Subunit Gene Expression Through Smad-Binding and Homeobox Elements

Activin Regulates Luteinizing Hormone ␤-Subunit Gene Expression through Smad-Binding and Homeobox Elements

Djurdjica Coss, Varykina G. Thackray, Chu-Xia Deng, and Pamela L. Mellon Departments of Reproductive Medicine and Neuroscience (D.C., V.G.T., P.L.M.), Center for Reproductive Science and Medicine, University of California, San Diego, La Jolla, California 92093- 0674; and Genetics of Development and Disease Branch (C.-X.D.), National Institute of Diabetes and Downloaded from https://academic.oup.com/mend/article/19/10/2610/2738010 by guest on 23 September 2021 Digestive and Kidney Diseases, National Institutes of Health, Bethesda, Maryland 20892

LH ␤-subunit (LH␤), which is essential for ovulation site found in this region of the promoter. Juxta- and reproductive fitness, is synthesized specifi- posed to the HB are three Smad-binding elements cally in pituitary gonadotropes. In this study, we (SBEs), which are essential for LH␤ induction. In- show that LH␤ gene expression is induced by ac- terestingly, two of the SBEs are also critical for tivin in mouse primary pituitary cells if the cells are basal expression of the LH␤ gene. We demonstrate treated within 24 h after dispersion in culture. Fur- that Smad proteins are necessary and sufficient for thermore, male mice deficient in Smad3, and there- activin induction of the LH␤ gene. Furthermore, fore in activin signaling, have lower expression of Smad proteins can bind one of the identified SBEs. both LH␤ and FSH␤ mRNAs compared with their In addition to binding this SBE, Smad proteins in- wild-type littermates. Using the L␤T2 immortalized teract with pituitary homeobox 1 (Ptx-1) and ortho- mouse gonadotrope cell line that endogenously denticle homeobox 1 (Otx-1), which can bind the expresses LH, we identify specific elements in the HB located close to the Smad-binding site. Thus, regulatory region of the rat LH␤ gene necessary for activin induction of LH␤ gene expression requires its induction by activin. Activin responsiveness is a combination of several transcription factors, conferred by a promoter-proximal region located both basal and activin induced, as well as cooper- ؊121/؊86 from the transcriptional start site. Max- ation between multiple DNA elements. (Molecular imal LH␤ induction by activin requires a homeobox Endocrinology 19: 2610–2623, 2005) (element (HB) and a 5؅-early growth response (Egr

H IS ESSENTIAL for steroidogenesis and repro- initially described as functioning in gonadal feedback Lductive function in both males and females, be- on gonadotropin synthesis. Activin increases release cause a lack of this hormone leads to hypogonadism of FSH (6) from the pituitary and induces FSH␤ ex- and infertility in both sexes (1). LH synthesis is repression in gonadotrope cells (7), whereas inhibin an- stricted exclusively to the anterior pituitary gonado- tagonizes activin action. Follistatin, a potent activin- tropes (2). It is a heterodimeric glycoprotein, com- binding protein (8), can inhibit the biosynthesis and posed of an ␣-subunit, in common with FSH and TSH, secretion of FSH (9). Interestingly, activin, follistatin, and a unique ␤-subunit, which confers biological and inhibin are expressed in the mature pituitary go- specificity. Transcription of the ␤-subunit is the rate- nadotrope and can function in an autocrine manner limiting step for LH production (3, 4). LH ␤-subunit (10–12). Follistatin is also synthesized by folliculostel- (LH␤) gene transcription is induced by GnRH and re- late cells in the pituitary and regulates activin availabil- pressed by gonadal steroids (5). ity in a paracrine manner (13, 14). Activin and inhibin, members of the TGF␤ family of TGF␤ family members, including activin, activate growth factors, also play important roles in the mod- signaling molecules known as receptor-associated ulation of gonadotropins. These glycoproteins were Smads, which, in the case of activin, are Smad2 and/or Smad3 (15). Smad2 or Smad3 then associate First Published Online June 16, 2005 with a common Smad, Smad4 (DPC4). The activated Abbreviations: BSA, Bovine serum albumin; Egr, early growth response; GAPDH, glyceraldehyde-3-phosphate de- heteromeric Smad complex translocates into the nu- hydrogenase; GFP, green fluorescent protein; GST, glutathi- cleus, where it binds a Smad-binding element GTCTA- one-S-transferase; HB, homeobox element; LH␤,LH␤-sub- GAC, or either half of this palindrome, within DNA to unit; NP-40, Nonidet P-40; Otx, orthodenticle homeobox; regulate the expression of target genes (16). Ptx, pituitary homeobox; SBE, Smad-binding element; SF-1, As mentioned above, there is considerable evidence steroidogenic factor 1. that activin regulates FSH synthesis and secretion. Molecular Endocrinology is published monthly by The Endocrine Society (http://www.endo-society.org), the However, the initial reports regarding the role of activin foremost professional society serving the endocrine in gonadotropes failed to detect an effect of activin on community. LH secretion (6, 17). In contrast, a number of subse-

2610 Coss et al. • Activin Regulation of LH␤ Mol Endocrinol, October 2005, 19(10):2610–2623 2611

quent studies suggest that activin can influence LH basal expression. In this region, we also identified synthesis, both in vivo and in cell culture. Stouffer et al. three Smad-binding elements (SBEs), and mutation of (18) have shown an acute and sustained increase in LH any one of these sites completely abolished activin secretion in response to activin in female rhesus mon- response. Interestingly, two of these SBEs are also keys. McLachlan et al. (19) reported that 2-d activin important for basal expression of LH␤. Finally, we infusion in adult male monkeys significantly increased demonstrate that overexpressed Smad proteins acti- both LH and FSH release in response to GnRH injec- vate LH␤, bind a SBE in gel-shift assay, and interact tion. Attardi and Miklos (20) demonstrated that treat- with orthodenticle homeobox (Otx) and pituitary ho- ment of primary rat pituitary cell cultures with activin meobox (Ptx) proteins, which can bind the HB. There- results in significant increases in both LH secretion fore, activin regulation of LH␤ gene expression, similar ␤ ␤ and protein content in the cells, as well as LH mRNA to LH regulation by GnRH, requires multiple, com- Downloaded from https://academic.oup.com/mend/article/19/10/2610/2738010 by guest on 23 September 2021 levels. More recently, this observation was confirmed posite DNA elements and involves a combinatorial in human fetal primary cell culture, where recombinant action of several DNA binding proteins. human activin caused a significant increase in LH secretion into the medium. In addition, inhibin decreased FSH and LH secretion, but the LH response to inhibin RESULTS was less prominent than that of FSH (21). Furthermore, our laboratory has previously shown that an LH␤ re- Activin Induces LH␤ in Primary Mouse Pituitary porter gene is induced by activin in transiently trans- Cell Culture fected L␤T2 cells (22), and, recently, this finding was extended in a study in which the endogenous LH␤ There is little doubt that activin is a major regulator of gene was induced by activin in this mature gonado- FSH synthesis; however, examination of the effects of trope cell model (23). Despite these reports, activin is activin on LH has resulted in conflicting reports. Some still generally regarded as a selective regulator of FSH. studies have shown that activin regulates LH␤ induction In this report, we used primary mouse pituitary cells in animals and cell culture, both in rat primary pituitary enzymatically dispersed in culture to address this dis- cells and a gonadotrope cell model derived from the crepancy in the literature by showing that the LH␤ mouse; however, others did not detect this response. In gene can be induced by activin treatment. Moreover, this study, we sought to provide a possible explanation using Smad3-deficient mice, we confirmed a role for for these differing results regarding activin regulation of activin in regulation of LH␤ expression in vivo, when LH synthesis as well as determine whether activin regu- we found that these mice have lower expression of lates LH␤ induction in mouse primary cells. Using mouse LH␤ mRNA, in addition to lower levels of FSH␤, com- cells instead of rat primary cells allowed us to directly pared with their wild-type littermates. We then sought correlate our results with experiments in genetically to identify the molecular mechanism of activin induc- modified mice and more detailed mechanistic studies tion of LH␤ gene expression using L␤T2 cells, the using the mouse-derived gonadotrope cell line, L␤T2. mature gonadotrope cell model derived from a trans- We enzymatically dispersed mouse pituitary cells and genic mouse pituitary tumor, which endogenously ex- treated them with activin or GnRH for 5 h, either1dor3d presses LH␤. We found that in L␤T2 cells, LH␤ re- after the dispersion. When cells were treated within 24 h sponds to activin in a time- and dose-dependent after dispersion, both GnRH and activin induced robust manner, and the response maps between Ϫ86 and expression of LH␤ compared with the vehicle-treated Ϫ121 bp from the transcriptional start site. This is an cells (Fig. 1). Therefore, activin, as well as GnRH, induces active region of the promoter that contains a ho- LH␤ gene expression. However, when cells were al- meobox element (HB) at Ϫ100 that is crucial for basal lowed to recover for 66 h before treatment with GnRH or and cell-specific expression of the LH␤ gene (24). In activin, GnRH treatment still caused a significant induc- close proximity, on either side of the HB, are tandem tion of LH␤, although to a lesser extent than at 24 h, steroidogenic factor 1 (SF-1) and early growth re- whereas activin induction failed to reach a significant sponse (Egr) sites (25). The SF-1 sites are located at level. Because the level of LH␤ [normalized to glyceral- Ϫ127 and Ϫ59 and are outside the Ϫ121/Ϫ86 region dehyde-3-phosphate dehydrogenase (GAPDH)], did not where activin response maps. The Egr sites are lo- differ dramatically in the control cells betweend1andd cated at Ϫ112 and Ϫ50 and convey GnRH respon- 3, the cells’ responsiveness to GnRH and activin seems siveness, upon induction of Egr proteins by GnRH (26, to have decreased fromd1tod3.Thus, it is possible 27). GnRH regulation of the LH␤ gene occurs through that the length of time in culture before treatment pro- the combinatorial action of several transcription fac- vides an explanation for the contradictory results ob- tors that bind the HB element, the SF-1 and Egr sites, tained in other studies of LH␤ induction by activin. because they show synergistic interaction on the induction of the LH␤ gene (26–28). The 5Ј-Egr site is Activin Induces LH␤ Gene Expression through found in the Ϫ121/Ϫ86 region of the promoter where Proximal Regulatory Sequences activin response is located. We found that mutation of either the HB or the 5Ј-Egr site dramatically decreases Activin is critical for gonadotrope cell function, and LH␤ induction by activin, in addition to decreasing LH␤ is crucial for both male and female reproduction 2612 Mol Endocrinol, October 2005, 19(10):2610–2623 Coss et al. • Activin Regulation of LH␤ Downloaded from https://academic.oup.com/mend/article/19/10/2610/2738010 by guest on 23 September 2021

Fig. 1. LH␤ Is Induced by Activin in Primary Mouse Pituitary Cells Primary pituitary cells were dispersed enzymatically from 8-wk-old male mice and plated in culture. They were treated with vehicle (white bars), 30 nM GnRH (hatched bars), or 200 ng/ml activin (black bars) for 5 h, on the first day or on the third day after dispersion. Total RNA was purified and reverse transcribed, and the level of LH␤ expression was assayed by Fig. 2. The LH␤ Promoter Responds to Activin Treatment real-time PCR. In each sample the amount of LH␤, calculated A, The 1800-bp rat LH␤ promoter was linked to a luciferase from the standard curve, was compared with the amount of reporter gene (LH␤-luc) and transiently transfected into GAPDH. Asterisk indicates significant difference from the gonadotrope-derived L␤T2 cells. The thymidine kinase ␤- same day control as determined by one-way ANOVA and galactosidase reporter was cotransfected as an internal con- Tukey’s post hoc test. trol. After overnight starvation in serum-free DMEM, the cells were treated with 1 ng/ml activin (dashed line, solid triangles), 10 ng/ml activin (solid line, open squares), or 100 ng/ml (1). Thus, it was important to determine the molecular activin (dashed line, solid circles) for different lengths of time mechanisms by which activin induces LH␤ gene ex- (indicated on the abscissa). Luciferase activity in the lysates was measured and normalized to ␤-galactosidase. Results pression. The proximal 1800 bp of the rat LH␤ 5Ј- represent the mean Ϯ SEM of at least three independent regulatory region linked to a luciferase reporter gene experiments, each performed in triplicate, and are presented ␤ ␤ (LH -luc) was transiently transfected into L T2 cells. as fold induction from vehicle control. Statistical significance This region of the LH␤ promoter is sufficient for gona- was determined by one-way ANOVA followed by Tukey’s dotrope-specific expression and for GnRH regulation post hoc test. B, L␤T2 cells were transiently transfected with (24, 29). L␤T2 cells transiently transfected with LH␤- either Ϫ1800 bp rat LH␤ or a Ϫ398 bp mouse FSH␤ promoter luc were treated with various concentrations of activin linked to a luciferase reporter and treated with vehicle (white to determine whether this region of the LH␤ gene is bars) or with 100 ng/ml of follistatin (gray bars) for 24 h, after also sufficient for activin responsiveness. Treatment which the luciferase levels were measured and normalized to Ϯ with activin over a range of doses and at 3, 6, or 24 h the internal control. Results represent the mean SEM of at least three independent experiments, each performed in trip- revealed that this regulatory region contains elements licate, and are presented as fold induction from vehicle con- that allow response to activin in a time- and dose- trol. *, Statistically significant difference from vehicle control, dependent manner. Maximal induction is achieved af- as calculated by Student’s t test. ter6hoftreatment and the induction is maintained for at least 24 h of activin treatment (Fig. 2A). There appears to be a decreasing trend at 24 h as compared sion by exogenous activin (30). It is possible that the with the induction at6hoftreatment; however, the response of LH␤ expression differs with endogenous difference is not statistically significant. vs. exogenous activin. It is also possible that there is a Because L␤T2 cells secrete activin and express the threshold level of activin needed to achieve induction activin receptors, thus having a fully functional auto- that is higher for LH␤ as compared with FSH␤ and that crine loop (22), we assessed the contribution of en- this threshold is not achieved by endogenous activin dogenous activin on LH␤ expression. We treated the produced by L␤T2 cells under our conditions. cells with follistatin for 24 h and measured the expres- To identify which promoter elements convey activin sion of LH␤-luc (Fig. 2B). Consistent with our previous responsiveness, we mapped the regions of the LH␤ report, follistatin treatment does not diminish LH␤ lev- gene promoter that confer activin response using trun- els in these cells (22). This is in contrast to FSH␤ in cation/deletion analysis. L␤T2 cells were transiently which follistatin treatment decreases expression of transfected with a series of truncations of the LH␤ FSH␤ by about 50%. The concentration of follistatin gene 5Ј-flanking region, ranging in length from 1800 used in this experiment was sufficient to inhibit induc- bp to 86 bp upstream of the transcription start site, tion of either LH␤ (data not shown) or FSH␤ expres- and the ability of activin to induce LH␤ gene transcrip- Coss et al. • Activin Regulation of LH␤ Mol Endocrinol, October 2005, 19(10):2610–2623 2613

tion was tested (Fig. 3). Samples treated with activin whereas the mutation of the 5Ј-Egr site decreased fold were normalized to the vehicle-treated samples for induction by activin by 33%. Thus, the 5Ј-Egr site and each truncation, and results are represented as fold especially the HB site are involved in the activin reg- induction because the basal levels of expression of the ulation of the LH␤ gene. The homeodomain protein, truncations vary (24). The response of LH␤ to activin which binds the HB in the gonadotrope cell, was de- mapped between Ϫ86 and Ϫ121. The 121 most prox- termined to be either an Otx-1-like protein the identity imal bp of the rat LH␤ promoter linked to luciferase of which is not known, or potentially a posttranslation- was induced about 2-fold, as was the longer 1800 bp ally modified Otx-1. This protein is expressed at a high of the promoter, whereas truncation to Ϫ86 reduced basal level in L␤T2 cells (24). The involvement of the the induction to the level of the vector control. HB site in activin regulation of LH␤ expression may,

therefore, involve this Otx-1-like protein. The involve- Downloaded from https://academic.oup.com/mend/article/19/10/2610/2738010 by guest on 23 September 2021 Homeobox and Smad-Binding Elements Are ment of the 5Ј-Egr in activin induction is not clear, ␤ Critical for LH Induction by Activin because Egr proteins are not expressed in the gonadotrope cell until they are induced by GnRH. There- Because the activin response maps directly to this fore, it was important to assess whether activin can region of 35 bp, we then determined what promoter also induce Egr-1 (Fig. 4D). Egr-1 is the major Egr elements in this region are necessary for this re- family member induced by GnRH to bind the Egr site sponse. The proximal region of the LH␤ promoter con- in the LH␤ promoter. We performed a Western blot to tains a homeobox element, GATTA, with tandem SF-1 detect Egr-1 protein following GnRH (G) or activin (A) and Egr sites on either side. The Egr-1 sites are im- treatment of L␤T2 cells. Because Egr-1 is an immedi- portant for GnRH induction of LH␤ because Egr-1 is induced by GnRH. SF-1 is expressed specifically in ate early gene, induced very rapidly after GnRH treat- the gonadotropes of the pituitary and is important for ment (25), we used the same duration of activin treat- expression of genes in these cells. The truncations of ment to assess the activin affect on Egr-1 protein ␤ 86 and 121 bp from the transcription start site of LH␤ levels in L T2 cells. We determined that activin, con- gene were originally created to narrow this region and trary to GnRH, did not induce Egr-1 protein under limit the number of transcription factor-binding sites. these conditions. Only the 5Ј-Egr site and the HB are located in this To identify promoter elements that may further con- small region, as illustrated in Fig. 4A with uppercase tribute to LH␤ induction by activin, we examined the letters. We created mutations in the Egr and the HB DNA sequence in this region more closely. As men- sites and named them mEgr and mHB, respectively tioned, activin signals primarily through Smad2 and/or (Fig. 4B). As has been shown previously, mutations in Smad3, which, together with Smad4, bind SBE, these sites decreased basal expression of the LH␤ GTCTAGAC, or its half-sites. Sequence analysis re- gene. In addition, they decreased the induction by vealed that the Ϫ121/Ϫ86 region contains three SBEs, activin (Fig. 4C). The HB site mutation significantly which may play roles in activin induction of LH␤ gene decreased the fold induction by activin by 57%, expression (Fig. 5A). Starting from the 5Ј-end, we

Fig. 3. Activin Response Localizes to a 35-bp Region in the LH␤ Proximal Promoter Different lengths of the LH␤ regulatory region were transiently transfected into L␤T2 cells and, after overnight starvation, the cells were treated with 10 ng/ml activin for 6 h. The results are represented as fold induction from vehicle-treated cells for each truncation. *, Significantly different induction in the treated cells vs. the control cells for each truncation, as determined by Student’s t test. Results represent the mean Ϯ SEM of three independent experiments each performed in triplicate. 2614 Mol Endocrinol, October 2005, 19(10):2610–2623 Coss et al. • Activin Regulation of LH␤

termed them S1, S2, and S3 and mutated each of these SBEs to investigate their roles in activin responsiveness (Fig. 5B). Each mutation abolished activin responsiveness of the LH␤ gene. Surprisingly, two of these SBEs, S2 and S3, also had a strong influence on LH␤ basal expression. The basal expression was reduced by 50% by either mutation as compared with the wild-type sequence.

Smad Proteins Are Essential for LH␤ Induction

by Activin Downloaded from https://academic.oup.com/mend/article/19/10/2610/2738010 by guest on 23 September 2021

To determine whether activin signals to the LH␤ promoter through its classical pathway by phosphorylation of the Alk4 receptor and activation of the Smad- signaling pathway, we overexpressed Smad7 in L␤T2 cells and, after activin treatment, assessed the induction of LH␤. Smad7 serves as a dominant-negative Smad because it prevents phosphorylation of receptor Smads and formation of an active Smad heterodimer of Smad2/3 and Smad4 (31, 32). Complete inhibition of activin signaling by overexpression of Smad7 would indicate that activin uses the classical signaling pathway to induce LH␤ gene expression. Indeed, overexpression of Smad7 completely abolishes activin induction of the LH␤ gene, indicating that an active Smad pathway is necessary for induction (Fig. 6A). Again, consistent with our results with follistatin treatment, Smad7 does not affect basal LH␤ levels, indicating that endogenous activin does not play a role in the regulation of LH␤ under these culture conditions. To further assess the role of Smad proteins in induction of LH␤ gene expression, we cotransfected a Smad3 expression vector with LH␤-luc and assessed luciferase levels with and without activin treatment. A recent report has shown that Smad2 cannot be overexpressed in L␤T2 cells and that Smad3 alone is sufficient for FSH␤ induction, presumably because Smad4 levels are not the limiting factor for activin effect in these cells (33). Similar to FSH␤ regulation, Fig. 4. The Homeobox and 5Ј-Egr Sites Are Required for LH␤ is induced by 3.2-fold with overexpression of ␤ Maximal Induction of LH by Activin Smad3 (Fig. 6B). Mutation of any one of the three SBE ␤ Ϫ Ϫ A, Rat LH promoter sequence from 130 to 86 bp from sites diminished LH␤-luciferase induction by overex- the start site of transcription is shown. The truncations be- pression of Smad3. Specifically, mutation of the SBE 1 tween which the activin response maps are marked with uppercase letters; however, the larger sequence was pre- or 2 sites completely abolished induction, not only by sented to identify the SF-1 site. The 5Ј-Egr and the homeobox element (HB) are indicated with an oval and a rect- angle, respectively. B, Mutations in the homeobox element (mHB) and Egr (mEgr) were introduced into the LH␤-luc vec- performed in triplicate. C, The same results from panel B, tor, and transfections were performed in L␤T2 cells. Cells presented as percent change in fold induction of the mutated were treated with vehicle (white bars) or with 10 ng/ml activin reporters from the induction of the wild-type reporter. #, (black bars) for 6 h, after which the luciferase activity was Statistically significant change in fold induction by one-way measured and normalized to ␤-galactosidase. The results are ANOVA and Tukey’s test. D, Western blot of L␤T2 whole-cell normalized to the luciferase/␤-galactosidase ratio in the cells extract after 2-h treatment with vehicle control (C), 10 nM transfected with the wild-type reporter and treated with ve- GnRH (G), or 10 ng/ml activin (A). Equal amounts of protein hicle control. Statistical significance was determined by one- were run on the gel and, after transfer, membranes were way ANOVA followed by Tukey’s post hoc test. *, Significant probed with antibodies specific for Egr-1 protein. After the induction by activin in the treated cells vs. the control cells for secondary antibody, enhanced chemiluminescence was per- each reporter; #, a significant difference in expression from formed and the blots were exposed to film. The experiment the wild-type reporter in control-treated cells. Results repre- was repeated three times with the same result and a represent the mean Ϯ SEM of four independent experiments, each sentative gel was shown. WT, wild type. Coss et al. • Activin Regulation of LH␤ Mol Endocrinol, October 2005, 19(10):2610–2623 2615 Downloaded from https://academic.oup.com/mend/article/19/10/2610/2738010 by guest on 23 September 2021

Fig. 5. The SBE Sites Are Crucial to the LH␤ Response to Activin A, Rat LH␤ promoter sequence from Ϫ121 to Ϫ86 bp from the start site of transcription is shown. In addition to the Fig. 6. Smad Proteins Are Necessary and Sufficient for LH␤ indicated homeobox and Egr sites, SBEs (S1, S2 and S3 Induction by Activin numbering from 5Ј to 3Ј) are circled for clear observation. B, A, Cells transfected with wild-type LH␤-luc were treated Point mutations (2 bp) in each of the SBEs were separately for 6 h with vehicle (white bars) or 10 ng/ml activin (black introduced into the reporter (mS1, mS2, and mS3), and their bars). Cells were cotransfected with an expression vector for induction by activin treatment was compared with the wild- Smad7 or its empty vector control, to assess the necessity for type reporter. *, Significantly different fold induction in the Smad protein activation in the induction by activin. Results treated cells vs. the control cells for each reporter; #, a represent the means of three independent experiments each significant difference in the level of luciferase expression from performed in triplicate. *, Statistically significant difference the control treated cells transfected with wild-type reporter. from the control cells transfected with the wild-type vector. B, Cells transfected with wild-type LH␤-luc, or each SBE mutation introduced into LH␤-luc, were cotransfected with activin, as we have shown in the previous figure, but Smad3 or empty vector control (control). Activin was added also by Smad3 overexpression. The SBE 3 site muta- to the cells 24 hr after transfection (filled bars are activin tion considerably reduced the level of induction. Pro- treated and white bars are control) and after6hoftreatment, moter induction was reduced from 3.2-fold for the wild luciferase activity was measured and normalized to ␤-galac- type to 1.65-fold. None of the mutant promoters tosidase. Results represent the means of three independent showed an additional increase with treatment with experiments each performed in triplicate. *, Statistically sig- activin, which is similar to what was observed in Fig. nificant induction by activin; #, statistically significant induction by Smad3 overexpression as analyzed by ANOVA and 5B. This result indicates that all three sites play roles in Tukey’s post hoc test. WT, Wild type. induction by activin and by Smad3 protein. As in previous reports studying FSH␤ induction (33, 34), overexpression of Smad3 alone is sufficient to reproduce the effect of activin on LH␤ induction. complexes that bind this region from cells transfected with empty vector control (first lane) with cells trans- Smad Proteins Bind an SBE in the LH␤ Promoter fected with the Smad4 expression vector (second and Can Interact with Ptx-1 and Otx-1 Proteins lane), we detected two strong bands not present in the control lane (marked with arrows) (Fig. 7B). The same To assess whether Smad proteins can bind the SBE pattern was observed when nuclear extract from Cos sequences in the Ϫ121/Ϫ86 region of the promoter, 1 cells transfected with both Smad3 and Smad4 was we used EMSA. The whole Ϫ121/Ϫ86 region was used (data not shown). These bands are supershifted used as a probe (Fig. 7A) with nuclear extracts from (labeled “ss”) with antibodies to Smad4 protein (third Cos 1 cells transfected with the expression vector for and last lane), indicating that Smad proteins are in- Smad4 or empty vector control. Smad proteins have deed a part of this complex. Thus, Smad proteins can relatively low affinity in binding DNA, and overexpres- bind this region in vitro. To determine which nucleo- sion is one way to overcome this limitation. Comparing tides are needed for Smad protein binding, competi- 2616 Mol Endocrinol, October 2005, 19(10):2610–2623 Coss et al. • Activin Regulation of LH␤

tions with 200-fold excess of unlabeled mutant oligonucleotides were used. Scanning mutations (3 bp) were introduced into the Ϫ121/Ϫ86 oligonucleotide and were termed mutations A–K (Fig. 7A). Oligonucle- otides with mutations in the second SBE (S2) element (Fig. 7, B and C) could not bind Smads and did not compete with the labeled wild-type probe. Therefore, SBE2atϪ116 from the start site of the transcription is the site that can be bound by Smad proteins with high enough affinity to be detected in EMSA.

In the next EMSA, we used nuclear extracts from Downloaded from https://academic.oup.com/mend/article/19/10/2610/2738010 by guest on 23 September 2021 L␤T2 cells treated with vehicle control or activin, to assess whether activin treatment causes changes in complexes that bind this promoter region. Activin treatment for 30 min, 2 h, or 6 h increased the intensity of a complex indicated with an asterisk in Fig. 8A. The same complex is supershifted with antibodies to Smad4 (indicated with ”ss“ in the figure), confirming the identity of the band as a Smad4-containing complex. Next, we introduced mutations into the wild-type sequence to assess the ability of each of the SBEs to bind Smad proteins. Subsequently, these mutants were used as probes in comparison with the wild-type sequence. Smad4 antibody was included with nuclear extracts to allow clearer observation of the Smad complex due to the supershift caused by Smad4 antibody (Fig. 8B). A supershift was observed when the wild-type sequence was used as a probe, as demonstrated in Fig. 8A. When the mutated sequence that contains only SBE 2 was used as a probe (2), a supershift with Smad4 antibody was retained, although SBE 1 and SBE 3 were not present. On the other hand, the probes containing only SBE 1 (1) or SBE 3 (3) sites, but lacking SBE 2, did not bind Smad4 in this assay. Thus, again, as with Cos-1 extract, the SBE 2 site is critical for Smad protein binding of LH␤ promoter. The SBE 1 and 3 may contribute to the affinity of binding because the intensity of the complex binding probe 2 Fig. 7. Smad Proteins Bind a SBE at Ϫ116 in the LH␤ Pro- was lower than that with the wild-type probe. As ex- moter pected, when all three SBE sites were mutated (Fig. A, An alignment of wild-type sequence (WT) from the rat 8A), Smad4 antibody did not cause a supershift, indi- LH␤ promoter Ϫ121/Ϫ86, and the oligonucleotides used as cating that Smad proteins cannot be tethered to the competitors, labeled A–K, is shown. Scanning mutations promoter solely through interaction with other promot- were introduced into oligonucleotides A–K, and these er-binding proteins. Furthermore, when we used a mu- changes are underlined. These unlabeled oligonucleotides tant probe that contains only the three SBE sites, with were used in 200-fold excess in EMSA experiments in panel the Egr and HB sites mutated (Fig. 8B), Smad4 anti- B, whereas wild-type sequence (WT) was used as a probe. body caused a supershift, indicating that Smad pro- The SBE sites are indicated with a circle in the wild-type ␤ sequence, and the HB site is indicated with a square. B, Nuclear teins do not need the Egr or HB sites to bind the LH extracts from transfected Cos 1 cells were subjected to EMSA promoter. with radiolabeled wild-type probe. Extracts from cells trans- Herein, we have determined in transfection assays fected with the control plasmid were used in the lane labeled C, that all of the three SBEs found in the Ϫ121/Ϫ86 whereas extracts from Cos 1 cells transfected with Smad4 region of the LH␤ promoter are required for activin expression vector were used in the remaining lanes. Complexes responsiveness and that the HB element at Ϫ100 is that change in Smad4-containing lysates are indicated with necessary for maximal induction of LH␤ by activin. arrows. Mutated oligonucleotides were used as competitors in We also determined by EMSA that Smad proteins 200-fold excess in the corresponding lanes. In the lanes labeled can bind one of these SBEs found in this region, 1 and 2, the antibody to Smad4 was included to induce the whereas previously, it has been shown that Ptx-1 or supershift, marked with “ss.” The antibody in the lane labeled 1 was obtained from Upstate USA, whereas the antibody in the Otx-1 proteins can bind the HB element (24, 35). lane labeled 2 was purchased from Santa Cruz Biotechnology. Further, it has also been shown that proteins that NE, Nuclear extract; ab, antibody. bind this region of the promoter can interact syner- Coss et al. • Activin Regulation of LH␤ Mol Endocrinol, October 2005, 19(10):2610–2623 2617 Downloaded from https://academic.oup.com/mend/article/19/10/2610/2738010 by guest on 23 September 2021

Fig. 8. Smad Proteins from Activin-Treated L␤T2 Cells Bind the LH␤ Promoter A, EMSA was performed with nuclear extracts from activin-treated L␤T2 cells for the times indicated above each lane, using the Ϫ121/Ϫ86 region of LH␤ promoter as a probe. In the IgG lane, nonspecific antibody was included, whereas in the S4 lane, antibody to Smad4 from Santa Cruz Biotechnology was included. “ss” indicates a supershift, whereas * marks a complex that changed after activin treatment. B, Wild-type and mutant probes used in EMSA are illustrated. In the bottom panel, each lane represents a corresponding probe used to assess binding in EMSA with activin-treated nuclear extract and Smad4 antibodies. Ab, Antibody; WT, wild type.

gistically (27). Consequently, it was important to Activin Is Critical for LH␤ Expression in Vivo assess whether Smad proteins can interact with Ptx or Otx proteins. We used a glutathione-S-trans- To validate our results obtained using the L␤T2 cells ferase (GST) pull-down assay with in vitro tran- and assess the role of activin in LH␤ gene expression scribed and translated Ptx-1 and Otx-1 proteins to in vivo, we determined the level of LH␤ and FSH␤ gene test whether they can interact with Smad2-, 3-, or expression in Smad3-deficient mice. These mice lack 4-GST fusion proteins. GST pull-down assays indi- exon 8 of the Smad3 gene, which prevents synthesis cate that both Ptx-1 and Otx-1 interact with the of the functional Smad3 protein (36). Females are in- Smad2, 3, and 4 proteins (Fig. 9). 35S-labeled Ptx-1 fertile due to an ovarian phenotype (37) and, therefore, and Otx-1 precipitate with glutathione beads pituitary effects are impossible to assess. For that through an interaction with GST-Smad2, 3, or 4. No reason, we used only male animals in our studies at 8 interactions were observed using GST alone, nor did wk of age. To determine the levels of LH␤ and FSH␤ labeled green fluorescent protein (GFP), which mRNA in the pituitary, quantitative PCR was used, and serves as a control, interact with any of the GST- values were normalized to the levels of GAPDH mRNA fusion proteins. Thus, Ptx-1 and Otx-1 can form expression for each animal (Fig. 10). We determined heteromeric complexes with Smad proteins in vitro, that both LH␤ and FSH␤ are expressed at a lower level through protein-protein interaction. in Smad3-deficient animals than in their wild-type lit- 2618 Mol Endocrinol, October 2005, 19(10):2610–2623 Coss et al. • Activin Regulation of LH␤ Downloaded from https://academic.oup.com/mend/article/19/10/2610/2738010 by guest on 23 September 2021

Fig. 9. Smads2, 3, and 4 Can Interact Directly with Ptx-1 and Otx-1 35S-labeled proteins, indicated on the left of the panels, were used in the binding assay with GST-fusion proteins, labeled above each lane. GST-fusion proteins were induced with isopropyl-␤-D-thiogalactosidase overnight, and the bacterial pellets were sonicated. These proteins were bound to Glutathione Sepharose beads and incubated with in vitro transcribed and translated labeled proteins. After extensive washing, the precipitates were run on a gel and subjected to Fig. 10. Smad3-Deficient Male Mice Have Lower Levels of autoradiography. The experiment was repeated three times LH␤ and FSH␤ mRNA with the same results and a representative experiment is Total RNA from individual pituitary was reverse transcribed shown. and LH␤, FSH␤, and GAPDH cDNA were quantified using real-time PCR. For each animal, the amount of LH␤ or FSH␤ mRNA was calculated from a standard curve performed si- termates. LH␤ was decreased by 38%, whereas FSH␤ multaneously. The amount was compared with the amount of ϭ was reduced by 32%, in comparison with gonadotro- GAPDH also calculated from its standard curve. n 9 ani- ␤ ϩ ϩ pin mRNA levels in wild-type mice. Thus, activin plays mals per group; the level of LH /GAPDH ratio in / animals was set to 1, to allow comparison of the change from wild a role in both LH␤ and FSH␤ expression in vivo. type. #, Significant difference from the wild-type littermates by Student’s t test: P ϭ 0.0007 for LH␤ and P ϭ 0.008 for FSH␤. DISCUSSION doses are necessary for stimulation of LH synthesis as Recently, a number of studies have shown that activin opposed to FSH, and the initial studies did not detect regulates both LH synthesis and secretion in vivo and the smaller, but significant, changes in LH due to the in primary pituitary cell culture, both in primates and in lower activin concentrations used. In our studies, ac- rodents. However, due to initial reports that did not tivin consistently induced LH␤ gene in primary cells detect increased LH synthesis after activin treatment, with the higher concentration (200 ng/ml), as pre- activin is still generally regarded as a selective regu- sented in Fig. 1, whereas lower concentrations of ac- lator of FSH. In gonadotrope-derived L␤T2 cells, both tivin (20 ng/ml) significantly increased LH␤ gene ex- endogenous LH␤ gene and a reporter gene under LH␤ pression in about 50% of experiments. Second, the promoter regulation were significantly induced by ac- difference may be due to the physiological state of the tivin. Herein, we show that activin induces LH␤ mRNA, animals from which the pituitaries were extracted or to if the primary pituitary culture is treated within 24 h the stress level the animals experienced during trans- after enzymatic cell dispersion. Several possibilities port or procedure. For example, the animals used can be proposed to explain the differences in these could have been from a stage of the estrous cycle various studies. First, it is possible that higher activin when ovarian follistatin is at its highest. On the other Coss et al. • Activin Regulation of LH␤ Mol Endocrinol, October 2005, 19(10):2610–2623 2619

hand, circulating activin may have been at a different basal regulation, and it is found to bind the Ptx pro- level. As demonstrated in Fig. 2B, autocrine, endoge- teins overexpressed in CV-1 cells (27) or an Otx-1- nous activin does not seem to play a role in LH␤ related protein, expressed endogenously in the L␤T2 expression, whereas it contributes significantly to cells (24). Therefore, this site is also involved in cell FSH␤ expression. Circulating activin, however, may specificity of LH␤ expression, because L␤T2 cells, have a different effect. It is also credible that different which represent the most mature gonadotrope cells levels of steroid hormones due to cycling of the female and endogenously express LH␤, are the only gonado- animals may have contributed to the differential regu- trope-derived cell type that expresses the protein that lation of FSH and LH by activin. FSH synthesis has binds this site. A less mature gonadotrope cell model, been shown to be stimulated by progesterone or tes- such as the ␣T3–1 cell, which does not express LH␤,

tosterone, which also synergize with activin to induce does not express this protein. An SF-1 site is found in Downloaded from https://academic.oup.com/mend/article/19/10/2610/2738010 by guest on 23 September 2021 FSH, whereas LH can be suppressed by progesterone close proximity to the HB, and it may also contribute to or testosterone in L␤T2 cells (Thackray, V. G., S. M. cell-specific expression, because SF-1 is limited to the McGillivray, and P. L. Mellon, manuscript submitted). gonadotrope population within the pituitary. Ptx pro- To eliminate fluctuation of hormones due to the es- teins were found to synergize with SF-1 to induce LH␤ trous cycle, we used male animals for our studies. gene expression in CV-1 cells, which do not express Third, the studies that failed to detect activin induction endogenous SF-1 (28). L␤T2 cells express high levels of LH␤ may have used less sensitive techniques to of endogenous SF-1, and thus it is difficult to observe analyze changes in the hormone or gene expression this regulation in these cells. Regardless, the SF-1 site levels. Lastly, the studies that did not observe activin was not present in the Ϫ121/Ϫ86 region of the pro- regulation of LH may have had a higher level of fol- moter that remains activin responsive, and therefore liculostellate cells in their primary pituitary cultures due we concentrated on the HB and Egr sites. Here we find to having been in culture longer before the experiment. that both HB and the 5Ј-Egr site have roles in activin Traditionally, primary cells were left to recover for 48 h regulation of LH␤ gene expression, because mutation after the pituitary dispersion and then were treated of these reduces the magnitude of activin induction. with the stimulus of interest, because that was the GnRH regulation of LH␤ occurs through the induc- optimal time for studying secretory response to the tion of Egr proteins, which bind their two sites also releasing hormones. Some studies in the literature still found in this region of the promoter. Interestingly, follow this protocol, despite more recent studies with there is a functional difference between the 5Ј- and primary pituitary cultures that have reported that se- 3Ј-Egr sites. Mutation of the 3Ј-Egr site diminishes cretory cells are rapidly overgrown by folliculostellate GnRH induction, whereas the 5Ј-site does not seem to cells, which secrete follistatin, a potent activin inhibitor play a role in GnRH regulation of LH␤ gene (38). Also, (14). Our results appear to correlate with the rationale in vitro binding to these sites by EMSA showed that of overgrowth of folliculostellate cells, because the Egr-1 binds with high affinity to the 3Ј-Egr site, LH␤ induction by activin was more robust when the whereas the intensity of binding to the 5Ј-site is orders treatment was conducted 1 d after dispersion. When of magnitude lower (25, 39). This raises the question the cells were treated on the third day after dispersion whether the 5Ј-Egr site is bound in vivo by a different in culture, induction of LH␤ was far less prominent, transcription factor. Because the 5Ј-Egr site does not perhaps due to high levels of follistatin secreted by the seem to bind Egr proteins with high affinity nor is it predominant folliculostellate cells. involved in GnRH induction of LH␤, this site may bind Smad3-deficient mice have lower levels of both LH␤ a different member of the Egr/SP-1 superfamily. It is and FSH␤ mRNA when compared with their wild-type interesting to speculate that this protein may be in- littermates, confirming a role for activin in gonadotro- duced by activin and may play a role in activin regu- pin regulation in vivo. Female animals have a severe lation of LH␤. On the other hand, it has been demon- ovarian phenotype, and any effect on the gonado- strated that Ptx can also synergize with Egr to induce tropes may be due to the lack of gonadal feedback. To LH␤ (27). Interestingly, mutation of the Ptx element circumvent these problems, we have used only male has a more profound effect, and it is possible that the animals. Although fertile, Smad3-deficient males are Egr site contributes to the activin induction only be- considerably smaller and we determined that they also cause of its synergistic interaction with Ptx or Otx. have lower gonadotropin levels than their littermates. Mutation of any of the three SBE sites completely Because of the importance of activin in appropriate abolishes induction by activin and dramatically dimin- gonadotropin gene expression and the necessity for ishes induction by Smad3 cotransfection. This require- LH␤ in both male and female reproductive function, ment for multiple sites has been found in other TGF␤/ we proceeded to identify the molecular mechanism of activin-responsive promoters (40). Multiple SBEs in activin regulation of LH␤ gene expression. close proximity to each other allow for cooperative Activin response maps to a very active region of the binding of Smad proteins and allow them to overcome promoter that contains elements for basal, cell-spe- their low binding affinity. Furthermore, the require- cific, and GnRH regulation of the LH␤ gene. Mutation ments for other promoter elements for full activin re- of the HB site, GATTA, in this region, dramatically sponse have also been reported (41). It is likely that a reduces activin responsiveness. The HB is critical for similar situation occurs with the LH␤ promoter, in 2620 Mol Endocrinol, October 2005, 19(10):2610–2623 Coss et al. • Activin Regulation of LH␤

which the Ptx/Otx-binding homeobox site is required activin induction, can bind these sites remains to be for full activin response. Interaction of Smad proteins determined. with other transcription factors has been reported (42). In this report, we determined that activin plays a role Most notably, Smad2 is known to interact with the in LH␤ expression in vivo and induces LH␤ mRNA in homeobox proteins Milk and Mixer (43). Herein we primary mouse pituitary cells before overgrowth of detect that Smads 2, 3, and 4 can interact with ho- secretory cells by folliculostellate cells, which may meobox proteins Ptx-1 and Otx-1. It is likely that, diminish bioavailability of activin by secreting follista- because Smads can interact with Ptx-1 in addition to tin. Activin acts through three SBE sites, the mutation Otx-1, they can also interact with a related family of which abolishes activin induction, and, of which, member expressed endogenously in L␤T2 cell, the two are critical for basal expression of the LH␤ gene as ␤ Otx-1-like protein, the identity of which is not known. well. Interestingly, the region of the LH promoter Downloaded from https://academic.oup.com/mend/article/19/10/2610/2738010 by guest on 23 September 2021 Possibly, that interaction with other proteins stabilizes where these SBE sites are found is also critical for Smad interaction with DNA and, in the case of LH␤, induction by GnRH and for basal expression. Tran- may play a role in activin induction. Additionally, SBE scription factors that bind elements in this region of site 2, which has a dramatic effect both on basal and the promoter have been shown to physically interact, activin-induced gene expression, and is bound by forming a complex. Because Smads bind and induce ␤ Smad4 in EMSA, is juxtaposed to the 5Ј-Egr site. Thus, LH and they can interact with homeodomain pro- it is possible that Smad proteins are interacting with teins, this suggests that Smad proteins are a part of a this putative Egr family member to regulate both basal large, transcriptionally active complex that is critical ␤ and activin-regulated LH␤ gene expression. for the regulation of the LH gene transcription. We determined that Smad proteins bind the DNA in the Ϫ121/Ϫ86 region of the promoter using EMSA both from Cos-1 cells with overexpressed Smad pro- MATERIALS AND METHODS teins and from activin-treated L␤T2 cells. Specifically, we established that the middle SBE is needed for this Primary Mouse Pituitary Cell Culture and Treatment binding. This SBE is located 5Ј to the HB and to the Egr site. It is possible that the binding affinity for the Male C57 Black 6 mice (6 wk of age) were purchased from other SBEs is too low to detect in a gel shift, because Harlan Sprague Dawley (Indianapolis, IN), and housed for 2 our transient transfection experiments indicate that all wk in UCSD animal facility under standard conditions. At 8 wk of age, mice were killed by decapitation and pituitaries were of the SBEs are required for activin response. SBE 1 collected in ice-cold Dulbecco’s A PBS (PBS). After a PBS and 3 may contribute to the stability of Smad protein rinse, pituitaries were placed in Hank’s balanced salt solution binding, because, when only SBE 2 is present, the with 25 mM HEPES, pH 7.2, containing 0.25% collagenase intensity of binding is lower than when all three sites and 0.25% trypsin. After cell dispersion for 30 min at 37 C in a shaking waterbath, the same volume of DMEM with 10% are present. fetal bovine serum was added to stop the reaction and then Surprisingly, two of the three SBEs identified are deoxyribonuclease was added to a final concentration of 20 critical for LH␤ basal expression as well. These two ␮g/ml and incubated for another 15 min at 37 C. Subsequent to removal of tissue debris, cells were pelleted by centrifu- SBEs are located around the HB, which has been 6 2 ␤ gation and plated at 10 cells/2-cm well density. The me- shown to be crucial for the basal expression of LH dium was changed to serum-free DMEM with 0.1% bovine gene. However, these SBE sites are sufficiently sepa- serum albumin (BSA) 16 h before treatment. Cells were rate such that the sequences do not overlap the HB, treated with GnRH (Sigma Chemical Co., St. Louis, MO) or and neither site is needed for binding of the homeodo- activin (Calbiochem, La Jolla, CA) for 5 h, after which the cells were lysed to obtain total RNA. main protein (24). Because neither follistatin nor over- Smad 3-deficient mice and their littermates were housed in expression of Smad7 can reduce the basal expression our facility in accordance with approved animal protocols. At of LH␤, it appears that endogenous activin does not 8 wk of age, mice were killed and pituitaries were removed for play a role in supporting basal expression under these total RNA extraction. culture conditions, and therefore what we are measur- ing are changes in “true” basal expression due to Quantitative Real-Time PCR these cis mutations. It would be interesting to deter- RNA was obtained with Trizol reagent (Invitrogen, Carlsbad, mine whether Smad proteins have a role in basal ex- CA) according to the manufacturer’s instructions. Contami- pression and the manner in which they accomplish it. nating DNA was removed with DNA-free reagent (Ambion, Smad4 has been shown to shuttle in and out of the Inc., Austin, TX) and 2 ␮g RNA was reverse transcribed using nucleus independent of activin treatment (44). Given Superscript III First-strand Synthesis System (Invitrogen, Carlsbad, CA). Quantitative real-time PCR was performed in that Smad4 can bind the SBE 2 that is critical for basal iCycler from Bio-Rad Laboratories, Inc. (Hercules, CA), using regulation, whereas Ptx or Otx bind the homeobox QuantiTect SYBR Green PCR Kit (QIAGEN, Valencia, CA) and element also involved in basal expression, Smad4 in- the following primers: teraction with Ptx and Otx may contribute to basal LH forward: CTGTCAACGCAACTCTGG expression of LH␤ gene though interaction with these LH reverse: ACAGGAGGCAAAGCAGC GAPDH forward: TGCACCACCAACTGCTTAG homeodomain proteins. Alternatively, whether some GAPDH reverse: GGATGCAGGGATGATGTTC other proteins, which are involved in both basal and FSH forward: GCCGTTTCTGCATAAGC Coss et al. • Activin Regulation of LH␤ Mol Endocrinol, October 2005, 19(10):2610–2623 2621

FSH reverse: CAATCTTACGGTCTCGTATACC with secondary antibodies linked to horseradish peroxidase under the following conditions: 95 C for 15 min, followed by and enhanced chemiluminescence reagent (Amersham Phar- 40 cycles at 95 C for 15 sec, 54 C for 30 sec, and 72 C for 30 macia Biotech, Piscataway, NJ). sec. For LH␤ and FSH␤ measurements, equivalent to 50 ng of starting RNA (as quantified before reverse transcription) EMSA was used in each reaction, whereas for GAPDH 10 ng was sufficient. Each sample was assayed in triplicate, and the experiment was repeated four times. A standard curve with L␤T2 cells, after vehicle control or 10 ng/ml activin treatment dilutions of 10 pg/well, 1 pg/well, 100 fg/well, and 10 fg/well for the times indicated, or Cos 1 cells, transfected for 24 h of a plasmid containing LH␤ cDNA, FSH␤ cDNA, or GAPDH with expression vectors containing Smad 3 and/or Smad 4 cDNA was generated in each run with the samples. In each cDNAs (kindly provided by Rik Derynck), or vector control, experiment, the amount of LH␤ was calculated by comparing were scraped in hypotonic buffer (20 mM Tris-HCl, pH 7.4; 10 threshold cycle obtained for each sample with the standard mM NaCl, 1 mM MgCl2) with protease inhibitors (aprotinin, curve generated in the same run. Replicates were averaged pepstatin, leupeptin) at 10 ␮g/ml each, and 1 mM PMSF and Downloaded from https://academic.oup.com/mend/article/19/10/2610/2738010 by guest on 23 September 2021 and divided by the mean value of GAPDH in the same sam- allowed to swell on ice. Cells were broken by passing through ple. After each run, a melting curve analysis was performed to a 25-gauge needle, and the nuclei were pelleted by centrif- confirm that a single amplicon was generated in each ugation. Nuclear proteins were extracted in hypertonic buffer reaction. (20 mM HEPES, pH 7.8; 420 mM KCl; 1.5 mM MgCl2 with protease inhibitors; and 20% glycerol). Nuclear protein (2 ␮g per sample) was used in the binding reaction (10 mM HEPES, Cell Culture and Transient Transfection pH 7.8; 50 mM KCl; 5 mM MgCl2;5mM dithiothreitol; 0.1% BSA; 0.1% NP-40 with 0.5 ␮g/ml polydeoxyinosinic deoxy- L␤T2 cells were plated in 12-well plates 1 d before transfec- cytidylic acid; and 2 fmol per reaction of end-labeled probe). tion. Transfection was performed in DMEM with 10% FBS Oligonucleotides were labeled with T4 kinase using ␥-32P- using Fugene 6 reagent (Roche Molecular Biochemicals, In- labeled ATP. In the competition experiments, competitor oli- dianapolis, IN) following the manufacturer’s instructions. gonucleotide was added 10 min before addition of the probe, Each well was transfected with 0.5 ␮g rat LH␤-luciferase or as were the antibodies in the supershift assays. The Smad4 mouse FSH␤-luciferase plasmid (45). Plasmid construction antibody and nonspecific IgG were obtained from Santa Cruz and preparation were described previously (24). The se- Biotechnology and from Upstate USA, Inc. (Charlottesville, quences of all of the promoter fragments were confirmed by VA). The reaction was loaded on a 5% acrylamide gel in dideoxynucleotide sequencing. An expression plasmid con- 0.25ϫ TBE and run on 0.5 V/ cm2 constant voltage. After taining ␤-galactosidase driven by the Herpes virus thymidine drying, gels were exposed to autoradiography. kinase promoter was co-transfected with LH␤-luc and used as an internal control. Sixteen hours after transfection, the cells were switched to serum-free DMEM supplemented with Mutagenesis 0.1% BSA, 5 mg/liter transferrin, and 50 nM sodium selenite. The following day, the cells were treated with 10 ng/ml activin Mutagenesis of the LH␤-luc plasmid was performed using for 6 h, unless otherwise indicated, or follistatin (R&D Sys- the QuikChange Site-Directed Mutagenesis kit (Stratagene, tems, Minneapolis, MN) for 24 h. The cells were then lysed La Jolla, CA) according to the manufacturer’s protocol. The with 0.1 M K-phosphate buffer (pH 7.8) with 0.2% Triton HB mutation and Egr site mutation were described in a pre- X-100. Equal volumes of each lysate were placed in 96-well vious report (24). From the wild-type sequence 5Ј-TGTCT- plates, and luciferase activity was measured on a luminom- GTCTCGCCCCCAAAGAGATTAGTGTCTAGG-3Ј, three SBEs eter (EG&G Microplate, Berthold Technologies, Oak Ridge, (S1, S2, and S3; GTCT, underlined) were individually mutated TN) by injecting 100 ␮l of a buffer containing 100 mM Tris-HCl to GTAG and named mutant SBE 1 (mS1, most 5Ј), mutant ␮ Ј (pH 7.8), 15 mM MgSO4,10mM ATP, and 65 M luciferin per SBE 2 (mS2, middle SBE), and mutant SBE 3 (mS3, most 3 ). well. Galactosidase activity was measured using the Galacto- Mutations were confirmed by dideoxyribonucleotide se- light assay (Tropix, Bedford, MA) following the manufactur- quencing performed by the DNA Sequencing Shared Re- er’s instructions. All transfection experiments were per- source, UCSD Cancer Center. formed in triplicate and repeated at least three times. Luciferase values from reporter gene-transfected cells were GST Interaction Assay consistently at least 100 times higher than values from mock transfected cells. Results represent the mean Ϯ SEM of all samples analyzed. Asterisk marks a statistically significant The GST-Smad2, 3, and 4 in the pGEX vector were kindly difference from the control-treated cells, determined by one- provided by Dr. Rik Derynck. The Otx-1 and Ptx-1 expression way ANOVA analysis followed by Tukey’s post hoc multiple vectors were obtained from Dr. Antonio Simeone and Dr. Յ Jacques Drouin, respectively. The GFP expression vector range test for individual comparison with P 0.05 or Stu- 35 dent’s t test as indicated. was provided by Dr. Douglass Forbes. S-labeled proteins were produced using the TnT T7 Coupled Reticulocyte Ly- sate System (Promega Corp., Madison, WI). Bacteria trans- Western Blot formed with the pGEX vectors were grown to an OD of 0.6, upon which protein expression was induced by addition of After overnight starvation and 2-h treatment with vehicle con- 0.25 mM isopropyl-␤-D-thiogalactosidase. Bacterial pellets trol, 10 nM GnRH, or 10 ng/ml activin, L␤T2 cells were rinsed were sonicated in PBS with 5 mM EDTA and 0.1% Triton with PBS and lysed with lysis buffer [20 mM Tris-HCl (pH 7.4), X-100 and centrifuged, and the supernatant was bound to 140 mM NaCl, 0.5% Nonidet P-40 (NP-40), 0.5 mM EDTA], glutathione sepharose beads (Amersham Pharmacia Bio- with protease inhibitors (aprotinin, pepstatin, leupeptin) at 10 tech). Beads were washed four times with sonication buffer ␮g/ml each, and 1 mM phenyl-methyl-sulfonyl-fluoride followed by equilibration in the binding buffer (below) and (PMSF). Protein concentration was determined with Bradford split equally between different samples and the control. 35S- reagent (Bio-Rad Laboratories), and an equal amount of pro- labeled proteins were added to the beads and bound for 1 h tein per sample was loaded on an SDS-PAGE gel. After at4Cin20mM HEPES (pH 7.8), with 50 mM NaCl, 10 mg/ml proteins had been resolved by electrophoresis and trans- BSA, 0.1% NP-40, and 5 mM dithiothreitol. After extensive ferred to a polyvinylidene fluoride membrane, they were washing, samples were eluted from the beads by boiling in probed with specific antibodies for Egr-1 (Santa Cruz Bio- Laemmli sample buffer and subjected to SDS-PAGE. After- technology, Inc., Santa Cruz, CA). The bands were detected ward, the gels were dried and autoradiographed. 2622 Mol Endocrinol, October 2005, 19(10):2610–2623 Coss et al. • Activin Regulation of LH␤

Acknowledgments 10. Kaiser UB, Lee BL, Carroll RS, Unabia G, Chin WW, Childs GV 1992 Follistatin gene expression in the pituitary: localization in the gonadotropes and folliculos- We thank Rik Derynck who kindly provided the GST- tellate cells in diestrous rats. Endocrinology 130: Smad2, 3, and 4 in the pGEX vector and Smad3 and 4 3048–3056 expression vectors, and Suzanne Rosenberg Jacobs for 11. Roberts V, Meunier H, Vaughan J, Rivier J, Rivier C, Vale many LH␤ reporter plasmids. We are grateful to Antonio W, Sawchenko P 1989 Production and regulation of in- Simeone and Jacques Drouin from whom we obtained the Otx-1 and Ptx-1 expression vectors, respectively, and to hibin subunits in pituitary gonadotropes. Endocrinology Douglass Forbes for the GFP expression vector. We appre- 124:552–554 ciate the time and insight of the Mellon laboratory members 12. Kogawa K, Nakamura T, Sugino K, Takio K, Titani K, and Janice Sue Bailey for helpful discussions. Sugino H 1991 Activin-binding protein is present in pituitary. Endocrinology 128:1434–1440 13. Gospodarowicz D, Lau K 1989 Pituitary follicular cells Downloaded from https://academic.oup.com/mend/article/19/10/2610/2738010 by guest on 23 September 2021 secrete both vascular endothelial growth factor and fol- Received January 18, 2005. Accepted June 7, 2005. listatin. Biochem Biophys Res Commun 165:292–298 Address all correspondence and requests for reprints to: 14. Kawakami S, Fujii Y, Okada Y, Winters SJ 2002 Paracrine Pamela L. Mellon, Department of Reproductive Medicine, regulation of FSH by follistatin in folliculostellate cell- University of California San Diego, 9500 Gilman Drive, La enriched primate pituitary cell cultures. Endocrinology Jolla, California 92093-0674. E-mail: [email protected]. 143:2250–2258 This work was supported by National Institute of Child 15. Attisano L, Wrana JL 2002 Signal transduction by the Health and Human Development/National Institutes of Health TGF-␤ superfamily. Science 296:1646–1647 (NIH) through a cooperative agreement (U54 HD12303) as ␤ part of the Specialized Cooperative Centers Program in Re- 16. Massague J 1998 TGF- signal transduction. Annu Rev production Research (to P.L.M.). This work was also sup- Biochem 67:753–791 ported by NIH Grant R37 HD20377 (to P.L.M.). D.C. was 17. Katayama T, Shiota K, Takahashi M 1990 Activin A in- supported by NIH National Research Service Award F32 creases the number of follicle-stimulating hormone cells HD41301 and the Lalor Foundation. V.G.T. was supported by in anterior pituitary cultures. Mol Cell Endocrinol 69: NIH National Research Service Award F32 DK065437. Uni- 179–185 versity of California San Diego Cancer Center was funded in 18. Stouffer RL, Woodruff TK, Dahl KD, Hess DL, Mather JP, part by National Cancer Institute Cancer Center Support Molskness TA 1993 Human recombinant activin-A alters Grant P30 CA23100. pituitary luteinizing hormone and follicle-stimulating hormone secretion, follicular development, and steroidogenesis, during the menstrual cycle in rhesus monkeys. J Clin Endocrinol Metab 77:241–248 REFERENCES 19. McLachlan RI, Dahl KD, Bremner WJ, Schwall R, Schmelzer CH, Mason AJ, Steiner RA 1989 Recombinant human activin-A stimulates basal FSH and GnRH-stim- 1. Ma X, Dong Y, Matzuk MM, Kumar TR 2004 Targeted ␤ ulated FSH and LH release in the adult male macaque, disruption of luteinizing hormone -subunit leads to hy- Macaca fascicularis. Endocrinology 125:2787–2789 pogonadism, defects in gonadal steroidogenesis, and 20. Attardi B, Miklos J 1990 Rapid stimulatory effect of infertility. Proc Natl Acad Sci USA 101:17294–17299 activin-A on messenger RNA encoding the follicle- 2. Pierce JG, Parsons TF 1981 Glycoprotein hormones: stimulating hormone ␤-subunit in rat pituitary cell cul- structure and function. Annu Rev Biochem 50:465–495 tures. Mol Endocrinol 4:721–726 3. Kaiser UB, Jakubowiak A, Steinberger A, Chin WW 1997 21. Blumenfeld Z, Ritter M 2001 Inhibin, activin, and follista- Differential effects of gonadotropin-releasing hormone tin in human fetal pituitary and gonadal physiology. Ann (GnRH) pulse frequency on gonadotropin subunit and GnRH receptor messenger ribonucleic acid levels in vitro. NY Acad Sci 943:34–48 Endocrinology 138:1224–1231 22. Pernasetti F, Vasilyev VV, Rosenberg SB, Bailey JS, Huang H-J, Miller WL, Mellon PL 2001 Cell-specific tran- 4. Papavasiliou SS, Zmeili S, Khoury S, Landefeld TD, Chin ␤ WW, Marshall JC 1986 Gonadotropin-releasing hormone scriptional regulation of FSH by activin and GnRH in the ␤ differentially regulates expression of the genes for lutein- L T2 pituitary gonadotrope cell model. Endocrinology izing hormone ␣ and ␤ subunits in male rats. Proc Natl 142:2284–2295 Acad Sci USA 83:4026–4029 23. Yamada Y, Yamamoto H, Yonehara T, Kanasaki H, Na- 5. Jorgensen JS, Quirk CC, Nilson JH 2004 Multiple and kanishi H, Miyamoto E, Miyazaki K 2004 Differential ac- ␤ overlapping combinatorial codes orchestrate hormonal tivation of the luteinizing hormone -subunit promoter by responsiveness and dictate cell-specific expression of activin and gonadotropin-releasing hormone: a role for the genes encoding luteinizing hormone. Endocr Rev the mitogen-activated protein kinase signaling pathway 25:521–542 in L␤T2 gonadotrophs. Biol Reprod 70:236–243 6. Ling N, Ying S-Y, Ueno N, Shimasaki S, Esch F, Hotta O, 24. Rosenberg SB, Mellon PL 2002 An Otx-related home- Guillemin R 1986 Pituitary FSH is released by a het- odomain protein binds an LH␤ promoter element impor- erodimer of the ␤-subunits from the two forms of inhibin. tant for activation during gonadotrope maturation. Mol Nature 321:779–782 Endocrinol 16:1280–1298 7. Weiss J, Guendner MJ, Halvorson LM, Jameson JL 1995 25. Halvorson LM, Ito M, Jameson JL, Chin WW 1998 Ste- Transcriptional activation of the follicle-stimulating hor- roidogenic factor-1 and early growth response protein 1 mone ␤-subunit gene by activin. Endocrinology 136: act through two composite DNA binding sites to regulate 1885–1891 luteinizing hormone ␤-subunit gene expression. J Biol 8. Nakamura T, Takio K, Eto Y, Shibai H, Titani K, Sugino H Chem 273:14712–14720 1990 Activin-binding protein from rat ovary is follistatin. 26. Dorn C, Ou Q, Svaren J, Crawford PA, Sadovsky Y 1999 Science 247:836–838 Activation of luteinizing hormone ␤ gene by gonado- 9. Shimasaki S, Koga M, Esch F, Cooksey K, Mercado M, tropin-releasing hormone requires the synergy of early Koba A, Ueno N, Ying S-Y, Ling N, Guillemin R 1988 growth response-1 and steroidogenic factor-1. J Biol Primary structure of the human follistatin precursor and Chem 274:13870–13876 its genomic organization. Proc Natl Acad Sci USA 85: 27. Tremblay JJ, Drouin J 1999 Egr-1 is a downstream ef- 4218–4222 fector of GnRH and synergizes by direct interaction with Coss et al. • Activin Regulation of LH␤ Mol Endocrinol, October 2005, 19(10):2610–2623 2623

Ptx1 and SF-1 to enhance luteinizing hormone ␤ gene ished T cell responsiveness to TGF-␤. EMBO J 18: transcription. Mol Cell Biol 19:2567–2576 1280–1291 28. Tremblay JJ, Lanctoˆ t C, Drouin J 1998 The pan-pituitary 37. Tomic D, Brodie SG, Deng C, Hickey RJ, Babus JK, activator of transcription, Ptx1 (pituitary homeobox 1), Malkas LH, Flaws JA 2002 Smad 3 may regulate follicular acts in synergy with SF-1 and Pit1 and is an upstream growth in the mouse ovary. Biol Reprod 66:917–923 regulator of the Lim-homeodomain gene Lim3/Lhx3. Mol 38. Weck J, Anderson AC, Jenkins S, Fallest PC, Shupnik Endocrinol 12:428–441 MA 2000 Divergent and composite gonadotropin-releas- 29. Vasilyev VV, Lawson MA, DiPaolo D, Webster NJG, Mel- ing hormone-responsive elements in the rat luteinizing lon PL 2002 Different signaling pathways control acute hormone subunit genes. Mol Endocrinol 14:472–485 induction versus long-term repression of LH␤ transcrip- 39. Wolfe MW, Call GB 1999 Early growth response protein tion by GnRH. Endocrinology 143:3414–3426 1 binds to the luteinizing hormone-promoter and medi- 30. Jacobs SBR, Coss D, McGillivray SM, Mellon PL 2003 ates gonadotropin-releasing hormone-stimulated gene Nuclear factor-Y and steroidogenic factor-1 physically expression. Mol Endocrinol 13:752–763 and functionally interact to contribute to cell-specific ex- 40. Lopez-Rovira T, Chalaux E, Massague J, Rosa JL, Ven- Downloaded from https://academic.oup.com/mend/article/19/10/2610/2738010 by guest on 23 September 2021 pression of the mouse follicle-stimulating hormone-␤ tura F 2002 Direct binding of Smad1 and Smad4 to two gene. Mol Endocrinol 17:1470–1483 distinct motifs mediates bone morphogenetic protein- 31. Nakao A, Afrakhte M, Moren A, Nakayama T, Christian specific transcriptional activation of Id1 gene. J Biol JL, Heuchel R, Itoh S, Kawabata M, Heldin NE, Heldin Chem 277:3176–3185 CH, ten Dijke P 1997 Identification of Smad7, a TGF␤- 41. Datta PK, Blake MC, Moses HL 2000 Regulation of plas- inducible antagonist of TGF-␤ signalling. Nature 389: minogen activator inhibitor-1 expression by transforming 631–635 growth factor-␤-induced physical and functional interac- 32. Whitman M 1997 Signal transduction. Feedback from tions between smads and Sp1. J Biol Chem 275: inhibitory SMADs. Nature 389:549–551 40014–40019 33. Bernard DJ 2004 Both SMAD2 and SMAD3 mediate 42. Zhang Y, Feng XH, Derynck R 1998 Smad3 and Smad4 activin-stimulated expression of the follicle-stimulating cooperate with c-Jun/c-Fos to mediate TGF-␤-induced hormone ␤ subunit in mouse gonadotrope cells. Mol transcription. Nature 394:909–913 Endocrinol 18:606–623 43. Germain S, Howell M, Esslemont GM, Hill CS 2000 Ho- 34. Suszko MI, Lo DJ, Suh H, Camper SA, Woodruff TK 2003 meodomain and winged-helix transcription factors re- Regulation of the rat follicle-stimulating hormone ␤-sub- cruit activated Smads to distinct promoter elements via a unit promoter by activin. Mol Endocrinol 17:318–332 common Smad interaction motif. Genes Dev 14:435–451 35. Tremblay JJ, Marcil A, Gauthier Y, Drouin J 1999 Ptx1 44. Derynck R, Zhang YE 2003 Smad-dependent and Smad- regulates SF-1 activity by an interaction that mimics the independent pathways in TGF-␤ family signalling. Nature role of the ligand-binding domain. EMBO J 18: 425:577–584 3431–3441 45. Coss D, Jacobs SB, Bender CE, Mellon PL 2004 A novel 36. Yang X, Letterio JJ, Lechleider RJ, Chen L, Hayman R, AP-1 site is critical for maximal induction of the follicle- Gu H, Roberts AB, Deng C 1999 Targeted disruption of stimulating hormone ␤ gene by gonadotropin-releasing SMAD3 results in impaired mucosal immunity and dimin- hormone. J Biol Chem 279:152–162

Molecular Endocrinology is published monthly by The Endocrine Society (http://www.endo-society.org), the foremost professional society serving the endocrine community.