DOCSLIB.ORG

Subunit Gene Expression Through Smad-Binding and Homeobox Elements

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Subunit Gene Expression Through Smad-Binding and Homeobox Elements 0888-8809/05/$15.00/0 Molecular Endocrinology 19(10):2610–2623 Printed in U.S.A. Copyright © 2005 by The Endocrine Society doi: 10.1210/me.2005-0047 Activin Regulates Luteinizing Hormone ␤-Subunit Gene Expression through Smad-Binding and Homeobox Elements Djurdjica Coss, Varykina G. Thackray, Chu-Xia Deng, and Pamela L. Mellon Departments of Reproductive Medicine and Neuroscience (D.C., V.G.T., P.L.M.), Center for Reproductive Science and Medicine, University of California, San Diego, La Jolla, California 92093- 0674; and Genetics of Development and Disease Branch (C.-X.D.), National Institute of Diabetes and Downloaded from https://academic.oup.com/mend/article/19/10/2610/2738010 by guest on 23 September 2021 Digestive and Kidney Diseases, National Institutes of Health, Bethesda, Maryland 20892 LH ␤-subunit (LH␤), which is essential for ovulation site found in this region of the promoter. Juxta- and reproductive fitness, is synthesized specifi- posed to the HB are three Smad-binding elements cally in pituitary gonadotropes. In this study, we (SBEs), which are essential for LH␤ induction. In- show that LH␤ gene expression is induced by ac- terestingly, two of the SBEs are also critical for tivin in mouse primary pituitary cells if the cells are basal expression of the LH␤ gene. We demonstrate treated within 24 h after dispersion in culture. Fur- that Smad proteins are necessary and sufficient for thermore, male mice deficient in Smad3, and there- activin induction of the LH␤ gene. Furthermore, fore in activin signaling, have lower expression of Smad proteins can bind one of the identified SBEs. both LH␤ and FSH␤ mRNAs compared with their In addition to binding this SBE, Smad proteins in- wild-type littermates. Using the L␤T2 immortalized teract with pituitary homeobox 1 (Ptx-1) and ortho- mouse gonadotrope cell line that endogenously denticle homeobox 1 (Otx-1), which can bind the expresses LH, we identify specific elements in the HB located close to the Smad-binding site. Thus, regulatory region of the rat LH␤ gene necessary for activin induction of LH␤ gene expression requires its induction by activin. Activin responsiveness is a combination of several transcription factors, conferred by a promoter-proximal region located both basal and activin induced, as well as cooper- ؊121/؊86 from the transcriptional start site. Max- ation between multiple DNA elements. (Molecular imal LH␤ induction by activin requires a homeobox Endocrinology 19: 2610–2623, 2005) (element (HB) and a 5؅-early growth response (Egr H IS ESSENTIAL for steroidogenesis and repro- initially described as functioning in gonadal feedback Lductive function in both males and females, be- on gonadotropin synthesis. Activin increases release cause a lack of this hormone leads to hypogonadism of FSH (6) from the pituitary and induces FSH␤ ex- and infertility in both sexes (1). LH synthesis is re- pression in gonadotrope cells (7), whereas inhibin an- stricted exclusively to the anterior pituitary gonado- tagonizes activin action. Follistatin, a potent activin- tropes (2). It is a heterodimeric glycoprotein, com- binding protein (8), can inhibit the biosynthesis and posed of an ␣-subunit, in common with FSH and TSH, secretion of FSH (9). Interestingly, activin, follistatin, and a unique ␤-subunit, which confers biological and inhibin are expressed in the mature pituitary go- specificity. Transcription of the ␤-subunit is the rate- nadotrope and can function in an autocrine manner limiting step for LH production (3, 4). LH ␤-subunit (10–12). Follistatin is also synthesized by folliculostel- (LH␤) gene transcription is induced by GnRH and re- late cells in the pituitary and regulates activin availabil- pressed by gonadal steroids (5). ity in a paracrine manner (13, 14). Activin and inhibin, members of the TGF␤ family of TGF␤ family members, including activin, activate growth factors, also play important roles in the mod- signaling molecules known as receptor-associated ulation of gonadotropins. These glycoproteins were Smads, which, in the case of activin, are Smad2 and/or Smad3 (15). Smad2 or Smad3 then associate First Published Online June 16, 2005 with a common Smad, Smad4 (DPC4). The activated Abbreviations: BSA, Bovine serum albumin; Egr, early growth response; GAPDH, glyceraldehyde-3-phosphate de- heteromeric Smad complex translocates into the nu- hydrogenase; GFP, green fluorescent protein; GST, glutathi- cleus, where it binds a Smad-binding element GTCTA- one-S-transferase; HB, homeobox element; LH␤,LH␤-sub- GAC, or either half of this palindrome, within DNA to unit; NP-40, Nonidet P-40; Otx, orthodenticle homeobox; regulate the expression of target genes (16). Ptx, pituitary homeobox; SBE, Smad-binding element; SF-1, As mentioned above, there is considerable evidence steroidogenic factor 1. that activin regulates FSH synthesis and secretion. Molecular Endocrinology is published monthly by The Endocrine Society (http://www.endo-society.org), the However, the initial reports regarding the role of activin foremost professional society serving the endocrine in gonadotropes failed to detect an effect of activin on community. LH secretion (6, 17). In contrast, a number of subse- 2610 Coss et al. • Activin Regulation of LH␤ Mol Endocrinol, October 2005, 19(10):2610–2623 2611 quent studies suggest that activin can influence LH basal expression. In this region, we also identified synthesis, both in vivo and in cell culture. Stouffer et al. three Smad-binding elements (SBEs), and mutation of (18) have shown an acute and sustained increase in LH any one of these sites completely abolished activin secretion in response to activin in female rhesus mon- response. Interestingly, two of these SBEs are also keys. McLachlan et al. (19) reported that 2-d activin important for basal expression of LH␤. Finally, we infusion in adult male monkeys significantly increased demonstrate that overexpressed Smad proteins acti- both LH and FSH release in response to GnRH injec- vate LH␤, bind a SBE in gel-shift assay, and interact tion. Attardi and Miklos (20) demonstrated that treat- with orthodenticle homeobox (Otx) and pituitary ho- ment of primary rat pituitary cell cultures with activin meobox (Ptx) proteins, which can bind the HB. There- results in significant increases in both LH secretion fore, activin regulation of LH␤ gene expression, similar ␤ ␤ and protein content in the cells, as well as LH mRNA to LH regulation by GnRH, requires multiple, com- Downloaded from https://academic.oup.com/mend/article/19/10/2610/2738010 by guest on 23 September 2021 levels. More recently, this observation was confirmed posite DNA elements and involves a combinatorial in human fetal primary cell culture, where recombinant action of several DNA binding proteins. human activin caused a significant increase in LH se- cretion into the medium. In addition, inhibin decreased FSH and LH secretion, but the LH response to inhibin RESULTS was less prominent than that of FSH (21). Furthermore, our laboratory has previously shown that an LH␤ re- Activin Induces LH␤ in Primary Mouse Pituitary porter gene is induced by activin in transiently trans- Cell Culture fected L␤T2 cells (22), and, recently, this finding was extended in a study in which the endogenous LH␤ There is little doubt that activin is a major regulator of gene was induced by activin in this mature gonado- FSH synthesis; however, examination of the effects of trope cell model (23). Despite these reports, activin is activin on LH has resulted in conflicting reports. Some still generally regarded as a selective regulator of FSH. studies have shown that activin regulates LH␤ induction In this report, we used primary mouse pituitary cells in animals and cell culture, both in rat primary pituitary enzymatically dispersed in culture to address this dis- cells and a gonadotrope cell model derived from the crepancy in the literature by showing that the LH␤ mouse; however, others did not detect this response. In gene can be induced by activin treatment. Moreover, this study, we sought to provide a possible explanation using Smad3-deficient mice, we confirmed a role for for these differing results regarding activin regulation of activin in regulation of LH␤ expression in vivo, when LH synthesis as well as determine whether activin regu- we found that these mice have lower expression of lates LH␤ induction in mouse primary cells. Using mouse LH␤ mRNA, in addition to lower levels of FSH␤, com- cells instead of rat primary cells allowed us to directly pared with their wild-type littermates. We then sought correlate our results with experiments in genetically to identify the molecular mechanism of activin induc- modified mice and more detailed mechanistic studies tion of LH␤ gene expression using L␤T2 cells, the using the mouse-derived gonadotrope cell line, L␤T2. mature gonadotrope cell model derived from a trans- We enzymatically dispersed mouse pituitary cells and genic mouse pituitary tumor, which endogenously ex- treated them with activin or GnRH for 5 h, either1dor3d presses LH␤. We found that in L␤T2 cells, LH␤ re- after the dispersion. When cells were treated within 24 h sponds to activin in a time- and dose-dependent after dispersion, both GnRH and activin induced robust manner, and the response maps between Ϫ86 and expression of LH␤ compared with the vehicle-treated Ϫ121 bp from the transcriptional start site. This is an cells (Fig. 1). Therefore, activin, as well as GnRH, induces active region of the promoter that contains a ho- LH␤ gene expression. However, when cells were al- meobox element (HB) at Ϫ100 that is crucial for basal lowed to recover for 66 h before treatment with GnRH or and cell-specific expression of the LH␤ gene (24). In activin, GnRH treatment still caused a significant induc- close proximity, on either side of the HB, are tandem tion of LH␤, although to a lesser extent than at 24 h, steroidogenic factor 1 (SF-1) and early growth re- whereas activin induction failed to reach a significant sponse (Egr) sites (25).
Load more

Recommended publications
  • Single-Cell RNA-Sequencing-Based Crispri Screening Resolves Molecular Drivers of Early Human Endoderm Development
    University of Massachusetts Medical School eScholarship@UMMS Open Access Articles Open Access Publications by UMMS Authors 2019-04-16 Single-Cell RNA-Sequencing-Based CRISPRi Screening Resolves Molecular Drivers of Early Human Endoderm Development Ryan M. Genga University of Massachusetts Medical School Et al. Let us know how access to this document benefits ou.y Follow this and additional works at: https://escholarship.umassmed.edu/oapubs Part of the Amino Acids, Peptides, and Proteins Commons, Cell Biology Commons, Cells Commons, Developmental Biology Commons, Embryonic Structures Commons, Genetic Phenomena Commons, and the Nucleic Acids, Nucleotides, and Nucleosides Commons Repository Citation Genga RM, Kernfeld EM, Parsi KM, Parsons TJ, Ziller MJ, Maehr R. (2019). Single-Cell RNA-Sequencing- Based CRISPRi Screening Resolves Molecular Drivers of Early Human Endoderm Development. Open Access Articles. https://doi.org/10.1016/j.celrep.2019.03.076. Retrieved from https://escholarship.umassmed.edu/oapubs/3818 Creative Commons License This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 4.0 License. This material is brought to you by eScholarship@UMMS. It has been accepted for inclusion in Open Access Articles by an authorized administrator of eScholarship@UMMS. For more information, please contact [email protected]. Report Single-Cell RNA-Sequencing-Based CRISPRi Screening Resolves Molecular Drivers of Early Human Endoderm Development Graphical Abstract Authors Ryan M.J. Genga, Eric M. Kernfeld, Krishna M. Parsi, Teagan J. Parsons, Michael J. Ziller, Rene´ Maehr Correspondence [email protected] In Brief Genga et al. utilize a single-cell RNA- sequencing-based CRISPR interference approach to screen transcription factors predicted to have a role in human definitive endoderm differentiation.
    [Show full text]
  • Single Cell Transcriptomics Reveal Temporal Dynamics of Critical Regulators of Germ Cell Fate During Mouse Sex Determination
    bioRxiv preprint doi: https://doi.org/10.1101/747279; this version posted November 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Single cell transcriptomics reveal temporal dynamics of critical regulators of germ 2 cell fate during mouse sex determination 3 Authors: Chloé Mayère1,2, Yasmine Neirijnck1,3, Pauline Sararols1, Chris M Rands1, 4 Isabelle Stévant1,2, Françoise Kühne1, Anne-Amandine Chassot3, Marie-Christine 5 Chaboissier3, Emmanouil T. Dermitzakis1,2, Serge Nef1,2,*. 6 Affiliations: 7 1Department of Genetic Medicine and Development, University of Geneva, 1211 Geneva, 8 Switzerland; 9 2iGE3, Institute of Genetics and Genomics of Geneva, University of Geneva, 1211 10 Geneva, Switzerland; 11 3Université Côte d'Azur, CNRS, Inserm, iBV, France; 12 Lead Contact: 13 *Corresponding Author: Serge Nef, 1 rue Michel-Servet CH-1211 Genève 4, 14 [email protected]. + 41 (0)22 379 51 93 15 Running Title: Single cell transcriptomics of germ cells 1 bioRxiv preprint doi: https://doi.org/10.1101/747279; this version posted November 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 16 Abbreviations; 17 AGC: Adrenal Germ Cell 18 GC: Germ cell 19 OGC: Ovarian Germ Cell 20 TGC: Testicular Germ Cell 21 scRNA-seq: Single-cell RNA-Sequencing 22 DEG: Differentially Expressed Gene 23 24 25 Keywords: 26 Single-cell RNA-Sequencing (scRNA-seq), sex determination, ovary, testis, gonocytes, 27 oocytes, prospermatogonia, meiosis, gene regulatory network, germ cells, development, 28 RNA splicing 29 2 bioRxiv preprint doi: https://doi.org/10.1101/747279; this version posted November 2, 2020.
    [Show full text]
  • Watsonjn2018.Pdf (1.780Mb)
    UNIVERSITY OF CENTRAL OKLAHOMA Edmond, Oklahoma Department of Biology Investigating Differential Gene Expression in vivo of Cardiac Birth Defects in an Avian Model of Maternal Phenylketonuria A THESIS SUBMITTED TO THE GRADUATE FACULTY In partial fulfillment of the requirements For the degree of MASTER OF SCIENCE IN BIOLOGY By Jamie N. Watson Edmond, OK June 5, 2018 J. Watson/Dr. Nikki Seagraves ii J. Watson/Dr. Nikki Seagraves Acknowledgements It is difficult to articulate the amount of gratitude I have for the support and encouragement I have received throughout my master’s thesis. Many people have added value and support to my life during this time. I am thankful for the education, experience, and friendships I have gained at the University of Central Oklahoma. First, I would like to thank Dr. Nikki Seagraves for her mentorship and friendship. I lucked out when I met her. I have enjoyed working on this project and I am very thankful for her support. I would like thank Thomas Crane for his support and patience throughout my master’s degree. I would like to thank Dr. Shannon Conley for her continued mentorship and support. I would like to thank Liz Bullen and Dr. Eric Howard for their training and help on this project. I would like to thank Kristy Meyer for her friendship and help throughout graduate school. I would like to thank my committee members Dr. Robert Brennan and Dr. Lilian Chooback for their advisement on this project. Also, I would like to thank the biology faculty and staff. I would like to thank the Seagraves lab members: Jailene Canales, Kayley Pate, Mckayla Muse, Grace Thetford, Kody Harvey, Jordan Guffey, and Kayle Patatanian for their hard work and support.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • 1 Supplementary Table S1. Primers Used for RT-Qpcr PROX1
    Supplementary Table S1. Primers used for RT-qPCR PROX1 (Prospero Homeobox 1) 5’ – CCAGCTCCAATATGCTGAAGACCTA – 3’ 5’ – CATCGTTGATGGCTTGACGTG – 3‘ MMP-1 (Matrix Metallopeptidase 1) 5' –CTGTCCCTGAACAGCCCAGTACTTA– 3' 5' –CTGGCCACAACTGCCAAATG– 3' FGF2 (Fibroblast Growth Factor 2) 5′ - GGCTTCTTCCTGCGCATCCA – 3′ 5′ – GCTCTTAGCAGACATTGGAAGA – 3′ MMP-3 (Matrix Metallopeptidase 3) GAAATGAGGTACGAGCTGGATACC– 3’ 5’ –ATGGCTGCATCGATTTTCCT– 3’ NUDT6 (Nudix Hydrolase 6) 5’ –GGCGAGCTGGACAGATTC– 3’ 5’ –GCAGCAGGGGCAATAAATCG– 3’ BAIAP2 (BAI1 Associated Protein 2) 5’ –AAGTCCACAGGCAGATCCAG– 3’ 5’ –GCCTTTGCTCCTTTGCTCAG– 3’ VEGFC (Vascular Endothelial Growth 5’ –GCCACGGCTTATGCAAGCAAAGAT– 3’ Factor C) 5’ –AGTTGAGGTTGGCCTGTTCTCTGT– 3’ ANGPT1 (Angiopoietin 1) 5’ –GAAGGGAACCGAGCCTATTC– 3’ 5’ –AGCATCAAACCACCATCCTC– 3’ KDR (Kinase Insert Domain Receptor) 5’ –AGGAGAGCGTGTCTTTGTGG– 3’ 5’ –GCCTGTCTTCAGTTCCCCTC– 3’ VEGFA (Vascular Endothelial Growth 5’ –CTTGCCTTGCTGCTCTACCT– 3’ Factor A) 5’ –AAGATGTCCACCAGGGTCTC– 3’ PLAT (Plasminogen Activator, Tissue 5’ –AGGAGAGCGTGTCTTTGTGG– 3’ Type) 5’ –GCCTGTCTTCAGTTCCCCTC– 3’ MDK (Midkine) 5’ –CCTGCAACTGGAAGAAGGAG– 3’ 5’ -- CTTTCCCTTCCCTTTCTTGG– 3’ ADAMTS9 (ADAM Metallopeptidase 5’ –ACGAAAAACCTGCCGTAATG– 3’ With Thrombospondin Type 1 Motif 9) 5’ –TCAGAGTCTCCATGCACCAG– 3’ TIMP3 (TIMP Metallopeptidase Inhibitor 5’ –CTGACAGGTCGCGTCTATGA– 3’ 3) 5’ –AGTCACAAAGCAAGGCAGGT– 3’ ACTB (Beta Actin) 5’ – GCCGAGGACTTTGATTGC – 3’ 5’– CTGTGTGGACTTGGGAGAG – 3’ 1 Figure S1. Efficient silencing of PROX1 in CGTH-W-1 and FTC-133 cells. Western blotting analysis shows a decrease in PROX1 protein level by targeting with siRNAs purchased from Santa Cruz (SC) and Sigma-Aldrich (SA) in both CGTH-W-1 and FTC-133 cell line. Beta-actin was used as a loading control of protein lysates. Figure S2. The tube formation assay. The silencing of PROX1 in CGTH-W-1 and FTC-133 cells enhances the angiogenesis in vitro of endothelial cells. HUVECs were cultured in 96-well plates coated with a semi-solid Matrigel.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • Single Cell Profiling of CRISPR/Cas9-Induced OTX2 Deficient Retinas Reveals Fate Switch from Restricted Progenitors
    bioRxiv preprint doi: https://doi.org/10.1101/538710; this version posted February 2, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Single cell profiling of CRISPR/Cas9-induced OTX2 deficient retinas reveals fate switch from restricted progenitors Miruna G. Ghinia Tegla1, Diego F. Buenaventura1, 2, Diana Y. Kim1, Cassandra Thakurdin1, Kevin C. Gonzalez1, 3, Mark M. Emerson1,2* 1 Department of Biology, The City College of New York, City University of New York, New York, NY, 10031; United States of America 2 Biology Ph.D. Program, Graduate Center, City University of New York, New York, NY, 10031; United States of America 3 Present address: Doctoral Program in Neurobiology and Behavior, Columbia University, New York, NY 10032; United States of America *Corresponding author: [email protected] Email addresses: Miruna G. Ghinia Tegla: [email protected] Diego F. Buenaventura: [email protected] Diana Y. Kim: [email protected] Cassandra Thakurdin: [email protected] Kevin C. Gonzalez: [email protected] Mark M. Emerson: [email protected] Running title: Single cell analysis of retinal cell fate changes induced by OTX2 mutagenesis bioRxiv preprint doi: https://doi.org/10.1101/538710; this version posted February 2, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Development of the vertebrate eye, like many developmental systems, depends on genes that are used iteratively in multiple distinct processes.
    [Show full text]
  • The Id-Protein Family in Developmental and Cancer-Associated Pathways Cornelia Roschger and Chiara Cabrele*
    Roschger and Cabrele Cell Communication and Signaling (2017) 15:7 DOI 10.1186/s12964-016-0161-y REVIEW Open Access The Id-protein family in developmental and cancer-associated pathways Cornelia Roschger and Chiara Cabrele* Abstract Inhibitors of DNA binding and cell differentiation (Id) proteins are members of the large family of the helix-loop- helix (HLH) transcription factors, but they lack any DNA-binding motif. During development, the Id proteins play a key role in the regulation of cell-cycle progression and cell differentiation by modulating different cell-cycle regulators both by direct and indirect mechanisms. Several Id-protein interacting partners have been identified thus far, which belong to structurally and functionally unrelated families, including, among others, the class I and II bHLH transcription factors, the retinoblastoma protein and related pocket proteins, the paired-box transcription factors, and the S5a subunit of the 26 S proteasome. Although the HLH domain of the Id proteins is involved in most of their protein-protein interaction events, additional motifs located in their N-terminal and C-terminal regions are required for the recognition of diverse protein partners. The ability of the Id proteins to interact with structurally different proteins is likely to arise from their conformational flexibility: indeed, these proteins contain intrinsically disordered regions that, in the case of the HLH region, undergo folding upon self- or heteroassociation. Besides their crucial role for cell-fate determination and cell-cycle progression during development, other important cellular events have been related to the Id-protein expression in a number of pathologies. Dysregulated Id-protein expression has been associated with tumor growth, vascularization, invasiveness, metastasis, chemoresistance and stemness, as well as with various developmental defects and diseases.
    [Show full text]
  • At the X-Roads of Sex and Genetics in Pulmonary Arterial Hypertension
    G C A T T A C G G C A T genes Review At the X-Roads of Sex and Genetics in Pulmonary Arterial Hypertension Meghan M. Cirulis 1,2,* , Mark W. Dodson 1,2, Lynn M. Brown 1,2, Samuel M. Brown 1,2, Tim Lahm 3,4,5 and Greg Elliott 1,2 1 Division of Pulmonary, Critical Care and Occupational Medicine, University of Utah, Salt Lake City, UT 84132, USA; [email protected] (M.W.D.); [email protected] (L.M.B.); [email protected] (S.M.B.); [email protected] (G.E.) 2 Division of Pulmonary and Critical Care Medicine, Intermountain Medical Center, Salt Lake City, UT 84107, USA 3 Division of Pulmonary, Critical Care, Sleep and Occupational Medicine, Department of Medicine, Indiana University School of Medicine, Indianapolis, IN 46202, USA; [email protected] 4 Richard L. Roudebush Veterans Affairs Medical Center, Indianapolis, IN 46202, USA 5 Department of Anatomy, Cell Biology & Physiology, Indiana University School of Medicine, Indianapolis, IN 46202, USA * Correspondence: [email protected]; Tel.: +1-801-581-7806 Received: 29 September 2020; Accepted: 17 November 2020; Published: 20 November 2020 Abstract: Group 1 pulmonary hypertension (pulmonary arterial hypertension; PAH) is a rare disease characterized by remodeling of the small pulmonary arteries leading to progressive elevation of pulmonary vascular resistance, ultimately leading to right ventricular failure and death. Deleterious mutations in the serine-threonine receptor bone morphogenetic protein receptor 2 (BMPR2; a central mediator of bone morphogenetic protein (BMP) signaling) and female sex are known risk factors for the development of PAH in humans.
    [Show full text]
  • FOXP1 Acts Through a Negative Feedback Loop to Suppress FOXO-Induced Apoptosis
    Cell Death and Differentiation (2013) 20, 1219–1229 & 2013 Macmillan Publishers Limited All rights reserved 1350-9047/13 www.nature.com/cdd FOXP1 acts through a negative feedback loop to suppress FOXO-induced apoptosis R van Boxtel1,5, C Gomez-Puerto1,6, M Mokry2,6, A Eijkelenboom3, KE van der Vos1, EES Nieuwenhuis2, BMT Burgering3, EW-F Lam4 and PJ Coffer*,1,2 Transcriptional activity of Forkhead box transcription factor class O (FOXO) proteins can result in a variety of cellular outcomes depending on cell type and activating stimulus. These transcription factors are negatively regulated by the phosphoinositol 3-kinase (PI3K)–protein kinase B (PKB) signaling pathway, which is thought to have a pivotal role in regulating survival of tumor cells in a variety of cancers. Recently, it has become clear that FOXO proteins can promote resistance to anti-cancer therapeutics, designed to inhibit PI3K–PKB activity, by inducing the expression of proteins that provide feedback at different levels of this pathway. We questioned whether such a feedback mechanism may also exist directly at the level of FOXO-induced transcription. To identify critical modulators of FOXO transcriptional output, we performed gene expression analyses after conditional activation of key components of the PI3K–PKB–FOXO signaling pathway and identified FOXP1 as a direct FOXO transcriptional target. Using chromatin immunoprecipitation followed by next-generation sequencing, we show that FOXP1 binds enhancers that are pre-occupied by FOXO3. By sequencing the transcriptomes of cells in which FOXO is specifically activated in the absence of FOXP1, we demonstrate that FOXP1 can modulate the expression of a specific subset of FOXO target genes, including inhibiting expression of the pro-apoptotic gene BIK.
    [Show full text]
  • The Role of Inhibitors of Differentiation Proteins ID1 and ID3 in Breast Cancer Metastasis
    The role of Inhibitors of Differentiation proteins ID1 and ID3 in breast cancer metastasis Wee Siang Teo A thesis in fulfilment of the requirements for the degree of Doctor of Philosophy St Vincent’s Clinical School, Faculty of Medicine The University of New South Wales Cancer Research Program The Garvan Institute of Medical Research Sydney, Australia March, 2014 THE UNIVERSITY OF NEW SOUTH WALES Thesis/Dissertation Sheet Surname or Family name: Teo First name: Wee Siang Abbreviation for degree as given in the University calendar: PhD (Medicine) School: St Vincent’s Clinical School Faculty: Faculty of Medicine Title: The role of Inhibitors of Differentiation proteins ID1 and ID3 in breast cancer metastasis Abstract 350 words maximum: (PLEASE TYPE) Breast cancer is a leading cause of cancer death in women. While locally-confined breast cancer is generally curable, the survival of patients with metastatic breast cancer is very poor. Treatment for metastatic breast cancer is palliative not curative due to the lack of targeted therapies. Metastasis is a complex process that still remains poorly understood, thus a detailed understanding of the biological complexity that underlies breast cancer metastasis is essential in reducing the lethality of this disease. The Inhibitor of Differentiation proteins 1 and 3 (ID1/3) are transcriptional regulators that control many cell fate and developmental processes and are often deregulated in cancer. ID1/3 are required and sufficient for the metastasis of breast cancer in experimental models. However, the mechanisms by which ID1/3 mediate metastasis in breast cancer remain to be determined. Little is known about pathways regulated by ID1/3 in breast cancer as well as their functional role in the multiple steps of metastatic progression.
    [Show full text]
  • ID1 Mediates Escape from TGF-Β Tumor Suppression in Pancreatic Cancer
    Author Manuscript Published OnlineFirst on October 3, 2019; DOI: 10.1158/2159-8290.CD-19-0529 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. ID1 mediates escape from TGF-β tumor suppression in pancreatic cancer Yun-Han Huang1,2,3, Jing Hu1, Fei Chen1, Nicolas Lecomte4, Harihar Basnet1, Charles J. David1,10, Matthew D. Witkin5, Peter J. Allen6, Steven D. Leach4,6,7,9, Travis J. Hollmann7,8, Christine A. Iacobuzio-Donahue4,7,8, and Joan Massagué1* 1Cancer Biology and Genetics Program, Sloan Kettering Institute, Memorial Sloan Kettering Cancer Center, New York, NY 10065 2Weill Cornell/Sloan Kettering/Rockefeller Tri-Institutional MD-PhD Program, New York, NY 10065 3Gerstner Sloan Kettering Graduate School of Biomedical Sciences, New York, NY 10065 4The David M. Rubinstein Center for Pancreatic Cancer Research, Memorial Sloan Kettering Cancer Center, New York, NY 10065 5Center for Epigenetics Research, Memorial Sloan Kettering Cancer Center, New York, NY 10065 6Department of Surgery, Memorial Sloan Kettering Cancer Center, New York, NY 10065 7Department of Pathology, Memorial Sloan Kettering Cancer Center, New York, NY 10065 8Human Oncology and Pathogenesis Program, Memorial Sloan Kettering Cancer Center, New York, NY 10065 9Present address: Department of Molecular and Systems Biology, Dartmouth Geisel School of Medicine, 1 Rope Ferry Road, Hanover, NH 03755-1404 10Present address: Tsinghua University School of Medicine, Department of Basic Sciences, Medical Sciences Building D106, Haidian District, Beijing, China, 100084 Running title: ID1 mediates escape from TGF-β tumor suppression in PDA Keywords: TGF-β, pancreatic cancer, ID1, tumor suppression, EMT Financial support: National Cancer Institute grants R01-CA34610 (JM) and P30-CA008748 (MSKCC), and Predoctoral Fellowship F30-CA203238 (YH).
    [Show full text]