Resolves Molecular Drivers of Early Human Endoderm Development Ryan M. Genga University of Massachusetts Medical School Et al. Let us know how access to this document benefits ou.y Follow this and additional works at: https://escholarship.umassmed.edu/oapubs Part of the Amino Acids, Peptides, and Proteins Commons, Cell Biology Commons, Cells Commons, Developmental Biology Commons, Embryonic Structures Commons, Genetic Phenomena Commons, and the Nucleic Acids, Nucleotides, and Nucleosides Commons Repository Citation Genga RM, Kernfeld EM, Parsi KM, Parsons TJ, Ziller MJ, Maehr R. (2019). Single-Cell RNA-Sequencing- Based CRISPRi Screening Resolves Molecular Drivers of Early Human Endoderm Development. Open Access Articles. https://doi.org/10.1016/j.celrep.2019.03.076. Retrieved from https://escholarship.umassmed.edu/oapubs/3818 Creative Commons License This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 4.0 License. This material is brought to you by eScholarship@UMMS. It has been accepted for inclusion in Open Access Articles by an authorized administrator of eScholarship@UMMS. For more information, please contact [email protected]. Report Single-Cell RNA-Sequencing-Based CRISPRi Screening Resolves Molecular Drivers of Early Human Endoderm Development Graphical Abstract Authors Ryan M.J. Genga, Eric M. Kernfeld, Krishna M. Parsi, Teagan J. Parsons, Michael J. Ziller, Rene´ Maehr Correspondence [email protected] In Brief Genga et al. utilize a single-cell RNA- sequencing-based CRISPR interference approach to screen transcription factors predicted to have a role in human definitive endoderm differentiation.
    [Show full text]
  • Single Cell Transcriptomics Reveal Temporal Dynamics of Critical Regulators of Germ Cell Fate During Mouse Sex Determination
    bioRxiv preprint doi: https://doi.org/10.1101/747279; this version posted November 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Single cell transcriptomics reveal temporal dynamics of critical regulators of germ 2 cell fate during mouse sex determination 3 Authors: Chloé Mayère1,2, Yasmine Neirijnck1,3, Pauline Sararols1, Chris M Rands1, 4 Isabelle Stévant1,2, Françoise Kühne1, Anne-Amandine Chassot3, Marie-Christine 5 Chaboissier3, Emmanouil T. Dermitzakis1,2, Serge Nef1,2,*. 6 Affiliations: 7 1Department of Genetic Medicine and Development, University of Geneva, 1211 Geneva, 8 Switzerland; 9 2iGE3, Institute of Genetics and Genomics of Geneva, University of Geneva, 1211 10 Geneva, Switzerland; 11 3Université Côte d'Azur, CNRS, Inserm, iBV, France; 12 Lead Contact: 13 *Corresponding Author: Serge Nef, 1 rue Michel-Servet CH-1211 Genève 4, 14 [email protected]. + 41 (0)22 379 51 93 15 Running Title: Single cell transcriptomics of germ cells 1 bioRxiv preprint doi: https://doi.org/10.1101/747279; this version posted November 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 16 Abbreviations; 17 AGC: Adrenal Germ Cell 18 GC: Germ cell 19 OGC: Ovarian Germ Cell 20 TGC: Testicular Germ Cell 21 scRNA-seq: Single-cell RNA-Sequencing 22 DEG: Differentially Expressed Gene 23 24 25 Keywords: 26 Single-cell RNA-Sequencing (scRNA-seq), sex determination, ovary, testis, gonocytes, 27 oocytes, prospermatogonia, meiosis, gene regulatory network, germ cells, development, 28 RNA splicing 29 2 bioRxiv preprint doi: https://doi.org/10.1101/747279; this version posted November 2, 2020.
    [Show full text]
  • Watsonjn2018.Pdf (1.780Mb)
    UNIVERSITY OF CENTRAL OKLAHOMA Edmond, Oklahoma Department of Biology Investigating Differential Gene Expression in vivo of Cardiac Birth Defects in an Avian Model of Maternal Phenylketonuria A THESIS SUBMITTED TO THE GRADUATE FACULTY In partial fulfillment of the requirements For the degree of MASTER OF SCIENCE IN BIOLOGY By Jamie N. Watson Edmond, OK June 5, 2018 J. Watson/Dr. Nikki Seagraves ii J. Watson/Dr. Nikki Seagraves Acknowledgements It is difficult to articulate the amount of gratitude I have for the support and encouragement I have received throughout my master’s thesis. Many people have added value and support to my life during this time. I am thankful for the education, experience, and friendships I have gained at the University of Central Oklahoma. First, I would like to thank Dr. Nikki Seagraves for her mentorship and friendship. I lucked out when I met her. I have enjoyed working on this project and I am very thankful for her support. I would like thank Thomas Crane for his support and patience throughout my master’s degree. I would like to thank Dr. Shannon Conley for her continued mentorship and support. I would like to thank Liz Bullen and Dr. Eric Howard for their training and help on this project. I would like to thank Kristy Meyer for her friendship and help throughout graduate school. I would like to thank my committee members Dr. Robert Brennan and Dr. Lilian Chooback for their advisement on this project. Also, I would like to thank the biology faculty and staff. I would like to thank the Seagraves lab members: Jailene Canales, Kayley Pate, Mckayla Muse, Grace Thetford, Kody Harvey, Jordan Guffey, and Kayle Patatanian for their hard work and support.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • 1 Supplementary Table S1. Primers Used for RT-Qpcr PROX1
    Supplementary Table S1. Primers used for RT-qPCR PROX1 (Prospero Homeobox 1) 5’ – CCAGCTCCAATATGCTGAAGACCTA – 3’ 5’ – CATCGTTGATGGCTTGACGTG – 3‘ MMP-1 (Matrix Metallopeptidase 1) 5' –CTGTCCCTGAACAGCCCAGTACTTA– 3' 5' –CTGGCCACAACTGCCAAATG– 3' FGF2 (Fibroblast Growth Factor 2) 5′ - GGCTTCTTCCTGCGCATCCA – 3′ 5′ – GCTCTTAGCAGACATTGGAAGA – 3′ MMP-3 (Matrix Metallopeptidase 3) GAAATGAGGTACGAGCTGGATACC– 3’ 5’ –ATGGCTGCATCGATTTTCCT– 3’ NUDT6 (Nudix Hydrolase 6) 5’ –GGCGAGCTGGACAGATTC– 3’ 5’ –GCAGCAGGGGCAATAAATCG– 3’ BAIAP2 (BAI1 Associated Protein 2) 5’ –AAGTCCACAGGCAGATCCAG– 3’ 5’ –GCCTTTGCTCCTTTGCTCAG– 3’ VEGFC (Vascular Endothelial Growth 5’ –GCCACGGCTTATGCAAGCAAAGAT– 3’ Factor C) 5’ –AGTTGAGGTTGGCCTGTTCTCTGT– 3’ ANGPT1 (Angiopoietin 1) 5’ –GAAGGGAACCGAGCCTATTC– 3’ 5’ –AGCATCAAACCACCATCCTC– 3’ KDR (Kinase Insert Domain Receptor) 5’ –AGGAGAGCGTGTCTTTGTGG– 3’ 5’ –GCCTGTCTTCAGTTCCCCTC– 3’ VEGFA (Vascular Endothelial Growth 5’ –CTTGCCTTGCTGCTCTACCT– 3’ Factor A) 5’ –AAGATGTCCACCAGGGTCTC– 3’ PLAT (Plasminogen Activator, Tissue 5’ –AGGAGAGCGTGTCTTTGTGG– 3’ Type) 5’ –GCCTGTCTTCAGTTCCCCTC– 3’ MDK (Midkine) 5’ –CCTGCAACTGGAAGAAGGAG– 3’ 5’ -- CTTTCCCTTCCCTTTCTTGG– 3’ ADAMTS9 (ADAM Metallopeptidase 5’ –ACGAAAAACCTGCCGTAATG– 3’ With Thrombospondin Type 1 Motif 9) 5’ –TCAGAGTCTCCATGCACCAG– 3’ TIMP3 (TIMP Metallopeptidase Inhibitor 5’ –CTGACAGGTCGCGTCTATGA– 3’ 3) 5’ –AGTCACAAAGCAAGGCAGGT– 3’ ACTB (Beta Actin) 5’ – GCCGAGGACTTTGATTGC – 3’ 5’– CTGTGTGGACTTGGGAGAG – 3’ 1 Figure S1. Efficient silencing of PROX1 in CGTH-W-1 and FTC-133 cells. Western blotting analysis shows a decrease in PROX1 protein level by targeting with siRNAs purchased from Santa Cruz (SC) and Sigma-Aldrich (SA) in both CGTH-W-1 and FTC-133 cell line. Beta-actin was used as a loading control of protein lysates. Figure S2. The tube formation assay. The silencing of PROX1 in CGTH-W-1 and FTC-133 cells enhances the angiogenesis in vitro of endothelial cells. HUVECs were cultured in 96-well plates coated with a semi-solid Matrigel.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • Subunit Gene Expression Through Smad-Binding and Homeobox Elements
    0888-8809/05/$15.00/0 Molecular Endocrinology 19(10):2610–2623 Printed in U.S.A. Copyright © 2005 by The Endocrine Society doi: 10.1210/me.2005-0047 Activin Regulates Luteinizing Hormone ␤-Subunit Gene Expression through Smad-Binding and Homeobox Elements Djurdjica Coss, Varykina G. Thackray, Chu-Xia Deng, and Pamela L. Mellon Departments of Reproductive Medicine and Neuroscience (D.C., V.G.T., P.L.M.), Center for Reproductive Science and Medicine, University of California, San Diego, La Jolla, California 92093- 0674; and Genetics of Development and Disease Branch (C.-X.D.), National Institute of Diabetes and Downloaded from https://academic.oup.com/mend/article/19/10/2610/2738010 by guest on 23 September 2021 Digestive and Kidney Diseases, National Institutes of Health, Bethesda, Maryland 20892 LH ␤-subunit (LH␤), which is essential for ovulation site found in this region of the promoter. Juxta- and reproductive fitness, is synthesized specifi- posed to the HB are three Smad-binding elements cally in pituitary gonadotropes. In this study, we (SBEs), which are essential for LH␤ induction. In- show that LH␤ gene expression is induced by ac- terestingly, two of the SBEs are also critical for tivin in mouse primary pituitary cells if the cells are basal expression of the LH␤ gene. We demonstrate treated within 24 h after dispersion in culture. Fur- that Smad proteins are necessary and sufficient for thermore, male mice deficient in Smad3, and there- activin induction of the LH␤ gene. Furthermore, fore in activin signaling, have lower expression of Smad proteins can bind one of the identified SBEs.
    [Show full text]
  • Physical and Linkage Mapping of Mammary-Derived Expressed Sequence Tags in Cattle
    Genomics 83 (2004) 148–152 www.elsevier.com/locate/ygeno Physical and linkage mapping of mammary-derived expressed sequence tags in cattle E.E. Connor,a,* T.S. Sonstegard,a J.W. Keele,b G.L. Bennett,b J.L. Williams,c R. Papworth,c C.P. Van Tassell,a and M.S. Ashwella a U.S. Beltsville Agricultural Research Center, ARS, U.S. Department of Agriculture, 10300 Baltimore Avenue, Beltsville, MD 20705, USA b U.S. Meat Animal Research Center, ARS, U.S. Department of Agriculture, P.O. Box 166, Clay Center, NE 68933-0166, USA c Roslin Institute (Edinburgh), Roslin, Midlothian EH25 9PS, Scotland, United Kingdom Received 2 June 2003; accepted 5 July 2003 Abstract This study describes the physical and linkage mapping of 42 gene-associated markers developed from mammary gland-derived expressed sequence tags to the cattle genome. Of the markers, 25 were placed on the USDA reference linkage map and 37 were positioned on the Roslin 3000-rad radiation hybrid (RH) map, with 20 assignments shared between the maps. Although no novel regions of conserved synteny between the cattle and the human genomes were identified, the coverage was extended for bovine chromosomes 3, 7, 15, and 29 compared with previously published comparative maps between human and bovine genomes. Overall, these data improve the resolution of the human–bovine comparative maps and will assist future efforts to integrate bovine RH and linkage map data. Crown Copyright D 2003 Published by Elsevier Inc. All rights reserved. Keywords: RH mapping; Linkage mapping; SNP; Cattle; EST Selection of positional candidate genes controlling eco- pig [4,5], and cattle [6], and serve as a resource for nomically important traits in cattle requires a detailed candidate gene identification.
    [Show full text]
  • Supplemental Information
    Supplemental information Dissection of the genomic structure of the miR-183/96/182 gene. Previously, we showed that the miR-183/96/182 cluster is an intergenic miRNA cluster, located in a ~60-kb interval between the genes encoding nuclear respiratory factor-1 (Nrf1) and ubiquitin-conjugating enzyme E2H (Ube2h) on mouse chr6qA3.3 (1). To start to uncover the genomic structure of the miR- 183/96/182 gene, we first studied genomic features around miR-183/96/182 in the UCSC genome browser (http://genome.UCSC.edu/), and identified two CpG islands 3.4-6.5 kb 5’ of pre-miR-183, the most 5’ miRNA of the cluster (Fig. 1A; Fig. S1 and Seq. S1). A cDNA clone, AK044220, located at 3.2-4.6 kb 5’ to pre-miR-183, encompasses the second CpG island (Fig. 1A; Fig. S1). We hypothesized that this cDNA clone was derived from 5’ exon(s) of the primary transcript of the miR-183/96/182 gene, as CpG islands are often associated with promoters (2). Supporting this hypothesis, multiple expressed sequences detected by gene-trap clones, including clone D016D06 (3, 4), were co-localized with the cDNA clone AK044220 (Fig. 1A; Fig. S1). Clone D016D06, deposited by the German GeneTrap Consortium (GGTC) (http://tikus.gsf.de) (3, 4), was derived from insertion of a retroviral construct, rFlpROSAβgeo in 129S2 ES cells (Fig. 1A and C). The rFlpROSAβgeo construct carries a promoterless reporter gene, the β−geo cassette - an in-frame fusion of the β-galactosidase and neomycin resistance (Neor) gene (5), with a splicing acceptor (SA) immediately upstream, and a polyA signal downstream of the β−geo cassette (Fig.
    [Show full text]
  • Single Cell Profiling of CRISPR/Cas9-Induced OTX2 Deficient Retinas Reveals Fate Switch from Restricted Progenitors
    bioRxiv preprint doi: https://doi.org/10.1101/538710; this version posted February 2, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Single cell profiling of CRISPR/Cas9-induced OTX2 deficient retinas reveals fate switch from restricted progenitors Miruna G. Ghinia Tegla1, Diego F. Buenaventura1, 2, Diana Y. Kim1, Cassandra Thakurdin1, Kevin C. Gonzalez1, 3, Mark M. Emerson1,2* 1 Department of Biology, The City College of New York, City University of New York, New York, NY, 10031; United States of America 2 Biology Ph.D. Program, Graduate Center, City University of New York, New York, NY, 10031; United States of America 3 Present address: Doctoral Program in Neurobiology and Behavior, Columbia University, New York, NY 10032; United States of America *Corresponding author: [email protected] Email addresses: Miruna G. Ghinia Tegla: [email protected] Diego F. Buenaventura: [email protected] Diana Y. Kim: [email protected] Cassandra Thakurdin: [email protected] Kevin C. Gonzalez: [email protected] Mark M. Emerson: [email protected] Running title: Single cell analysis of retinal cell fate changes induced by OTX2 mutagenesis bioRxiv preprint doi: https://doi.org/10.1101/538710; this version posted February 2, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Development of the vertebrate eye, like many developmental systems, depends on genes that are used iteratively in multiple distinct processes.
    [Show full text]
  • The Id-Protein Family in Developmental and Cancer-Associated Pathways Cornelia Roschger and Chiara Cabrele*
    Roschger and Cabrele Cell Communication and Signaling (2017) 15:7 DOI 10.1186/s12964-016-0161-y REVIEW Open Access The Id-protein family in developmental and cancer-associated pathways Cornelia Roschger and Chiara Cabrele* Abstract Inhibitors of DNA binding and cell differentiation (Id) proteins are members of the large family of the helix-loop- helix (HLH) transcription factors, but they lack any DNA-binding motif. During development, the Id proteins play a key role in the regulation of cell-cycle progression and cell differentiation by modulating different cell-cycle regulators both by direct and indirect mechanisms. Several Id-protein interacting partners have been identified thus far, which belong to structurally and functionally unrelated families, including, among others, the class I and II bHLH transcription factors, the retinoblastoma protein and related pocket proteins, the paired-box transcription factors, and the S5a subunit of the 26 S proteasome. Although the HLH domain of the Id proteins is involved in most of their protein-protein interaction events, additional motifs located in their N-terminal and C-terminal regions are required for the recognition of diverse protein partners. The ability of the Id proteins to interact with structurally different proteins is likely to arise from their conformational flexibility: indeed, these proteins contain intrinsically disordered regions that, in the case of the HLH region, undergo folding upon self- or heteroassociation. Besides their crucial role for cell-fate determination and cell-cycle progression during development, other important cellular events have been related to the Id-protein expression in a number of pathologies. Dysregulated Id-protein expression has been associated with tumor growth, vascularization, invasiveness, metastasis, chemoresistance and stemness, as well as with various developmental defects and diseases.
    [Show full text]
  • Mutation Analysis of Genes Within the Dynactin Complex in a Cohort of Hereditary Peripheral Neuropathies
    Clin Genet 2016: 90: 127–133 © 2015 John Wiley & Sons A/S. Printed in Singapore. All rights reserved Published by John Wiley & Sons Ltd CLINICAL GENETICS doi: 10.1111/cge.12712 Original Article Mutation analysis of genes within the dynactin complex in a cohort of hereditary peripheral neuropathies a a Tey S., Ahmad-Annuar A., Drew A.P., Shahrizaila N., Nicholson G.A., S. Tey , A. Ahmad-Annuar , Kennerson M.L. Mutation analysis of genes within the dynactin complex in A.P. Drewb, N. Shahrizailac, , a cohort of hereditary peripheral neuropathies. G.A. Nicholsonb d and Clin Genet 2016: 90: 127–133. © John Wiley & Sons A/S. Published by M.L. Kennersonb,d John Wiley & Sons Ltd, 2015 aDepartment of Biomedical Science, The cytoplasmic dynein–dynactin genes are attractive candidates for Faculty of Medicine, University of Malaya, b neurodegenerative disorders given their functional role in retrograde Kuala Lumpur, Malaysia, Northcott transport along neurons. The cytoplasmic dynein heavy chain (DYNC1H1) Neuroscience Laboratory, ANZAC Research Institute, and Sydney Medical gene has been implicated in various neurodegenerative disorders, and School, University of Sydney, Sydney, dynactin 1 (DCTN1) genes have been implicated in a wide spectrum of Australia, cDepartment of Medicine, disorders including motor neuron disease, Parkinson’s disease, spinobulbar Faculty of Medicine, University of Malaya, muscular atrophy and hereditary spastic paraplegia. However, the Kuala Lumpur, Malaysia, and dMolecular involvement of other dynactin genes with inherited peripheral neuropathies Medicine Laboratory, Concord Hospital, (IPN) namely, hereditary sensory neuropathy, hereditary motor neuropathy Sydney, Australia and Charcot–Marie–Tooth disease is under reported. We screened eight genes; DCTN1-6 and ACTR1A and ACTR1B in 136 IPN patients using Key words: Charcot–Marie–Tooth – whole-exome sequencing and high-resolution melt (HRM) analysis.
    [Show full text]