The role of Inhibitors of Differentiation proteins ID1 and ID3 in breast cancer metastasis
Wee Siang Teo
A thesis in fulfilment of the requirements for the degree of Doctor of Philosophy
St Vincent’s Clinical School, Faculty of Medicine The University of New South Wales
Cancer Research Program The Garvan Institute of Medical Research Sydney, Australia
March, 2014
THE UNIVERSITY OF NEW SOUTH WALES Thesis/Dissertation Sheet
Surname or Family name: Teo
First name: Wee Siang
Abbreviation for degree as given in the University calendar: PhD (Medicine)
School: St Vincent’s Clinical School Faculty: Faculty of Medicine
Title: The role of Inhibitors of Differentiation proteins ID1 and ID3 in breast cancer metastasis
Abstract 350 words maximum: (PLEASE TYPE)
Breast cancer is a leading cause of cancer death in women. While locally-confined breast cancer is generally curable, the survival of patients with metastatic breast cancer is very poor. Treatment for metastatic breast cancer is palliative not curative due to the lack of targeted therapies. Metastasis is a complex process that still remains poorly understood, thus a detailed understanding of the biological complexity that underlies breast cancer metastasis is essential in reducing the lethality of this disease. The Inhibitor of Differentiation proteins 1 and 3 (ID1/3) are transcriptional regulators that control many cell fate and developmental processes and are often deregulated in cancer. ID1/3 are required and sufficient for the metastasis of breast cancer in experimental models. However, the mechanisms by which ID1/3 mediate metastasis in breast cancer remain to be determined. Little is known about pathways regulated by ID1/3 in breast cancer as well as their functional role in the multiple steps of metastatic progression. The current body of work was aimed at exploring the role of ID1/3 and their transcriptional targets that mediate their function in breast cancer. This was achieved through the use of a range of in vitro and in vivo techniques to; firstly, examine ID1 expression in a cohort of breast cancer patients. Secondly, a model of inducible, stable Id1/3 knockdown system was employed to establish the function of Id1/3 in the 4T1 breast cancer cell line and to identify Id1/3 target genes. Thirdly, the requirement of Id1/3 in controlling mammary tumour growth and metastasis was determined by conditional knockdown of Id1/3 expression during tumour progression. The data gathered is the first study to identify the global transcriptional targets of Id1/3 in breast cancer as well as to investigate the role of Id1/3 in the multi steps of metastatic cascade. The results presented here showed that ID1 expression is associated with the triple-negative and HER2-enriched subtypes of breast cancer. ID1 expression is enriched in brain metastases compared to patient matched primary breast cancers. Silencing of Id1/3 reduces primary tumour growth and significantly impairs spontaneous lung metastasis. These data strongly suggest Id1/3 as central controllers of the metastatic phenotype in breast cancer. Transcript profiling experiments revealed a multitude of genes that are regulated by Id1/3. Subsequent validation identified several novel Id1/3 target genes and suggested that the function of Id1/3 in 4T1 cells is possibly mediated by Bmi1/Mel18 and TGF-β signalling pathway. Further functional validation is required to confirm this finding.
Declaration relating to disposition of project thesis/dissertation
I hereby grant to the University of New South Wales or its agents the right to archive and to make available my thesis or dissertation in whole or in part in the University libraries in all forms of media, now or here after known, subject to the provisions of the Copyright Act 1968. I retain all property rights, such as patent rights. I also retain the right to use in future works (such as articles or books) all or part of this thesis or dissertation.
I also authorise University Microfilms to use the 350 word abstract of my thesis in Dissertation Abstracts International (this is applicable to doctoral theses only).
………………………………………………… ……………………………………..…… ……….……………………... Signature Witness Date
The University recognises that there may be exceptional circumstances requiring restrictions on copying or conditions on use. Requests for restriction for a period of up to 2 years must be made in writing. Requests for a longer period of restriction may be considered in exceptional circumstances and require the approval of the Dean of Graduate Research.
FOR OFFICE USE ONLY Date of completion of requirements for Award:
I
Copyright and Authenticity Statements
COPYRIGHT STATEMENT
'I hereb;• grant t1e Universil;' of Ne'l•' South Wales or ~s agents the right to (ifChi•J@an d t Signed 30 March 2014 Oat(,! ALITHENTICITY STATEMENT 'I carlify 1h(lt the Library de;::os t digitdl oo;;y is a direct equiva1Etnt of the fin(tl ott:cially appro,·ed versicn of my thesis. No emendation oi content has occurred ~nd if thsfe are any minor -.rari~tions in ionn~n:ng , they are t1e rGsu:t of ihe con\•er5ion to digital forrrot: Signed 30 March 2014 Dal II Originality Statement ‘I hereby declare that this submission is my own work and to the best of my knowledge it contains no materials previously published or written by another person, or substantial proportions of materials which have been accepted for the award of any other degree or diploma at UNSW or any other educational institution, except where due acknowledgment is made in the thesis. Any contribution made to the research by others, with whom I have worked at UNSW or elsewhere, is explicitly acknowledged in the thesis. I also declare that the intellectual content of this thesis is the product of my own work, except to the extent that the assistance from others in project’s design and conception or in style, presentation and linguistic expression is acknowledged.’ Signed: Date: III Acknowledgements No man is an island, but rather it is through the help and support of many people that made this research possible. First and foremost, I would like to express my deepest appreciation and gratitude to my supervisor, Alex Swarbrick. Thank you for taking me under your tutelage and for your patience, invaluable guidance and constant encouragement throughout my PhD candidature. Secondly, I would like to extend my gratitude to my co-supervisor, Radhika Nair. I am deeply indebted to you for everything you have done to help and support me over the past five years. I would also like to thank the many people who have contributed to my PhD project. I am very grateful for having labmates who are there all the time to help and support me. Without them, I would have never overcome all the hurdles that I had encountered in this journey. I express my sincere thanks to Andrea McFarland, Jessica Yang and Nicola Foreman for their assistance in the animal work. I would also like to acknowledge Dr Daniel Roden for his expertise in bioinformatics, Dr Natasha Sharma for her input in the TFG-β experiments and Kate Harvey for her assistance on IHC. I would also like to thank Yuwei Phua, Drs Akira Nguyen and Simon Junankar for their very helpful discussion and help along the way. Not forgetting all the other wonderful people in the CTP group, Laura, Mun, Aurelie, Iva, Sunny, Jaynish, Dorothy, Astrid and Stephanie. Thank you for making the lab such a positive and enjoyable place to work in! And finally to my parents, I would not be able to make it without your love and support. I am forever indebted to you. IV Publications, Conferences and financial support Publications: 1. Nair R, Roden DL, Teo WS, McFarland A, Junankar S, Ye S, Nguyen A, Yang J, Nikolic I, Hui M, Morey A, Shah J, Pfefferle AD, Usary J, Selinger C, Baker LA, Armstrong N, Cowley MJ, Naylor MJ, Ormandy CJ, Lakhani SR, Herschkowitz JI, Perou CM, Kaplan W, O'Toole SA, Swarbrick A. c-Myc and Her2 cooperate to drive a stem-like phenotype with poor prognosis in breast cancer. Oncogene. 2013 Sep 23. doi: 10.1038/onc.2013.368. [Epub ahead of print]. 2. Teo WS, Nair R, Swarbrick A. New insights into the role of ID proteins in breast cancer metastasis: a MET affair. Breast Cancer Research. 2014, 16:305 doi:10.1186/bcr3654. 3. Nair R*, Teo WS*, Mittal V, Swarbrick A. ID proteins regulate diverse aspects of cancer progression and provide novel therapeutic opportunities. Molecular Therapy. 2014 May 14. doi: 10.1038/mt.2014.83. (*These authors contributed equally) 4. Nair R*, Teo WS*, Ye S, McFarland A, Harvey K, Roden D, Junankar S, Baker L, Yang J, Fluke N, Millar E, Mellick A, Naylor M, Ormandy C, Lakhani S, O’Toole S, Swarbrick A. The Inhibitor of Differentiation proteins mediate tumour- initiating properties and metastasis in breast cancer. Manuscript in preparation. (*These authors contributed equally) V Conferences: 1. Poster presentation: W. S. Teo, R. Nair, A. Swarbrick. Genome-wide screening for genes that regulate the metastasis of breast cancer. The 20th St Vincents & Mater Health Sydney (SV&MHS) Research Symposium. September 2010. 2. Poster presentation: W. S. Teo, R. Nair, A. Swarbrick. The role of ID1 in breast cancer metastasis. The 23rd Lorne Cancer Conference, Victoria, Australia. February 2011. 3. Training: The 61st Meeting of Nobel Laureates with Young Scientists at Lindau, Germany, and study visit to centres of excellence in scientific research and development in Germany and the UK. June 2011. 4. Training: BioInfo Summer 2011 Workshop and AMSI Summer Symposium in Bioinformatics, Melbourne, Australia. December, 2011. 5. Poster presentation: W. S. Teo, R. Nair, A. McFarland, S. Ye, A. Swarbrick. Dissecting the role of the Inhibitor of Differentiation 1 in breast cancer metastasis and characterization of pathways controlling breast cancer stem cell phenotype. The 24th Lorne Cancer Conference, Victoria, Australia. February 2012. 6. Poster presentation: W. S. Teo, R. Nair, A. McFarland, S. Ye, A. Swarbrick. Dissecting the role of the Inhibitor of Differentiation 1 in breast cancer metastasis and characterization of pathways controlling breast cancer stem cell phenotype. The 33rd Annual Lorne Genome Conference, Victoria, Australia. February 2012. VI 7. Poster presentation: W. S. Teo, R. Nair, A. McFarland, S. Ye, A. Mellick, S. Lakhani, A. Swarbrick. Dissecting the role of the Inhibitor of Differentiation 1 in breast cancer metastasis and characterization of pathways controlling breast cancer stem cell phenotype. The 22nd Biennial Congress of the European Association for Cancer Research, Barcelona, Spain. July 2012. 8. Poster presentation: W. S. Teo, R. Nair, A. McFarland, S. Ye, A. Mellick, S. Lakhani, A. Swarbrick. Dissecting the role of the Inhibitor of Differentiation 1 in breast cancer metastasis and characterization of pathways controlling breast cancer stem cell phenotype. The 14th EMBL PhD Symposium Conference, Heidelberg, Germany. October 2012. Financial support: 1. International Postgraduate Research Scholarship (IPRS) (2010-2013) 2. Academy of Sciences Malaysia Lindau Programme Young Scientist Travel Fellowship (2011) 3. Australian Genome Research Facility Travel Award (2011) 4. The Beth Yarrow Memorial Award in Medical Science (2012) 5. Student Travel Bursary to the Lorne Cancer Conference (2011, 2012) 6. Lorne Genome Conference Travel Award (2012) 7. European Association for Cancer Research Travel Scholarship (2012) 8. EMBL Australia Travel Grant (2012) VII Abstract Breast cancer is a leading cause of cancer death in women. While locally- confined breast cancer is generally curable, the survival of patients with metastatic breast cancer is very poor. Treatment for metastatic breast cancer is palliative not curative due to the lack of targeted therapies. Metastasis is a complex process that still remains poorly understood, thus a detailed understanding of the biological complexity that underlies breast cancer metastasis is essential in reducing the lethality of this disease. The Inhibitor of Differentiation proteins 1 and 3 (ID1/3) are transcriptional regulators that control many cell fate and developmental processes and are often deregulated in cancer. Our group and others have previously demonstrated that ID1/3 are required and sufficient for the metastasis of breast cancer in experimental models. However, the mechanisms by which ID1/3 mediate metastasis in breast cancer remain to be determined. Little is known about pathways regulated by ID1/3 in breast cancer as well as their functional role in the multiple steps of metastatic progression. The current body of work was aimed at exploring the role of ID1/3 and their transcriptional targets that mediate their function in breast cancer. This was achieved through the use of a range of in vitro and in vivo techniques to; firstly, examine ID1 expression in a cohort of breast cancer patients. Secondly, a model of inducible, stable Id1/3 knockdown system was employed to establish the function of Id1/3 in the 4T1 breast cancer cell line and to identify Id1/3 target genes. Thirdly, the requirement of Id1/3 in controlling mammary tumour growth and metastasis was determined by conditional knockdown of Id1/3 expression during tumour progression. The data gathered is the first study to identify the global transcriptional targets of Id1/3 in breast cancer as well as to investigate the role of Id1/3 in the multi steps of metastatic cascade. The results presented here showed that ID1 expression is associated with the triple-negative and HER2-enriched subtypes of breast cancer. ID1 expression is enriched in brain metastases compared to patient matched primary breast cancers. Silencing of Id1/3 reduces primary tumour growth and significantly impairs spontaneous lung metastasis. These data strongly suggest Id1/3 as central controllers of the metastatic phenotype in breast cancer. VIII Transcript profiling experiments revealed a multitude of genes that are regulated by Id1/3. Subsequent validation identified several novel Id1/3 target genes and suggested that the function of Id1/3 in 4T1 cells is possibly mediated by Bmi1/Mel18 and TGF-β signalling pathway. Further functional validation is required to confirm this finding. IX Frequently used abbreviations ABCTB Australian breast cancer tissue bank Akt V-akt murine thymoma viral oncogene homolog ATCC American Type Culture Collection BCA Bicinchoninic acid BCL2 B-cell CLL/lymphoma 2 bHLH Basic helix-loop-helix BMI1 B lymphoma Mo-MLV insertion region 1 homolog BMP Bone morphogenic protein BRCA1 Breast cancer 1, early onset BRCA2 Breast cancer 2, early onset CCND1 Cyclin D1 CCNE1 Cyclin E1 CDK Cyclin-dependent kinase CKI Cyclin-dependent kinase inhibitor CSC Cancer stem cell CXCL Chemokine (C-X-C motif) ligand CXCR Chemokine (C-X-C motif) receptor DMEM Dulbecco’s modified eagle medium DMSO Dimethyl sulfoxide DNA Deoxyribonucleic acid Dox Doxycycline ECM Extracellular matrix EDTA Ethylenediaminetetraacetic acid ER Estrogen receptor ErbB-1 Epidermal growth factor receptor FACS Fluorescence activated cell sorting FBS Fetal bovine serum GAPDH Glyceraldehyde-3-phosphate dehydrogenase GSEA Gene set enrichment analysis HEK293T Human embryonic kidney 293T HEPES 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid HER2 V-erb-b2 erythroblastic leukemia viral oncogene homolog 2 HLH Helix-loop-helix HRP Horseradish peroxidase hTERT Human telomerase reverse transcriptase ID Inhibitor of differentiation ID1/3 ID1 and ID3 LB Luria-Bertani MMP Matrix metalloproteinase MT-CO2 Mitochondrially encoded cytochrome c oxidase II MYC V-myc myelocytomatosis viral oncogene homolog NF-κB Nuclear factor-κB PBS Phosphate buffered saline PCR Polymerase chain reaction PhosSTOP Protease and phosphatase inhibitor cocktail PKB Protein kinase B PVDF Polyvinylidene difluoride RAS Rat sarcoma viral oncogene RB1 Retinoblastoma 1 RIPA Radioimmunoprecipitation assay RNAi Ribonucleic acid interference X rtTA Reverse Tetracycline-transactivator SDS-PAGE Sodium dodecyl sulfate polyacrylamide gel electrophoresis shRNA Short hairpin ribonucleic acid siRNA Small interfering ribonucleic acid TAE Tris-acetate-EDTA TBS Tris buffered saline TGF-α Transforming growth factor alpha TGF-β Transforming growth factor beta TNF Tumour necrosis factor TRE Tetracycline response element TSP-1 Thrombospondin-1 VEGF Vascular endothelial growth factor XI Gene nomenclature Gene/Protein Symbol Example Human gene Italics, with all letters in ID1 uppercase. Mouse gene Italics, with only the first letter in Id1 uppercase and the remaining letters in lowercase. Human protein Normal case, with all uppercase ID1 letters. Mouse protein Normal case, with only the first Id1 letter in uppercase and the remaining letters in lowercase. XII ContentsTHE UNIVERSITY OF NEW SOUTH WALES ...... I Thesis/Dissertation Sheet ...... I Copyright and Authenticity Statements ...... II Originality Statement ...... III Acknowledgements ...... IV Publications, Conferences and financial support ...... V Abstract ...... VIII Frequently used abbreviations ...... X Gene nomenclature ...... XII Chapter 1. Introduction ...... 1 1.1 General introduction ...... 1 1.2 Breast cancer ...... 2 1.2.1 Breast cancer as a major health issue worldwide ...... 2 1.2.2 Genetics of breast cancer...... 2 1.2.3 Breast cancer growth and progression ...... 5 1.2.4 Classification of breast cancer ...... 8 1.3 Inhibitors of Differentiation proteins ...... 17 1.3.1 The bHLH family of transcription factors ...... 17 1.3.2 The ID proteins ...... 20 1.3.3 Regulation of ID proteins ...... 22 1.3.4 ID proteins in developmental and stem cell biology ...... 26 1.3.5 Deregulation of IDs in cancer ...... 28 1.3.6 ID1 and ID3 regulate diverse aspects of cancer progression ...... 34 1.3.7 ID1/3 as potential therapeutic targets in cancer ...... 45 1.4 Outline of thesis ...... 46 Chapter 2. Materials and Methods ...... 48 2.1 Buffers and media ...... 48 2.2 Molecular Cloning ...... 49 2.2.1 Plasmids and siRNAs ...... 49 2.2.2 Entry vector construction ...... 53 2.2.3 Expression vector construction ...... 54 2.2.4 Agarose gel electrophoresis ...... 54 2.2.5 Transformation of bacterial cells with plasmid DNA ...... 55 2.2.6 Miniprep preparation of plasmid DNA ...... 55 2.2.7 Maxiprep preparation of plasmid DNA ...... 55 2.2.8 Plasmid DNA sequencing ...... 56 2.3 Tissue culture ...... 57 2.3.1 Mammalian cell culture ...... 57 2.3.2 Cryopreservation ...... 57 2.3.3 Microscopic imaging ...... 57 2.4 Production of lentivirus and viral infection of cell lines ...... 58 2.4.1 Lentivirus production ...... 58 2.4.2 Infection of mammalian cell lines ...... 58 2.5 Flow cytometry ...... 59 2.5.1 Cell staining for flow cytometry ...... 59 2.5.2 Cell sorting and flow cytometry analysis ...... 59 2.6 In vitro functional assays ...... 60 2.6.1 MTS assay ...... 60 2.6.2 Cell proliferation assay by the IncuCyte Kinetic Imaging System ...... 60 XIII 2.6.3 Tumoursphere assay ...... 60 2.7 RNA methods ...... 61 2.7.1 RNA extraction, quantitation and integrity estimation ...... 61 2.7.2 Microarray analysis ...... 61 2.7.3 cDNA synthesis ...... 62 2.7.4 Quantitative real-time PCR ...... 62 2.8 Protein methods ...... 65 2.8.1 Extracting protein lysates ...... 65 2.8.2 Quantifying protein concentration ...... 65 2.8.3 Sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) ...... 66 2.8.4 Protein transfer and immunoblotting ...... 66 2.9 In vivo studies ...... 67 2.9.1 Mice ...... 67 2.9.2 Surgical procedure for primary tumour progression and spontaneous metastasis assay ...... 67 2.9.3 Surgical procedure for experimental metastasis assay ...... 69 2.9.4 In vivo and ex vivo imaging ...... 69 2.10 Histological protocols ...... 70 2.10.1 Tissue processing and paraffin embedding...... 70 2.10.2 Immunohistochemistry ...... 70 Chapter 3. Id1 and Id3 knockdown in a model of triple-negative breast cancer ...... 73 3.1 Introduction ...... 73 3.1.1 The 4T1 tumour cell model ...... 75 3.1.2 The pSLIK vector system ...... 77 3.1.3 Chapter summary ...... 78 3.1.4 Hypothesis ...... 80 3.1.5 Aims ...... 80 3.2 Results...... 81 3.2.1 ID1 is expressed in the triple-negative and HER2-enriched breast cancers ...... 81 3.2.2 4T1 cells endogenously express Id1 and Id3 ...... 85 3.2.3 Integration of pSLIK into 4T1 cells ...... 87 3.2.4 Analysis of knockdown efficiency in 4T1 pSLIK shId1/3 pool cells...... 89 3.2.5 Targeting Id1/3 reduces proliferation of 4T1 cells ...... 92 3.2.6 Effect of selection pressure in 4T1 pSLIK shId1/3 cells...... 96 3.2.7 Loss of Id1/3 knockdown after prolonged Dox induction...... 98 3.2.8 Generation of pSLIK clonal cell lines ...... 104 3.2.9 Functional requirement of Id1/3 in 4T1 cell self-renewal ...... 107 3.3 Discussion ...... 109 Chapter 4. Genome-wide determination of Id1/3 target genes ...... 113 4.1 Introduction ...... 113 4.1.1 Hypothesis ...... 114 4.1.2 Aim ...... 115 4.2 Results...... 115 4.2.1 Knockdown of Id1/3 in 4T1 cells for expression profiling ...... 115 4.2.2 Analysis of profiling results ...... 119 4.2.3 Validation of transcript profiling results ...... 137 4.2.4 Validation of regulation of TGF-β signalling by Id1/3 ...... 151 4.2.5 Bmi1 expression was down-regulated in Id1/3 depleted 4T1 cells ...... 156 4.3 Discussion ...... 159 4.3.1 Determination of Id1/3 target genes by gene expression profiling ...... 159 4.3.2 Induction of an interferon response by shRNA expression from the pSLIK vector in 4T1 cells ...... 160 XIV 4.3.3 A potential regulation of TGF-β signalling by Id1/3 ...... 163 4.3.4 Bmi1 as a potential target of Id1/3 in 4T1 cells and may integrate the multiple pathways regulated by Id1/3 ...... 164 Chapter 5. The role of Id1 and Id3 in breast cancer metastasis ...... 168 5.1 Introduction ...... 168 5.1.1 Breast cancer metastasis ...... 168 5.1.2 Dissecting the role of ID1/3 in breast cancer metastasis...... 171 5.1.3 Hypothesis ...... 173 5.1.4 Aims ...... 173 5.2 Results...... 174 5.2.1 ID1 expression is enriched in metastasis ...... 174 5.2.2 In vivo characterisation of the 4T1 mouse breast cancer cell line ...... 177 5.2.3 The number of 4T1 cells required to form a primary mammary tumour in orthotopic transplantation ...... 178 5.2.4 The number of 4T1 cells required to form experimental metastases by tail vein injection ...... 180 5.2.5 Loss of Id1/3 leads to a delay in tumour growth, prolonged survival and suppresses spontaneous lung metastasis ...... 182 5.2.6 Loss of Id1/3 increases experimental lung metastatic outgrowth and colonization...... 186 5.2.7 Loss of Id1/3 increases extravasation and metastatic cell seeding in the lung...... 188 5.2.8 Loss of Id1/3 has no effect on lung metastatic colonization following extravasation ...... 190 5.2.9 Assessing the induction of interferon response by pSLIK in vivo ...... 192 5.3 Discussion ...... 195 Chapter 6. Discussion ...... 204 References: ...... 210 Appendix: ...... 241 XV Chapter 1. Introduction Chapter 1. Introduction 1.1 General introduction Breast cancer represents the most common type of cancer among women worldwide and a leading cause of cancer deaths in women in the developed world (Jemal et al., 2011). In recent years, the implementation of anti-cancer campaigns and screening programs has allowed earlier detection of breast cancer. Many patients have benefitted immensely as this disease is still treatable when discovered early. In addition, a proportion of patients with early stage estrogen receptor-positive (ER+) breast cancer have benefited from the development of anti-estrogen therapies. The development of targeted anti- HER2 therapies such as Trastuzumab has also improved clinical outcomes for women with HER2 (Human epidermal growth factor receptor 2) enriched (Her2+) breast cancer. However, despite this, a number of important clinical problems remain in the treatment of breast cancer. The vast majority of deaths from breast cancer are due to metastatic relapse and cancer recurrence. While locally-confined breast cancer is generally curable, the survival of patients with metastatic breast cancer is very poor, and treatment for metastatic breast cancer is palliative not curative (Gupta and Massague, 2006). Trastuzumab leads to improvements in survival but only for a subset of women with Her2+ breast cancer. It is poorly effective against metastatic disease, leading to improvements in survival of only 2-6 months (Spector, 2008). Another clinical problem in the treatment of breast cancer is the lack of targeted therapies for patients with the triple-negative breast cancers, which are hormone receptor-negative and HER2-negative. The triple-negative breast cancers are more frequently high grade, appear in younger women and have a poor outcome when compared to hormone receptor positive disease. No clinically validated targeted therapies exist for the triple-negative breast cancers. Patients with triple-negative disease currently only have cytotoxic chemotherapy available to them. Despite early data suggesting a good clinical response to chemotherapy in patients with triple-negative disease, long term survival in patients with triple-negative disease is still poorer than that of ER+ 1 Chapter 1. Introduction cases (Carey et al., 2007a). Therefore, there is an urgent need to design better therapies and personalised medicine for hormone receptor negative breast cancers, which will most likely come through a better understanding of the molecular pathology of this disease. A detailed understanding of the biology driving cancer progression, in particular the metastatic process is essential in reducing the lethality of this disease. 1.2 Breast cancer 1.2.1 Breast cancer as a major health issue worldwide Breast cancer is the most prevalent cancer in women, accounting for 22.9% of all cancers worldwide (Jemal et al., 2011). Approximately 1.4 million new cases of breast cancer were diagnosed globally in 2008 (Jemal et al., 2011). Moreover, the mortality rate of breast cancer patients accounted for 13.7% of cancer related deaths, making it the most common cancer related death (Jemal et al., 2011). There is an increased incidence of breast cancer in both developed and developing countries. Breast cancer incidence rate has risen 30% in developed countries over the past 25 years, because of changes in lifestyle, reproductive patterns and increased screening (Garcia et al., 2007). The risk of breast cancer increases as a woman ages, therefore despite major advancement in breast cancer research which provides better understanding and treatment of the disease, the incidence of breast cancer continue to increase due to the rapid growth and aging of the world population. In Australia, it has been predicted that the incidence of breast cancer in women will reach 17210 cases in 2020, an increase from 13567 cases in 2008 (Australian Institute of Health and Welfare & Cancer Australia 2012). 1.2.2 Genetics of breast cancer Breast cancer is a complex genetic disease, which is the outcome of hereditary and environmental factors. Like other types of cancer, it is caused by a series of genetic alterations that result in transformation of normal cells into malignant cancer cells. The genetic alterations in cancer cells occur at different levels, from small-scale mutations in nucleotide sequences to large-scale modifications 2 Chapter 1. Introduction of chromosomal integrity such as alterations in chromosomal number, chromosomal translocation and gene amplification within chromosome (Lengauer et al., 1998). The most common form of genetic alteration is a subtle change in nucleotide sequence, which includes nucleotide base substitutions, deletions and insertions. A series of these small-scale mutations in certain classes of genes is usually required before a normal cell is transformed into a malignant cancer cell (Lengauer et al., 1998). It is widely acknowledged that carcinogenesis results from genetic alterations to three types of genes: proto- oncogene, tumour-suppressor gene and stability gene (Vogelstein and Kinzler, 2004). These three categories of genes play vital roles in various cellular processes such as DNA repair, cell division and cell death. Mutations in these genes can either be the inherited germline mutations or the somatic mutations which are acquired during the life of an individual (Vogelstein and Kinzler, 2004). Breast cancers which are caused by inherited germline mutation are called hereditary breast cancers, whereas breast cancers with no obvious family history are called sporadic breast cancers. Most of the breast cancers are found to be sporadic and hereditary breast cancers represent only 5-10% of breast cancer cases (Suter and Marcum, 2007). Oncogenes are often mutated forms of proto-oncogenes that often function to regulate normal cell proliferation and differentiation processes (Weinberg, 1991). Oncogenes often come from somatic mutations. There are three main ways that a proto-oncogene can become an oncogene. Firstly, mutations occur in coding regions of a proto-oncogene which confer structural changes to the resultant protein, causing an increased activity or stability of the protein, resulting in dysregulation of downstream signalling. Secondly, amplification of proto-oncogenes through misregulation or copy number variation which results in over-expression of proteins. Thirdly, chromosomal translocation events may occur in nearby regulatory sequences, inducing protein over-expression, or rearrangement of proto-oncogenes causes its fusion to a second gene, resulting in a hybrid protein that may be over-expressed or hyperactive (Nambiar et al., 2008). Many oncogenes have long been implicated in the development of breast cancer, for example, MYC and HER2 (Suter and Marcum, 2007). More recently, genome wide studies of large cohorts of breast 3 Chapter 1. Introduction cancer tumours have also shown the amplification of oncogenes such as IGF1R, KRAS, EGFR, PIK3CA, FOXA1, MET and BRAF (Curtis et al., 2012b; TCGA, 2012). In contrast to oncogenes, mutations in tumour-suppressor genes cause loss of their activities which results in carcinogenesis (Weinberg, 1991). Some tumour suppressor genes support normal cell cycle checkpoints, which prevent the incorporation of DNA damage into daughter cells during cell division, whereas others detect, process, and repair DNA damage (Macleod, 2000; Weinberg, 1991). Genetic alterations to tumour suppressor genes mostly occur through mutations or deletions by CNV. One of the most widely studied tumour- suppressor genes found in breast cancer is TP53 (Lane, 1992; Muller and Vousden, 2014). TP53 codes for the tumour suppressor p53 that plays a variety of roles in cells, including DNA repair, cell cycle arrest, initiation of apoptosis and inhibition of blood vessel formation. Mutations in p53 are a common hallmark in many types of human cancers (Lane, 1992; Muller and Vousden, 2014). In breast cancer, approximately 20-40% cases have a mutated TP53, which is often correlated with poor clinical outcome (Suter and Marcum, 2007). Another classic example of a tumour suppressor is the retinoblastoma (RB1) gene. RB1 functions to limit cell growth and proliferation by inhibiting cell cycle progression and promoting cell differentiation. Loss of RB1 activity is associated with about one-third of sporadic breast cancer cases (Suter and Marcum, 2007). The third category of genes which play vital roles in carcinogenesis is called stability genes. Stability genes are genes which function to minimise genetic alterations. Therefore inactivation of stability genes results in higher mutation rates of other genes in the affected cells (Vogelstein and Kinzler, 2004). Examples of stability genes involved in breast cancer development are the BRCA1 and BRCA2. Both BRCA1 and BRCA2 are important for maintaining genomic integrity of cells by recognizing and repairing genetic alterations via mechanisms such as homologous recombination repair (Rosen et al., 2003). BRCA1 and BRCA2 play an important role in hereditary breast cancers and approximately 25% of hereditary breast cancer cases are found to have germline mutations in BRCA1 and BRCA2 (Easton, 1999). Individuals with 4 Chapter 1. Introduction BRCA1 and BRCA2 mutations have a higher risk of developing breast cancer in their lifetime (Nathanson et al., 2001). 1.2.3 Breast cancer growth and progression The formation of a cancer begins from the uncontrolled proliferation of cells which results in an abnormal tissue mass (neoplasm). Starting as a benign form, a breast tumour initially grows in the confined local area. Subsequent transformation into malignant form permits unlimited growth and the spread from the site of origin to surrounding tissue through the process of invasion, and eventually spread to other parts of the body, known as metastasis (Valastyan and Weinberg, 2011). Invasion and metastasis are frequently the final fatal steps in the progression of breast cancer. The most common sites of breast cancer metastasis are the bone, lungs, brain and liver (Donegan and Spratt, 2002). Surgical resection of localized primary tumour is often the first step in treating a breast cancer. However, the majority of deaths from breast cancer are caused by metastases, which can be undetectable and remain latent for many years following primary tumour removal and adjuvant therapy (Weigelt et al., 2005). The progression of breast cancer is an outcome of several aberrant changes to normal cellular processes that control the growth and maintenance of tissues. A landmark review written by Hanahan and Weinberg (Hanahan and Weinberg, 2000) distilled the properties that cause cancer growth and progression into several ‘hallmarks of cancer’, namely, self-sufficiency in growth signal, insensitivity to growth-inhibitory signals, evasion of apoptosis, unlimited replicative potential, sustained angiogenesis and tissue invasion and metastasis. Recently, this model has been revised to include two emerging hallmarks, reprogrammed energy metabolism,evasion of immune destruction and other enabling properties (Hanahan and Weinberg, 2011). The initial growth of breast cancers occurs when transformed cells in the breast proliferate in an uncontrolled manner to form a tumour. Under normal physiological condition, the growth and proliferation of cells are rigidly controlled. Cells require growth factors in order to propagate. However, cancer 5 Chapter 1. Introduction cells show a greatly reduced dependence on these growth stimulations by self- generating many of their growth factors or mutating their receptors. One example of a growth factor that is overexpressed in a proportion of breast cancers is the transforming growth factor alpha (TGF-α) (Schroeder and Lee, 1997). TGF-α binds to the epidermal growth factor receptor (EGFR or HER1) to stimulate cell proliferation. EGFR belongs to the ErbB protein family. The ErbB receptors have been found to be overexpressed in many types of cancer including breast cancer (Witton et al., 2003; Yarden and Sliwkowski, 2001). One prominent example of ErbB proteins which plays a critical role in human breast cancer is the human epidermal growth factor receptor 2 (ErbB-2 or HER2). Amplification of HER2 and overexpression of HER2 have been observed in 20- 25% of breast cancers and is often associated with poor prognosis and survival (Slamon et al., 1987). HER2 is the targeted of the therapeutic antibody Trastuzumab, or Herceptin. Another example of receptors that are important for breast cancer are the estrogen receptors (ERs). ERs are transcription factors. They are activated by estrogen which is a potent mitogenic hormone that drives normal breast development and its carcinogenesis. Hence ERs serve as good therapeutic targets in breast cancer (Hayashi et al., 2003). In addition to sustained growth, cancer cells also become insensitive to normal anti-proliferative signals that function to maintain tissue homeostasis. It is well known that cell cycle progress is rigidly controlled via checkpoints which involve several regulators such as cyclins (e.g. cyclins D1 and E), cyclin-dependent kinases (CDKs, such as CDK4 and CDK2), CDK inhibitors (CKIs, such as p16, p21 and p27) and RB1. Altered expression of these regulators is frequently found in breast cancer (Caldon et al., 2006; Wakasugi et al., 1997). Furthermore, the rapid propagation of breast cancer cells is also a result from the ability of cancer cells to evade apoptosis through mechanisms such as inactivation of p53 or aberrant activation of anti-apoptotic pathways such as activation of the BCL2 family of proteins that regulate apoptotic pathways (Muller and Vousden, 2014; Strasser et al., 2011). Breast cancer cells are also able to overcome senescence to acquire unlimited replicative potential. Unlike normal cells in which cellular senescence is often associated with progressive loss of telomeres following cell divisions, cancer cells express the enzyme 6 Chapter 1. Introduction telomerase to prevent shortening of telomeres. Expression of hTERT, a catalytic subunit of the telomerase occurs in a large majority of breast cancer (Herbert et al., 2001). In order to support the rapid growth of tumours, there must be adequate blood supply of nutrients and oxygen needed for the tumour. Angiogenesis is a process involving the formation of new blood vessels is a rate limiting step in tumour progression. Stimulation of vascular endothelial cells is required for angiogenesis, through the release of angiogenic proteins from the tumour cells such as overexpression of vascular endothelial growth factor (VEGF) (Goel and Mercurio, 2013). Angiogenesis also provides access to the circulation for metastatic cells. As a cancer progresses, the primary tumour invades into locally surrounding tissue and can eventually metastasize to other distant tissues. Metastasis is a complex multi-step process. Cells from the primary tumour can be dispersed through blood vasculature or lymphatics to distant organs via processes including local invasion of basement membrane, intravasation of the circulatory system and extravasation to distant sites, followed by proliferation of cancer cells and formation of secondary tumours in the distant organs (Nguyen et al., 2009). Many genes have been identified to be involved in invasion and metastatic processes of breast cancer. For instance, increased expression of MMP genes which encode the matrix metalloproteinases that degrade the basement membrane, and changes in expression of cell adhesion molecules (CAMs) that form cell-cell and cell-ECM junctions have been observed in a proportion of breast cancers (Kobayashi et al., 2007; Kohrmann et al., 2009). In recent times, a number of studies were undertaken using functional genomic approaches and complex in vitro and in vivo modelling systems to investigate genes that mediate breast cancer metastasis, as well as to determine the functions of these genes in individual steps of metastatic progression (Bos et al., 2009; Finak et al., 2008; Kang et al., 2003b; Landemaine et al., 2008; Minn et al., 2005a; Minn et al., 2005b; Ramaswamy et al., 2003; van 't Veer et al., 2002; Wang et al., 2005). Genome-wide screens have identified several 7 Chapter 1. Introduction molecular signatures and key regulators that are required for breast cancer cells to preferentially metastasize to specific organs (Bos et al., 2009; Finak et al., 2008; Kang et al., 2003b; Landemaine et al., 2008; Minn et al., 2005a; Minn et al., 2005b; Ramaswamy et al., 2003; van 't Veer et al., 2002; Wang et al., 2005). These findings suggested that metastatic cells are a specialized population of cells within the heterogeneous breast tumour that possess these metastatic gene expression signatures, and that the metastatic capacity may have been pre-determined by genetic changes acquired at the initial stage of tumour development. However, the mechanism and genetics of breast cancer metastasis is complex. The molecular pathways disrupted in metastasis and the roles of many genes involved are still poorly understood. A major current focus of the field is to understanding the mechanisms by which tumour cells colonize the distant metastatic organs, as well as addressing questions about organotropism and dormancy in cancer metastasis. Different cancers are known to have preferential sites of metastasis (Fidler, 2003). For example, lung and breast cancers can metastasize to multiple organs, including the bone, lung and liver, whereas prostate cancer and melanoma metastasis are confined largely to the bone and the liver, respectively. Some cancer patients can even harbor simultaneous metastases in multiple organs that can result from either synchronous spread of the malignancy from the primary site to systemic sites or subsequent seeding from other established metastases (Fidler, 2003). The mechanism controlling this metastasis organotropism is poorly understood and has prompted the search for organ-specific metastasis genes. In breast cancer, many patients show metastasis after a prolonged period of dormancy (Aguirre- Ghiso, 2007). This clinical phenomenon has raised important questions and research as to what controls dormancy and whether dormancy offers a therapeutic opportunity to control metastatic breast cancer. 1.2.4 Classification of breast cancer 1.2.4.1 Overview Breast cancer is a complex and heterogeneous disease, which encompasses a broad range of genetic, phenotypic and histological types and also exhibits 8 Chapter 1. Introduction different clinical behaviours. The classification of breast cancer can be done by several approaches from histological, prognostic and predictive standpoints. The traditional approach is to classify breast cancers on the basis of their overall morphological features and structural organization. Most breast cancers are derived from the epithelium lining the ducts or lobules of the mammary gland, and these cancers are classified as either ductal or lobular carcinoma. The most frequent histologic type of breast tumour is invasive ductal carcinoma, not otherwise specified (IDC NOS) which accounts for 75% of cases, while invasive lobular carcinoma (ILC) represents the next common type observed and reported (about 10% of cases) (Li et al., 2005). These two types of breast tumours make up the vast majority (about 90%) of breast cancers. Another approach is based on the histological appearance in combination with a grading system that shows prognostic implication. This approach assesses breast tumours based on three histological and clinical factors: tumour size, lymph node status and histological grade. Tumour size is associated with the distant recurrence of the disease (Carter et al., 1989). The lymph node status is used as a prognostic predictor for patients in the early stages of breast cancer in predicting distant relapse and overall survival (Saez et al., 1989). The histological grading of the tumour focuses on the appearance of the breast tumour cells compared to the normal breast tissue. It serves as a prognostic marker to inform clinicians how differentiated the tumour cells are. Poorly differentiated cancers have a worse prognosis. However, grading of tumours based on their histological appearance can be inconsistent due to subjectivity in interpretation and assessment by pathologists as well as variation in protocols used for tissue collection and processing (Dalton et al., 1994; Harvey et al., 1992; Hopton et al., 1989; Theissig et al., 1990). The presence of specific markers in breast cancer has long been recognized to both define subtypes with differential overall prognosis and to identify tumours susceptible to targeted treatments. Another traditional approach is to use IHC and/or Fluorescent In-situ Hybridisation (FISH) to classify breast cancers on the basis of their expression status of Estrogen receptor (ER), Progesterone receptor (PR) and Human epidermal growth factor receptor (HER2) (Allred et 9 Chapter 1. Introduction al., 1998). Classification of breast cancers into the ER+, ER- and HER2+ categories enables clinicians to determine whether targeted therapies against ER (anti-estrogen therapies such as Tamoxifen) or HER2 (the monoclonal anti- HER2 antibody Trastuzumab) can be used to treat patients and allows prediction of a probable response to a particular treatment. PR status generally correlated with ER status and has less clinical significance. Several studies have also shown that PR status does not appear to predict relative benefit from specific types of endocrine therapy (Bartlett et al., 2011; Dowsett et al., 2008). There is currently no standard targeted therapy for the triple-negative breast cancers which are assessed as PR-, ER- and HER-. Over the past decade, introduction of high-throughput molecular technology has allowed has allowed relatively large-scale studies of breast cancer cohorts, leading to the identification of multiple molecular subtypes of breast cancer based on their gene expression patterns. Microarray-based gene expression profiling of human breast cancer revealed several biologically and clinically distinct subtypes of the disease exist within the broad definitions of ER+ and ER- breast cancer. These cancers are cluster into five distinct groups, defined as: Luminal A, Luminal B, HER2-enriched, Basal and Claudin-low (Perou et al., 2000; Prat et al., 2010; Sorlie et al., 2003) (Figure 1-1). The five different subtypes of breast cancers are associated with different clinical outcomes (Figure 1-2). The molecular and clinical characteristics of these different subtypes are described below. 10 Chapter 1. Introduction Figure 1-1 Different subtypes of breast cancer identified from gene expression profiling analysis. Subtypes are classified as: Claudin-low, Basal, HER2- enriched, Luminal A and B (top) using classifier gene sets (right) [Figure adapted and modified from Prat et al (Prat and Perou, 2011)] 11 Chapter 1. Introduction Figure 1-2 Kaplan Meier analysis of relapse-free (left) and overall survival rates (right) of a cohort of 337 breast cancer patients associated with each subtype of breast cancer. [Figure adapted from Prat et al (Prat and Perou, 2011)] 1.2.4.2 Breast cancer subtypes 1.2.4.2.1 Luminal A subtype Luminal breast cancers contain principally ER+ cases and are distinguished by the presence of genes regulated by the ER signalling pathway. The luminal breast cancers have gene expression profiles that are enriched for the “luminal” cluster, resembling the gene profiles of luminal epithelial cells, hence are termed “luminal” (Perou et al., 2000). As briefly mentioned early, ER serves as a good therapeutic target. The ER+ breast cancer is often treated with anti- estrogen therapies such as Tamoxifen, although it has been reported that resistance to anti-estrogen drugs occurs over time (Cook et al., 2011). The luminal subtype can be divided into luminal A and luminal B. Patients who belong to luminal A subtype are characterised by being ER+ and/or PR+ and HER2-. Luminal A breast cancer represents the most commonly occurring subtype of breast cancer, accounting for roughly 30 –50% of all cases. Clinically, it has been shown that the Luminal A subtype has a better overall survival and relapse-free survival rates than other breast cancer subtypes and is associated with relatively good prognosis (Sorlie et al., 2001) (Figure 1-2). 12 Chapter 1. Introduction 1.2.4.2.2 Luminal B subtype The next most frequent subtype of breast cancer is the Luminal B breast cancer, which accounts for approximately 10 – 20% of breast cancer cases. Luminal B tumours are positive for ER and PR and show low to moderate expression of luminal specific genes (Sorlie et al., 2001). Unlike Luminal A, Luminal B cancers are also enriched for a highly proliferative gene signature that may include activated HER2 pathways. Patients with Luminal B breast cancer exhibit a higher tumour grade as well as augmented expression in proliferative gene signatures (Cheang et al., 2009; Nielsen et al., 2010; Sorlie et al., 2001). In addition, Luminal B cancers do not respond to the anti-estrogen therapy as well as Luminal A subtype but targeted therapies such as Trastuzumab can be used in cases where the HER2 pathway is activated. Patients with Luminal B cancer have a poorer prognosis compared to Luminal A subtype, but slightly better than patients with HER2-enriched and Basal tumours (Sorlie et al., 2003). 1.2.4.2.3 HER2-enriched subtype The HER2-enriched subtype accounts for approximately 15% of breast cancers. The HER2-enriched subtype is characterised by activation of the HER2 pathway, often due to the amplification of the HER2 gene (Perou et al., 2000). As described earlier, HER2 is a proto-oncogene which is amplified in ~20% of breast cancers (Slamon et al., 1987). HER2 is a tyrosine kinase growth factor receptor which forms heterodimers upon ligand binding. HER2 can heterodimerise with any of the other three ErbB receptors and is considered to be the preferred dimerisation partner of the other ErbB receptors. The activated receptor dimers are involved in a variety of signal transduction pathways leading to tumourigenesis. A significant proportion of HER2-enriched tumours is ER positive, and clusters with the Luminal B subgroup (Prat and Perou, 2010). The HER2-enriched subtype of breast cancer is typically associated with aggressive clinical behaviour and shows shorter overall and relapse-free survival time compared to Luminal A and Luminal B subtype (Sorlie et al., 2003). While failing to respond to Tamoxifen, patients with HER2-enriched breast cancer can be treated with targeted therapies such as the monoclonal antibody against HER2, Trastuzumab. Nonetheless, the heterogeneity of HER2- 13 Chapter 1. Introduction enriched breast cancer, which results from the complex genetic alterations, often causes a variable clinical prognosis and different degrees of responses to trastuzumab treatment. Despite this, cancers of the HER2-enriched subtype show very poor outcomes as a result of a proportion of patients that does not respond to Trastuzumab treatment due to de novo or acquired resistance (Piccart, 2008). It has been reported that more than half of the HER2-enriched breast cancer patients do not show response to Trastuzumab treatment (Spector, 2008). 1.2.4.2.4 Basal subtype The Basal subtype of breast cancer accounts for approximately 15% of breast cancer cases. Basal cancers lack the expression of ER, PR and HER2. The gene expression profile of basal cancer contrasts vastly from the other subtypes. The basal tumour expresses basal/myoepithelial markers of normal breast epithelium such as cytokeratins 5/6, 17, Laminin, Fatty acid binding protein 7 and Integrin β4 (Perou et al., 2000; Sorlie et al., 2001). Tumours from patients with BRCA1 germline mutations frequently show basal-like gene expression profiles, with up to 80% of cases clustering into the basal molecular subtype (Hedenfalk et al., 2001; Lewis Phillips et al., 2008; Turner and Reis- Filho, 2006). In addition, mutations in TP53 are also frequently observed in Basal breast tumours, occurring in about 80% of cases (Sorlie et al., 2001; TCGA, 2012). Similar to HER2+ breast cancer, the basal breast cancer has complex and heterogeneous genetics and has been shown to display a very poor and variable clinical outcome, with the majority of deaths happening within 5 years following diagnosis (Fulford et al., 2007; Jumppanen et al., 2007). Women who have basal breast cancers have shorter relapse-free survival times than women who have other subtypes of breast cancer (Perou et al., 2000). Basal breast cancers also have an aggressive behaviour, preferentially disseminating to vital organs such as lungs, liver and brain (Luck et al., 2008). There are currently no effective targeted therapies exist for basal breast cancer. Although basal breast cancer can be treated with cytotoxic chemotherapy, long term survival of patients is poor and metastasis of the disease is very common. PARP-1 (poly ADO ribose polymerase) inhibitors have been proposed as a potential therapeutic to treat patients with BRCA1 mutations and has been used 14 Chapter 1. Introduction in combination with standard chemotherapy to treat basal breast cancer in clinical trials but yielded mixed results (O'Shaughnessy et al., 2011; O’Shaughnessy J., 2011b; Tutt et al., 2010). 1.2.4.2.5 Claudin-low subtype The claudin-low subtype is the least commonly occurring subtype, accounting for less than 10% of breast cancer cases (Prat and Perou, 2010). Similar to the basal breast cancer, the claudin-low subtype is negative for ER, PR and Her2, but is characterised by the low expression of claudin genes and is enriched in epithelial mesenchymal transition (EMT) genes and cancer stem cells markers (Herschkowitz et al., 2012; Prat et al., 2010). Gene expression profiling showed that Claudin-low tumours are also enriched in mammary stem cell (Lim et al., 2009) and EMT signatures (Taube et al., 2010). The claudin-low subtype has a poorer overall and relapse-free survival compared to Luminal A cancers, but are not significantly different to any other subtype (Prat and Perou, 2011). Like the basal subtype, there is no clinically approved targeted therapy for the claudin- low breast cancer. 1.2.4.2.6 Other classification systems Recently, a number of other classification systems for determining breast cancer subtypes have been proposed. Based on analyses on gene copy number aberrations (CNAs) and gene expression in approximately 2000 primary breast cancer samples, Curtis and colleagues identified 10 new breast cancer subtypes that are associated with distinct patient outcomes (Curtis et al., 2012a). The subtypes identified in their study included an ER+ subgroup with a poor outcome characterized by 2 separate amplicons at 11q13 and 11q14 (affecting CCND1 and several putative oncogenes); 2 low-CNA subgroups with a good prognosis that incorporated luminal A, ER+, and ER- tumours; and an expanded HER2-enriched subgroup that included both ER- and luminal ER+ subtypes (Curtis et al., 2012a). Another major study from the Cancer Genome Atlas consortium described a multifaceted analysis of 825 primary breast cancers (TCGA, 2012). Exome sequencing, copy number variation, DNA methylation, mRNA arrays, microRNA sequencing and proteomic analyses were performed and integrated to study the molecular heterogeneity of breast 15 Chapter 1. Introduction cancer. Reverse-phase protein array identified two novel protein-expression- defined subtypes, possibly produced by stromal/microenvironmental elements (TCGA, 2012). On the other hand, there are studies claiming that a much simpler classification can be achieved. For example, Haibe-Kains and co- workers demonstrated that for breast cancer molecular subtyping, a simple classification model, which is based on the expression levels of three key genes -- ER, HER2, and aurora kinase A (AURKA), was surprisingly concordant with the more complex published classifiers and yielded similar prognostic value (Haibe-Kains et al., 2012). Overall, these new studies may reshape the way breast cancer is classified in the future. However, more research needs to be performed to investigate whether the association of these new breast cancer subtypes with patient outcomes are strong enough to be applied in the clinic. 16 Chapter 1. Introduction 1.3 Inhibitors of Differentiation proteins The inhibitor of DNA binding/differentiation (ID) family of proteins are important transcriptional regulators in a wide range of developmental and cellular processes and are often deregulated in cancer. Four members of ID family, ID1, ID2, ID3, ID4, have been discovered in vertebrates. In the following section, I will provide an extensive review on this family of proteins. ID1 and ID3 are the focus of this project. Both genes are closely related to each other, based on genetic studies documenting functional overlap in development and cancer. Previous studies have shown a high significant coexpression of ID1 and ID3, but not other ID proteins in human breast cancer, and their expression correlates with poor clinical outcome (Gupta et al., 2007; Schoppmann et al., 2003b). Knockdown of both Id1 and Id3 causes an inhibition of cancer metastasis however the mechanism is unclear (Gupta et al., 2007). Since ID1 and ID3 are the focus of this project, my discussion will be focused on these two members of ID proteins. 1.3.1 The bHLH family of transcription factors The basic helix-loop-helix (bHLH) family of transcription factors play critical roles in the transcriptional network which functions in regulating a variety of cellular processes including lineage commitment, cell differentiation and proliferation (Massari and Murre, 2000). The bHLH transcription factors are distinguished by two α-helices linked by a loop and a DNA binding domain that contains several basic amino acids (Norton, 2000). The bHLH family of transcription factors consists of 118 members in human and 107 members in mice. A recent phylogenetic analysis of the mouse basic helix-loop-helix (bHLH) gene superfamily has classified them into 5 clades based on their full amino acid sequences (Figure 1-4) (Skinner et al., 2010). Each member of the family has a highly conserved HLH domain which is responsible for homo- or hetero-dimerizing with another HLH domain/protein (Figure 1-3). The homo- or hetero-dimers act as transcriptional enhancers or inhibitors of a variety of genes via direct DNA binding to a canonical sequence called E-box (CANNTG) (Ephrussi et al., 1985). While some bHLH proteins are 17 Chapter 1. Introduction ubiquitously expressed such as the E proteins, others are expressed in a tissue specific manner such as NeuroD and MyoD (de Candia et al., 2004b; Ruzinova and Benezra, 2003). These bHLH proteins play an important role in development, lineage commitment and stem cell homeostasis, for instance, the E proteins function to mediate haematopoetic differentiation, NeuroD and MyoD have the ability to specify cell fate of neural cells and myoblast respectively (Davis et al., 1987). Figure 1-3 Schematic structure of different HLH protein families. Four main groups of HLH protein can be distinguished on the basis of the presence or absence of additional functional domains. The basic DNA binding region (b), leucine zipper (LZ) and PAS domains that bound the HLH region are shown (not to scale). The ID proteins lack a DNA-binding region and function by dimerisation with other transcriptionalregulators, principally those of the bHLH. [Figure adapted from (Norton, 2000)] 18 Chapter 1. Introduction Figure 1-4 Phylogenic tree of mouse basic bHLH transcription factors The Id proteins classified in the Clade B (indicated in the red box) in the mouse bHLH phylogenic tree. Figure adapted and modified from Skinner et al 2010 (Skinner et al., 2010). 19 Chapter 1. Introduction 1.3.2 The ID proteins ID proteins belong to the bHLH proteins (Benezra et al., 1990). They lack the basic DNA-binding domain, hence they do not have the ability to bind to DNA. They function by hetero-dimerizing with other bHLH proteins and act as dominant negative regulators of those bHLH transcription factors to control transcription of genes (Figure 1-5) (Benezra et al., 1990; Sikder et al., 2003). Id proteins can also block the function of some helix-turn-helix factors such as the Ets1/2 and Pax family members of transcription factors (Norton, 2000). Four ID proteins, namely ID1, ID2, ID3 and ID4, have been identified in vertebrate. All four members share the highly conserved HLH region and have similar molecular weights of between 13-20 kDa. However, there are extensive sequence differences among all four members of the ID proteins. Different members of the ID proteins are expressed in a tissue-specific and stage- dependent manner, hence controlling different cellular and physiological processes (Norton et al., 1998). Of the four members of ID proteins, ID1 and ID3 have overlapping expression pattern and functional redundancy, and it is thought that one can compensate for the loss of the other one (Lyden et al., 1999; Norton, 2000; Volpert et al., 2002) 20 Chapter 1. Introduction Figure 1-5 Mode of action of ID proteins as dominant negative regulators of the bHLH transcription factors. [Figure adapted and modified from Perk et al 2005 (Perk et al., 2005a)] (a) In the absence of an ID protein, bHLH proteins dimerize with each other and bind to E-box (CANNTG) to activate transcription of differentiation-associated genes. (b) ID protein heterodimerizes with a bHLH protein to form a bHLH-ID dimer. Because the ID protein lacks a DNA binding domain, therefore the bHLH-ID dimer is unable to bind DNA to inhibit the expression of its direct target genes. Hence ID proteins serve as dominant negative regulators of the bHLH transcription factors. 21 Chapter 1. Introduction 1.3.3 Regulation of ID proteins ID proteins exhibit unique spatio-temporal patterns of tissue expression during development (Jen et al., 1997b) and tumourigenesis (Perk et al., 2006a). The mechanisms governing ID protein expression are complex. In many instances, the mechanisms of ID gene activation are unclear. A number of studies have indicated that ID gene transcription is exquisitely sensitive to signals from the extracellular environment, including members of bone morphogenic protein (BMP) and TGF-β superfamily (Kang et al., 2003a; Kowanetz et al., 2004), steroid hormones and growth factors such as the epidermal growth factor (EGF) and insulin-like growth factor-I (IGF-I) (Lin et al., 2000b), receptor tyrosine kinases (Bain et al., 2001b; Tam et al., 2008) and oncoproteins (Lasorella et al., 2000) (Figure 1-6A and Table 1-1). IDs serve as downstream targets of several known oncogenic pathways. Regulation of ID proteins has been shown to be mediated by several well-established oncoproteins such as MYC, RAS, RB and p53 (Lasorella et al., 2014) (Figure 1-6A). Stability of the ID proteins has been reported to be promoted by dimerisation induced nuclear localisation, and some family members of ID proteins are also regulated by the relative levels of ubiquitinase and deubiquitinase enzymes (Williams et al., 2011b; Yokota and Mori, 2002). Lasorrella and colleagues reported the stability of IDs is controlled by the APC/Cdh1 E3 ubiquitin ligase complex (Lasorella et al., 2006), resulting in short half-lives for ID proteins in most tissues. Another study showed that ID proteins are stabilised by the ubiquitin specific peptidase 1 (USP1) deubiquitinase which counters ubiquitin-mediated ID destruction in certain physiological and cancer stem cell populations (Williams et al., 2011a). USP1 is overexpressed in a subset of primary osteosarcomas, where it stabilises ID1, ID2 and ID3, leading to repression of p21 and the osteogenic differentiation program (Williams et al., 2011a). 22 Chapter 1. Introduction Figure 1-6 Regulation of ID protein expression and their multifactorial function in cancer biology. (A) Numerous proteins including members of the BMP and TGF-β superfamily, growth factors such as EGF have been shown to regulate ID proteins. In addition, the aberrantly high levels of expression of ID proteins in cancer are often a consequence of transcriptional induction by oncoproteins such as RAS- Egr1, MYC, and Src-PI3k as well as tumour suppressors RB, p53 and KLF17. (B) ID proteins function as mediators for the coordination of multiple cancer hallmarks essential to the development and progression of cancer. ID proteins mediate self-renewal phenotype and cell-cycle by regulating a number of known stem and proliferation factors such as Notch, Sox2 /4, LIF, cyclin genes and the Cyclin-dependent kinase inhibitors (CKI) p21waf1 and p16INK4A. In addition, IDs remodel the tumour microenvironment by inducing the expression of pro- angiogenic cytokines such as IL6, IL8 and CXCL1 which increase endothelial cell proliferation and migration and that might influence the biological properties 23 Chapter 1. Introduction of other cell types in the tumour microenvironment. ID proteins have also been shown to promote invasion by degrading the extracellular matrix through induction of several members of the maxtrix metalloproteinase (MMP) protein family such as MMP-2, MMP-9 and MMP-14. In neural stem cells and in glioma, ID genes control a neural stem cell-intrinsic transcriptional programme that preserves stem cell adhesion to the niche. ID proteins activate the Ras-related protein RAP1 by suppressing the GTPase activating protein RAP1GAP, thereby promoting adhesion of cells to a supportive endothelial niche via integrin signalling Signal Target Tissue or cell Influence on Pathway Effect Reference ID mediato transcriptio s n r BMP4 ID1,3 Mouse + SMAD Self renewal and (Hollnagel embryonic pluripotency stem cells et al., 1999; Ying et al., 2003) BMP4 ID4 Neural + Inhibition of (Samanta progenitor oligodendroglial cells differentiation and Kessler, 2004) Nanog ID1,3 Mouse + Not Self renewal and (Ying et al., embryonic pluripotency stem cells known 2003) BMP2 ID1,3 Neural + SMAD Inhibition of (Nakashim precursors neural differentiation a et al., 2001) 24 Chapter 1. Introduction BMP2 ID1 Myogenic and + SMAD Myogenic and (Katagiri et osteogenic osteogenic precursor cells differentiation al., 1994; regulation Lopez- Rovira et al., 2002; Ogata et al., 1993) BMP7 ID2,3 Epithelial cells + SMAD Proliferation (Kowanetz et al., 2004) TGF-β ID1,2, Epithelial cells - SMAD Cytostatic; (Kowanetz and epithelial- 3 ATF3 mesenchymal et al., 2004) activatio transition n TGF-β ID1 Endothelial + TGF-β/ Migration and (Goumans (low cells ALK1/ proliferation levels) SMAD et al., 2002) TGF-β ID2,3 Immune cells + TGF-β Lineage (Kee et al., determination; receptor IgE-class-switch 2001; suppression; lymphocyte Sugai et al., regulation (ID3) 2004) VEGF ID1,3 Bone marrow + Not Angiogenesis (Lyden et known al., 2001b) MYC ID2 Neuroblastom + Tumorigenesis (Lasorella a et al., 2000) β- ID2 Colon cancer + APC/ Tumorigenesis (Rockman cateni Β- n catenin/ et al., 2001) TCF 25 Chapter 1. Introduction IGF1R ID1 Mouse embryo + Multiple (Belletti et fibroblasts pathway al., 2002) s IGF1R ID2 32D murine + IRS1/ Inhibition of (Belletti et hemopoietic PI3K differentiation cells pathway al., 2001) TCR ID3 Thymocytes + RAS Thymocyte (Bain et al., cascade, EGR1 maturation 2001a; Bettini et al., 2002) FSH ID2 Sertoli cells + cAMP Regulation of (Scobey et spermatogenesi al., 2004) s Table 1-1 Transcriptional regulation of Id proteins [Figure adapted from (Perk et al., 2005b)] 1.3.4 ID proteins in developmental and stem cell biology ID proteins play an important role in development by regulating the process of cell differentiation and lineage commitment. ID1 has been shown to be expressed during mammalian embryonic development but its expression is restricted in normal adult tissues (Jen et al., 1997a; Perk et al., 2006b; Redrado et al., 2013). A recently study using a highly specific monoclonal anti-Id1 antibody showed that in mouse embryos, Id1 was highly expressed in the lung, cartilage, oropharyngeal cavity and skin, whereas in adult tissues Id1 expression was only detectable in epithelial cells of the uterus and gut (Redrado et al., 2013). Id1 is required to maintain the self-renewal ability of embryonic stem cells. Loss of Id1 resulted in decreased expression of Nanog, a key regulator of pluripotency (Boiani and Scholer, 2005; Romero-Lanman et al., 2012). Functionally, Id1 and Id3 are required in early development. Id1 and Id3 double knockout (KO) mice are embryonic lethal. Premature neural 26 Chapter 1. Introduction differentiation associated with severe hemorrhages specifically in the forebrain was observed in these mice (Lyden et al., 1999). Id1 has been found by our group to be expressed by a subset of basal mammary epithelium, in which stem cells are known to reside, suggesting a role of Id1 in controlling mammary gland development (Nair et al., 2010). ID proteins also have a well-established role in the development of the various cell types of the neuronal, muscular, hematopoietic and the immune system. ID proteins play a critical role in mediating differentiation during the development of these systems. Cell differentiation is a process by which a less specialized cell becomes a more specific type of cell. Differentiation of cell lineages is accompanied by downregulation of ID1 expression in many cell types, while overexpression of ID1 inhibits the ability of cells to differentiate. ID1 has been shown to inhibit the differentiation of myoblast, myeloid and neural cells by interacting with bHLH transcription factors such as MyoD, E proteins and NeuroD (Ruzinova and Benezra, 2003). The level of ID1 expression was also reported to decrease as myoblast and myeloid cells differentiate (Jen et al., 1992; Kreider et al., 1992). In the neuronal system, high level of Id1 expression was observed in the neural stem cells but gradually decreased with increasingly differentiated cells (Nam and Benezra, 2009). The same study also showed that Id1 expressing neural cells population isolated from subventricular tissue demonstrated high self- renewal capacity through in vitro neurosphere assays and were able to divide assymetrically to produce both stem cell and differentiated daughter cells over several passages (Nam and Benezra, 2009). ID proteins have also been reported to regulate the generation of neurons and glia from common progenitor cells. Ectopic overexpression of Id1 in the embryonic cerebral cortex blocking differentiation and led to exclusive formation of glia cells at the expense of neurons (Cai et al., 2000). A separate study showed that in vitro overexpression of Id1 and Id3 blocked neurogenesis, and a premature neuronal differentiation was observed in the Id1/3 double KO mice (Ruzinova and Benezra, 2003). 27 Chapter 1. Introduction Evidence has also pointed to a functional role of ID1 in normal haematopoetic stem cells. ID1 is required for self-renewal and the maintenance of an undifferentiated state of the haematopoetic stem cells. Two separate studies showed that haematopoetic stem cells isolated from Id1-null mice readily commit to myeloid differentiation in culture, and the cells failed to repopulate bone marrow in in vivo competitive repopulation transplant studies (Jankovic et al., 2007; Perry et al., 2007). ID proteins are expressed by some progenitor cells in the immune system (Murre, 2005). For instance, ID3 is required for both pre-B cell receptor and pre-T cell receptor signalling in developing B and T cells (Murre, 2005). ID2 plays a role in natural killer (NK) cell differentiation from a common T cell/NK cell progenitor. Furthermore, loss of ID2 also impairs the differentiation of some dendritic cell subsets including splenic dendritic and Langerhans cells (Kee, 2009; Ruzinova and Benezra, 2003). 1.3.5 Deregulation of IDs in cancer ID proteins are aberrantly expressed in most cancer types and often correlate with poor outcome. Elevated ID expression has been reported in a wide variety of solid and haematological cancers. Clinical data shows that high ID protein expression strongly correlates with aggressive clinical behaviour and poor patient outcome in many forms of cancer, as reviewed previously by Perk and Lasorella (Lasorella et al., 2014; Perk et al., 2005b). The expression of ID proteins in different tumour types and their prognostic significance are summarized in Table 1-2. Several studies summarised in Table 1-2 have also experimentally addressed the idea that ID proteins are plausible prognostic markers and therapeutic targets in cancer because certain subsets of human tumours can become addicted to high levels of ID protein expression (Niola et al., 2013; Ponz-Sarvise et al., 2011; Yang et al., 2011). However, analysing ID proteins at the whole tissue level can be complicated by their expression by multiple cell types including blood vessels and immune cells. This is particularly true for ID1. For example, tumour-associated endothelial cells often show high expression of ID1, confounding expression analysis in whole tumour extracts. Furthermore, ID1 can be expressed by rare neoplastic cells in subsets of breast (Gupta et al., 2007), glioma (Anido et al., 2010) and bladder (Perk et al., 2006a) 28 Chapter 1. Introduction cancers, which can be difficult to identify using tissue microarrays or bulk tumour extracts. Although IDs are overexpressed in a wide range of cancers, they are not necessarily genomically altered or over-expressed or appear to act like typical oncogenes, which are commonly activated in cancer by genetic alterations such as mutation and amplification (Bertram, 2000; Weinberg, 1991). No genetic alterations have been observed in ID1 in cancer tissues to date. A study which sequenced ID1 in 13 families of patients who had malignant melanoma had found no mutation in ID1 gene (Casula et al., 2003). Recently, several studies have demonstrated a complex context-dependency of ID function in cancer, where IDs can play opposing roles at times in neoplastic progression. For example, several groups demonstrated that ID3 act as a tumour suppressor in Burkitt’s lymphoma, and is inactivated through somatic mutation in up to 68% of cases (Love et al., 2012; Richter et al., 2012; Schmitz et al., 2012). ID3 inactivation promotes tumour cell survival through ligand-independent signalling by the B-cell receptor (BCR) to the PI3K pathway. Similarly, ID4 is epigenetically silenced through promoter hypermethylation in subsets of cancers, including human leukemia (Chen et al., 2011c; Yu et al., 2005), suggesting a tumour suppressive function. In addition, chromosomal translocation of ID4 gene has been observed in patients with B-cell lineage acute lymphoblastic leukemia (ALL) (Bellido et al., 2003; Russell et al., 2008). Conversely, in serous ovarian cancer (SOC), ID4 acts as a proto-oncogene and is genomically amplified, overexpressed and required for SOC cell line proliferation (Ren et al., 2012b). These data demonstrate that the functions of IDs in cancer are complex and context-dependent and the importance of context in understanding ID function. The biological relevance of the expression data is substantiated by the evidence that ID proteins are implicated in maintaining many cancer-related phenotypes. ID proteins have been shown to regulate central hallmarks of cancer such as proliferation, cellular senescence and survival (Lasorella et al., 2014; Perk et al., 2005b). Recently, a number of studies have been conducted to investigate the role for ID proteins and their mechanism of action in cancer by 29 Chapter 1. Introduction utilising both in vitro and in vivo systems, functional genomic approaches as well as correlating the findings with clinical expression levels and patient outcome data. These studies have provided critical insights into novel cellular and molecular events controlled by ID proteins, revealing complex roles of IDs within cancer cells and the local microenvironment. In particular, ID expression is critical in controlling cancer stem cell phenotypes and is associated with the induction of cancer cell invasion and metastasis, activation of angiogenesis, and remodelling of the microenvironment (Nair et al., 2014). 30 Chapter 1. Introduction Cancer type ID Protein Expression Phenotype Prognosis Reference Bladder ID1 Increased Invasion Poor (Ding et al., 2006) Breast ID1 Increased Invasion, Poor (Fong et al., 2003; metastasis Gumireddy et al., and 2009; Gupta et al., angiogenesis 2007; Minn et al., 2005a; Olmeda et al., 2007; Swarbrick et al., 2008b; Tobin et al., 2011) ID2 Reduced Differentiation Good (Stighall et al., 2005) and reduced invasion ID4 Reduced Lymph node Poor (Umetani et al., metastasis 2005b) Brain ID1 Increased Proneural Good (Barrett et al., 2012) ID2 Increased Mesenchymal Poor (Niola et al., 2013) ID3 Increased Mesenchymal Poor (Niola et al., 2013) ID4 Increased Proliferation, Poor (Zeng et al., 2010) anaplasia and associated with high- grade cancer Colon and ID1 Increased Hyperproliferat Poor (O'Brien et al., rectal ion and CSC 2012a; Wilson et al., 2001) ID2 Increased Hyperproliferat Poor (Wilson et al., 2001) ion ID3 Increased CSC Poor (O'Brien et al., 2012a) ID4 Reduced Dedifferentiati Poor (Umetani et al., 31 Chapter 1. Introduction on 2005a) Oesophagea ID1 Increased Associated Poor (Luo et al., 2012) l with metastasis Gastric ID1 Increased Loss of Poor (Iwatsuki et al., 2009; differentiation Yang et al., 2011) ID3 Increased Loss of Poor (Yang et al., 2011) differentiation Kidney ID1 Increased Lower CR rate Poor (Li et al., 2007a) Head and ID1 Increased Tumour Poor (Sun et al., 2012) neck angiogenesis Leukaemia ID1 Increased Myeloid Poor (Tobin et al., 2011) leukaemia ID4 Increased Myelodisplasti Leukaemic (Wang et al., 2010) c syndrome transformati on Epigeneticall Myeloid Leukemic (Chen et al., 2011b; y silenced leukemia transformati Yu et al., 2005) on Lung ID1 Increased Migration and Poor (Bhattacharya et al., metastasis 2010; Castanon et al., 2013; Pillai et al., 2011; Ponz-Sarvise et al., 2011) Hodgkin’s ID2 Increased Loss of B cell Not (Renne et al., 2006) lymphoma properties applicable Non- ID3 Loss of Loss of B cell Not (Love et al., 2012; Hodgkin’s function differentiation applicable Richter et al., 2012; lymphoma Schmitz et al., 2012) Pancreatic ID1 Increased Hyperproliferat Poor (Maruyama et al., ion and tumour 1999) 32 Chapter 1. Introduction angiogenesis ID2 Increased Hyperproliferat Poor (Kleeff et al., 1998) ion ID3 Increased Hyperproliferat Not (Lee et al., 2011) ion and applicable metastasis Prostatic ID1 Increased Tumour Poor (Coppe et al., 2004; progression Sharma et al., 2012; Zhang et al., 2007) ID3 Increased Tumour Poor (Sharma et al., 2012) progression ID2 Increased Tumour Poor (Coppe et al., 2004) progression ID4 Increased Associated Poor (Yuen et al., 2006) with metastasis Thyroid ID1 Increased Tumour Poor (Ciarrocchi et al., growth 2011; Kebebew et al., 2004) Ovarian ID4 Increased Tumour Not (Ren et al., 2012a) growth applicable ID1 Increased Tumour Poor (Schindl et al., 2003) angiogenesis and anaplasia Nasopharyn ID1 Increased Invasion Poor (Sun et al., 2012) geal carcinoma Liver ID1 Increased Associated Poor (Ding et al., 2010; with Matsuda et al., 2005) progression 33 Chapter 1. Introduction Table 1-2 ID protein expression in common cancer types [Table adapted and modified from Lasorella et al (Lasorella et al., 2014)] 1.3.6 ID1 and ID3 regulate diverse aspects of cancer progression A malignant tumour possesses special hallmarks that distinguish it from the normal tissue and confer on it the ability to grow and progress in the body. Cancer cells hold a set of properties which are essential for tumour growth and progression. These properties include self-sufficiency in growth signal, insensitivity to antigrowth signals, evasion of apoptosis, unlimited replicative potential, sustained angiogenesis, tissue invasion and metastasis. In the following section, I will also summarize the multiple roles of ID1 and ID3 in regulating several important hallmarks of cancer and how deregulation of ID1/3 activity leads to malignancy (For simplicity, “ID1 and ID3” will be abbreviated as ID1/3 in this thesis). In addition, I will highlight recent development in the understanding of the cellular and molecular mechanisms responsible for the action of ID1/3 in cancer, with an emphasis on their potential role in controlling metastasis, which is the focus of this thesis. 1.3.6.1 The association of ID1/3 with cell cycle regulation, proliferation and senescence ID1 is involved in regulating cell proliferation and senescence by mediating the activity of cell cycle regulators such as Cyclins, Cyclin-dependent kinases (CDK) and Cyclin-dependent kinase inhibitors (CKI) (Figure 1-8B). Several studies have shown that ID1 is required for the proliferation of many cell types, including fibroblasts and mammary epithelial cells (Lin et al., 1999; Norton et al., 1998; Swarbrick et al., 2005). ID1 appears to be mainly involved in the progression of cells from G0/G1 into S phase. Mechanistically, Alani and colleagues showed that Id1 promotes proliferation of mouse embryo fibroblasts by reducing the expression of CKI p16 (Alani et al., 2001). A separate study indicated that ID1 may have inhibitory effect on other CKIs such as p21 and p27 (Tang et al., 2002). It was also shown that ectopic overexpression of ID1 causes inactivation of the pRb, a protein which functions in preventing excessive cell growth and proliferation by inhibiting cell cycle (Alani et al., 1999). In human breast epithelial cells, ID1 stimulates cell proliferation by 34 Chapter 1. Introduction promoting expression of cyclins D1 and E for activation of CDK4 and CDK2 activities (Swarbrick et al., 2005) (Figure 1-6B). Unlimited replicative potential together with evasion of senescence is another major hallmark of a cancer. Constitutive expression of ID1 in keratinocytes induces cell proliferation, extended the lifespan of the cells and allowed cells to bypass senescence and become immortalised (Alani et al., 1999). Overexpression of ID1 resulted in activation of telomerase activity via promoting the expression of hTERT. The same study also indicated that ID1 may also have an inhibitory effect on p53, a protein which plays a major role in apoptosis and other tumour suppressing effects (Alani et al., 1999). Another study reported that ID1 can function to delay cellular senescence via downregulation of p16 (Nickoloff et al., 2000). Id1 was shown to promote tumourigenicity and metastasis by activating nuclear factor-κB (NF-κB) and Akt signalling pathway (Lee et al., 2009; Li et al., 2009; Lin et al., 2010; Ling et al., 2003). Both NF-κB and Akt regulate many cellular processes involving in cancer progression such as proliferation, anti-apoptosis, increased cellular survival, invasion and metastasis (Baldwin, 2001; Vivanco and Sawyers, 2002). Our group has also demonstrated that in mouse models of metastatic breast cancer, Id1 is required for tumour maintenance by cooperating with activated RAS oncogenes to avert cell senescence and to drive progression of metastatic breast cancer. Tumour expressing activated Ras and Id1 continue shows increased proliferation with high level of p21Waf1/Cip1, suggesting that Id1 acts downstream of p21Waf1/Cip1 to maintain cellular proliferation. Inactivation of Id1 in established tumours lead to widespread senescence, tumour growth arrest, tumour regression and reduced metastasis (Swarbrick et al., 2008b). Id1 was required for tumour maintenance, as inactivation of the Id1 transgene in established tumours led to growth arrest followed by regression associated with widespread cellular senescence, which is essentially the irreversible loss of self- renewal and proliferative capacity (Swarbrick et al., 2008b). 35 Chapter 1. Introduction 1.3.6.2 The role of ID1/3 in cancer stem cell Emerging evidence has suggested that specific subpopulations of tumour cells, known as cancer stem cells (CSC), drive the tumourigenesis and metastasis of many tumours. These CSC in tumours are also described as tumour initiating cells for their ability to self-renew and to regenerate tumours which retain the heterogeneity of the original tumour (Visvader and Lindeman, 2012). The function of ID1/3 in cancer stem cells is best understood in colon cancer and malignant glioma. In colon cancer stem cells, John Dick and colleagues reported that the combined expression of ID1/3 increased both self-renewal and tumour initiation through cell-cycle restriction driven by the cell-cycle inhibitor p21 (O'Brien et al., 2012b). Silencing of ID1/3 led to a dramatic loss of tumour initiating potential. Though it seems counterintuitive that a cell cycle inhibitor would help maintain self renewal, the authors hypothesize that stabilization of p21, through attenuation of PTEN, prevents cells from undergoing aberrant cell cycle progression in response to DNA damage. The same study also showed that silencing of ID1/3 sensitized colon cancer-initiating cells to the chemotherapeutic agent oxaliplatin. A substantial amount of recent studies addressing the role of ID1/3 in self renewal has also come from work in the Glioblastoma field. High-grade gliomas are among the most lethal forms of solid cancers with significant cellular and genetic heterogeneity complicating treatment efforts. Interestingly, in a developmental context, previous work had already identified that high levels of Id1 identify type B adult neuronal stem cells and ID1/3 were required to maintain the self-renewal capacity of this population (Nam and Benezra, 2009). A recent work by Anido and colleagues (Anido et al., 2010) showed that Glioma-Initiating cells (GICs) are enriched for co-expression of ID1 and CD44. Co-expression of ID1 and CD44 predicts poor prognosis in GBM. Using a mouse model of GBM, they observed that TGF-β inhibitors prevented GBM growth via regulation of ID1/3, providing a mechanistic insight into how ID1 could be regulating the CSC phenotype. Further in vitro studies support a role for ID1/3 in GIC biology as pharmacological inhibition of TGF-β or genetic ablation of ID1/3 reduces human High-grade glioma sphere formation and invasiveness in vitro. In another study, Niola and colleagues (Niola et al., 2013) 36 Chapter 1. Introduction tested the therapeutic impact of ID inactivation in high-grade gliomas by selective ablation of ID in tumour cells and after tumour initiation in a mouse model of human mesenchymal high-grade gliomas. They found that deletion of three IDs (ID1, ID2 and ID3) induced rapid release of GICs from the perivascular niche, followed by tumour regression. They found that the GIC displacement was mediated by derepression of Rap1gap and subsequent inhibition of RAP1, a master regulator of cell adhesion. They identified a signature module of 5 genes in the ID pathway, including RAP1GAP, which segregated 2 subgroups of glioma patients with markedly different clinical outcomes. Their study showed that ID activity is required for the maintenance of mesenchymal high-grade gliomas and suggested that pharmacological inactivation of Id proteins could serve as a therapeutic strategy for brain cancer. The studies highlighted above have suggested a role for ID1/3 in the maintenance of the CSC phenotype. Although the mechanistic details remain to be determined, these studies identify self-renewal pathways controlled by ID1/3 as potential targets for the development of therapies to eradicate cancer- initiating cells. CSC behaviour has also been reported to be associated with the acquisition of EMT and a gain of mesenchymal properties. Whether ID1/3 have a role in regulating CSCs that are likely to play essential roles in the metastatic spread of primary tumours because of their self-renewal capability and their potential to give rise to differentiated progenies that can adapt to different target organ microenvironments, as well as the function of ID1/3 in cancer stem cell adhesion to the niche represent interesting subjection for future investigation. 1.3.6.3 ID1/3 in cancer metastasis 1.3.6.3.1 Expression of ID1/3 is associated with poor prognosis and metastatic replase A growing body of evidence has pointed to a role for ID1/3 in the metastatic progression of cancer. Research conducted over the past decade has indicated ID1/3 as potential prognostic markers whose expression levels in primary tumour are associated with propensity of patients to suffer metastatic relapse. As presented in Table 1-2, clinical data showed that high ID1/3 expression 37 Chapter 1. Introduction strongly correlates with aggressive clinical behaviour and poor patient outcome in many forms of cancer, which include breast (Gumireddy et al., 2009; Schoppmann et al., 2003a), prostate (Yuen et al., 2006), lung (Castanon et al., 2013; Pillai et al., 2011), ovarian (Schindl et al., 2003; Takai et al., 2001), cervical (Schindl et al., 2001), gastric (Han et al., 2004; Iwatsuki et al., 2009), colon (Zhao et al., 2008), oral (Dong et al., 2010), bladder (Ding et al., 2006) and esophageal cancer (Luo et al., 2012). The expression of ID1 has been shown to be associated with tumour stage, tumour recurrence and progression to metastatic disease in different studies. ID1 is a strong predictor of progression to lymph node metastasis in breast, colon and gastric cancer (Gumireddy et al., 2009; Iwatsuki et al., 2009; Zhao et al., 2008). ID1 is highly expressed in infiltrating human breast cancer specimens (Lin et al., 2000a), in which patients with high ID1 expression had a significant shorter overall and disease-free survival compared to patients with absent or low ID1 expression (Schoppmann et al., 2003a). Although early studies using commercially available polyclonal antibodies described broad overexpression of ID1 protein in a majority of human primary breast tumours, data from studies using a newly developed highly specific monoclonal antibody showed that the expression of ID1 is not nearly as widespread (Perk et al., 2006a). Rare ID1-expressing cells have been found in the triple-negative subset (Gupta et al., 2007) but not in other groups of breast cancer. In addition, ID1 expression is enriched in clinically obtained hormone receptor negative lung metastases (Gupta et al., 2007) compared to patient-matched primary breast tumours. However, there has been some dispute on the validity and reliability of ID1 polyclonal antibody (Catalogue SC-488, Santa Cruz Biotechnology, Santa Cruz, CA, USA) used in most of the previous studies. Although the same antibody was used in the studies, significant batch-to-batch variability has been observed with this antibody (de Candia et al., 2004a; Perk et al., 2006a). 1.3.6.3.2 ID1/3 as mediators of cancer cell migration and invasion As described earlier, the tumour invasion-metastasis cascade is a multistep process which involves dissemination of cancer cells into distant organ sites and their subsequent adaptation to foreign tissue microenvironments. Many of the stages in tumour invasion require degradation of the extracellular matrix 38 Chapter 1. Introduction (ECM) (Valastyan and Weinberg, 2011). Matrix metalloproteinases (MMPs) represent a major protein family which regulates remodelling of the ECM, degradation of the basement membrane and stromal cell layers, allowing the infiltration of the cancer cells during tumour invasion (Egeblad and Werb, 2002). Overexpression of MMPs has been well documented to be involved in tumour initiation, invasion and metastasis. Several studies have shown that ID1/3 play a role in regulating MMPs (Figure 1-6B). Desprez et al. (Desprez et al., 1998) reported that during the involution of the mammary gland, constitutive expression of ID1 results in upregulation of a novel MMP protein and directly correlated with mobility and invasiveness of breast cancer cells. Breast cancer cells transfected with ID1 dissociate and invade the basement membrane and resume proliferation (Desprez et al., 1998). High expression of ID1 also induces an increased secretion of MMP-2 in prostate cancer (Coppe et al., 2004) and MMP-9 in leukemia (Nieborowska-Skorska et al., 2006). Furthermore, Fong et al. (Fong et al., 2003) showed that targeting ID1 by RNAi in the human breast cancer cell line MDA-MB-231 reduces cell invasion and that the expression of the matrix metalloproteinase MT1-MMP is decreased when ID1 is downregulated, representing a potential mechanism for the reduction of invasiveness. As mentioned earlier, emerging evidence indicates that activation of the epithelial-to-mesenchymal transition (EMT) program is critical in regulating invasion and metastasis by inducing non-cancer stem cells to enter into a cancer stem cell-like state (Mani et al., 2008; Morel et al., 2008). As such, the EMT confers on epithelial cells a set of characteristics that empower them to disseminate from primary tumours and seed metastases (Thiery et al., 2009). ID1 has been implicated with EMT both directly through interaction with Cav-1 in prostate cancer cells (Zhang et al., 2007), induction of cadherin-switching in immortalized esophageal epithelial cells (Cheung et al., 2011), suppression of E-cadherin and ZO-1 in human kidney cells (Li et al., 2007b) and indirectly through loss of KLF17 (Gumireddy et al., 2009) and Cyclin D1 (Tobin et al., 2011) in breast cancer cells. Work by Tobin and colleagues showed that low Cyclin D1 and high ID1 expression can be linked to aggressive features in the claudin-low subgroup of breast cancer tumours, and at the same time, display increased expression of EMT markers and are associated with reduced recurrence free survival. 39 Chapter 1. Introduction 1.3.6.3.3 ID1/3 regulate metastatic colonization To investigate the transcriptional changes associated with metastatic dissemination, Minn and colleagues (Minn et al., 2005a) used the human breast cancer cell line MDA-MB-231 in a mouse xenograft model to select cell subpopulations that are highly metastatic to lung. Transcriptional profiling analysis revealed 95 genes differentially expressed by lung-tropic sublines. ID1 was identified as the sole transcription regulator in this gene expression signature that is associated with lung metastasis of human breast cancer. Functional studies by Minn and others now show that ID1 and ID3 are required for tumour initiating functions, both in primary tumour formation and during metastatic colonization of the distant organs (Fong et al., 2003; Gumireddy et al., 2009; Gupta et al., 2007; Minn et al., 2005a; Tsuchiya et al., 2005). Suppression of ID1 and ID3 resulted in a decreased number of peritoneal metastatic nodules and size of gastric tumours (Tsuchiya et al., 2005) and pancreatic tumour (Shuno et al., 2010). Using antisense oligonucleotide, Fong et al. (Fong et al., 2003) showed that targeting Id1 expression significantly reduces the invasive and metastatic spread of human and mouse metastatic breast cancer cells in both xenograft and syngeneic mouse model via a mechanism which is partly due to a decrease in the expression of MT1-MMP. Two other groups also reported that silencing Id1 and as well as Id3 expression inhibits primary tumour initiation and metastatic colonization of the lungs in animal models of human breast cancer (Gupta et al., 2007; Minn et al., 2005a). Related to this function, our group demonstrated that Id1 cooperates with oncogenic h-Ras in transformation of mammary epithelia to generate highly metastatic breast cancers in animal model (Swarbrick et al., 2008a). Id1 was required for breast tumour maintenance as inactivation of the Id1 transgene in established tumours led to growth arrest followed by regression associated with widespread cellular senescence (Swarbrick et al., 2008b). In vivo characterization of lung metastatic progression from a separate study revealed that ID1/3 facilitated sustained cells proliferation during the stage of metastatic colonization, subsequent to extravasation into the parenchyma of lung tissue (Gupta et al., 2007). A recent study by Stankic and colleagues (Stankic et al., 2013) supported the finding by Gupta and colleagues and proposed a mechanism by which ID1 regulate breast cancer lung metastatic colonization. 40 Chapter 1. Introduction Stankic and colleagues showed that under the control of TGF-β signaling, ID1 mediates epithelial-mesenchymal plasticity. ID1 expression is associated with an epithelial phenotype in breast cancer lung metastases (Stankic et al., 2013). ID1 induces a mesenchymal to epithelial transition (MET) at the metastatic site by antagonizing the activity of Twist, a bHLH transcription factor, but not at the primary site, where this state is controlled by the zinc finger protein Snail1. The observation by Stankic et al has also shed light on a possible role of ID1 in regulating the dynamic interactions among epithelial and mesenchymal gene programs, and strengthened the concept that the reversal of EMT is necessary for efficient metastatic colonization (Brabletz, 2012a). Overall, these studies described above provided evidence that ID1/3 may play a critical role in the initial survival of the disseminated cancer cells in the lung microenvironment in order to form micrometastases, as well as promote micrometastatic outgrowth from dormancy at the metastatic site. Whether ID1/3 have a role in organ-specific function during lung metastasis of breast cancer, and the mechanisms of how they mediate metastatic dormancy and reinitiate proliferative programs to generate neoplastic growth at the metastatic sites represent exciting subjects of future investigation. Nonetheless, the study from Gupta and Stankic (Gupta et al., 2007; Stankic et al., 2013) sheds light on the proliferative mechanisms that initiate metastatic colonization, and also implicates ID1/3 as mediators of the malignant function and potential therapeutic targets in the triple-negative subgroup of breast cancer. In principle, suppression of any of the steps in the metastatic process, from the initial dissemination of primary tumour cells into the circulation, to the final stage of the metastatic outgrowth in the distant organs, can offer therapeutic value (Chambers et al., 2002). However clinically, cancer cells can disseminate from a tumour very early in the life of a tumour. Therefore, targeting early steps in metastasis, which may have already occurred at the time of diagnosis, is less likely to be effective. On other hand, the later steps of the metastatic cascade offer more promising targets for therapy. The fact that ID1/3 are required in vivo for the sustained proliferative activity of metastatic tumour cells during tumour reinitiation and colonization suggests that both genes and their associated 41 Chapter 1. Introduction pathways are promising therapeutic targets that can inhibit the growth of metastases, the main determinant of metastatic outcome. 1.3.6.4 ID1/3 as regulators of angiogenesis As discussed earlier, a large body of evidence exists for cell-autonomous functions in metastasis. However, recent evidence from multiple groups suggests that tumours can remodel the microenvironment in distant sites prior to colonisation to adapt the demands imposed by host tissues (Psaila and Lyden, 2009). The disseminated tumour cells can utilize both cell-autonomous and cell-nonautonomous mechanisms in order to convert foreign microenvironments into more hospitable niches to escape dormancy and to begin active proliferation. Although the cell-autonomous effect of IDs in tumourigenesis has been shown, currently it is not clear if IDs regulate the metastatic site at a distance before colonization, either directly via interaction of tumour cells with the stroma or indirectly via regulation of mediators, and whether expression of IDs in the primary tumour and/or the disseminated cancer cells is required for metastatic success. However, a recent study by Gao et al. (Gao et al., 2008) pointed to a role of Id1 in this context. Using mouse models of pulmonary metastasis, they showed that recruitment of bone marrow derived endothelial progenitor cells (EPCs) to the early pre-metastatic niche mediates the angiogenic switch and enables progression to macrometastases. Id1 was identified in their study as an important mediator of EPCs to prime the lungs for metastatic engraftment of the tumour cells. They showed that tumours induce expression of Id1 in the EPCs. Suppression of Id1 after metastatic colonization blocked EPC mobilization, caused angiogenesis inhibition, impaired pulmonary macrometastases, and increased survival of tumour- bearing mice. A separate study by Ruzinova and colleague demonstrated that loss of Id results in disruption of vasculature and impaired angiogenesis. Loss of Id1 in tumour endothelial cells causes downregulation of several proangiogenic genes (Ruzinova et al., 2003). Consistent with the notion above, two earlier studies using Id1/3 KO mice demonstrated that expression of both genes is required for normal angiogenesis during embryogenesis as well as tumour-associated angiogenesis 42 Chapter 1. Introduction during metastatic progression (Lyden et al., 1999; Volpert et al., 2002). For instance, loss of capillary branching and haemorrhage were observed in the brain of Id1/3 double KO mouse embryo. When tumour xenografts were implanted into these mutant mice, impaired tumour growth and loss of metastasis were observed as a result of loss of vascular integrity of the tumour (Lyden et al., 1999). In this same study, Lyden and colleague also found that a downregulation of both proangiogenic factor VEGF and its receptor in endothelial cells of the Id1/3 double KO mice, indicating a possible link between Ids and VEGF. A separate study by Lyden (Lyden et al., 2001a) subsequently showed that VEGF in the circulation leads to a dramatic upregulation of Id1 and Id3 proteins in the bone marrow, presumably in bone marrow-derived EPCs which results in their mobilization into the circulation. Volpert and colleagues (Volpert et al., 2002) obtained a similar observation when using Id1 KO mice. Mechanistically, they showed that a potent angiogenic inhibitor, thrombospondin (TSP1), was a target of Id1 repression in vivo and a potent mediator of Id1-associated effects on angiogenesis. Interestingly, a recent study suggested the existence of a perivascular niche in which lung-metastatic breast cancer cell dormancy is enforced by the expression of TSP1 by endothelial cells (Ghajar et al., 2013). This leads me to speculate that ID1 signaling in activated endothelial cells may be responsible for the suppression of TSP1, permitting cancer cell escape from metastatic dormancy (Figure 1-7). Furthermore, a recent study has strengthened the role of ID1/3 in regulating angiogenesis (Jin et al., 2011). In this study, ID3 was shown to play a role in the expression of pro-angiogenic factors by neoplastic cells. ID3 promote tumour angiogenesis via secretion of IL8 and CXCL1 by glioma, which may support tumour growth via the promotion of vessel remodelling and reinforcement of the cancer niche (Jin et al., 2011) (Figure 1-6B and Figure 1-7). 43 Chapter 1. Introduction Figure 1-7 A proposed model of ID1/3 in regulating metastatic dormancy and angiogenesis. Control of endothelial cells by ID1 plays an important role in angiogenesis- mediated growth of lung metastases. Endothelial cells express TSP1 which enforces quiescence of disseminated breast cancer cells in the lung. ID1/3 are expressed in both the cancer cell and the endothelial cell. ID1 expression in the cancer cells or the endothelial cells activates the expression of pro-angiogenic factors CXCL1 and IL8 to drive endothelial activation and sprouting. Activated or sprouting endothelial cells downregulate TSP1 and instead express TGF-β which promotes the escape of disseminated tumour cells from dormancy. Endothelial progenitor cells can also support angiogenesis by the expression of VEGF. Endothelial activation can be further promoted by the recruitment from the bone marrow to nascent metastatic sites of ID1 expressing endothelial progenitor cells, which require ID1 for mobilization and proliferation. 44 Chapter 1. Introduction 1.3.7 ID1/3 as potential therapeutic targets in cancer As discussed earlier, ID1/3 have been shown to mediate cell autonomous programs which allow disseminated cancer cells to adapt to the demands imposed by foreign tissues. Targeting ID1/3 in primary tumours and the disseminated cells is sufficient to reduce metastatic spread in animal models (Anido et al., 2010; Fong et al., 2003; Gupta et al., 2007; Minn et al., 2005a; Niola et al., 2013; O'Brien et al., 2012a). Expression of Id1/3 is also required for the formation of a supportive pre-metastatic niche as well as angiogenesis and neovascularization (Gao et al., 2008; Lyden et al., 1999; Volpert et al., 2002). Hence, targeting ID1/3 expression and their associated pathways in tumour cells and endothelial cells from bone marrow and tumour blood vessels will disrupt both cell-autonomous and cell-nonautonomous programs, which may eventually produce additive or even synergistic antitumour effects. Moreover, the fact that ID1/3 are expressed at low levels in most normal adult tissues but are reactivated in cancer cells and their supporting vasculature may indicate low toxicity of such a targeted therapy. While protein-protein interactions that involve nuclear proteins are notoriously difficult to inhibit with small molecule inhibitors. Several groups have used a variety of alternative methods to disrupt ID proteins in cancer cells. For example, Henke and colleagues (Henke et al., 2008) fused an Id1 antisense oligonucleotide with a peptide to develop an antitumour agent that downregulated Id1 in tumour endothelial cells in vivo. They showed that systemic delivery of this drug led to inhibition of primary tumour growth and metastasis in vivo, similar to the observation in previous studies using Id1 KO mice. Several other groups have targeted ID1 expression rather than function. Anido and colleagues showed that treatment of mice bearing glioblastoma multiforme with small molecule inhibitiors of TGF-β receptor known to downregulate Id1 and Id3, led to reduced tumour initiation and tumour growth (Anido et al., 2010). Another study utilized a small molecule called cannabidiol to downregulate Id1 in a mouse model of high grade glioma, leading to marked inhibition of tumour growth in vivo (Soroceanu et al., 2013). Similarly, Mistry and colleagues demonstrated that small molecule inhibitors of the ubiquitin specific protease USP1 promote degradation of ID1 and inhibition of acute myeloid leukemia cell line growth and survival in vitro and in vivo (Mistry et al., 2013). 45 Chapter 1. Introduction 1.4 Outline of thesis Overall, multiple lines of evidence show that ID proteins play a key role in the progression of breast cancer. ID1 is expressed in the aggressive basal subtype of breast cancer and several groups including our laboratory have previously demonstrated that ID1/3 are required and sufficient for metastasis of breast cancer in mouse models. However, the mechanisms by which ID1/3 mediate metastasis in breast cancer remain unclear. Little is known about pathways regulated by ID1/3 in breast cancer and their functional role during metastatic progression. To date, the role of ID1/3 and their binding partners and genome- wide transcriptional targets in breast cancer are still not known. As described previously, experiments performed on normal tissue and several cancers indicate that ID1/3 play regulate important cellular pathways that are implicated in cancer development and progression. However, many studies suggest that the function of ID1/3 is tissue specific. This prevents us from implying the functions of ID1/3 in breast cancer, in particular the triple-negative breast cancer from studies performed on other cell types. The oncogenic function of ID1/3 may involve multiple signalling pathways in different types of cancers by regulating different targets that are still poorly understood. The overall aim of this thesis is to better understand the role of ID1/3 in breast cancer, more specifically, to explore the role of ID1/3 and their transcriptional targets that mediate their function in breast cancer. This was achieved through the use of a range of in vitro and in vivo techniques. The specific aims of the three results chapters are: 1. Examine ID1/3 expression profiles in breast cancer patients. 2. Establish a model of inducible, stable Id1/3 knockdown system to study the function of Id1/3 in the different steps of metastatic cascade in a mouse model of breast cancer. 3. Determine the pathways regulated by ID1/3 and also their transcriptional targets. 46 Chapter 1. Introduction 4. Examine the requirement of Id1/3 in controlling mammary tumour growth and metastasis by conditional knockdown of Id1/3 expression during tumour progression. 47 Chapter 2. Materials and Methods Chapter 2. Materials and Methods 2.1 Buffers and media Medium/Buffer Composition Preparation and storage FACS buffer PBS plus salts (Life Freshly made, Technologies, Mulgrave, Vic, Australia) chilled before use 2%FBS (Thermo Fisher Scientific, Scoresby, Vic, Australia) 2%HEPES (Gibco, Grand Island, NY, USA) o 4T1 cell culture RPMI 1640 (Gibco, Grand 4 C medium Island, NY, USA) 10% (v/v) FBS (Thermo Fisher Scientific, Scoresby, Vic, Australia) 20mM HEPES (Gibco, Grand Island, NY, USA) 1mM sodium pyruvate (Gibco, Grand Island, NY, USA) o HEK293T cell culture DMEM (Gibco, Grand Island, 4 C medium NY, USA) 10% (v/v) FBS (Thermo Fisher Scientific, Scoresby, Vic, Australia) 6mM glutamine (Gibco, Grand Island, NY, USA) 1mM sodium pyruvate (Gibco, Grand Island, NY, USA) 1% (v/v) MEM non-essential amino acids (Gibco, Grand Island, NY, USA) Annealing buffer 10mM Tris Room temperature pH 7.5–8.0 50mM NaCl 1mM EDTA o RIPA lysis buffer 50mM Tris-HCl pH 7.4 4 C 1% NP-40 0.5% Sodium Deoxycholate 0.1% SDS 48 Chapter 2. Materials and Methods 1% Glycerol 137.5mM NaCl 5mM EDTA Tris buffered saline 100mM Tris-Cl pH7.8, Room temperature (TBS) 1mM EDTA TBS-Tween (TBST) TBS Room temperature 0.1% Tween 20 (USB Corporation, Cleveland, OH, USA) Tris acetate EDTA 20 mM Tris Room temperature (TAE) buffer 0.11% Glacial Acetic acid 0.2% EDTA Luria Bertani (LB) 1% (w/v) tryptone Room temperature medium 0.5% (w/v) yeast extract 171 mM NaCl Super Optimal broth 0.5% (w/v) yeast extract Room temperature with catabolite 2% (w/v) tryptone repression (SOC) 10 mM NaCl media 2.5 mM KCl 10 mM MgCl2 10 mM MgSO4 20% (w/v) glucose 2.2 Molecular Cloning 2.2.1 Plasmids and siRNAs The plasmids used in these studies are described in Table 2-1. Construct Antibiotic Insert Backbone Obtained from selection pEN_TmiRc3 Gentamycin - pENTR1A-Gent American Type Culture Collection (ATCC) (Manassas, VA,USA) pSLIK-Venus- Ampicillin Id1 shRNA pSLIK –Tet inducible Constructed in this TmiR-shId1 sequence- miR30 based shRNA study GGGACCTG backbone, upstream CAGCTGGA of a constitutive rtTA GCTGAA IRES and Venus 49 Chapter 2. Materials and Methods fluorescent protein cassette. pSLIK-Neo- Ampicillin Id3 shRNA pSLIK –Tet inducible Constructed in this TmiR-shId3 sequence- miR30 based shRNA study ATGGATGA backbone, upstream GCTTCGAT of a constitutive rtTA CTTAA IRES and Neo cassette. pLV4301G- Ampicillin Enhanced pLV 3rd generation Brian Rabinovich (The enhanced luciferase- lentiviral vector University of Texas luciferase- IRES-murine M.D. Anderson Thy1.1 Thy1.1 Cancer Center, Houston, TX, USA) pLV4301G- Ampicillin Enhanced pLV 3rd generation Brian Rabinovich (The enhanced luciferase- lentiviral vector University of Texas luciferase- IRES-EGFP M.D. Anderson EGFP Cancer Center, Houston, TX, USA) pMDLg/pRRE, Ampicillin - 3rd generation Addgene (Cambridge, pRSV-Rev, lentiviral packaging MA, USA). pMD2.G vectors pLKO.1- Ampicillin Non- pLKO.1 3rd Sigma-Aldrich hPGK-Puro- targeting generation lentiviral (Lismore, NSW, Non-Targeting shRNA vector Australia) sequence pLKO.1- Ampicillin Non- pLKO.1 3rd Sigma-Aldrich hPGK-Neo- targeting generation lentiviral (Lismore, NSW, Non-Targeting shRNA vector Australia) sequence pLKO.1- Ampicillin Id1 shRNA pLKO.1 3rd Sigma-Aldrich hPGK-Puro- sequence- generation lentiviral (Lismore, NSW, shId1#1 CCGGGCAG vector Australia) CATGTAAT CGACTACA TCTCGAGA TGTAGTCG ATTACATG CTGCTTTTT G pLKO.1- Ampicillin Id1 shRNA pLKO.1 3rd Sigma-Aldrich 50 Chapter 2. Materials and Methods hPGK-Puro- sequence- generation lentiviral (Lismore, NSW, shId1#2 CCGGCGGC vector Australia) TGCTACTC ACGCCTCA ACTCGAGT TGAGGCGT GAGTAGCA GCCGTTTT TG pLKO.1- Ampicillin Id1 shRNA pLKO.1 3rd Sigma-Aldrich hPGK-Puro- sequence- generation lentiviral (Lismore, NSW, shId1#3 CCGGGAGC vector Australia) TGAACTCG GAGTCTGA ACTCGAGT TCAGACTC CGAGTTCA GCTCTTTTT G pLKO.1- Ampicillin Id1 shRNA pLKO.1 3rd Sigma-Aldrich hPGK-Puro- sequence- generation lentiviral (Lismore, NSW, shId1#4 CCGGGTGA vector Australia) ACGTCCTG CTCTACGA CCTCGAGG TCGTAGAG CAGGACGT TCACTTTTT G pLKO.1- Ampicillin Id1 shRNA pLKO.1 3rd Sigma-Aldrich hPGK-Puro- sequence- generation lentiviral (Lismore, NSW, shId1#5 CCGGGGTA vector Australia) GAGGGTTT GATCAACA GCTCGAGC TGTTGATC AAACCCTC TACCTTTTT G pLKO.1- Ampicillin Id3 shRNA pLKO.1 3rd Sigma-Aldrich 51 Chapter 2. Materials and Methods hPGK-Neo- sequence- generation lentiviral (Lismore, NSW, shId3#1 CCGGGCAG vector Australia) CGTGTCAT AGACTACA TCTCGAGA TGTAGTCT ATGACACG CTGCTTTTT G pLKO.1- Ampicillin Id3 shRNA pLKO.1 3rd Sigma-Aldrich hPGK-Neo- sequence- generation lentiviral (Lismore, NSW, shId3#2 CCGGTCTT vector Australia) AGCCTCTT GGACGACA TCTCGAGA TGTCGTCC AAGAGGCT AAGATTTTT G pLKO.1- Ampicillin Id3 shRNA pLKO.1 3rd Sigma-Aldrich hPGK-Neo- sequence- generation lentiviral (Lismore, NSW, shId3#3 CCGGGCTG vector Australia) AGCTCACT CCGGAACT TCTCGAGA AGTTCCGG AGTGAGCT CAGCTTTTT G pLKO.1- Ampicillin Id3 shRNA pLKO.1 3rd Sigma-Aldrich hPGK-Neo- sequence- generation lentiviral (Lismore, NSW, shId3#4 CCGGGAAA vector Australia) TCCTGCAG CGTGTCAT ACTCGAGT ATGACACG CTGCAGGA TTTCTTTTT G pLKO.1- Ampicillin Id3 shRNA pLKO.1 3rd Sigma-Aldrich 52 Chapter 2. Materials and Methods hPGK-Neo- sequence- generation lentiviral (Lismore, NSW, shId3#5 CCGGATGG vector Australia) ATGAGCTT CGATCTTA ACTCGAGT TAAGATCG AAGCTCAT CCATTTTTT G Table 2-1 Summary of plasmids used in this study. 2.2.2 Entry vector construction 2.2.2.1 Generation of shRNA linker The shRNA linkers were designed as described in Shin et al 2006 (Shin et al., 2006). Single stranded cDNA sequences of mouse Id1 and Id3 shRNAs were purchased from Sigma-Aldrich (Lismore, NSW, Australia). The Id1 shRNA sequence which targets 5’-GGGACCTGCAGCTGGAGCTGAA-3’ has been validated in a previous study (Gao et al., 2008). The Id3 sequence was adopted from Gupta et al 2007 (Gupta et al., 2007) and targets 5’- ATGGATGAGCTTCGATCTTAA-3’. The cDNA oligonucleotides were resuspended to 50µM with annealing buffer. 25µL of each sense and antisense oligonucleotides were mixed in a 1.5mL Eppendorf tube and incubated at 95°C for 5min, followed by a quick transfer into a 70°C water bath and incubated for another 10min. The water bath was then turned off to allow the temperature to drop gradually to facilitate effective annealing of oligonucleotides overnight. The tube was removed the next morning and briefly spun. The annealed oligonucleotides were stored at -20 °C for future use or on ice for immediate use. The shRNA linker was designed such that, after annealing of two complementary oligonucleotides, the linker had double-stranded DNA sequences at both ends that were compatible with BfuAI restriction sites, which allowed the cloning of the linker into the pEN_TmiRc3 entry plasmid ( refer to Figure 3-4 in Chapter 3). 53 Chapter 2. Materials and Methods 2.2.2.2 Generation of entry vectors pEN_TmiRc3 parental entry plasmid was obtained from the ATCC (Manassas, VA,USA). Entry vector pEN_TmiR_Id1 and pEN_TmiR_Id3 were constructed as described (Shin et al., 2006). The double-stranded Id1 or Id3 shRNA linker was cloned into pEN_TmiRc3 entry vector using the BfuAI restriction sites to create pEN_TmiR_Id1 or pEN_TmiR_Id3. Briefly, the pEN_TmiRc3 was first digested with endonuclease BfuA1 (New England Biolabs, Arundel, Qld, Australia), to allow the excision of ccdB toxic gene from the vector. Digestion reaction was carried out in a final volume of 50μl consisted of 6.25 units of BfuA1, 5μl of NEBuffer 3 and 5μg of pEN_TmiRc3 plasmid DNA. The linearised vector was gel purified using the Wizard®SVGel and PCR clean-up system (Promega, Alexandria, NSW, Australia) according to manufacturer’s protocol before use in the ligation reaction. Ligation was performed using T4 DNA ligase (New England Biolabs, Arundel, Qld, Australia). The ligation mixture was made up in a final volume of 15µL consisted of 160ng of linearised pEN_TmiRc3 plasmids, 4µL of annealed oligonucleotides, l.5µL of 10x T4 DNA ligase reaction buffer (New England Biolabs, Arundel, Qld, Australia) and 400 units of T4 DNA ligase. The ligation reaction was incubated overnight at 16°C. 2.2.3 Expression vector construction pSLIK-Venus and pSLIK-Neo destination vectors were obtained from the ATCC (Manassas, VA,USA). Id1 and Id3 shRNA expressing pSLIK lentiviral vectors, namely pSLIK-Venus-TmiR-shId1 and pSLIK-Neo-TmiR-shId1, were generated by Gateway recombination between the pEN_TmiR_Id1 or the pEN_TmiR_Id3 entry vector and the pSLIK-Venus or pSLIK-Neo destination vector (ATCC, Manassas, VA, USA) respectively. The Gateway recombination was performed using the LR reaction according to the manufacturer’s protocol (Invitrogen, Mulgrave, Vic, Australia). 2.2.4 Agarose gel electrophoresis Digested plasmid DNA was separated by 1-1.5% (w/v) agarose (Quantum Scientific, Murarrie, Qld, Australia) / TAE gels. Gel Red (Biotium, Hayward, CA, USA) was added directly to the cooled molten agarose at 0.05µL/mL. DNA samples were mixed with 6x DNA loading dye (Promega, Alexandria, NSW, 54 Chapter 2. Materials and Methods Australia) and electrophoresed at 100-170mA in 1x TAE buffer until separation was achieved. The bands were visualised under UV light using a Molecular Imager ChemiDoc XRS System (Bio-Rad, Gladesville, NSW, Australia). 2.2.5 Transformation of bacterial cells with plasmid DNA Commercially available chemically competent Escherichia coli DH5α cells (Invitrogen, Mulgrave, Vic, Australia) were used for transformation of entry vectors. Briefly, the bacteria were thawed on ice for 5min prior to transformation. 5µg of ligation reaction was added into 50µL of competent cells and incubated on ice for 30min. Cells were then heat-shocked at 42°C for 25s and placed on ice for 2min. 500µL of SOC medium was added into the transformation mixture, and incubated for 1hr at 37°C in a shaking incubator (200rpm). Following transformation, cells were pelleted 4000rpm for 1min. 400µL the supernatant was discarded, and cells were resuspended in the remaining supernatant and streaked on LB agar plates containing 15µg/mL of Gentamicin. The plates were incubated overnight at 37°C. Transformation of lentiviral expression vectors were carried out in the same condition as described above, except Escherichia coli Stbl3 strain (Invitrogen, Mulgrave, Vic, Australia) was used to minimize occurrence of plasmid recombination. In addition, amplicillin (100µg/mL) instead of gentamicin, was used to select positive colonies containing expression vectors. 2.2.6 Miniprep preparation of plasmid DNA Escherichia coli colonies containing plasmid DNA were picked with sterile pipette tips and cultured in 3mL of LB medium containing the appropriate antibiotic in 15ml polypropylene tubes at 37°C overnight in a shaking incubator at 220rpm. Cells were pelleted at 6000rpm for 2min. Plasmid DNA was isolated using the Wizard®Plus SV miniprep kit (Promega, Alexandria, NSW, Australia) as per the manufacturer's protocol. 2.2.7 Maxiprep preparation of plasmid DNA Escherichia coli colonies were first picked and grown in 3ml of LB medium supplemented with the appropriate antibiotic in 15mL polypropylene tubes at 37°C for 8-12hr in a shaking incubator (220rpm). 1mL of the bacterial culture 55 Chapter 2. Materials and Methods from each polypropylene tube was then used to inoculate 250mL of LB medium supplemented with appropriate antibiotic in a larger 1L bacterial culture flask. The cells were grown at 37°C overnight in a shaking incubator (220rpm), and pelleted the next day at 5500rpm for 15min at 4°C. Plasmids were extracted using the Qiagen QIAfilter plasmid maxi kit (Qiagen, Doncaster, Vic, Australia) following instructions from the manufacturer. 2.2.8 Plasmid DNA sequencing Both the entry vectors and the pSLIK expression vectors constructed were verified by sequencing. BigDye Terminator v3.1 cycle sequencing reactions were set up in a final volume of 20µL with 200ng of plasmid DNA, 3.2pmol of sequencing primer (Sigma-Aldrich, Lismore, NSW, Australia) (Table 2-2), 1.5µL of 5x sequencing buffer, 1.7µL of betaine (a DNA relaxing agent) and 1µL of BigDye v3.1 reaction mix (Applied Biosystems/Life Technologies, Scoresby, Vic, Australia) in 8-tube PCR strips. The reactions were carried out in a thermocycler under the following conditions: (96°C for 1min) x 1 cycle; (96°C for 10s, 50°C for 5s, 60°C for 4min) x 40 cycles; hold at 10°C. The reaction mixtures were then sent for clean-up and automated sequencing at the Australian Cancer Research Foundation (ACRF) Unit for the Molecular Genetics of Cancer (The Garvan Institute of Medical Research), using the ABI PRISM® 3100 Genetic Analyser (Applied Biosystems/Life Technologies, Scoresby, Vic, Australia). Sequences were analysed and aligned using the BioEdit v7.0.5 software available free of charge online. Primer name Sequence (5’ to 3’) Application (plasmid sequenced) F1pENpSLIK ATA GAA GAC ACC GGG ACC GAT pEN_TmiR_Id1 CCA G pEN_TmiR_Id3 pSLIK-Venus-TmiR-Id1 pSLIK-Neo-TmiR-Id3 R1pENpSLIK GCT CCT AAA GTA GCC CCT TGA pEN_TmiR_Id1 ATT C pEN_TmiR_Id3 pSLIK-Venus-TmiR-Id1 pSLIK-Neo-TmiR-Id3 Table 2-2 Primers used in plasmid sequencing. 56 Chapter 2. Materials and Methods 2.3 Tissue culture 2.3.1 Mammalian cell culture The cell lines 4T1 and HEK293T used in this study were obtained from the American Type Culture Collection (ATCC). The composition of cell culture media is described in Section 2.1. All cell lines were cultured at 37°C in 5% CO2 and 95% air to no more than 80% confluence. Cells were passaged by washing with PBS (Life Technologies, Mulgrave, Vic, Australia) twice and trypsinised with Trypsin-EDTA (0.025%) (Life Technologies, Mulgrave, Vic, Australia), followed by incubation at 37°C until the cells were detached from the tissue culture flask. An equal or greater volume of culture medium was added to neutralise the Trypsin-EDTA. Appropriate volume of cell suspension was then added into a new tissue culture flask for passaging. 2.3.2 Cryopreservation All cell lines were preserved by cryopreservation. Each cryovial contained 1x106 cells and were frozen in a solution consisting of 50% (v/v) foetal bovine serum (FBS) (Thermo Fisher Scientific, Scoresby, Vic, Australia), 40% (v/v) growth media, and 10% (v/v) DMSO (Sigma-Aldrich, Lismore, NSW, Australia) to -80°C at a rate of 1°C/min using a “Mr Frosty” (Thermo Fisher Scientific, Scoresby, Vic, Australia) for a minimum of 4hr before transferring to liquid nitrogen vapour phase storage. Cells were revived by warming individual cryovials to 37°C and seeding into 30mL of culture medium in a T75 tissue culture flask. 2.3.3 Microscopic imaging Cells on tissue culture plates were magnified with an inverted epifluorescence microscope (Carl Zeiss, ICM-405, Oberkochen, Germany), under both high and low magnification. Images were captured by the Leica DFC280 digital camera system (Leica Microsystems, Wetzlar, Germany). 57 Chapter 2. Materials and Methods 2.4 Production of lentivirus and viral infection of cell lines 2.4.1 Lentivirus production Lentiviral supernatant was produced by transfecting each lentiviral expression vector along with third-generation lentiviral packaging and pseudotyping plasmids (Dull et al., 1998) into the packaging cell line HEK293T. Briefly, 1.4 x 106 of HEK293T cells were seeded in 4mL of culture medium in a 60mm tissue culture dish, such that the cells were at around 80% confluence at the next day for transfection. 3µg of expression plasmid was co-transfected with lentiviral packaging and pseudotyping plasmids (2.25µg of pMDLg/pRRE, 2.25µg of pRSV-REV and 1.5µg of pMD2.G) in a 6cm tissue culture dish, using Lipofectamine 2000 (Invitrogen, Mulgrave, Vic, Australia) according to manufacturer’s protocol. pMDLg/pRRE is a lentiviral packaging plasmid which encodes for proteins that are essential for viral replication and assembly, such as the Pol protein and the viral structural protein Gag. pRSV-REV codes Rev protein which facilitates export of the RNA from the nucleus. pMD2.G is responsible for envelope production. The transfected cells were grown at 37°C in an incubator supplemented with 5% CO2 and 95% air. The cell culture medium was replaced after 24hr. The viral supernatant was collected 48hr after transfection and filtered using a 0.45µm filter. The filtered lentiviral supernant was concentrated 20-fold by using Amicon Ultra-4 filter units (100 kDa NMWL) (Millipore, North Ryde, NSW, Australia). The lentiviral supernatant was used for infection immediately or stored at -80°C for later use. 2.4.2 Infection of mammalian cell lines 4T1 cells were plated at low density (1.0 x 105 cells in each well of 6-well tissue culture plates) one day prior to infection. The next day cell culture medium was replaced with culture medium containing 8µg/mL of polybrene (Sigma-Aldrich, Lismore, NSW, Australia). The 4T1 cells were infected overnight with the concentrated virus at a 1:5 dilution. The cell culture medium was changed 24hr after infection. The infected cells were grown until reaching confluence and then expanded in larger tissue culture dishes. Cells that were transduced with pLV4311-IRES-Thy1.1 were stained with anti-Thy1.1-APC antibodies and then 58 Chapter 2. Materials and Methods sorted on FACS Vantage SE Cell Sorter (BD Biosciences, San Jose, CA, USA) for expression of Thy1.1. pSLIK-Venus-TmiR-Id1 transduced 4T1 cells were sorted on FACS Vantage SE Cell Sorter (BD Biosciences, San Jose, CA, USA) using Venus as a marker. pSLIK-Neo-TmiR-Id3 transduced cells were selected by neomycin at 400µg/mL for 5 days. 2.5 Flow cytometry 2.5.1 Cell staining for flow cytometry The pLV4311-IRES-Thy1.1 transduced cells were trypsinised, neutralised, washed twice with FACS buffer (PBS + 1% FCS, HEPES) to prepare for antibody incubation. The cell were then counted, 3.0 x 106 cells were taken and resuspended in 600µL of FACS buffer. The anti-Thy1.1-APC antibody (BD Biosciences, San Jose, CA, USA) was added into the cell suspension at a 1:300 dilution and incubated for 30min. After the incubation, the cells were washed twice and resuspended in FACS buffer. Prodium Iodide or DAPI (1:1000) was added before sorting to identify live or dead cells. 2.5.2 Cell sorting and flow cytometry analysis Cell sorting and flow cytometry analyses were performed at the Garvan Institute Flow Cytometry Facility. Cell sorting of the Thy1.1 expressing cells was performed by the facility technician, Miss Nikki Alling, on the FACS Vantage SE Cell Sorter (BD Biosciences, San Jose, CA, USA) following cell staining as described above. For Venus expressing cells, flow cytometry analysis of Venus expression was done on a BD FACSCanto I (BD Biosciences, San Jose, CA, USA). Briefly, 4T1 cells were trypsinised and neutralised with culture medium. Cells were passaged through a 30μm nylon mesh to remove clumps. Cells were then analysed for Venus expression levels on the BD FACSCanto I. Isolation of a pure population of Venus expressing cells was carried out on a FACS Vantage SE Cell Sorter. All flow cytometry data was analysed using FlowJo software version 8 (Tree Star Inc., Ashland, OR, USA). 59 Chapter 2. Materials and Methods 2.6 In vitro functional assays 2.6.1 MTS assay The MTS (3-(4,5-dimethylthiazol-2-yl)-5-(3- carboxymethoxyphenyl)-2-(4- sulfophenyl)-2H-tetrazolium) assay is a colorimetric assay used to assess the viability and proliferation of cells in vitro. The assay utilizes the ability of metabolically active cells to metabolize the MTS compound into a soluble formazan dye, the levels of which are directly proportional to the number of viable cells in culture. To set up the MTS assay, 100L of 4T1 cell suspension was plated into 96-well tissue culture plates at a seeding density of 500 cells/well. Six replicates were set up for each tested condition. At various chosen experimental time points viable cells were quantified with the Cell Titre 96 Aqueous Non-Radioactive Cell Proliferation Assay (Promega, Alexandria, NSW, Australia) according to the manufacturer’s instructions. 20L of MTS/phenazine methosulfate (PMS) solution was added into each well of the cell culture and incubated at 37oC for 2 hours. Proliferation was assessed by measuring the absorbance at 490-500 nm relative to that of control wells (without cells), using a Fluostar (BMG Labtech, Ortenburg, Germany) plate reader. 2.6.2 Cell proliferation assay by the IncuCyte Kinetic Imaging System 4T1 cells were seeded into 24-well plates at a density of 3.0 x 104 cells/well. Cells were allowed to plate down for 2hr, and then loaded into the IncuCyte Live Cell Imaging System (Essen Bioscience, Ann Arbor, MI, USA). Cell proliferation was assessed and recorded for 4 days. Briefly, cells were cultured at conditions of 37°C, 5% CO2 and 95% air inside the IncuCyte system, while images of cells inside each well (3 images per well) were captured every 2 hours. Proliferation was measured at each time-point as a percentage of confluence, as determined by the IncuCyte software based on automated analysis of captured images. 2.6.3 Tumoursphere assay 4T1 cells were trypsinised and washed twice with PBS (Life Technologies, Mulgrave, Vic, Australia). Cells were then resuspended in RPMI1640 medium 60 Chapter 2. Materials and Methods without FBS and sieved through a 40μM cell strainer (BD Biosciences, Franklin lakes, NJ, USA) twice to ensure at least 95-99% of cells were in single cell suspension before being counted on the haemocytometer. Single cells were plated in ultralow attachment 6-well plates (Corning Incorporated, Clayton, Vic, Australia) at a density of 2.0 x 104 viable cells/well in triplicate. Cells were cultured in serum-free RPMI1640 medium, supplemented with B27 (Life Technologies, Mulgrave, Vic, Australia) and 20ng/mL bFGF (Millipore, North Ryde, NSW, Australia), and 4μg/mL heparin (Sigma-Aldrich, Lismore, NSW, Australia). Serum-free media supplemented with the additives mentioned above was added to the cells every 3 days. The plate was tapped very gently to ensure even distribution of the cells. Primary tumourspheres were counted at day 10. 2.7 RNA methods 2.7.1 RNA extraction, quantitation and integrity estimation Total RNA was extracted by using the Qiagen RNeasy minikit (Qiagen, Doncaster, Vic, Australia) according to manufacturer’s protocol. RNA was eluted in nuclease free water (Promega, Alexandria, NSW, Australia). RNA concentration and purity were analysed using the NanoDrop® ND-1000 Spectrophotometer (Nano-Drop Technologies, Wilmington, DE, USA). The ratio of A260/A280 was used to determine the purity of RNA. A ratio of more than 1.8 indicated that the RNA was free from protein contamination. For microarray analysis, the integrity of RNA was analysed using the Agilent Bioanalyser 2100 6000 Nano Assay (Agilent Technologies, Palo Alto, CA, USA) according to the manufacturer’s instructions. RNA used for transcript profiling had minimum quality requirements of: A260/280 ≥ 1.8, A260/230 ≥ 1.8, RNA integrity number (RIN) ≥ 8. 2.7.2 Microarray analysis RNA samples were sent to the Ramaciotti Centre for Gene Function Analysis (The University of New South Wales) for expression profiling using the Affymetrix GeneChip® Gene 1.0 ST Array, a whole-transcript array which 61 Chapter 2. Materials and Methods covers >28000 coding transcripts and >7000 non-coding long intergenic non- coding transcripts. cDNA synthesis, probe labelling, hybridization, scanning and data processing were all conducted by the the Ramaciotti Centre for Gene Function Analysis. Data analysis was performed using the Genepattern software package from the Broad Institute. Key steps are summarised as follow: Briefly, data was stored on the caArray microarray data management system (https://array.nci.nih.gov/caarray/home.action). Data from each array was normalised using the NormalizeaffymetrixST module in the GenePattern software package (http://pwbc.garvan.unsw.edu.au/gp/pages/login.jsf). Data from the two experimental conditions were then combined and analysed using the LIMMA module within GenePattern (http://bioinf.wehi.edu.au/limma/). This included determination of the fold change between samples as well as measures of the statistical robustness of these analyses, including t-tests. Three different modules, HierarichicalClusteringViewer, ComparativeMarkerSelectionViewer and HeatmapViewer were used to visualise the data. In addition to identifying candidate molecules and pathways of interest, Gene Set Enrichment Analysis (GSEA) (http://www.broadinstitute.org/gsea) (Subramanian et al., 2005) was performed using the GSEAPreranked module. Briefly, GSEA compares differentially regulated genes in an expression profiling dataset with curated and experimentally determined sets of genes in the MSigDB database to determine if certain sets of genes are statistically over-represented in the expression profiling data. The details of GSEA analysis was further discussed in Chapter 4. 2.7.3 cDNA synthesis cDNA was synthesised from 0.5-1µg of RNA using the Superscript® III first- strand synthesis system (Invitrogen, Mulgrave, Vic, Australia) using oligo-dT primers and following the manufacturer’s protocol. Synthesised cDNA was stored at -20°C for later use or on ice for immediate use. 2.7.4 Quantitative real-time PCR Quantitative real-time PCR was carried out using either the TaqMan probe- based system (Applied Biosystems/Life Technologies, Scoresby, Vic, Australia) on the ABI Prism 7900HT Sequence Detection System (Applied 62 Chapter 2. Materials and Methods Biosystems/Life Technologies, Scoresby, Vic, Australia) or the Universal ProbeLibrary (UPL) probes (Roche, Basel, Switzerland) on the Lightcycler 480 system (Roche, Basel, Switzerland), according to manufacturer’s instructions. Both TaqMan gene expression master mix and TaqMan gene expression assays were purchased from Applied Biosystems/Life Technologies. UPL probes were purchased by the Australian Cancer Research Foundation (ACRF) Unit for the Molecular Genetics of Cancer (The Garvan Institute of Medical Research) from Roche and are supplied to Garvan researchers. Primers used in the Lightcycler 480 system were purchased from Sigma-Aldrich (Lismore, NSW, Australia). TaqMan gene expression assays and UPL primers used in this study are listed in Table 2-3. For Taqman assay, briefly, each reaction was carried out in triplicate using a mixture of 9µL diluted cDNA, 10µL of TaqMan gene expression master mix and 1µL of TaqMan gene expression assay. Reactions were performed in 384 well plates. Reaction mixtures were dispensed onto 384 well plates by using the Eppendorf epMotion 5070 robotic workstation (Eppendorf, AG, Germany). Amplification was carried out using standard TaqMan gene expression assay conditions for 40 cycles. For UPL assay, each reaction was carried out in triplicate using a mixture of 5µL Roche FastStart TaqMan Probe Master mixture, 0.1µL forward primer (20µM), 0.1µL reverse primer (20µM), 0.2µL UPL probe, 0.4µL of diluted cDNA and 0.6µL nuclease free water. Reaction mixtures were dispensed onto 384 well plates by using the Eppendorf epMotion 5070 robot. Amplification was carried out using a Lightcycler 480 reaction condition as follows: 1 cycle at 94oC for 7 minutes, followed by 40 cycles of 94oC for 15 seconds, 60oC for 30 seconds, 72oC for 15 seconds, and a final cooling step of 1 cycle at 40oC for 30 seconds. The relative mRNA expression level was obtained by using the ΔΔCt method (Schefe et al., 2006). The expression of Gapdh or Actb was used as an endogenous internal control for normalisation. The change in Ct value (ΔCt) in each replicate was obtained by subtracting the Ct value of the internal control from the Ct value of the gene of interest, which is illustrated by the equation below. ΔCt = CtGene of interest – CtInternal control This ΔCt was obtained for each replicate and the mean was calculated from triplicate samples from each experiment. Subsequently the change in ΔCt for 63 Chapter 2. Materials and Methods each replicate was derived by subtracting the mean ΔCt negative control group from the mean ΔCt experimental group as shown below. ΔΔCt = Mean ΔCt experimental group – Mean ΔCt negative control group The fold difference was obtained by applying this formula Fold difference = 2-ΔΔCt Gene TaqMan gene expression assay ID Mouse Id1 Mm00775963_g1 Mouse Id3 Mm01188138_g1 Mouse Tgfbr3 Mm00803538_m1 Mouse Pdgfc Mm00480205_m Mouse Fermt1 Mm01270148_m1 Mouse Foxc2 Mm00546194_s1 Mouse Tnc Mm00495662_m1 Mouse Cxcl1 Mm04207460_m1 Mouse Angptl4 Mm00480431_m1 Mouse Il6 Mm00446190_m1 Mouse Postn Mm00450111_m1 Mouse Ccl5 Mm01302427_m1 Mouse Robo1 Mm00803879_m1 Mouse Sparc Mm00486332_m1 Mouse Vcam1 Mm01320970_m1 Mouse Zeb2 Mm00497193_m1 Mouse Src Mm00436785_m1 Mouse Cdh1 Mm01247357_m1 Mouse Vim Mm01333430_m1 Mouse Twist1 Mm04208233_g1 Mouse Snai1 Mm00441533_g1 Mouse Smad3 Mm01170760_m1 Mouse Bmi1 Mm03053308_g1 Mouse Gapdh Mm99999915_g1 Mouse Actb Mm00607939_s1 Gene Primer used in the Lightcycler 480 system Forward: cttcagcactttcttccgaga Mouse Irf7 Reverse: tgtagtgtggtgacccttgc Forward: gagaggacccagtgttcctg Mouse Irf 9 Reverse: ggtgagcagcagcgagtagt 64 Chapter 2. Materials and Methods Forward: aaatgtgaaggatcaagtcatgtg Mouse Stat1 Reverse: catcttgtaattcttctagggtcttga Forward: ggaacagctggaacagtggt Mouse Stat2 Reverse: gtagctgccgaaggtgga Table 2-3 Taqman gene expression assays and UPL primers used in quantitative real-time PCR 2.8 Protein methods 2.8.1 Extracting protein lysates Protein lysates were obtained by direct lysis from the tissue culture plates. Cells were washed once with chilled PBS (Life Technologies, Mulgrave, Vic, Australia) before adding ice cold RIPA lysis buffer supplemented with complete ULTRA protease inhibitor cocktail tablets (Roche, Basel, Switzerland) to inhibit protein degradation. The cell lysate was then transferred to 1.5mL tubes. All steps above were performed on ice. The cell lysates were then centrifuged at 14000rpm for 10min, 4°C. The supernatants were transferred to new 1.5mL tubes and were stored at -80°C for later use or on ice for immediate use. 2.8.2 Quantifying protein concentration The protein concentration of each sample was measured by using a BCA assay using the micro bicinchoninic acid (BCA) kit (Pierce, Rockford, IL, USA) following the manufacturer’s instructions. The assay was performed in a clear- bottomed flat surface 96-well plate. Briefly, the BSA (2mg/ml) was serially diluted in distilled water to generate a dilution range of: 0.2µg/µL to 1.4µg/µL. Protein lysate was diluted 1 in 10 with distilled water. The BCA reagents were then mixed (50:1 Part A:Part B) and 200ul was added to each well. The plate was then incubated at 37°C for 30min, followed by a measurement of absorbance at 560nm using the FLUOstar OPTIMA plate reader. The protein concentration of each sample was calculated by using a bovine serum albumin standard curve. 65 Chapter 2. Materials and Methods 2.8.3 Sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS- PAGE) SDS was performed by using the NuPAGE system (Invitrogen, Mulgrave, Vic, Australia). 15-30µg of protein from each sample was made up in 1x NuPAGE LDS sample buffer and 1x NuPAGE reducing agent up to 20µL and denatured at 70°C for 10min. The denatured protein samples were loaded onto NuPAGE pre-cast polyacrylamide gels. Gels consisted of a 4% acrylamide stacking gel and a 4-12% acrylamide gradient separating gel. Electrophoresis was performed for 35min at 200V in 1x NuPAGE SDS running buffer. 2.8.4 Protein transfer and immunoblotting Following electrophoresis, proteins were transferred onto PVDF membranes (Millipore, North Ryde, NSW, Australia) at 30V for 1hr in 1x NuPAGE transfer buffer (Invitrogen, Mulgrave, Vic, Australia). The PVDF membranes were blocked in a solution containing 5% (w/v) skim milk powder and 0.1% TBS- tween for 1hr at room temperature. After blocking, the membranes were washed five times in TBS-tween (5min each time). The primary antibodies were diluted in an antibody diluting solution containing 5% (w/v) BSA, 0.025% (w/v) sodium azide, and 0.5-2% (v/v) phenol red in 1% (v/v) TBS. The washed membranes were incubated with primary antibody solutions at concentration as per Table 2-4 for 1hr at room temperature or overnight at 4°C. Following primary antibody incubation, the membranes were washed four times ( 15min each time). The secondary antibodies used were anti-rabbit IgG or anti-mouse IgG conjugated with horseradish peroxidise (HRP). Membranes were incubated in secondary antibodies at a concentration of 1:8000 in 5% (w/v) skim milk/TBS- tween buffer for 1hr at room temperature. Excess secondary antibody was washed in TBS-tween four times (15min each time). Specific protein bands were detected by ECL chemiluminesence (Perkin-Elmer, Rowville, Vic, Australia). Densitometry was performed using Quantity One software (Bio-Rad, Gladesville, NSW, Australia). 66 Chapter 2. Materials and Methods Antibody Manufacturer Catalogue # Concentration Rabbit anti-mouse Id1 BioCheck BCH-1/37-2 1:500 (primary) (Burlingame, CA, USA) Rabbit anti-human/mouse BioCheck BCH-4/#17-3 1:500 Id3 (Burlingame, CA, USA) (primary) Rabbit anti-Smad3 (C67H9) Cell Signaling 9523 1:1000 Rabbit anti-Phospho-Smad3 Cell Signaling 9520 1:1000 (Ser423/425) (C25A9) Rabbit-anti-E-Cadherin Cell Signaling 3195 1:1000 (24E10) Mouse anti- β-actin AbCam Ab6276 1:4000 (primary) (Cambridge, UK) Horse anti-mouse IgG-HRP Cell Signaling 7054 1:8000 (secondary) (Beverly, MA, USA) Goat anti-rabbit IgG-HRP Cell Signaling 7054 1:5000 (secondary) (Beverly, MA, USA) Table 2-4 Antibodies used in the Western blot analysis 2.9 In vivo studies 2.9.1 Mice All experiments involving animal work were performed in accordance with the rules and regulations stated by the Garvan Institute Animal Ethics Committee. The BALB/c mice were sourced from the Australian BioResources Ltd. (Moss Vale, NSW, Australia). Doxycycline (Dox) food, which contains 700mg Dox/kg, was manufactured by Gordon’s Specialty Stock Feed (Yanderra, NSW, Australia) and fed to the mice during studies involving Dox-induced switch-off of Id1/3. 2.9.2 Surgical procedure for primary tumour progression and spontaneous metastasis assay 4T1 cells were suspended at 7.0x105 cells/mL in PBS containing magnesium and calcium salts (Life Technologies, Mulgrave, Vic, Australia). Six-week old BALB/c mice were used in the orthotopic transplantation. First, the mice were anaesthetised using isofluorane (Baxter, Deerfield, IL, USA) anaesthetic 67 Chapter 2. Materials and Methods machine, set on 5 for induction and 3 for maintenance. Anaesthesia was checked by a foot pad pinch. Topical bupivacaine (8mg/kg) (AstraZenica, London, UK), and subcutaneous ketoprofen (5mg/kg) (Parnell, Sydney, Australia) were also used for analgesia. A small incision of 1–2cm was cut through the skin from the midline up to the base of the ribcage, taking care not to penetrate the peritoneum. A second incision (1 cm) was made from the base of the midline towards the left hind leg. The skin flap is then peeled back and pinned down to expose the 4th mammary gland. 10l of cell suspension was then injected into the mammary gland by using a Hamilton syringe. Autoclip 9mm wound clips (BD Primary Care Diagnostics, Sparks, MD, USA) were used to close skin flaps. Mice were then allowed to recover on a heat pad. Wound clips were removed 14 days after surgery. Mice were weighed and imaged weekly. Palpable tumours were measured with vernier calipers twice a week. The mice were harvested at ethical end point which was determined by having a tumour which is greater than 1cm3 in size or a deterioration of body condition score represented by the physical appearance of the mouse such as having difficulty to breathe and a loss of body weight by greater than 20% since last monitoring. Primary tumour was collected. A cross section of the tumour was placed in 10% neutral buffered formalin (Australian biostain, Traralgon, VIC, Australia). In addition, 3 cryovials containing 5-10 small 1mm3 pieces of tumour were snap frozen in liquid nitrogen and subsequently stored at -80oC. Besides primary tumour, various organs including the lungs, liver, lymph node, spleen, pancreas and brain were also harvested and visually examined for metastatic lesions and foci and the number of metastatic lesions was recorded. The lung and brain were also examined under the LEICA MZ16 FA fluorescence microscope (Leica Microsystems, Wetzlar, Germany) to detect and quantify the presence of any metastatic lesions, which express the Venus fluorescent protein. Organs with detectable metastases were collected and fixed with 10% formalin overnight at 4oC, similar to the fixation procedure for primary tumours, and then transferred to 70% ethanol and stored at 4oC until further processing for standard histopathology evaluation. 68 Chapter 2. Materials and Methods 2.9.3 Surgical procedure for experimental metastasis assay 4T1 cells were suspended at 3.75x104 cells/mL in PBS containing magnesium and calcium salts (Life Technologies, Mulgrave, Vic, Australia). Six-week old BALB/c mice received 200l of cell suspension by tail vein injection. Following injection, mice were intraperitoneally injected with 200μL of 30% D-luciferin (Xenogen, Hopkinton, MA, USA) diluted from 10mg/mL in PBS with salts (Life Technologies, Mulgrave, Vic, Australia), anesthetized with isoflurane and were imaged from ventral and dorsal views using the IVIS Imaging System 200 Biophotonic Imager (Xenogen, Alameda, CA, USA). Metastatic development and growth were monitored twice weekly by in vivo bioluminescent imaging until they reached ethical end point, which was determined by a deterioration of body condition score represented by the physical appearance of the mouse such as having difficulty to breathe and a loss of body weight by greater than 20% since last monitoring. Autopsy was performed at the ethical end point. Before euthanasia, 200μL of 30% D-luciferin (Xenogen, Hopkinton, MA, USA) diluted from 10mg/mL in PBS with salts (Life Technologies, Mulgrave, Vic, Australia) was intraperitoneally injected into the mice. Various organs including the lungs, liver, lymph node, spleen, pancreas and brain, were excised from the mice and placed in 6-well plates with PBS with salts. Bioluminescence was measured by ex vivo imaging. Organs were then carefully examined for any visible metastases. Number of metastases was quantified and recorded. Selected organs with metastases were fixed with 10% formalin and histopathology was performed. 2.9.4 In vivo and ex vivo imaging The 4T1 cells were lentivirally modified with the pLV4311-IRES-Thy1.1 vector, a luciferase expressing vector (a kind gift from Dr Brian Rabinovich, The University of Texas M.D. Anderson Cancer Center, Houston, TX, USA). Mice which received the transplanted cells developed tumours and metastases that expressed luciferase. Mice were monitored using the IVIS Imaging System 200 Biophotonic Imager (Xenogen, Alameda, CA, USA) using Living Image 3.1 software (Xenogen, Alameda, CA, USA). Animals were imaged twice weekly. Briefly mice were first injected intraperitoneally with 200μL of 30% D-luciferin (Xenogen, Hopkinton, MA, USA) diluted from 10mg/mL in PBS with salts (Life 69 Chapter 2. Materials and Methods Technologies, Mulgrave, Vic, Australia). Mice were anaesthetised and placed onto the warmed stage inside the imager with continuous exposure to isoflurane. Three to six mice were imaged at a time. Bioluminescent intensity was analysed and quantified using the Image Math feature in Living Image 3.1 software (Xenogen, Alameda, CA, USA). Bioluminescence is expressed as photons/sec/ROI (region of interest) minus background bioluminescence for a similarly sized region. For ex vivo imaging, 200μL of 30% D-luciferin was injected into the mice just before autopsy. Tissues of interest were collected, placed into 6-well tissue culture plates in PBS, and imaged for 1–2min. 2.10 Histological protocols 2.10.1 Tissue processing and paraffin embedding Tissue samples were transferred to tissue processing and embedding cassettes (Simport, Beloeil, QC, Canada), fixed in 10% formalin (Australian biostain, Traralgon, VIC, Australia) overnight at 4oC. Formalin was replaced with 70% ethanol on the next day and the cassettes were stored at 4oC. Tissue processing was performed by the Garvan Institute Histology Facility by Ms Alice Boulghourjian and Ms Anaiis Zaratzian. Paraffin embedding was done at Sydpath (St Vincent’s pathology, Sydney, NSW, Australia). The formalin-fixed, paraffin-embedded (FFPE) tissue blocks were cut in 4μm-thick sections on a microtome with a disposable blade and mounted on coated clean glass slides. 2.10.2 Immunohistochemistry Id1 and Id3 protein expression was assessed on paraffin-embedded tissue samples using antibodies listed in Table 2-5. Briefly, antigen retrieval was carried out using DAKO antigen retrieval solution s1699 (Glostrup, Denmark) in a pressure cooker. IHC was performed by using the DAKO Autostainer. First, slides were rinsed with DAKO wash buffer, followed by incubation with DAKO peroxide blocking solution for 5min. The slides were then rinsed again and incubated with DAKO protein blocking solution for 30min. Primary antibody was diluted in antibody diluent (1% BSA in TBS). Primary and secondary antibody conditions are summarised in Table 2-5. The diluted antibody was then 70 Chapter 2. Materials and Methods dispensed on the slide. Depending on the size of the section, generally 100- 300uL of antibody was used on one slide in order to cover the whole section. The slides were then incubated at room temperature in a humidified chamber for required time. Following that, slides were rinsed and incubated with the secondary antibody. Slides were then rinsed again and incubated with DAKO DAB+ reagent for 10min and then rinsed in water. Counterstaining was performed on the slides with haematoxylin for 2min for human tissue and for 20- 30 seconds for mouse tissue. Slides were then dehydrated through graded alcohols (70%, 95% and 100%), cleared in xylene, and mounted using Ultramount #4 (Fronine, Riverstone, NSW, Australia). Sections were also stained with hematoxylin (Thermo Fisher Scientific, Scoresby, Vic, Australia) and eosin (Sigma-Aldrich, Lismore, NSW, Australia). Briefly, slides were incubated at 65oC for 5min in an oven and with xylene for 5min. This is then followed by incubation with 100% Ethanol twice for 2min each time, 95% ethanol for 1min, 70% ethanol for 1min and finally in water for 1min. Slides were then incubated in haematoxylin for 2min for human tissue or 1min for mouse tissue and rinsed in excess water until the water runs clear. Following that, slides were incubated in 1% acid alcohol for 10 seconds and placed under running water for 1min, followed by incubation in 70% ethanol for 1min, 95% ethanol for 1min and two quick dips in eosin. Slides were then placed in 95% ethanol twice, 30 seconds for the first time and 1min for the second time. Finally slides were dehydrated in 100% ethanol twice for 2 minutes each time and allowed to dry, before being cover slipped using Ultramount #4 (Fronine, Riverstone, NSW, Australia). 71 Chapter 2. Materials and Methods Antigen Manufacturer and Antigen Antibody Secondary clone/catalogue retrieval dilution and detection number incubation time Human Id1 BioCheck 5min 1:50, 60 min Envision Rabbit (Burlingame, CA, USA) 30 min BCH 1/195-14 Mouse Id1 BioCheck 5min 1:50, 90 min Envision Rabbit (Burlingame, CA, USA) 30 min BCH-1/37-2 Mouse Id3 BioCheck 1min 1:50, 60 min Envision Rabbit (Burlingame, CA, USA) 30 min BCH-4/#17-3 Table 2-5 Immunohistochemistry conditions. 72 Chapter 3. Id1 and Id3 knockdown in a model of triple-negative breast cancer Chapter 3. Id1 and Id3 knockdown in a model of triple- negative breast cancer 3.1 Introduction Within the large class of HLH-domain proteins, higher organisms possess four ID-family proteins (ID1-ID4). While IDs lack the DNA binding domain required for transcriptional activity, they bind and inactivate other helix-loop-helix transcription factors that are required for differentiation. Many of these transcription factors are lineage- and tissue-specific, which include the E proteins (mediate haematopoetic differentiation), NeuroD (neuronal), MyoD (myoblast), Ets1/2 and Pax family members (Coppe et al., 2003). Therefore the functions of ID proteins depend on the suite of transcription factors expressed in the cell of interest. Depending on the specific transcription factors expressed in a particular cell type, the response to modulation of ID protein expression will be different. This prevents us from implying the functions of ID1/3 in breast cancer from studies performed on other cell types. The oncogenic function of ID1/3 may involve multiple signalling pathways in different types of cancers by regulating different targets that largely remain poorly understood. To date, the role of ID1/3 and its binding partners and genome-wide transcriptional targets in breast cancer are not well understood. At the time I initiated this study, there were very few studies conducted to investigate ID1/3 target genes mediating the aggressive phenotypes of metastatic breast cancer both in vitro and in vivo. Most of these studies focused on a small number of candidate genes (Fong et al., 2003; Qian et al., 2010; Swarbrick et al., 2005; Swarbrick et al., 2008b; Tobin et al., 2011). As described in the introduction, multiple lines of evidence show that ID1/3 play a multifaceted role in the progression of breast cancer. ID1 is endogenously expressed in a wide range of solid tumours, including a majority of advanced breast cancers and breast cancer cell lines. ID1 is highly expressed in the aggressive triple-negative breast cancer and contribute to the malignant phenotypes of this disease (Fong et al., 2003; Gupta et al., 2007). Importantly, ID1 expression is a strong independent predictor of progression to metastatic disease and death in breast cancer (Schoppmann et al., 2003b). Previous work 73 Chapter 3. Id1 and Id3 knockdown in a model of triple-negative breast cancer in our laboratory has shown that Id1 cooperates with oncogenic h-Ras in transformation of mammary epithelia to generate highly metastatic breast cancers (Swarbrick et al., 2008a). Other groups have reported targeting ID1 reduces the metastatic capacity of human breast cancer cell lines in xenografts models (Fong et al., 2003; Gupta et al., 2007; Minn et al., 2005a), but the mechanism by which ID1/3 mediates metastasis in breast cancer remains largely unknown. The first part of my PhD project was undertaken to investigate functions of Id1/3 in controlling the aggressive phenotype of breast cancer and genes that are regulated by Id1/3 in metastatic breast cancer, with an aim to identify molecular pathways that regulate breast cancer metastasis. I then used a loss-of-function approach to identify potential target genes of Id1/3. The approach involved expression profiling with RNA from aggressive mouse breast cancer cells depleted of Id1/3 expression by RNA interference (RNAi) ‘knockdown’. I performed a double knockdown of both Id1 and Id3 as opposed to Id1 or Id3. Id3 represents an Id family member that is most closely related to Id1, based on genetic studies documenting functional overlap in mouse development (Lyden et al., 1999). Only crosses between mice that lack different Id genes are embryonic lethal. Mice with a combinations of double knockouts of Id1 and Id3 (Id1−/− Id3−/−) are non-viable and die before birth (Lyden et al., 1999). However, Id1+/− Id3−/− mice are viable owing to the presence of a single Id1 allele (Lyden et al., 1999). In cancer, highly significant coexpression of Id1 and Id3 was observed in human breast cancer (Gupta et al., 2007). Knockdown of both Id1 and Id3 are required for inhibition of cancer metastasis (Gupta et al., 2007). Both Id1 and Id3 have also been demonstrated to control the cancer stem cell phenotype in glioma and colon cancer (Anido et al., 2010; Niola et al., 2013; O'Brien et al., 2012a) Subsequent functional study described in this thesis showed that knockdown of both Id1 and Id3 causes a higher inhibition of cell proliferation compared to Id1 single knockdown. In this chapter, I described my studies characterising ID1 protein expression in different subtypes of breast cancer. In addition, I developed a cell model for loss of function studies of Id1/3 in breast cancer using a murine metastatic triple- 74 Chapter 3. Id1 and Id3 knockdown in a model of triple-negative breast cancer negative breast cancer cell line, the 4T1 cell line. I examined the phenotype that results from Id1/3 knockdown in the 4T1 cells. In my subsequent chapters, I used this system to discover the transcriptional targets of Id1/3 in 4T1 cells, as well as determining the function and mechanism of Id1/3 in regulating breast cancer metastasis in animal models. 3.1.1 The 4T1 tumour cell model A major hindrance to the study of metastasis has been the lack of suitable models that accurately recapitulate the metastatic process in vivo and allows us to address fundamental mechanisms of metastatic progression in human disease. Several approaches have been used to model metastasis in vivo. Xenograft models in which human tumour cells or tissues are transplanted into immunocompromised animals have been used extensively for the study of tumour growth and metastasis. While some human xenograft models can approximate primary tumour growth in mice, replication of the metastatic process is often problematic (Bibby, 2004; Eccles et al., 1994; Hoffman, 1999). Human tumour cells generally metastasize poorly in mice and when metastasis does occur, unexpected metastatic characteristics are often observed. It has also been reported that human xenograft models fail to recapitulate the heterogeneity of a spontaneous tumour (Kelly et al., 2007). Furthermore, in order for human tumours to grow in mice the murine host must be immunocompromised to prevent immune rejection. This eliminates the ability to examine the role of the immune system (Quail and Joyce, 2013) in tumour progression in xenograft models. In contrast, syngeneic murine models, in which tumours derived from murine cancer cell lines or tissues in inbred animals of the same genetic background, often metastasize more effectively and display metastatic characteristics more similar to those observed in cancer patients (Vernon et al., 2007). The advantage of syngeneic models is that the transplanted murine cancer cells or tissues, the tumour microenvironment, and the host are from the same species. This is particularly important when considering the importance of microenvironment and tumour-host interactions in the process of metastasis (De Wever and Mareel, 2003). 75 Chapter 3. Id1 and Id3 knockdown in a model of triple-negative breast cancer A desirable syngeneic mouse model for the study of metastasis is a transgenic model in which a tumour develops as a result of the increased expression of an active oncogene or through the repression of a tumour suppressor gene. In these genetically engineered mouse models, the initial stages of transformation and tumorigenesis can be faithfully reproduced. Metastases arise spontaneously from a pre-existing transgenic, transplantable primary tumour in these animals. However, a major drawback of using transgenic models is the long latency for tumourigenesis and metastatic disease, which can range from several months to years (Hutchinson and Muller, 2000). Due to this reason, we decided to use a transplantable murine tumour cell model in this study. Although transplantable models bypass the initial oncogenic conversion into a growing neoplasm, they have some major advantages for studying metastatic disease. They can, depending on the cell line, recapitulate clinically relevant spontaneous metastases and also allow genetic modification of the tumour cell line ex vivo before assessment in vivo (Eckhardt et al., 2012). The 4T1 mammary carcinoma cell line was originally isolated by Fred Miller and colleagues (Miller, 1983; Miller et al., 1983). The cell line was derived from a spontaneous arising BALB/c mammary tumour. Following orthotopic transplantation, the 4T1 cells have a high propensity to spontaneously metastasize to distant sites often affected in aggressive human breast cancer including bone, lung, brain, liver and other sites (Aslakson and Miller, 1992; Eckhardt et al., 2005; Lelekakis et al., 1999; Pulaski and Ostrand-Rosenberg, 1998; Tao et al., 2008; Yoneda et al., 2000). Several 4T1 sibling cell lines have also been isolated and characterized with different metastatic properties. Some of these derivatives closely mimic the pathology of aggressive human breast cancer (Miller, 1983; Miller et al., 1983). Transplantation of these cells into syngeneic mice allows a rapid assessment of the contribution of host factors to metastatic propensity, and is more efficient than the conventional and time- consuming generation of transgenic tumour models. To understand the characteristics of several mouse models of breast cancer used in our laboratory, my co-supervisor Dr Radhika Nair and I, together with another member in our group (Mr Sunny Ye) recently collaborated with Dr 76 Chapter 3. Id1 and Id3 knockdown in a model of triple-negative breast cancer Charles Perou (The University of North Carolina, Chapel Hill, NC, USA) and Dr Jason Herschkowitz (Baylor College of Medicine, Houston, TX, USA) to investigate the gene expression patterns and copy number variations present in three tumour models, namely, the 4T1 model, the p53-null model (Kuperwasser et al., 2000) and a breast tumour model that is driven by overexpression of Her2 and c-Myc (Nair et al., 2013). Gene expression profiling revealed that the 4T1 tumours clustered with the Claudin-low subtype of the triple-negative breast cancer (Nair et al, unpublished data). The p53-null tumours and Her2/c-Myc tumours were also characterised as a Claudin-low model (Nair et al., 2013). This information provides insight into the relevance of these tumour systems in modelling human breast cancers. In this study, I will modify the 4T1 cell line for optimal use as a model to facilitate analysis of tumour growth and metastasis, and evaluation of the function of Id1/3 in breast cancer metastasis in both an in vitro and in vivo setting. I will genetically modify the parental 4T1 cell line to express high levels of firefly luciferase to allow non-invasive longitudinal imaging of in vivo tumour growth and metastasis. To discern the role of Id1/3 in breast cancer metastasis, I will take a loss-of-function approach by stably expressing inducible shRNAs targeting Id1/3 to investigate the effect of down regulation of Id1/3 expression in the 4T1 tumour model. 3.1.2 The pSLIK vector system In order to achieve a stable depletion of Id1/3 expression, a viral-based shRNA mediated gene silencing approach was used in this study. The viral-based shRNA system is a promising approach for long-term silencing gene expression for in vivo application (Manjunath et al., 2009). The model described in this study to downregulate Id1/3 in 4T1 cells was pSLIK, a single lentiviral vector system for inducible gene knockdown (Shin et al., 2006). The pSLIK platform permits tetracycline-regulated expression of microRNA-like shRNAs from a single viral infection of the cells. The tetracycline inducible gene expression is a method of controlling gene expression in which transcription is reversibly turned on or off in the presence of tetracycline or one of its derivatives such as doxycycline (Gossen and Bujard, 1992). 77 Chapter 3. Id1 and Id3 knockdown in a model of triple-negative breast cancer The pSLIK system/construct used in this study is a Tet-On system (Figure 3-1). Three pSLIK vectors were constructed in this chapter. Briefly, sequences encoding shRNA directed against Id1, Id3 or EGFP were integrated downstream of a Tetracycline Response Element (TRE) promoter. The TRE is made up of Tet operator (tetO) sequence concatemers, which makes it subject to activation by the reverse Tet-transactivator protein (rtTA3). The rtTA3 protein is expressed on the same plasmid, under the control of the constitutively active Ubi-C promoter. Activation is induced by treatment with doxycycline (Dox), which binds to rtTA3 activator and induces a conformational change that allows the rtTA3 protein to bind to the TRE promoter, permitting the expression of a shRNA as primary microRNA (miR) mimics (miR-shRNAs) by the RNA polymerase (pol) II. The miR-shRNA structures are subsequently processed by the cellular machinery of the cell into functional siRNA. The basic principles of pSLIK are outlined in Figure 3-1, while a more detailed description of its constituents can be found in the result section. The pSLIK system is a bi- cistronic lentiviral vector platform. The benefit of all the components required for the knockdown of a gene of interest being present on one plasmid is that only a single round of cell infection and selection is required. Therefore, pSLIK is more efficient than the standard 2-vector inducible models and increases the level of integrity of the resulting cell lines. 3.1.3 Chapter summary In this chapter, I first investigated the expression of ID1/3 in breast cancer subtypes. Our results from examining patient cohorts demonstrated that ID1 expression associates with the HER2-enriched and triple-negative subtypes of breast cancer. Following that, using a triple-negative breast cancer cell line, the 4T1 cells, I described the creation and validation of several stable inducible Id1/3 shRNA clonal cell lines through the use of the pSLIK vector system. This model was employed to observe the effect of downregulating endogenous Id1/3 in 4T1 cells in vitro. The data suggested that inhibition of Id1/3 in 4T1 cells results in a decrease in proliferation and self-renewal capacity of the cells. 78 Chapter 3. Id1 and Id3 knockdown in a model of triple-negative breast cancer Figure 3-1 Conditional knock down of Id1/3 using the pSLIK system. pSLIK is a single lentiviral vector platform for microRNA-based conditional RNA interference, which contains all of the elements required for stable inducible gene knockdown on one plasmid. These include a TRE promoter upstream of an shRNA sequence, a downstream Ubi-C promoter, which controls the constitutive expression of the reverse Tet transativator (rtTA3) protein, and a Venus maker or a neomycin (neo) resistance marker. The pSLIK-Venus/Neo vector has constitutive expression of a doxycycline-transactivating component and the selection markers Venus and Neo, and conditional expression of miR- shRNAs targeting Id1/3 under the presence of Dox. The constitutively expressed rtTA3 activator is capable of binding the TRE operator only if bound by Dox, allowing shRNAs to be expressed. LTR = long terminal repeat; IRES = internal ribsome entry site; WRE = Woodchuck Hepatitis Regulatory Element. 79 Chapter 3. Id1 and Id3 knockdown in a model of triple-negative breast cancer 3.1.4 Hypothesis ID1/3 functionally associate with hormone receptor-negative breast cancers, and that suppression of Id1/3 expression in a triple-negative breast cancer cell line affects the malignant phenotype of the cells. 3.1.5 Aims The specific aims of this chapter are to: 1. Determine the tissue expression of ID1/3 in different subtypes of human breast cancer. 2. Establish a cell model for loss of function studies of Id1/3 in vitro and in vivo. 3. Examine the phenotype that results from Id1/3 knockdown on the cell model. 80 Chapter 3. Id1 and Id3 knockdown in a model of triple-negative breast cancer 3.2 Results 3.2.1 ID1 is expressed in the triple-negative and HER2-enriched breast cancers Previous studies have demonstrated that ID1 is expressed in breast cancers that are hormone non-responsive and is strongly predictive of poor outcome in breast cancer (Gumireddy et al., 2009; Gupta et al., 2007; Minn et al., 2005a; Schoppmann et al., 2003b). However, there has been some dispute on the validity and reliability of ID1 polyclonal antibody (Catalogue SC-488, Santa Cruz Biotechnology, Santa Cruz, CA, USA) used in most of the previous studies. Although the same antibody was used in the studies, significant batch-to-batch variability has been observed with this antibody (de Candia et al., 2004a; Perk et al., 2006a). In this study, I examined the expression ID1 in human breast cancer using a recently available commercial monoclonal ID1 antibody (Nair et al., 2010; Perk et al., 2006a) To determine whether ID1 expression is associated with a particular subtype of breast cancer, we obtained paraffin sections of 44 human breast tumours sections, comprised of 10 ER+, 15 HER2-enriched, and 19 triple-negative breast cancers from the Australian Breast Cancer Tissue Bank (ABCTB). Using the recently available monoclonal ID1 antibody (Catalogue BCH-1/195-14-100, BioCheck, Burlingame, CA, USA), we analysed ID1 expression in this panel of human breast tumour tissues by immunohistochemistry. Strong nuclear ID1 expression in tumor epithelial cells was observed in a number of the breast cancer samples (Figure 3-2A). Quantitative evaluation of ID1 expression was done by using H score which took into account the percentage of ID1 positive tumor cells (identified morphologically) (0-100%) and the staining intensity (0- 3+) by Professor Sandra O’Toole (The University of Sydney and the Royal Prince Alfred Hospital) (Table. 3-1). We observed small patches of cells throughout the tumour positive for ID1 expression in hormone receptor negative disease (9/19 triple-negative cancers and 7/15 HER2-enriched cancers), but ID1 staining was only observed in 1 of 9 cases in the ER+ cancers (Table 3-1 and Figure 3-1). Gupta and colleagues have previously reported the presence 81 Chapter 3. Id1 and Id3 knockdown in a model of triple-negative breast cancer of ID1-expressing cells in the metaplastic triple-negative subset of human breast tumours (Gupta et al., 2007). My result confirms their finding, showing that ID1 protein expression was associated with the triple-negative disease, but also expands the expression of ID1 into the HER2-enriched subtype of breast cancer which has not been previously reported. I am currently examining the expression of ID3 in the same cohort of patients. Once the ID3 staining is completed, we will also correlate ID1/3 expression with clinical follow up data on this cohort of patients. Sample name Hormone receptor Percentage of cells Intensity H Score status positive 053 ER+ 0 0 0 008 ER+ 0 0 0 018 ER+ 0 0 0 063 ER+ 0 0 0 033 ER+ 2 1 2 032 ER+ 0 0 0 021 ER+ 0 0 0 014 ER+ 0 0 0 101 ER+ 0 0 0 015 ER+ 0 0 0 195-14 Triple-negative 2 1 2 08-013 Triple-negative 10 2 20 08-024 Triple-negative 0 0 0 08-059 Triple-negative 1 1 1 08-087 Triple-negative 0 0 0 07-034 Triple-negative 2 2 4 07-102 Triple-negative 5 1 5 07-109 Triple-negative 1 2 2 07-100 Triple-negative 0 0 0 07-057 Triple-negative 0 0 0 06-058 Triple-negative 0.5 1 0.5 06-026 Triple-negative 1 1 1 07-007 Triple-negative 0 0 0 07-115 Triple-negative 0 0 0 07-006 Triple-negative 0 0 0 82 Chapter 3. Id1 and Id3 knockdown in a model of triple-negative breast cancer 07-001 Triple-negative 2 2 4 08-018 Triple-negative 2 2 4 07-088 Triple-negative 0 0 0 07-060 Triple-negative 0 0 0 1 HER2-enriched 5 2 10 2 HER2-enriched 8 1 8 3 HER2-enriched 6 2 12 4 HER2-enriched 0 0 0 5 HER2-enriched 0 0 0 6 HER2-enriched 0 0 0 7 HER2-enriched 0 0 0 8 HER2-enriched 0 0 0 06-106 HER2-enriched 0 0 0 06-048 HER2-enriched 3 2 6 08-126 HER2-enriched 1 1 1 08-010 HER2-enriched 0 0 0 06-092 HER2-enriched 0 0 0 07-058 HER2-enriched 2 1 2 07-092 HER2-enriched 3 2 6 Table 3-1 Tabulated results of ID1 immunohistochemistry performed on a panel of human breast tumour tissues. H Score was obtained by multiplying the percentage of ID1 positive cells by the intensity. 83 Chapter 3. Id1 and Id3 knockdown in a model of triple-negative breast cancer Figure 3-2 ID1 is only expressed in the triple-negative and HER2-enriched breast cancer subtypes. (A) IHC staining for ID1 expression in a cohort of breast cancers. (B) Quantification of ID1 expression in ER+, triple-negative and HER2-enriched breast cancer. H score is determined by multiplying the percentage of positive tumour cells (identified morphologically) by the staining intensity (graded on a scale of 0, 1, 2, or 3). 84 Chapter 3. Id1 and Id3 knockdown in a model of triple-negative breast cancer 3.2.2 4T1 cells endogenously express Id1 and Id3 Having confirmed ID1 is expressed in the triple-negative and HER2-enriched breast cancer, we decided to use a mouse tumour cell line of triple-negative breast cancer, the 4T1 cell line, to investigate the function of Id1/3 in breast cancer metastasis. I first needed to confirm that this cell line expressed Id1 and Id3, in order to justify the use of 4T1 cell line as an appropriate model for studying Id1/3 in breast cancer biology,. Previous studies have reported expression of Id1 in the 4T1 cell line (Fong et al., 2003; Gumireddy et al., 2009). However, whether Id3 is expressed in 4T1 is not clear. Therefore, I performed western blot using cell lysate from the 4T1 and IHC on FFPE sections from cell pellets to analyse 4T1 cells for Id1/3 protein expression. My results showed that Id1/3 protein could easily be detected by both techniques (Figure 3-3). Quantification of the IHC staining showed that 15% of the cells express high level of Id1, and 35% have intermediate level of Id1 expression, whereas the expression of Id3 was found in all cells. 85 Chapter 3. Id1 and Id3 knockdown in a model of triple-negative breast cancer Figure 3-3 Endogenous levels of Id1 and Id3 expression in 4T1 cells. (A) (i) FFPE 4T1 cells stained for Id1 expression (brown) and counterstained with haematoxylin (top image). Mammary gland tissue from Id1 null (Id1-/-) mice was stained with Id1 and counterstained with haematoxylin (bottom image) to serve as a negative control for Id1 IHC (ii) Western blot analysis of protein lysate from 4T1 cells for Id1 expression. (B) (i) FFPE 4T1 cells stained for Id3 expression (brown) and counterstained with haematoxylin (top image). Mammary gland tissue from Id3 null (Id3-/-) mice was stained with Id3 and counterstained with haematoxylin (bottom image) to serve as a negative control for Id3 IHC. (ii) Western blot analysis of protein lysate from 4T1 cells for Id3 expression. 86 Chapter 3. Id1 and Id3 knockdown in a model of triple-negative breast cancer 3.2.3 Integration of pSLIK into 4T1 cells I then utilized a loss-of-function approach to knockdown Id1/3 expression in 4T1 using the pSLIK vector platform. All components of the pSLIK system were obtained from the American Type Culture Collection (ATCC). siRNA sequences specific to Id1 and Id3 have been validated in previous studies (Gao et al., 2008; Gupta et al., 2007). The sequences were transformed into shRNA through the addition of a hairpin loop that linked the sense and antisense target sequences together to create a shRNA linker as described by Shin and colleagues (Shin et al., 2006). The shRNA linker was designed such that, after annealing of two complementary oligonucleotides, the linker had double- stranded DNA sequences at both ends that were compatible with BfuAI restriction sites, which allowed the cloning of the linker into the entry vector, pEN_TmiRc3. An outline of this process is presented in Figure 3-4. Following this, the Id1/3 shRNA insert was subcloned from the pEN_TmiR_shId1/3 into the pSLIK vector via a Gateway recombination reaction to form expression vectors, which contributes the remaining components essential for successful knockdown. The final vector structure is outlined in Figure 3-1. Three pSLIK vectors were created, namely pSLIK-Venus-TmiR-shId1, which expressed the Id1 shRNA and the fluorescent protein Venus as a selection marker; pSLIK- Neo-TmiR-shId3, which expressed the Id3 shRNA and the neo gene as a selection marker; and the control, pSLIK-Neo-TmiR-shGFP, which expressed the EGFP shRNA and the neo gene as a selection marker. All three pSLIK expression vectors constructed were verified by Sanger sequencing. In order to allow in vivo bioluminescence imaging for investigation of Id1/Id3 function in metastatic progression, the 4T1 cells were modified with lentivirus for stable expression of firefly luciferase. The vector used was named pLV4301G- enhanced luciferase-Thy1.1, which codes for an enhanced firefly luciferase (ffLuc) and a Thy1.1 receptor (O'Toole et al., 2011; Rabinovich et al., 2008). The pLV4301G-enhanced luciferase-Thy1.1 construct was incorporated into viral particles by means of the HEK293T packaging cell line. These viral particles were used to infect the 4T1 parental cells (ATCC). The lentiviral transduced cells were sorted for Thy1.1 expression. The stable cells created were named 4T1 Enh Luc Thy1.1 pool. Following that, the pSLIK anti-Id1 87 Chapter 3. Id1 and Id3 knockdown in a model of triple-negative breast cancer construct (pSLIK-Venus-TmiR-shId1) was used to infect the 4T1 Enh luc Thy1.1 cells. Successfully infected cells were then sorted based on Venus fluorescence. Sorted cells were subsequently infected with the pSLIK anti-Id3 construct (pSLIK-Neo-TmiR-shId3). Successfully infected cells were selected with neomycin and combined into stable pooled populations that will be subsequently referred to as 4T1 pSLIK shId1/3 pool for simplicity. The control will be referred to as 4T1 pSLIK shGFP pool. For more details of each of these procedures, please refer to Material and Methods chapter. (A) (B) 88 Chapter 3. Id1 and Id3 knockdown in a model of triple-negative breast cancer Figure 3-4 Generation of the shRNA linker and the entry vectors. (A) shRNA oligonucleotide design process. (i) Hairpin structure after transcription of the shRNA linker by RNA polymerase II. shRNA folded into a stem-loop structure which contained a loop (green) and a double-stranded stem that was subsequently cleaved by the endoribonuclease, Dicer, to form an active siRNA that targets Id1 mRNA degradation. (ii) Sense and antisense oligonucleotides were generated, composed of the sense and antisense siRNA to Id1, a hairpin and the BfuAI restriction endonuclease sites at the ends. (iii) The two oligonucleotides were annealed to each other to create a complementary double-stranded structure that could be ligated into the BfuAI sites of a linearized pSLIK-Venus vector. (B) Construction the entry vector encoding the anti-Id1 shRNA. The ccdB toxic gene in the parental entry vector pEN_TmiRc3 was removed by digestion with BfuAI restriction enzyme to create a vector backbone.Ligation was performed using the anti-Id1 shRNA linker with overhangs of BfuAI restriction sites and the BfuA1 cut pEN_TmiRc3 to create pEN_TmiR_Id1. The pEN_TmiR_shId1 was then transferred into pSLIK-Venus destination by a Gateway reaction to generate the pSLIK-Venus-TmiR-shId1 expression construct. Identical methodology was used to produce the anti-Id3 construct (pSLIK-Neo-TmiR-shId3), and the the anti-EGFP shRNA control (pSLIK-Neo-TmiR-shGFP). 3.2.4 Analysis of knockdown efficiency in 4T1 pSLIK shId1/3 pool cells. The effectiveness of Id1/3 knockdown in 4T1 pSLIK shId1/3 pool cells treated with Dox was examined and compared to control 4T1 pSLIK shGFP pool cells and the 4T1 Enh luc Thy1.1 cells, at the protein level. The cells were grown with or without Dox over a time course of 5 days. Western analysis was performed with protein lysates collected on day 1, 3 and 5. Results from several duplicate Western blot experiments are summarized in Figure 3-5. It was observed that a decrease in Id1 and Id3 expression levels occurred as early as 1 day post Dox induction and continued for the next 4 days in the 4T1 pSLIK shId1/3 pool cells. Downregulation of Id1/3 was not observed by the presence of Dox in the control 4T1 pSLIK shGFP pool cells and the 4T1 Enh luc Thy1.1 cells. These results confirm that over multiple experiments, the pSLIK system produced consistent results for knockdown of Id1/3 by shRNAs. The anti-Id1/3 shRNAs were efficient 89 Chapter 3. Id1 and Id3 knockdown in a model of triple-negative breast cancer to inhibit the expression of Id1/3, whereas the 4T1 pSLIK shGFP pool, as well as the 4T1 Enh luc Thy1.1 cells showed on average no decrease in Id1/3 levels following treatment with the Dox. This data demonstrated that, using the pSLIK lentiviral vector, we can introduce a tightly regulated shRNA expression system for conditional knockdown of Id1/3 expression in the 4T1 cells. During these experiments, it was noted that during the time course the level of Id1/3 protein initially increased before decreasing by the final time point in the control 4T1 Enh luc Thy1.1 cells (Figure 3-5A iii), and occasionally in the 4T1 pSLIK shGFP pool cells (result not shown). This suggested that Id1/3 levels are regulated in a dynamic way depending on the density of these cells in culture. 90 Chapter 3. Id1 and Id3 knockdown in a model of triple-negative breast cancer Figure 3-5 Kinetics of conditional Id1/3 knockdown in 4T1 cells. (A) Western blot analysis of Id1/3 protein levels in (i) 4T1 pSLIK shId1/3 pool cells, (ii) 4T1 pSLIK shGFP pool cells, and (ii) the control 4T1 Enh luc Thy1.1 cells over time. The cells were cultured in the presence of 1 µg/ml Dox for 1, 3 and 5 days. Protein lysates were subjected to Western analysis with an antibody to Id1, Id3 or β- actin. (B) Densitometry analysis was carried out by Quantity One on replicate Western blot experiments for each time point (4T1 pSLIK shId1/3 pool cells, - and +Dox, n=5; 4T1 pSLIK shGFP pool cells, - and +Dox, n=3; 4T1 Enh luc Thy1.1 cells, - and +Dox, n=3). Calculated intensities of individual Id1/3 bands were adjusted for variations in loading using the relative intensities of the β- actin controls. The densitometry values of Dox treated cells were normalized to the values of Dox untreated samples, set at 1, for each individual experiment. 91 Chapter 3. Id1 and Id3 knockdown in a model of triple-negative breast cancer 3.2.5 Targeting Id1/3 reduces proliferation of 4T1 cells To first characterise the 4T1 pSLIK shId1/3 cells, I tested whether depletion of Id1/3 expression had any effect on cell proliferation. Cell proliferation was compared between the pSLIK shId1/3 cells treated with and without Dox over a 4-day time course by two independent methods firstly by the MTS (3-(4,5- dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H- tetrazolium) assay, and secondly by using time-lapse phase-contrast microscopy with the automated Live Cell Imaging System IncuCyte. The MTS assay is a cell viability assay which utilizes the ability of metabolically active cells to metabolize the MTS compound into formazan, the level of which is directly proportional to the number of viable cells in culture. The benefit of using the MTS assay and the IncuCyte Live Cell Imaging System methodology as opposed to the standard manual cell count is that MTS assays and the IncuCyte Live Cell Imaging System are relatively automated and performed on a larger scale, allowing more conditions to be tested concurrently. Before performing the proliferation assays, optimisation was carried out to determine the cell number to be used in the 96-well plate format in the MTS assay and 24- well plate format in the IncuCyte system. This was to ensure the cells that were seeded would not be over confluent at the end of the assay. Both MTS and IncuCyte methods showed a decrease in proliferation when Id1/3 were depleted in the 4T1 pSLIK shId1/3 pool cells under Dox treatment (Figure 3-6). This result demonstrated a functional requirement of Id1/3 in 4T1 cell proliferation. 92 Chapter 3. Id1 and Id3 knockdown in a model of triple-negative breast cancer (A) (B) 93 Chapter 3. Id1 and Id3 knockdown in a model of triple-negative breast cancer (C) (i) 4T1 pSLIK shld1 /3 pool (ii) 4T1 pSLIK shGFP pool (iii) 4T1 Enh luc Thy1 .1 pool 94 Chapter 3. Id1 and Id3 knockdown in a model of triple-negative breast cancer Figure 3-6 Knockdown of Id1/3 decreases 4T1 cell proliferation. (A) Proliferation was measured for 4 days by using the MTS assay on (i) 4T1 pSLIK shId1/3 pool, (ii) 4T1 pSLIK shGFP pool, (iii) 4T1 Enh luc Thy1.1 pool cells. Graphs depict the average of 6 technical replicates from 3 biological replicates ±SEM. The raw absorbance value for each condition was normalised to the negative control absorbance measured on day 0. **p<0.0001. (B) Proliferation assay was measured using the automated Live Cell Imaging System IncuCyte on (i) 4T1 pSLIK shId1/3 pool, (ii) 4T1 pSLIK shGFP pool, (iii) 4T1 Enh luc Thy1.1 pool cells. Cells were seeded triplicate in a 24-well plate, which was immediately loaded into the IncuCyte imaging system. Nine images per well were collected at 2 h intervals. The percent confluence of the cells was calculated using individual data from each of the nine images taken per well at each time point. Graphs depict the average of 3 technical replicates ±SEM. *p<0.005. (C) Representative images taken on Day 2 on (i) 4T1 pSLIK shId1/3 pool, (ii) 4T1 pSLIK shGFP pool, (iii) 4T1 Enh luc Thy1.1 pool cells cultured under the presence of Dox or without Dox. Scale bar =100µm. 95 Chapter 3. Id1 and Id3 knockdown in a model of triple-negative breast cancer 3.2.6 Effect of selection pressure in 4T1 pSLIK shId1/3 cells The 4T1 pSLIK shId1/3 pool stable cells were created by transduction of the 4T1 Enh luc Thy1.1 pool cells with the pSLIK-Venus-TmiR-shId1 and pSLIK- Neo-TmiR-shId3, and a subsequent FACS sort based on Venus fluorescence and neomycin selection. I next tested if the presence of neomycin selection was required for maintenance of shRNA expression for downregulation of Id1/3. 4T1 pSLIK shId1/3 pool cells were grown with or without neomycin. Id1/3 knockdown was compared between neomycin treated and untreated cells to determine the extent to which the maintenance of selection pressure plays a role in maintaining Id1/3 knockdown. Cell lysate was collected on day 1 and 3 for Western blot analysis. The results presented in Figure 3-7A showed that both neomycin and non- neomycin treated 4T1 pSLIK shId1/3 pool cells reached similar level of Id1 knockdown under Dox induction. However, the level of Id3 detected by Western blot in the presence of neomycin was visibly less that in its presence. This was further confirmed through densitometry analysis which showed a decrease of Id3 expression of about 84% in neomycin treated pSLIK shId1/3 pool cells after 3 days of Dox induction, whereas a 38% of Id3 knockdown was observed in cells cultured in the absence of neomycin after the same period of Dox induction. Thus, it was concluded that the maintenance of continued selection pressure had a certain level of impact on the extent of Id3 downregulation. All in vitro experiments using the 4T1 pSLIK shId1/3 and pSLIK shGFP stable cells in this and the subsequent chapters were performed in the presence of Neomycin selection. 96 Chapter 3. Id1 and Id3 knockdown in a model of triple-negative breast cancer Figure 3-7 Impact of selection pressure on Id1/3 knockdown in the 4T1 pSLIK shId1/3 pool cells. (A) Cells were grown with or without Dox in the presence or absence of neomycin for 3 days. Cell lysate was harvested on day 1 and day 3 for Western analysis. (B) Result from Western blot was quantified by densitometry. β-actin was used as a loading control. The intensity of each of the bands from the Dox treated cells were normalized to the Dox untreated cells, set at 1. 97 Chapter 3. Id1 and Id3 knockdown in a model of triple-negative breast cancer 3.2.7 Loss of Id1/3 knockdown after prolonged Dox induction The next aspect of characterising the 4T1 pSLIK shId1/3 cells was to test whether knockdown of Id1/3 can be reversed upon Dox removal. Reexpression of Id1/3 will allow us to test if the phenotype associated with silencing of Id1/3 can be reversed or rescued. Figure 3-8 depicts the results of an experiment in which the 4T1 pSLIK shId1/3 pool cells were treated with Dox for a period of 10 days, after which Dox treatment was withdrawn. Following that, the cells were cultured without Dox for an additional 7 days. Cell lysate was collected on day 3, 5 and 7 for Western blot analysis. The results suggested that the effect of Dox induced Id1/3 knockdown on the cells was reversible, as the removal of Dox from the medium resulted in the restoration of Id1/3 protein expression. As observed in the Western blots in Figure 3-8, the degree of Id1/3 knockdown decreased over time after prolonged Dox exposure. A significant decrease in the level of Id1/3 knockdown was evident after 10 days of Dox treatment. This result suggested that the Id1/3 depletion in the 4T1 pSLIK shId1/3 pool cells is lost over time after extended Dox induction. As illustrated in Figure 3-6A (i) and 3-6B (i), it appeared that a significant reduction in proliferation occurred when the pSLIK shId1/3 pool cells were initially induced with Dox at plating, but after 2-3 days of Dox treatment, the cell number plateaued irrespective of continual Dox induction or replenishment of medium with fresh Dox. Pictures taken on the pSLIK shId1/3 pool cells treated with Dox [Figure 3-6C (i)] showed that despite the overall inhibitory effect on proliferation, some cells survived, eventually forming colonies. We hypothesized that these colonies were formed by cells that had lost or attenuated their expression of Id1/3 shRNAs, which would corroborate the Western results which showed a decrease of Id1/3 knockdown over time after prolonged Dox induction. These data suggested that as Id1/3 knockdown is lost over time, cells that continued to grow under Dox induction might have escaped the knockdown. This prompted me to test whether these Id1/3 expressing cells that had escaped the knockdown after prolonged Dox induction would behave similarly to the control 4T1 pSLIK shGFP pool cells or the 4T1 Enh luc Thy1.1 pool cells in term of their proliferative potential. In order to answer this, I grew 98 Chapter 3. Id1 and Id3 knockdown in a model of triple-negative breast cancer the pSLIK shId1/3 pool cells for a period of 14 days under exposure to Dox, after which Dox was withdrawn from the medium, the resulting colonies were pooled, re-plated into Dox-containing medium and assayed for proliferation by MTS. Figure 3-9 illustrated how the experiment was carried out. Western blot was also performed to assess the level of Id1/3 expression at several time points over the course of Dox induction. The growth curves were compared to those of Dox-untreated pSLIK shId1/3 pool cells. The results in Figure 3-10 showed that the growth rate of cells that had escaped the knockdown, when treated with Dox, was different to those of cells that were never exposed to Dox but treated with Dox subsequently. Western blot result in Figure 3-11 showed that the degree of Id1/3 knockdown has significant decreased over time in the pSLIK shId1/3 pool cells that have been previously exposed to Dox. 99 Chapter 3. Id1 and Id3 knockdown in a model of triple-negative breast cancer Figure 3-8 Re-expression of Id1/3 following Dox removal in the 4T1 pSLIK shId1/3 pool cells. (A) 4T1 pSLIK shId1/3 pool cells were treated with DOX for 10 days (Dox Induction), Dox was then omitted (Dox Removal) from the medium. The cells were cultured in the medium without Dox for 7 days. Western analysis was performed on cell lysates harvested on day 3, 5 and 7 post Dox removal with antibodies to Id1, Id3 or the β-actin loading control. (B) Id1/3 expression on Western blot was measured by densitometry. Calculated intensities of individual Id1/3 bands were adjusted for variations in loading using the relative intensities of the β-actin controls. The densitometry values of Dox treated cells were normalized to the values of Dox untreated samples, set at 1, for each individual experiment. Measurement on day 10 showed that the level of Id1/3 protein increase over time after prolonged Dox exposure. 100 Chapter 3. Id1 and Id3 knockdown in a model of triple-negative breast cancer Figure 3-9 Experimental strategy to determine the effect of in vitro long-term Id1/3 silencing on cell proliferation. 4T1 pSLIK shId1/3 pool cells were then treated with or without Dox and passaged for 2 weeks. Following that, Dox was withdrawn. Cells were then assayed for proliferation by MTS and Id1/3 protein expression by Western blot in the absence or presence of Dox. 101 Chapter 3. Id1 and Id3 knockdown in a model of triple-negative breast cancer Figure 3-10 Growth properties of the 4T1 pSLIK shId1/3 pool cells that had escaped Id1/3 knockdown. 4T1 pSLIK shId1/3 pool cells (A) and 4T1 Enh luc Thy1.1 pool cells (B) were treated with Dox for 14 days, harvested and re-plated in the presence or absence of Dox. MTS assay was performed. Growth curves of Dox pretreated cells (+Dox -Dox) were compared to those of unpretreated cells (–Dox -Dox), and growth curves of Dox pretreated cells that were subsequently treated with Dox (+Dox +Dox), as well as those of unpretreated cells that were subsequently treated with Dox (–Dox +Dox). 102 Chapter 3. Id1 and Id3 knockdown in a model of triple-negative breast cancer Figure 3-11 Western blot analysis of Id1/3 expression in 4T1 pSLIK shId1/3 pool cells (A) and 4T1 Enh luc Thy1.1 pool cells (B) after prolonged Dox treatment and a subsequent re-exposure to Dox. Cell lysate was harvested on day 1 and 5 for western blot. Densitometry quantification (bottom panel) showed that the degree of Id1/3 knockdown has significant decreased over time in the pSLIK shId1/3 pool cells that have been previously exposed to Dox (labelled as “-Dox” in italic and black) when compared to the cells that have not been exposed to Dox (labelled as “+Dox” in italic and red). A significant different was observed when comparing the expression of Id1/3 in Day 5 (“-Dox -Dox” vs “- Dox +Dox” and “+Dox –Dox” vs “+Dox +Dox”). This effect was not observed in the 4T1 Enh luc Thy1.1 pool cells. 103 Chapter 3. Id1 and Id3 knockdown in a model of triple-negative breast cancer 3.2.8 Generation of pSLIK clonal cell lines The pSLIK system was developed by Shin and colleagues (Shin et al., 2006), and was demonstrated to permit effective inducible knockdown of genes in pool cells (Shin et al., 2006). Pooled cellular populations carry the advantage of decreasing the possibility of a dominant effect arising from a cell line derived from a single cell (clonal cell line). However, loss of knockdown after prolonged Dox induction may obscure the extent of the influence exerted by downregulation of Id1/3, especially when assessing the function of Id1/3 in in vivo assays over a long period of time during the process of metastasis. To obtain a more homogeneous population of cells with a greater degree of shRNA knockdown over a long period of time, I generated several clonal cell lines based on the level of Id1/3 knockdown. To test whether or not a stronger impact of Id1/3 knockdown would be detected in clonal cells, individual 4T1 pSLIK shId1/3 cells and control 4T1 Enh luc Thy1.1 cells were isolated from the pooled populations used previously into single wells of 96-well plates. The single cells were expanded to create several clonal cell lines. The proliferative capability of the cells upon Dox induction was assessed by MTS assay. Id1/3 expression profiles were tested following 5 days of Dox exposure by Western blot. The results are shown in Figure 3-12. Reduction in cell proliferation in response to Dox treatment was observed with the original 4T1 pSLIK shId1/3 pool cells and several but not all the clonal cell lines generated. This suggests the presence of pre-existing non-Dox-responsive clones in the pool. The extent of the decrease in proliferation varied between clonal cell lines which responded to Dox treatment. Clones 8 and 12 displayed the greatest decrease, while Clone 10 was less. Clone 8, 12 and 10 all showed greater reduction in cell proliferation in response to Dox induction over time compared to the 4T1 pSLIK shId1/3 pool. The remaining clones did not respond to Dox induction. In addition to pSLIK clonal cell lines, two control clonal cell lines were created from the 4T1 Enh luc Thy1.1 pool cells, 4T1 Enh luc Thy1.1 Clone 1 and 4T1 Enh luc Thy1.1 Clone 2. Both cell lines were referred to as Control C1 and Control C2 respectively for simplicity. No significant difference in growth was detected between Dox treated and untreated Control C1 and Control C2 cells. Cell lysate was collected from 6 clones and subject to Western 104 Chapter 3. Id1 and Id3 knockdown in a model of triple-negative breast cancer blot analysis. When the MTS assay data was compared to Western blot analysis of the corresponding cell lysates, a similar pattern was observed, whereby a reduction in Id1/3 expression level was observed in the clones that showed a marked decrease in cell proliferation. pSLIK Clones 8 and 12 were chosen for subsequent experiments, due to their response to Dox induction. (A) 105 Chapter 3. Id1 and Id3 knockdown in a model of triple-negative breast cancer (B) Figure 3-12 Growth and Id1/3 expression properties of clonal cell lines. (A) 4T1 pSLIK shId1/3 and 4T1 Enh luc Thy1.1 clones were assayed for their proliferative potential under the treatment with or without Dox. **p<0.0001 when Dox treated and untreated samples were compared. (B) Six clones were selected for Western analysis. Cell lysate was harvested on day 1, 3 and 5 post Dox induction. 106 Chapter 3. Id1 and Id3 knockdown in a model of triple-negative breast cancer 3.2.9 Functional requirement of Id1/3 in 4T1 cell self-renewal There is accumulating evidence that acquisition of a stem-like state is associated with metastatic phenotype in cancer. Id1 has been implicated in the generation or maintenance of stem and progenitor cells. Recent studies also indicated Id1/3 have a role in controlling the cancer stem cell phenotype of several cancer types (Lasorella et al., 2014). I therefore asked whether targeting Id1/3 will affect the self-renewal potential of the 4T1 cells. To answer this, I performed a tumoursphere forming assay on the 4T1 pSLIK C8, C12 as well as the Control C1 clonal cells. In tumoursphere assay, the sphere-forming capacity of the cells is proportional to self-renewal capacity, the ability of the cells to replicate while maintaining in a less differentiated state (Nair et al., 2013). The cells were dissociated into single cells before being plated onto low adherent 6-well plates in the absence of serum. Dox was added into the medium at two different time points, immediately after plating and 5 days post plating. After 10 days from the initial day of seeding, tumourspheres were quantified. Knockdown of Id1/3 both from day 0 and 5 significantly reduced the ability of the pSLIK C8 and C12 cells to form tumourspheres in the suspension culture (Figure 3-13). This effect was not observed in the Control C1 cells. pSLIK C8 and C12 cells that were treated with Dox from day 0 displayed the greatest fall compared to the same cells that were treated with Dox from day 5. Interestingly, the Control C1 cells have a higher tumoursphere forming capacity than both the pSLIK C8 and C12 clonal cells when grown in the absence of Dox. 107 Chapter 3. Id1 and Id3 knockdown in a model of triple-negative breast cancer Figure 3-13 Assays measuring self-renewal of 4T1 cells depleted of Id1/3 expression. 4T1 pSLIK shGFP, C8, C12 and Control C1 cells were assayed for their tumoursphere forming potential. Dox was added into the culture medium on day 0. Number of primary and secondary tumoursphere formed was quantified by visual examination on day 7 and day 14 respectively. *p<0.0001. 108 Chapter 3. Id1 and Id3 knockdown in a model of triple-negative breast cancer 3.3 Discussion One of the aims of this project is to determine the tissue expression of ID1 and ID3 in human breast cancer. Analysis of ID protein expression in breast cancer has been hampered by a number of technical limitations. Analysis of gene expression datasets derived from total tumour extracts cannot be used to study ID1 protein expression in breast cancer because ID1-positive cancer cells can appear at low frequency in a tumour compared to numerous stromal cell types and tumour-associated endothelial cells that express high levels of ID proteins. Furthermore, high quality, widely accepted antibodies have only become available since 2006 (Nair et al., 2010; Perk et al., 2006a)leading some to question the validity of the earlier clinical studies. By performing IHC analysis on human breast cancer using tissue microarrays (TMA), Perk and colleagues (Perk et al., 2006a) revealed a substantial incidence (23% of cases) of ID1 protein expression in the rare metaplastic breast cancer subtype. The incidence of ID1 expression was lower (2.5% of cases) in the poorly differentiated triple- negative breast cancer subtype. However, because of the focal pattern of ID1 expression that is frequently observed, it remained possible that evaluation of tumour samples by TMA might underestimate the proportion of ID1-positive breast cancers. In this project, I reassessed the expression of ID1 in breast cancer by using the newly developed antibody. I chose to use histological detection of ID proteins, rather than techniques that rely on tissue extracts which are subject to contamination by non-epithelial ID1-expressing cells. In addition, I conducted IHC on whole tumour block sections instead of TMA. I optimised antibody staining with help from Ms Emie Roy (Garvan Institute of Medical Research) and Mr Jaynish Shah (Garvan Institute of Medical Research) using the new commercially available rabbit monoclonal antibodies on FFPE samples. The specificity of the anti-ID1 and anti-ID3 antibodies were also validated using mammary gland tissue from ID1 and ID3 KO mice (Figure 3-3). Using these highly specific antibodies, the results described in this chapter demonstrated that ID1 protein expression is associated with the triple-negative and HER2- enriched subtypes of breast cancer, but not in other subtypes. This finding is 109 Chapter 3. Id1 and Id3 knockdown in a model of triple-negative breast cancer consistent with my hypothesis that ID1 is a key regulator in the progression of the aggressive triple-negative breast cancer. I am currently expanding this study in a larger cohort of patients as well as examining the expression of ID3 in these patients and to correlate ID1/3 expression with clinical follow up data. My IHC results confirmed the expression of ID1 in triple-negative and the HER2-enriched breast cancer, for this reason, my project focused on the role of ID1/3 in the hormone receptor negative disease. I chose a mouse breast cancer cell line of triple-negative subtype, the 4T1 cells, as a model in this study. The second part of this chapter outlines the generation of a stable, Dox-inducible, shRNA-based Id1/3 gene knockdown system in the 4T1 cancer cell line, which was used to successfully decrease endogenous expression of Id1 and Id3 upon Dox induction. shRNAs targeting Id1 and Id3 were successfully integrated into the pSLIK single vector lentiviral inducible gene knockdown system, which was subsequently introduced into the 4T1 cells. A time course measurement of Id1/3 protein expression following Dox induction showed a significant knockdown as early as 1 day post Dox treatment, and increased progressively, reaching the highest degree of Id1/3 depletion at day 5. This inducible system to downregulate Id1/3 in 4T1 cells represents a powerful tool that would allow me to test the requirement for Id1/3 in animal models as well as performing acute knockdown experiments for gene expression discovery and in vitro functional assays. I then performed an experiment to determine the effect of Id1/3 targeting on the proliferation of the 4T1 cells. Proliferation assay revealed a significant decrease in cell number following Id1/3 repression in the 4T1 cells. This corroborates other studies on the role of Id1 on cell proliferation. A number of studies have demonstrated that Id1 promotes cell cycle progression and is required for proliferation of many cells types including fibroblasts and mammary epithelial cells (Lin et al., 1999; Norton et al., 1998; Swarbrick et al., 2005). Increased Id1 expression is correlated with suppression of CKIs p16, p21, and p27 (Alani et al., 2001; Nickoloff et al., 2000; Ohtani et al., 2001a; Tang et al., 2002), which results in preventing both cell cycle arrest and premature senescence. Id1/3 are also inhibited by ETS1. ETS1 is a transcription factor which activates the 110 Chapter 3. Id1 and Id3 knockdown in a model of triple-negative breast cancer p16INK4a promoter through an ETS-binding site. Id1 interacts with the ETS- binding site which results in inhibition of p16INK4a expression and consequently allows cyclinD-CDK4 phosphorylation of RB6 (Ohtani et al., 2001b). In human breast epithelial cells, ID1 stimulates cell proliferation at least in part by promoting expression of cyclins D1 and E (Swarbrick et al., 2005). Overexpression of ID1 has also been suggested to repress pRb, a protein which plays a crucial role in preventing excessive cell growth and proliferation by inhibiting cell cycle (Alani et al., 1999). In addition to its effect on cell proliferation, I also showed that silencing of Id1/3 led to a reduction in self- renewal capacity as observed in the tumoursphere-forming assay. This result represents a novel finding for a role of Id1/3 in regulating breast cancer self- renewal, and is consistent with previous studies performed on other cancer types. Several studies have demonstrated that inactivation of Id1/3 led to loss of self-renewal and tumour-initiating capacity, and high levels of Id1/3 identify cancer cells with high self-renewal and tumour-initiating capacity in colon and brain (Anido et al., 2010; Barrett et al., 2012; Jin et al., 2011; Niola et al., 2013; O'Brien et al., 2012a). An issue encountered during the generation of the Dox-inducible stable cells was that after prolonged exposure to Dox, the degree of Id1/3 knockdown declined. This might be a reflection of the emergence of cell subpopulations that have lost the shRNA transgene expression and have been subsequently selected. Over time, cell numbers stabilized and began to recover, which was accompanied by the appearance of colonies, which increased in size and subsequently reached confluency. Western blot analysis and cell proliferation assays on cells that were previously subjected to prolonged Dox induction showed a decrease in response of the emergent cells to Dox induction. The cells re-expressed Id1/3 and displayed typical rates of growth when treated with Dox. In order to overcome this problem, clonal pSLIK cells were generated subsequent to the pooled cells. The clonal cell lines generated displayed the same pattern of growth as the equivalent pooled populations. Growth patterns and the extent reduction (Dox-induced) in cell proliferation differed between each cell line, which means that individual clones were isolated successfully. The absence of response to Dox in some of the clonal cell lines may have been 111 Chapter 3. Id1 and Id3 knockdown in a model of triple-negative breast cancer a result of an insufficient amount of knockdown achieved by Id/3 shRNAs, as a higher degree of reduction in Id1/3 expression level was observed in the clonal cell lines that showed a more profound decrease in cell proliferation. During the tumoursphere assay, an interesting observation was made that the Control clone have a higher tumoursphere forming capacity than both the pSLIK C8 and C12 clones when grown in the absence of Dox. This higher tumoursphere- forming capacity of the Control C1 cells compared to the pSLIK C8 and C12 clonal cells when cultured in the absence of Dox could be due to leakiness of the pSLIK inducible system. In addition, this result may indicate that the 4T1 pooled population is a heterogeneous mix of cells with different attributes. The starting 4T1 population may display substantial phenotypic heterogeneity in self-renewal. Not all of the cells within the pooled population are capable of sustained self-renewal. In summary, the data presented in this chapter demonstrated that ID1/3 expression is associated with hormone receptor-negative breast cancers. The Id1/3 genes were successfully knocked down in the 4T1 cell line using the pSLIK inducible gene silencing system. The 4T1 is a cell line which represents the triple-negative breast cancer subtype and is known to express Id1/3. My results support the hypothesis that targeting Id1/3 has an inhibitory effect on the proliferation and the self-renewal capacity of these breast carcinoma cells. It can thus be suggested that expression of Id1/3 is a prerequisite for carcinogenesis and/or is required for supporting the malignant phenotype of the hormone receptor-negative breast cancers. The cell model for inducible knockdown of Id1/3 generated will serve as a powerful tool for studying the role of Id1/3 by rapid switch off their expression at different stages of tumour progression to investigate the function of Id1/3 in the metastatic cascade. 112 Chapter 4. Genome-wide determination of Id1/3 target genes Chapter 4. Genome-wide determination of Id1/3 target genes 4.1 Introduction The ID family of transcription factors is a member of the HLH proteins which lack a DNA binding domain, thereby regulating gene transcription by heterodimerization with other transcription factors and inhibiting them from DNA binding and expression of their target genes. Studies have shown that, besides bHLH, ID proteins exert inhibitory activity towards other transcription factors, which include the Ets and Pax families (Ohtani et al., 2001a; Roberts et al., 2001; Yates et al., 1999). Evidence to date indicates that in different cellular contexts ID proteins can exert divergent functions (Lasorella et al., 2014). It is well established that ID proteins are likely to carry out distinct biological functions depending on when and where the proteins are expressed. Several ID1-dependent targets have been identified in breast cancer. Our group has demonstrated that Id1 is required for tumour maintenance by cooperating with activated RAS oncogenes to avert cell senescence in mouse models of metastatic breast cancer. Tumours expressing activated Ras and Id1 show increased proliferation with high level of p21Waf1/Cip1, suggesting that Id1 acts downstream of p21Waf1/Cip1 to maintain cellular proliferation (Swarbrick et al., 2008b). We have also shown that ID1 stimulated cell proliferation by promoting expression of Cyclin D1 and Cyclin E for activation of CDK4 and CDK2 activities in human breast epithelial cells (Swarbrick et al., 2005). Fong and colleagues suggested that a target for ID1 in MDA-MB-231 cells is MT1-MMP, a matrix metalloproteinase that can promote invasion and metastasis (Fong et al., 2003). Id1 has also been implicated in EMT indirectly through loss of KLF17 (Gumireddy et al., 2009) and Cyclin D1 (Tobin et al., 2011) in breast cancer cells. Another group showed a regulation of Bcl-2 and Bax expression by ID1 in MCF7 breast cancer cells (Kim et al., 2008). ID1 has also been demonstrated to regulate the expression of MEL18 and BMI1 in MDA-MB-231 cells (Qian et al., 2010) however the mechanism of regulation is unclear. 113 Chapter 4. Genome-wide determination of Id1/3 target genes Until today, we still lack a comprehensive picture of the downstream molecular events that are controlled by ID1/3 in breast cancer, the molecular mechanism of ID1/3 activity and their associated pathways mediating progression of breast cancer. A genome wide investigation of ID1/3 target genes in breast cancer metastasis has not been conducted. In this chapter, I aim to investigate downstream effectors of Id1/3. To understand the mechanisms and the molecular pathways regulated by Id1/3 in breast cancer, I will use a loss-of- function approach combined with genome-wide transcription profiling to identify genes that are targets of Id1/3 in breast cancer. Expression profiling will be performed with RNA depleted of Id1/3 expression from the 4T1 cell model described in Chapter 3. I will compare 4T1 pSLIK C8 cells depleted of Id1/3 by Dox induction of shRNAs to the untreated cells which express endogenous Id1/3. During my Honours study, by performing expression profiling with RNA from the human breast cancer cell line, MDA-MB-231, transfected with ID1 siRNA, I generated preliminary data showing that, amongst other targets, the polycomb protein BMI1 is down-regulated in ID1 depleted cells. Based on previous reported functions of BMI1, an oncogene and a stem cell regulator, we speculate that BMI1 may serve as a novel mediator of ID1 function in breast cancer by controlling phenotypes such as cell proliferation, self-renewal and inhibiting-apoptosis. Qian and colleagues subsequently demonstrated that ID1 regulates the expression of MEL18 and BMI1 through AKT signalling pathway (Qian et al., 2010). However, the functional role of the regulation of BMI1 by ID1 in breast cancer has not been explored. In this chapter, I will the 4T1/ID shRNA system to identify more candidate genes. I will prioritise genes with cellular functions related to metastasis to identify molecular pathways regulated by Id1/3 that are critical in controlling metastatic progression of breast cancer. 4.1.1 Hypothesis Modulating Id1/3 levels in the 4T1 cell line will modulate the molecular pathways that regulate cellular functions involved in proliferation, self-renewal and metastasis. 114 Chapter 4. Genome-wide determination of Id1/3 target genes 4.1.2 Aim The specific aim of this chapter is to determine the transcriptional targets of Id1/3 in breast cancer by transcript profiling the Id1/3 depleted 4T1 cells. 4.2 Results 4.2.1 Knockdown of Id1/3 in 4T1 cells for expression profiling In Chapter 3, I have described the creation of several pSLIK clonal cell lines which allow efficient knockdown of Id1/3 upon Dox induction. Two clonal cell lines, pSLIK C8 and pSLIK C12, were selected for subsequent experiments, due to their good response to Dox induction which was characterised by a significant degree of repression at the Id1/3 protein expression and a reduction in proliferation upon Dox induction. In this chapter, to understand downstream pathways regulated by Id1/3, I performed expression profiling with RNA from the pSLIK C8 cells treated with Dox. As shown in Chapter 3, a significant knockdown of Id1/3 was observed in the pSLIK C8 cells at 48 hours after Dox treatment (Figure 3-12B). As the MTS proliferation assay had also demonstrated that the number of viable cells was significantly lower in the pSLIK C8 cells treated with Dox compared to the untreated cells at this time point (Figure 3-12A), I selected this time point for transcript profiling. To perform this experiment, the pSLIK C8 cells were first seeded and allowed to adhere overnight. Dox was added into the medium and the cells were cultured for 48 hours in the presence of Dox. A separate flask of pSLIK C8 cells was set up and cultured under the same condition except without Dox. Forty eight hours post Dox induction, total RNA was extracted from these samples as described in the Materials and Methods section. Protein lysate was also collected for Western blot analysis from cells set up in parallel with the cells for RNA extraction. Another 4 independent knockdown experiments were set up subsequently. Five sets of samples were collected at the end. Id1/3 knockdown was first checked by western blot analysis, followed by quantitative real-time PCR using Taqman probes. Results in Figure 4-1 showed that 50% Id1 knockdown was confirmed in 2 samples (R1, R3) treated with Dox and 30% in 115 Chapter 4. Genome-wide determination of Id1/3 target genes the other 2 samples (R4, R5). For Id3 knockdown, 3 of the 5 samples (R3, R4, R5) treated with Dox showed a 50% reduction of Id3 protein expression and the other 2 samples (R1, R2) showed a 40% reduction. Quantitative real-time PCR showed all 5 samples achieved a reduction of both Id1 and Id3 mRNA level at more than 40%. It was decided that the four samples with the best Id1/3 knockdown (R1, R3, R4, R5) and their respective controls would be used for the mRNA expression profiling. RNA integrity was confirmed using the Agilent bioanalyser. The microarray analysis was performed by the Ramaciotti Centre for Gene Function Analysis using the Affymetrix GeneChip Human Gene 1.0 ST Array. cDNA synthesis, probe labelling, hybridization, scanning and data processing were all conducted by the Ramaciotti Centre as previously described in the Materials and Methods section. 116 Chapter 4. Genome-wide determination of Id1/3 target genes Figure 4-1 Knockdown of Id1/3 in 4T1 cells prior microarray analysis. (A) Id1 and Id3 western blot analysis was performed on the pSLIK C8 cells treated with or without Dox for 48 hours. β-actin was used as a control for protein loading. (B) Id1/3 protein expression levels were measured using densitometry, by comparing the expression level in the Dox treated cells to the untreated cells. The densitometry values of Dox treated samples were normalized to the values of untreated samples, set at 1. 117 Chapter 4. Genome-wide determination of Id1/3 target genes Figure 4-2 Matching RNA samples were analysed by quantitative real-time PCR for expression of Id1/3 genes using TaqMan® probed-based system. Gapdh was used as an endogenous control for normalisation of samples for any possible variations in amount of RNA added to each cDNA reaction as well as variation in PCR amplification efficiency. Relative mRNA level was obtained by comparing mRNA level in cells treated with Dox to the untreated cells which was set at 1. 118 Chapter 4. Genome-wide determination of Id1/3 target genes 4.2.2 Analysis of profiling results 4.2.2.1 Basic analysis The profiling was analysed using Genepattern software package from the Broad Institute (http://pwbc.garvan.unsw.edu.au/gp/pages/login.jsf). Briefly, data from the Affymetrix files was stored on the caArray microarray data management system (https://array.nci.nih.gov/caarray/home.action). Data from each array was normalised using the RMA algorithm of NormalizeAffymetrixST in the GenePattern. Data from the two experimental conditions were then combined and analysed using the LIMMA module within GenePattern (http://bioinf.wehi.edu.au/limma/). This included determination of the fold change between samples as well as measures of the statistical robustness of these analyses, including t-tests. By setting a maximum Q-value threshold of 0.05, 6081 differentially expressed genes were identified. The q-value uses more stringent criteria for determining statistical significance than the equivalent p-value, as it takes into account the false discovery rate (FDR) in the microarray analysis. Among the 6081 differentially expressed genes, 3310 genes were found to be up-regulated, and 2771 genes were down-regulated in Id1/3 depleted 4T1 cells. Appendix shows a list of top 1000 genes that changed in expression in response to Id1/3 downregulation, with a significance threshold of p<0.05. The top 25 of each up- regulated and down-regulated genes, as determined by fold change between knockdown and control, are listed in Table 4-1. These differentially expressed genes can be either direct or indirect targets of Id1/3. However, none of them has been previously reported to be a target of Id1/3. Interestingly, a large number of the top candidates in the up-regulated gene list are interferon response genes, inflammatory pathway genes, and immune regulators- for example, genes that are involved in interferon signalling pathways such as the interferon regulatory factor (IRF) family members (eg. Irf7) and their target genes (eg. Mx2), and the Janus kinase-STAT (JAK-STAT) signalling pathway (eg. Stat1, Stat2). Examination of the expression profile of these genes in the limma GP module showed almost identical expression in the biological 119 Chapter 4. Genome-wide determination of Id1/3 target genes replicates of Id1/3 knockdown or control (Fig 4-3), indicating that this result was reproducible in each biological replicate in the expression profiling experiment. Figure 4-3 Microarray profile of Irf7, Mx2, Stat1 and Stat2 expression in biological replicates of the Control (the first four samples on the X-axis: WT_37R2C, WT_R1C, WT_R3C, WT_R4C) and Id1/3 knockdown (the last four samples on the X-axis:WT_R1KD, WT_R3KD, WT_4KD and WT_R5KD), derived from limma GP module in gene pattern and measured as log2 intensity. 120 Chapter 4. Genome-wide determination of Id1/3 target genes Gene Fold Q-value Direc Change tion Mx2 :: myxovirus (influenza virus) resistance 2 26.6015 7.592E-08 UP Oas1g :: 2'-5' oligoadenylate synthetase 1G 14.9574 1.041E-07 UP Oas3 :: 2'-5' oligoadenylate synthetase 3 15.124 1.951E-07 UP Cmpk2 :: cytidine monophosphate (UMP-CMP) kinase UP 2, mitochondrial 24.33 2.319E-07 Stat1 :: signal transducer and activator of transcription UP 1 6.8186 3.287E-07 Xaf1 :: XIAP associated factor 1 9.0697 4.063E-07 UP Usp18 :: ubiquitin specific peptidase 18 30.489 4.104E-07 UP Oas2 :: 2'-5' oligoadenylate synthetase 2 36.1304 4.104E-07 UP Ifit1 :: interferon-induced protein with tetratricopeptide UP repeats 1 18.5318 4.576E-07 Gpr56 :: G protein-coupled receptor 56 21.8355 4.723E-07 UP Zbp1 :: Z-DNA binding protein 1 13.582 4.723E-07 UP Olfr65 :: olfactory receptor 65 8.3323 4.723E-07 UP Parp14 :: poly (ADP-ribose) polymerase family, UP member 14 5.9386 5.221E-07 Angptl4 :: angiopoietin-like 4 12.113 5.221E-07 UP Irf7 :: interferon regulatory factor 7 13.4442 5.221E-07 UP Gbp3 :: guanylate binding protein 3 10.1348 5.678E-07 UP Stat2 :: signal transducer and activator of transcription UP 2 5.0425 6.796E-07 Oasl2 :: 2'-5' oligoadenylate synthetase-like 2 5.7617 7.455E-07 UP Bst2 :: bone marrow stromal cell antigen 2 8.4297 7.455E-07 UP 121 Chapter 4. Genome-wide determination of Id1/3 target genes Lypd3 :: Ly6/Plaur domain containing 3 4.2202 7.455E-07 UP Iigp1 :: interferon inducible GTPase 1 14.3364 7.931E-07 UP Pvrl1 :: poliovirus receptor-related 1 4.7014 7.931E-07 UP Oas1b :: 2'-5' oligoadenylate synthetase 1B 9.7557 8.896E-07 UP Megf10 :: multiple EGF-like-domains 10 11.0025 1.044E-06 UP Rtp4 :: receptor transporter protein 4 9.0028 1.044E-06 UP H19 :: H19 fetal liver mRNA 2.8526 3.677E-06 DOWN Mpzl2 :: myelin protein zero-like 2 3.1982 3.862E-06 DOWN Cpox :: coproporphyrinogen oxidase 2.5431 4.324E-06 DOWN Gpr116 :: G protein-coupled receptor 116 2.9257 5.335E-06 DOWN Cep78 :: centrosomal protein 78 2.5606 8.087E-06 DOWN Gpt2 :: glutamic pyruvate transaminase (alanine DOWN aminotransferase) 2 3.2592 8.294E-06 Cth :: cystathionase (cystathionine gamma-lyase) 4.9146 1.009E-05 DOWN Zfp420 :: zinc finger protein 420 2.6201 1.065E-05 DOWN Gja1 :: gap junction protein, alpha 1 2.2993 1.728E-05 DOWN Cldn9 :: claudin 9 4.2349 1.824E-05 DOWN Rtkn2 :: rhotekin 2 3.3638 1.926E-05 DOWN Aqp1 :: aquaporin 1 3.4829 2.796E-05 DOWN Fermt1 :: fermitin family homolog 1 (Drosophila) 2.1462 3.047E-05 DOWN Taf5 :: TAF5 RNA polymerase II, TATA box binding DOWN protein (TBP)-associated factor 1.9337 3.624E-05 Slc7a11 :: solute carrier family 7 (cationic amino acid DOWN transporter, y+ system), member 11 7.3157 3.722E-05 122 Chapter 4. Genome-wide determination of Id1/3 target genes B4galnt4 :: beta-1,4-N-acetyl-galactosaminyl DOWN transferase 4 2.2432 3.812E-05 Gls2 :: glutaminase 2 (liver, mitochondrial) 2.3353 3.933E-05 DOWN Fbln2 :: fibulin 2 2.0405 4.051E-05 DOWN 2610021K21Rik :: RIKEN cDNA 2610021K21 gene 2.9111 4.506E-05 DOWN Gstcd :: glutathione S-transferase, C-terminal domain DOWN containing 1.8478 0.0000465 Rps6ka6 :: ribosomal protein S6 kinase polypeptide 6 2.1709 5.279E-05 DOWN Hspa1l :: heat shock protein 1-like 1.9999 5.886E-05 DOWN Dyrk3 :: dual-specificity tyrosine-(Y)-phosphorylation DOWN regulated kinase 3 2.8598 6.145E-05 Hmgn5 :: high-mobility group nucleosome binding DOWN domain 5 3.2189 6.359E-05 Deptor :: DEP domain containing MTOR-interacting DOWN protein 4.1093 6.371E-05 Table 4-1 Top 25 up-regulated and down-regulated genes identified in Id1/3 depleted 4T1 cells ranked based on Q-value. Column 1 shows the gene symbols and annotation. Fold change in column 2 represents the ratio of gene expression change in Id1/3 knockdown versus control. Column 3 represents the Q-value for the difference between knockdown and control group. Column 4 shows the direction of change in gene expression. 123 Chapter 4. Genome-wide determination of Id1/3 target genes 4.2.2.2 Gene set enrichment analysis revealed an over-representation of gene sets related to the interferon response pathways and a regulation of a multitude of metastasis-related genes by Id1/3 To better understand the biological significance behind these genes, Gene Set Enrichment Analysis (GSEA) (http://www.broadinstitute.org/gsea) (Subramanian et al., 2005) was used to identify molecular pathways that are potentially regulated by Id1/3. GSEA compares differentially regulated genes in an expression profiling dataset with experimentally determined and computationally curated published sets of genes to determine if certain sets of genes are statistically over-represented in the expression profiling data. This would allow identification of subsets of genes in the microarray data that exhibit the same trend of expression. Using this analysis, I hoped to identify the target genes or pathways that are responsible for the functional roles of Id1/3 in breast cancer. Curated gene sets are available from the molecular signatures database (MSigDB). The GSEA analyses were performed using gene sets from four major collections within the MSigDB database, the C2, C4, C5 and C6 collection. The C2 collection interrogates curated gene sets collected from various sources such as online pathway databases, published datasets and compiled knowledge from experts in the field. The C4 collection comprises computational gene sets that are defined by mining large collections of cancer- oriented microarray data. The C5 collection consists of genes that are annotated by the gene ontology (GO) term. The C6 collection is a set of oncogenic signatures that are defined from microarray gene expression data from cancer gene perturbations. The C2 collection consists of 2908 curated gene sets. The differentially expressed genes analysed against the C2 collection showed that 1704 out of 2908 gene sets were up-regulated in the Id1/3 knockdown sample compared to the control. The GSEA normalized enrichment scores were used as a measure of relative enrichment between Id1/3 knockdown and the control. A larger absolute value implies a higher enrichment. Often, the strongest enriched gene sets have a NES value of 2-3.5. An additional filter was also applied to identify those which had a Q-value of less than 0.05. Using this method, I systematically 124 Chapter 4. Genome-wide determination of Id1/3 target genes identified 687 gene sets were significantly enriched. There were 1204 out of 2908 gene sets that were down-regulated in Id1/3 knockdown compared to the control, with 570 gene sets being significantly enriched at a Q-value cut-off of 0.05. Analysis done by using the C5 collection of gene sets showed that there were 201 up-regulated gene sets being enriched in the Id1/3 depleted cells (Q- value <0.05), and 261 gene sets were down-regulated (Q-value <0.05). The C6 collection only contains 188 gene sets. Seventy-nine gene sets were found to be up-regulated, while 29 were down-regulated when Id1/3 were knocked down. Table 4-2, Table 4-3 and Table 4-4 present the top 20 gene sets identified from the C2, C5 and C6 collection respectively in the GSEA analyses. Analysis using both the C2 and C5 collection of gene sets led to the identification of many enriched gene sets (Table 4-2 and Table 4-3) encompassing a diversity of processes. Of interest, the analysis showed that genes up-regulated in response to Id1/3 knockdown were associated with pathways triggered by inflammatory and immune responses such as interferon (IFN) and tumour necrosis factor (TNF) (Table 4-2, Table 4-3). Several of the top-ranking gene sets that were significantly enriched are presented in Figure 4- 4. This finding is consistent with the result from the LIMMA analysis which showed a large number of genes that are up-regulated in the Id1/3 knockdown cells to be associated with interferon signalling such as the interferon regulatory factor (IRF) family of transcription factors as well as members in the JAK-STAT signalling pathway. This suggests that silencing Id1/3 promotes immune response in the 4T1 cells. In addition, several gene sets involved in cell cycle control were down-regulated when Id1/3 were silenced, such as M_PHASE, CELL_CYCLE_PROCESS, M_PHASE_OF_MITOTIC_CELL_CYCLE, MITOSIS, MITOTIC_CELL_CYCLE (Table 4-3). This suggests that genes down-regulated by Id1/3 knockdown were related to cell cycle and proliferation pathways. This is consistent with my earlier result showing that Id1/3 is necessary for proliferation of 4T1 cells, as well as previous studies which reported a role of Id1/3 in controlling cell cycle progression (Lasorella et al., 2014). 125 Chapter 4. Genome-wide determination of Id1/3 target genes Analysis done by using the C6 gene sets showed there was an enrichment of genes involved in several oncogenic signatures such as MEK, VEGF, MYC and BMI1 (Table 4-4). VEGF_A_UP.V1_UP comprises of genes up-regulated in HUVEC cells by treatment with VEGFA. This gene set was found to be down regulated when Id1/3 were knocked down. This finding is compatible with the loss of proliferation and tumoursphere forming capacity of Id1/3 depleted cells observed earlier. In addition to this, a MEK signature (MEK_UP.V1_DN) and a MYC signature (MYC_UP.V1_DN) were found to be down regulated when Id1/3 were knocked down (Table 4-4). Both signatures consist of genes down- regulated in breast cancer cell over-expressing MEK1 or MYC. This observation does not correlate with the reported oncogenic roles of MEK1, MYC and ID1/3. Of interest, BMI1 has previously been identified as the top differentially expressed gene in an expression profiling experiment I performed using MDA- MB-231 cells depleted of ID1 expression during my Honours study (data not shown). Two BMI1 related signatures (BMI1_DN_MEL18_DN.V1_DN, BMI1_DN.V1_DN, MEL18_DN.V1_DN) were found to be down regulated when Id1/3 were knocked down (Table 4-4). These three gene sets were curated by Wiederschain and colleagues from a study where they examined the roles of BMI1 and MEL18 in medulloblastoma (Wiederschain et al., 2007). BMI1_DN_MEL18_DN.V1_DN is a gene set comprised of genes down- regulated in medulloblastoma cell line, the DAOY cells, upon knockdown of BMI1 and MEL18 genes by RNAi. The BMI1_DN.V1_DN signature consists of genes down-regulated in DAOY cells upon knockdown of BMI1 alone, whereas the MEL18_DN.V1_DN gene set was made up from genes down-regulated in MEL18 depleted DAOY cells. This represent an interesting finding as a number of reports have shown that MEL18 functions as a potential tumour suppressor by repressing the expression of BMI1 and consequent downregulation of several important pathways that are activated in breast cancer cells such as the AKT pathway (Guo et al., 2007a; Guo et al., 2007b). 126 Chapter 4. Genome-wide determination of Id1/3 target genes C2 Curated Gene Set Normalised P value Direction Enrichment Score BROWNE_INTERFERON_RESPONSIVE_GENES 2.893714 <0.0001 UP TAKEDA_TARGETS_OF_NUP98_HOXA9_FUSIO <0.0001 UP N_3D_UP 2.889862 ICHIBA_GRAFT_VERSUS_HOST_DISEASE_D7_ <0.0001 UP UP 2.805356 SANA_TNF_SIGNALING_UP 2.760641 <0.0001 UP SANA_RESPONSE_TO_IFNG_UP 2.652481 <0.0001 UP DER_IFN_ALPHA_RESPONSE_UP 2.650679 <0.0001 UP DAUER_STAT3_TARGETS_DN 2.568591 <0.0001 UP DER_IFN_BETA_RESPONSE_UP 2.544266 <0.0001 UP MOSERLE_IFNA_RESPONSE 2.528648 <0.0001 UP RADAEVA_RESPONSE_TO_IFNA1_UP 2.456697 <0.0001 UP ROSTY_CERVICAL_CANCER_PROLIFERATION_ <0.0001 DOWN CLUSTER -3.2496483 SOTIRIOU_BREAST_CANCER_GRADE_1_VS_3_ <0.0001 DOWN UP -3.1307108 WONG_EMBRYONIC_STEM_CELL_CORE -3.0442135 <0.0001 DOWN GRAHAM_CML_DIVIDING_VS_NORMAL_QUIES <0.0001 DOWN CENT_UP -2.9951138 KOBAYASHI_EGFR_SIGNALING_24HR_DN -2.950584 <0.0001 DOWN LEE_EARLY_T_LYMPHOCYTE_UP -2.9474769 <0.0001 DOWN PUJANA_BRCA2_PCC_NETWORK -2.91798 <0.0001 DOWN LI_WILMS_TUMOR_VS_FETAL_KIDNEY_1_DN -2.8696544 <0.0001 DOWN 127 Chapter 4. Genome-wide determination of Id1/3 target genes SHEDDEN_LUNG_CANCER_POOR_SURVIVAL_ <0.0001 DOWN A6 -2.8691382 FURUKAWA_DUSP6_TARGETS_PCI35_DN -2.841147 <0.0001 DOWN Table 4-2 Top 20 gene sets identified from the C2 curated gene sets that are enriched in the Id1/3 knockdown 4T1 cells. C5 GO Gene Set Normalised P value Direction Enrichment Score IMMUNE_RESPONSE 2.136929 <0.0001 UP G_PROTEIN_COUPLED_RECEPTOR_BINDING 2.1243143 <0.0001 UP CHEMOKINE_RECEPTOR_BINDING 2.111146 <0.0001 UP CHEMOKINE_ACTIVITY 2.0914385 <0.0001 UP I_KAPPAB_KINASE_NF_KAPPAB_CASCADE 2.0558612 <0.0001 UP DEFENSE_RESPONSE 2.0529644 <0.0001 UP JAK_STAT_CASCADE 2.0520313 <0.0001 UP HEMATOPOIETIN_INTERFERON_CLASSD200_DO <0.0001 UP MAIN_CYTOKINE_RECEPTOR_ACTIVITY 2.0426128 LOCOMOTORY_BEHAVIOR 2.0126882 <0.0001 UP REGULATION_OF_I_KAPPAB_KINASE_NF_KAPP <0.0001 UP AB_CASCADE 2.0115595 M_PHASE -2.5211284 <0.0001 DOWN CELL_CYCLE_PROCESS -2.5124967 <0.0001 DOWN RNA_PROCESSING -2.4857798 <0.0001 DOWN CHROMOSOME -2.3979888 <0.0001 DOWN 128 Chapter 4. Genome-wide determination of Id1/3 target genes M_PHASE_OF_MITOTIC_CELL_CYCLE -2.3873682 <0.0001 DOWN MITOSIS -2.386327 <0.0001 DOWN CHROMOSOMEPERICENTRIC_REGION -2.366616 <0.0001 DOWN SPINDLE -2.3466449 <0.0001 DOWN CHROMOSOME_ORGANIZATION_AND_BIOGENE <0.0001 DOWN SIS -2.3239574 MITOTIC_CELL_CYCLE -2.3222191 <0.0001 DOWN Table 4-3 Top 20 gene sets identified from the C5 GO gene sets that are enriched in the Id1/3 knockdown 4T1 cells. C6 Oncogenic Gene Set Normalised P value Direction Enrichment Score LTE2_UP.V1_DN 2.389604 <0.0001 UP MEK_UP.V1_DN 2.244798 <0.0001 UP VEGF_A_UP.V1_UP 2.124735 <0.0001 UP WNT_UP.V1_DN 2.070847 <0.0001 UP PKCA_DN.V1_UP 1.969476 <0.0001 UP MYC_UP.V1_DN 1.865835 <0.0001 UP BMI1_DN_MEL18_DN.V1_DN 1.860512 <0.0001 UP MEL18_DN.V1_DN 1.845022 <0.0001 UP BMI1_DN.V1_DN 1.83551 <0.0001 UP STK33_UP 1.819187 <0.0001 UP RPS14_DN.V1_DN -2.3749187 <0.0001 DOWN 129 Chapter 4. Genome-wide determination of Id1/3 target genes HOXA9_DN.V1_DN -2.214685 <0.0001 DOWN CSR_LATE_UP.V1_UP -2.1530662 <0.0001 DOWN PRC2_EZH2_UP.V1_UP -2.0872 <0.0001 DOWN VEGF_A_UP.V1_DN -2.0221975 <0.0001 DOWN RB_P107_DN.V1_UP -2.0133445 <0.0001 DOWN E2F1_UP.V1_UP -2.0126765 <0.0001 DOWN MYC_UP.V1_UP -1.8403969 <0.0001 DOWN STK33_DN -1.8023152 <0.0001 DOWN NFE2L2.V2 -1.7664328 <0.0001 DOWN Table 4-4 Top 20 gene sets identified from the C6 Oncogenic Signatures that are enriched in the Id1/3 knockdown 4T1 cells. 130 Chapter 4. Genome-wide determination of Id1/3 target genes Figure 4-4 Enrichment plots of several top-ranking gene sets that are involved in immune responses. GSEA analysis showed that knockdown of Id1/3 up- regulated genes that are related to the IFN, TNF and JAK-STAT signalling pathway. In addition, in order to identify whether Id1/3 regulate genes or signalling pathways controlling breast cancer metastasis, GSEA analysis was performed with a collection of “metastasis gene sets”. This collection of gene sets (Table 4- 5) consists of several metastatic signatures that were picked from the C2 collection, as well as a group of custom defined gene sets which were not available in the MSigDB database and were built based on several previous major studies which defined genes or molecular signatures that mediate metastasis and the cancer stem cell phenotype (Aceto et al., 2012; Bos et al., 2009; Charafe-Jauffret et al., 2009; Dontu et al., 2003; Kang et al., 2003b; Liu et al., 2007; Minn et al., 2005a; Minn et al., 2005b; Padua et al., 2008; Tang et al., 2007). The aim of this analysis is to understand if there is a functional and regulatory relationship between genes regulated by Id1/3 and the metastatic and CSC genes/signatures identified from these studies. 131 Chapter 4. Genome-wide determination of Id1/3 target genes Many of these gene sets were found to be enriched in the Id1/3 knockdown signature. Through a comprehensive literature search, I went on to systematically look for genes of interest that are known to play important roles in regulating metastasis within the enriched gene sets. This led to the identification of a multitude of metastasis-related genes of interest. The result is presented in Figure 4-5 in a Heatmap which shows the genes with known functional roles in metastasis and were differentially expressed upon Id1/3 knockdown. Since Id1/3 acts to promote tumourigenesis, one would have expected that knocking down Id1/3 would result in a down-regulation of metastasis-promoting genes or an up-regulation of metastasis-suppressing genes. Interestingly, this list of genes identified from my analysis comprised not only metastasis-supressing genes that were up-regulated (miR-30a), and metastasis-promoting genes that were down-regulated (Fermt1, Foxc2), but also a number of genes which were known to promote metastasis that were up- regulated when Id1/3 were knocked down (eg. Angptl4, Tnc, Cxcl1 etc). 132 Chapter 4. Genome-wide determination of Id1/3 target genes Study Signature Type Available on GSEA MSigDB database? Landemaine et al. A six-gene signature Lung metastasis Metastatic Yes predicting breast cancer lung signature of tissue tropism metastasis. Cancer Res. 2008 Aug breast cancer 1;68(15):6092-9 Bild et al. Oncogenic pathway Expression profile Signalling Yes signatures in human cancers as a guide of 4 individual pathway to targeted therapies. Nature 2006, genes -- Myc, 439:353-357. E2F3, Ras, Src, β-catenin van 't Veer et al. Gene expression Poor prognosis Classifier that Yes profiling predicts clinical outcome of signature of classifies breast cancer. Nature 2002, 415:530- breast cancer patients as 536. having good or poor prognosis Wang et al. Gene-expression profiles to Poor prognosis Classifier Yes predict distant metastasis of lymph- signature of node-negative primary breast cancer. breast cancer Lancet 2005, 365:671-679. Ramaswamy et al. A molecular General Classifier Yes signature of metastasis in primary solid metastasis tumors. Nat Genet 2003, 33:49-54. Finak et al. Stromal gene expression Breast tumour Classifier Yes predicts clinical outcome in breast stromal gene cancer. Nat Med 2008, 14:518-527. expression signature Farmer et al. A stroma-related gene Stromal gene Classifier Yes signature predicts resistance to expression neoadjuvant chemotherapy in breast signature of cancer. Nat Med 2009, 15:68-74. breast tumour treated with chemotherapy Kang et al. A multigenic program Bone metastasis Metastatic No 133 Chapter 4. Genome-wide determination of Id1/3 target genes mediating breast cancer metastasis to signature of tissue tropism bone. Cancer Cell 2003, 3:537-549. breast cancer Minn et al. Genes that mediate breast Lung metastasis Metastatic No cancer metastasis to lung. Nature 2005, signature of tissue tropism 436:518-524 breast cancer Bos et al. Genes that mediate breast Bone metastasis Metastatic No cancer metastasis to the brain. Nature signature of tissue tropism 2009, 459:1005-1009. breast cancer Padua et al. TGFbeta primes breast TGF-b signature Signalling No tumors for lung metastasis seeding in lung metastasis pathway through angiopoietin-like 4. Cell 2008, of breast cancer 133:66-77. Aceto et al. Tyrosine phosphatase Shp2 signature in Signalling No SHP2 promotes breast cancer breast cancer pathway progression and maintains tumor- metastasis initiating cells via activation of key transcription factors and a positive feedback signaling loop. Nat Med. 2012 Mar 4;18(4):529-37. Minn et al. Distinct organ-specific Poor prognosis Metastatic No metastatic potential of individual breast signature of tissue tropism cancer cells and primary tumors. J Clin breast cancer ; Invest. 2005 Jan;115(1):44-55. Breast cancer metastasis signature; Bone metastasis signature of breast cancer Tang et al. Transforming growth factor- TGF-b signature Signalling No beta can suppress tumorigenesis in lung metastasis pathway through effects on the putative cancer of breast cancer stem or early progenitor cell and committed progeny in a breast cancer xenograft model. Cancer Res. 2007 Sep 15;67(18):8643-52. 134 Chapter 4. Genome-wide determination of Id1/3 target genes Liu et al. The prognostic role of a gene Gene signatures Cancer stem No signature from tumorigenic breast- of CD44+CD24- cell cancer cells. The New England journal /low tumorigenic of medicine. 2007. 356(3), 217-26. breast-cancer cell-lines and normal breast epithelium Charafe-Jauffret et al. Breast cancer Breast cancer Cancer stem No cell lines contain functional cancer stem stem cell cell cells with metastatic capacity and a signature distinct molecular signature. 2009. Cancer research, 69(4), 1302-13. Dontu, et al. In vitro propagation and Gene signature of Cancer stem No transcriptional profiling of human human mammary cell/ mammary stem/progenitor cells. 2003. stem and Differentiation Genes & development, 17(10), 1253- progenitor cells 70. Table 4-5 Gene expression signatures of breast cancer metastasis and breast cancer stem cells. This table showed a collection of gene sets which comprised several metastatic signatures that were picked from the C2 collection on the MSigDB database and several other signatures that were manually curated. GSEA analysis was carried out to identify whether any of the Id1/3 targets from the profiling experiment are enriched in these signatures. 135 Chapter 4. Genome-wide determination of Id1/3 target genes Figure 4-5 GSEA analysis identified metastasis-related genes that were differentially expressed in response to Id1/3 knockdown. To determine if genes that mediate metastasis were enriched in the Id1/3 signature, GSEA analysis was performed using a manually curated set of metastasis gene sets. Genes differentially expressed in response to Id1/3 knockdown as well as associated with pathways regulating metastasis were identified based on reports from the literature. 136 Chapter 4. Genome-wide determination of Id1/3 target genes 4.2.3 Validation of transcript profiling results As described in Section 4.4.2.2, GSEA analysis led to identification of enriched gene sets encompassing a diversity of processes. A number of signatures appeared to be associated with immune response. Several top gene sets identified from GSEA analysis are involved in interferon signalling, for instance, the gene set BROWNE_INTERFERON_RESPONSIVE_GENES and DER_IFN_ALPHA_RESPONSE_UP. Table 4-6 listed examples of individual genes within these gene sets that were designated “core enriched” by the GSEA algorithm. BROWNE_INTERFERON_RESPONSIVE_GENES was curated from a study by Browne and colleagues (Browne et al., 2001). It is a gene set comprises genes that were up-regulated in primary fibroblast culture after treatment with interferon alpha (Browne et al., 2001). Of the 57 genes annotated to this gene set, 35 were regulated by Id1/3 knockdown (Table 4-6). DER_IFN_ALPHA_RESPONSE_UP consists of a list of genes that were up- regulated in fibrosarcoma by treatment with interferon alpha (Der et al., 1998). 27 out of 50 genes within this gene set were up-regulated when Id1/3 were silenced. This implies that Id1/3 may play a role in mediating and regulating IFN pathway which has been reported to be silenced in a variety of cancer (Ferrantini et al., 2007; Savitsky et al., 2010; Trinchieri, 2010) including human breast cancer (Bi et al., 2011; Bidwell et al., 2012; Bouker et al., 2005). Several top core enriched genes such as Irf7, Stat1, Stat2 have been demonstrated to play a critical tumour supressing role, and silencing of these genes promotes breast cancer metastasis (Bidwell et al., 2012). To validate the profiling result, I chose to analyse expression of a number of the top hits within these gene sets by quantitative real-time PCR. GSEA analysis performed using the metastasis and CSC gene sets has also identified a number of metastasis relevant genes of great interest. All the candidate genes presented in the Heatmap in Figure 4-5 will also be validated by quantitative real-time PCR. Candidate genes that are subjected to validation are summarized in Table 4-7. 137 Chapter 4. Genome-wide determination of Id1/3 target genes BROWNE_INTERFERON_RESPONSI DER_IFN_ALPHA_RESPONSE_UP VE_GENES Gene Core Enrichment Gene Core Enrichment MX2 Yes MX2 Yes STAT1 Yes STAT1 Yes XAF1 Yes OAS2 Yes OAS2 Yes BST2 Yes IRF7 Yes IFI35 Yes BST2 Yes ISG15 Yes EIF2AK2 Yes ADAR Yes IFI44 Yes TAP1 Yes SP100 Yes TRIM21 Yes CXCL11 Yes GBP1 Yes UBE2L6 Yes TRIM14 Yes PSMB8 Yes MX1 Yes IFI35 Yes NMI Yes SP110 Yes PSME1 Yes RSAD2 Yes IL6 Yes ISG15 Yes PML Yes CASP1 Yes PPP3CA Yes TAP1 Yes MAP3K10 Yes TRIM21 Yes RBBP4 Yes GBP1 Yes ATP6V0B Yes 138 Chapter 4. Genome-wide determination of Id1/3 target genes TRIM14 Yes IRF1 Yes TLR3 Yes C1S Yes MX1 Yes VEGFC Yes CXCL10 Yes PDXK Yes GBP2 Yes COL16A1 Yes NMI Yes RHOC Yes PSMB9 Yes CD164 Yes TNFSF10 Yes TDRD7 Yes ISG20 Yes TREX1 Yes PML Yes MYD88 Yes IFIT2 Yes IFI30 Yes Table 4-6. Id1/3 modulates the activity of a number of gene targets within the IFN signalling pathway. Core enrichment of gene targets potentially regulated by Id1/3 is marked as “Yes” under the core enrichment column, suggesting that the differential expression of these genes was significant. 139 Chapter 4. Genome-wide determination of Id1/3 target genes Gene Reference qPCR validation method EMT and Invasion miR30a (Hoffman, 1999; Kelly et al., 2007; Vernon et al., 2007) Taqman TGFBR3 (De Wever and Mareel, 2003; Eckhardt et al., 2012) Taqman FOXC2 (Miller, 1983; Miller et al., 1983) Taqman (Lelekakis et al., 1999; Padua et al., 2008; Yoneda et al., Taqman ANGPTL4 2000) (Eckhardt et al., 2005; Pulaski and Ostrand-Rosenberg, Taqman CXCL1 1998) IL6 (Eckhardt et al., 2005) Taqman (Lasorella et al., 2014; O'Toole et al., 2011; Rabinovich et Taqman ZEB2 al., 2008) PDGFC (Lou et al., 2011) Taqman FERMT1 (Cho et al., 2012; Le Devedec et al., 2009) Taqman SPARC (Al-Ejeh et al., 2013) Taqman Survival in Circulation or Distant Organs IRF7 (Bidwell et al., 2012) Lightcycler IRF9 (Bidwell et al., 2012) Lightcycler STAT1 (Bidwell et al., 2012) Lightcycler STAT2 (Bidwell et al., 2012) Lightcycler VCAM1 (Niola et al., 2013; O'Brien et al., 2012a) Taqman SRC (Barrett et al., 2012) Taqman (Eckhardt et al., 2005; Pulaski and Ostrand-Rosenberg, Taqman CXCL1 1998) 140 Chapter 4. Genome-wide determination of Id1/3 target genes ROBO1 (Hui et al., 2013; Natividad et al., 2013) Taqman Metastasis Niches TNC (Jin et al., 2011) Taqman POSTN (Anido et al., 2010) Taqman CCL5 (Stankic et al., 2013) Taqman Table 4-7 Candidate genes chosen to be validated by quantitative real-time PCR by using either the Lightcycler or the Taqman® probe based system. 4.2.3.1 Knockdown of Id1/3 using independent shRNAs for confirmation of expression profiling results It has been reported that off-target effects can pose a problem for RNAi-based gene silencing experiments and may contribute substantially to the false discovery of candidate genes (Bridge et al., 2003; Jackson et al., 2003; Scacheri et al., 2004; Sledz et al., 2003) . Off-target effects occur when a siRNA is processed by the RNA-Induced Silencing Complex (RISC) and targets unintended targets. Hence, I decided to confirm the results of the expression profiling by a second shRNA to the same target. I went on to generate RNA depleted of Id1/3 expression by independent shRNAs. I utilised a commercially available constitutive lentiviral shRNA system called pMISSION in this experiment. The pMISSION vectors were purchased from Sigma-Aldrich and contained 5 different knockdown sequences for each Id1 and Id3 in the pLKO.1- hPGK-Puro and the pLKO.1-hPGK-Neo vector backbone, respectively. The five different hairpins against Id1 or Id3 were firstly screened to determine which hairpin had the greatest knockdown efficiency. Knockdown efficiency was measured by western blotting for Id1/3 and densitometry (Figure 4-6). It was determined that the pLKO.1-hPGK-Puro-shId1 hairpin #2 and #3, and the pLKO.1-hPGK-Neo-shId3 hairpin #2 and #3 generated the greatest knockdown. For simplicity, these vectors will be described as shId1#2, shId1#3, shId3#2 and shId3#3. The vector shId1#2, shId3#2 and shId3#3 were selected to knock 141 Chapter 4. Genome-wide determination of Id1/3 target genes down both Id1 and Id3 in subsequent experiments for validation of expression profiling and phenotypic assay results performed using the pSLIK system. The 4T1 Enh luc Thy1.1 pool cells were transduced with both pMISSION Id1 and Id3 vectors in two different combinations (shId1 #1 + shId3 #2; shId1 #1 + shId3 #3), and then selected with puromycin and neomycin. A control cell line was also generated by tranducing the 4T1 Enh luc Thy1.1 pool cells with pLKO.1-hPGK-Puro-Non-Targeting and the pLKO.1-hPGK-Neo-Non-Targeting vectors. Protein lysate and total RNA were extracted and subjected to Western blot analysis and quantitative real-time PCR analysis. A modest degree of Id1/3 knockdown was achieved in both shId1 #1 + shId3 #2 and shId1 #1 + shId3 #3 transduced cells, as assessed by Western blot and quantitative real-time PCR (Figure 4-7). Figure 4-6 Testing the pMISSION system for Id1/3 knockdown in 4T1 cells. (A) (i) Analysis of Id1 knockdown using the Sigma-Aldrich pMISSION constitutive shRNA vectors, pLKO.1-hPGK-Puro by Western blot. The 4T1 Enh luc Thy1.1 cells were transduced with individual pLKO.1-hPGK-Puro vector containing an shRNA against Id1, named as shId1#1, shId1#2, shId1#3, shId1#4, shId1#5. 142 Chapter 4. Genome-wide determination of Id1/3 target genes The cells were then selected by puromycin. Protein lysate was collected for Western blot analysis. (ii) Densitometry was carried out to quantify the Id1 expression in each sample. β-actin was used as a loading control. The densitometry values of shId1 transduced cells were normalized to the values of Non-targeting shRNA transduced cells (Puro-NT) which was set at 1. (B) (i) 4T1 Enh luc Thy1.1 cells were transduced with individual pLKO.1-hPGK-Neo construct with an shRNA against Id3 (shId1#1, shId1#2, shId1#3, shId1#4, shId1#5). Cell lysate was collected for Western blot analysis after neomycin selection. (ii) Densitometry quantitation of Id3 expression in each sample. Intensities of individual Id3 bands were adjusted for variations in loading using the relative intensities of the β-actin controls. The densitometry values of shId3 transduced cells were normalized to the values of Non-targeting shRNA transduced cells (Neo-NT), set at 1. 143 Chapter 4. Genome-wide determination of Id1/3 target genes Figure 4-7 Id1/3 double knockdown using the Sigma-Aldrich pMISSION vectors. (A) (i) One best Id1 shRNA vector and two best Id3 shRNA vectors in Figure 4-6 were chosen to knock down both Id1/3 expression. (ii) Densitometry analysis of Id1/3 levels in (i) to determine knockdown efficiency. (B) Id1 (i) and Id3 (ii) mRNA expression was assessed by quantitative real-time PCR using TaqMan® probes. Gapdh was used as an endogenous control for normalisation of samples for any possible variations in amount of RNA added to each cDNA reaction as well as variation in PCR amplification efficiency. Relative mRNA level was obtained by comparing mRNA level in cells transduced with Id1/3 shRNAs to the non-targeting shRNA, set at 1. 144 Chapter 4. Genome-wide determination of Id1/3 target genes 4.2.3.2 Quantitative real-time PCR validation revealed an induction of interferon response by the pSLIK system and off-target gene regulation by RNAi Since both the LIMMA analysis and GSEA analysis identified an enrichment of the IFN signalling in the Id1/3 knockdown signature, the initial focus was made on validating this result. As briefly mentioned previously, I focused on IFN signalling for several reasons. First, IFN signalling has been reported to be silenced in a variety of cancers. Several IFNs such as the type I IFNs are also being used in the treatment of patients with some types of cancer (Ferrantini et al., 2007; Savitsky et al., 2010; Trinchieri, 2010). Second, in breast cancer, silencing of several interferon regulatory factors (IRF) such as IRF1, IRF5 and IRF7 helps the cancer cells to avoid host immune response and promotes metastasis (Bi et al., 2011; Bidwell et al., 2012; Bouker et al., 2005). Third, several downstream signalling molecules of IFN such as Stat1 and Stat2 have been demonstrated to play a tumour supressing role (Bidwell et al., 2012; Huang et al., 2002). The mRNA expression levels of candidate genes involved in the IFN and JAK- STAT signalling, namely, Irf7, Irf9, Stat1 and Stat2, were analysed by quantitative real-time PCR using the same RNA samples (4 biological replicates) used for the profiling experiment and the RNA generated by the pMISSION system in the previous section. In addition, a separate experiment was set up to collect RNA from Dox treated or untreated pSLIK C8 and pSLIK shGFP cells. This RNA was also used in the validation. The pSLIK C8 RNA from this experiment served as another biological replicate of the RNA samples used for expression profiling. Result from the quantitative real-time PCR was presented in Figure 4-8. mRNA expression levels of all four genes were increased in pSLIK C8 cells treated with Dox. Surprisingly, a dramatic increase in the mRNA levels of all four genes was also detected in the Dox treated pSLIK shGFP cells which were not related to the inhibition of Id1/3. The pMISSION shId1/3 (shId1 #1 + shId3 #2 and shId1 #1 + shId3 #3) showed no or minimal effect on the levels of Irf7, Irf9, Stat1 and Stat2 mRNA expression when compared to the control (Puro-NT + Neo-NT). This finding suggested that the upregulation of Irf7, Irf9, Stat1, Stat2 and possibly other IFN pathways and 145 Chapter 4. Genome-wide determination of Id1/3 target genes immune response identified in the GSEA were not specific to Id1/3 but rather were driven by shRNA expression from the pSLIK vector. This finding was also confirmed on the pSLIK C12 and the pSLIK shId1/3 pool cells (results not shown). The induction of this interferon response is specific to the presence of pSLIK RNAi elements, as transduction with pMISSION did not induce the expression of these interferon related genes. Treatment of Dox on the 4T1 Enh luc Thy1.1 did not cause any expression change on Irf7, Irf9, Stat1 and Stat2, which suggested that the activation of the interferon system was not a result of Dox treatment. In addition, induction of the interferon response was not caused by viral transduction, as a subsequent quantitative real-time PCR performed with RNA from the 4T1 parental cells treated with or without Dox showed no difference in the expression of on Irf7, Irf9, Stat1 and Stat2 (data not shown). 146 Chapter 4. Genome-wide determination of Id1/3 target genes Figure 4-8 Validation of array results by quantitative real-time-PCR using the Lightcycler® System. Relative mRNA expression of Irf7 (A), Irf9 (B), Stat1 (C) and Stat2 (D) in RNA from the 4T1 Enh luc Thy1.1 Clonal cell line 1 (Control C1), pSLIK shId1/3 Clonal cell line 8 (pSLIK C8), pSLIK shGFP and pMISSION, as indicated. **p<0.0001, *p<0.05, unpaired t-test. Error bars represent SEM. 147 Chapter 4. Genome-wide determination of Id1/3 target genes 4.2.3.3 Validation of metastasis-related genes identified several genes of interest and potential targets of Id1/3 Quantitative real-time PCR was carried out to validate the rest of the candidate genes in Table 4-8 using specific Taqman probes. Similar to the non-Id1/3 specific activation of the IFN response, the expression of a number of genes was found to be altered in both pSLIK C8 and pSLIK shGFP cells induced by Dox (Figure 4-9). I specifically looked for genes which were differentially expressed in the Id1/3 knockdown cells, i.e. pSLIK C8 +Dox and pMISSION shId1/3, but not genes whose expressions are altered when targeted by knockdown of GFP in the pSLIK shGFP cells treated with Dox. This led to the identification of several gene candidates, namely, Tgfbr3, Foxc2, Vcam1, Robo1 and Postn. The expression of Tgbr3, Vcam1, Robo1 and Postn were up- regulated in response to Id1/3 knockdown by both the pSLIK and pMISSION approach, while Foxc2 expression was reduced when Id1/3 were depleted. The expression of these five genes remained unchanged in the pSLIK shGFP cells under Dox induction. 148 Chapter 4. Genome-wide determination of Id1/3 target genes Pri-miR30a Tgfbr3 Foxc2 6 ·;;;"0 NS ·;;;0" ** ·";;;0 I!!"' 1 "'I!! "'~ Q. Q. )( ~4 )( " " " Angptl4 Cxcl1 116 Zeb2 Pdgfc Fermt1 15 "0 "0 "0 ·;;; ·;;; ·;;; NS I!!"' I!!"' "'~ Q. )( ~ 1 ~ 1 Spare Vcam1 Src ** 0 0 ·;;;" 0 ·";;; ·";;; I!! I!!"' "' I!!"' Q. ~2 Q. )( )( <" 149 Chapter 4. Genome-wide determination of Id1/3 target genes Figure 4-9 Validation of expression profiling results by quantitative real-time- PCR using the Taqman® probe based system. Relative mRNA expression of Pri-miR30a, Tgfbr3, Foxc2, Angptl4, Cxcl1, Il6, Zeb2, Pdgfc, Fermt1, Sparc, Vcam1, Src, Robo1, Tnc, Postn and Ccl5 in RNA from the 4T1 pSLIK shId1/3 Clonal cell line 8 (pSLIK C8), pSLIK shGFP and pMISSION transduced cells, as indicated. **p<0.0001, *p<0.05, unpaired t-test. Error bars represent SEM. 150 Chapter 4. Genome-wide determination of Id1/3 target genes 4.2.4 Validation of regulation of TGF-β signalling by Id1/3 After narrowing my focus down to a smaller number of candidate genes, I decided to functionally validate them. Of the potential Id1/3 target genes, Tgfbr3 and Postn represented interesting candidates. Several studies have indicated that ID gene transcription could be regulated by members of BMP and TGF-β superfamily in some contexts although in most of the cases the mechanism is unclear (Anido et al., 2010; Kang et al., 2003a; Kowanetz et al., 2004; Padua et al., 2008; Stankic et al., 2013). Both Tgfbr3 and Postn are involved in the TGF-β signalling pathway which has a complex role in regulating breast cancer metastasis. TGF-β acts as a tumour suppressor prior to tumour initiation and oncogenesis. However at later stages, TGF-β plays a critical role in promoting tumour progression (Massague, 2008). The TGF-β ligands function by binding to their receptor, the type II TGF-β receptor (Tgfbr2). The presence of the type III TGF-β (Tgfbr3) enhances the binding of the TGF-β binds to the Tgfbr2. Once bound to TGF-β, Tfgbr2 recruits and phosphorylates Tgfbr1, leading to activation of Smad2 and Smad3 by phosphorylation. Activated Smad2 and Smad3 form heterodimers with Smad4 and translocate to the nucleus and interacts with other transcription factors to regulate the transcription of TGF-β– responsive genes (Figure 4-10). It has been reported that overexpression of Tgfbr3 in MDA-MB-231 breast cancer cells suppresses tumour growth and metastasis in animal models (Bandyopadhyay et al., 1999). A separate study using 4T1 cells showed that restoring Tgfbr3 expression dramatically inhibited tumour invasiveness in vitro and tumour invasion, angiogenesis, and metastasis in vivo (Dong et al., 2007). Mechanistically, Tgfbr3 appeared to function by undergoing ectodomain shedding to produce soluble Tgfbr3 that antagonize the metastasis-promoting activity of TGF-β by sequestering active TGF-β isoforms that are produced by the cancer cells (Bandyopadhyay et al., 1999; Dong et al., 2007). Thus, loss of Tgfbr3 expression promotes breast cancer progression. An increase Tgfbr3 expression was observed in 4T1 cells depleted of Id1/3 expression in my experiment. This led to my hypothesis that knockdown of Id1/3 decreases 4T1 malignant phenotype through Tgfbr3 mediated repression of TGF-β signalling. As demonstrated in Chapter 3, knockdown of Id1/3 decreased 4T1 cell proliferation, which could be a result of a decreased TGF-β signalling 151 Chapter 4. Genome-wide determination of Id1/3 target genes due to an increased production of soluble Tgfbr3. To test this, I examined whether overexpression or treatment of TGF-β will rescue the proliferation defect of Id1/3 depleted cells by supplying the cells with more TGF-β ligand. 4T1 pSLIK C8 cells were treated with Dox for 3 days to deplete Id1/3 expression. Following that, the cells were stimulated with TGF-β1 and assayed for proliferation by MTS over a time course of 4 days. Results of the assay are presented in Figure 4-11. TGF-β1 stimulation failed to rescue the reduced activity of proliferation caused by suppression of Id1/3. As shown in Figure 4-11 (A), pSLIK C8 cells treated with Dox and TGF-β1 displayed a similar growth curve as the pSLIK C8 cells treated with Dox alone. Following this, I performed another experiment to investigate whether increased Tgfbr3 expression attenuate TGF-β signalling in the Id1/3 depleted 4T1 cells by examining activation of the Smad pathway by Western blot analysis. 4T1 pSLIK C8 cells were cultured in the presence of Dox for 3 days to deplete Id1/3 expression. Cell lysate was harvested on day 3 for Western blot analysis of total Smad3 and phospho-Smad3. In addition, a separate experiment was set up in parallel in which the cells were induced with Dox for 3 days and followed by treatment with TGF-β1 for 2 days. Cell lysate was collected from these TGF-β1 cells and served as a positive control for Smad3 activation in the Western blot analysis. If TGF-β signalling is antagonized by increased expression of Tgfbr3, one would expect to observe a decrease in phospho-Smad3 in the 4T1 cells depleted of Id1/3 expression. As shown in the Western blot in Figure 4-12, a 50% reduction of Id1/3 expression was observed when the cells were treated with Dox. TGF-β stimulation caused an increase expression of Id1/3 in cells regardless of Dox treatment, which is consistent with Padua’s study which showed Id1/3 expression is influenced by TGF-β signalling in breast cancer (Padua et al., 2008). Loss of E-cadherin was observed following Id1/3 knockdown and TGF-β treatment. Knocking down Id1/3 did not result in a reduction of Smad3 phosphorylation compared with the cells cultured in the absence of Dox. While Smad3 phosphorylation was not changed, we observed a significant reduction of total Smad3 in the cells treated with Dox. This suggested the expression of Smad3 is regulated by Id1/3. Since Smad3 is a substrate protein of TGF-β receptors and the cellular responses to TGF-β are mediated solely or partially through the canonical Smad signalling pathway, this implied a regulation of 152 Chapter 4. Genome-wide determination of Id1/3 target genes TGF-β signalling by Id1/3. An interesting point to make from the Western blot is that depletion of Id1/3 in the 4T1 cells resulted in increased TGF-β–stimulated Smad3 phosphorylation compared to the unstimulated cells. I am currently validating the regulation of Smad3 expression by Id1/3 by several in vitro assays and tumour samples from metastatic disease. First, overexpression experiment is being performed to test if etopic expression Smad3 can rescue proliferative defect caused by downregulation of Id1/3. In addition, by collaborating with my co-supervisor Dr Radhika Nair, we are examining the expression of several target genes of the TGF-β signalling in Id1/3 depleted mouse tumour and metastatic tissue which I generated and will be further elaborated in Chapter 5. 153 Chapter 4. Genome-wide determination of Id1/3 target genes Figure 4-10 The transforming growth factor β signalling pathway. Figure adapted from Hui et al (Hui and Friedman, 2003). Figure 4-11 Effect of TGF-β stimulation on 4T1 cells depleted of Id1/3 expression. pSLIK C8 (A) and pSLIK shGFP (B) were grown with or without Dox for 3 days to knock down Id1/3 expression. At the completion of Dox treatment, cells were collected, seeded and allowed to plate down in 96-well plates in the presence or absence of Dox for 24 hours before the medium was supplemented with or without TGF-β1 at a concentration of 2.5ng/ml. Quantification of viable cells was performed for 4 days post TGF-β1 treatment through an MTS assay. Averages and standard deviations were collected from 6 replicates. Data is representative of two independent experiments. 154 Chapter 4. Genome-wide determination of Id1/3 target genes Figure 4-12 Western blot analysis of Smad3 phosphorylation in Id1/3 depleted 4T1 cells. (A) 4T1 pSLIK C8 cells were treated with Dox for 3 days and subjected to western blot of total and phosphorylated Smad3 (from the same lysates). A separate set of cells were treated with Dox, which then followed by TGF-β1 treatment (2.5ng/ml) for 2 days to examine the effect of Id1/3 knockdown on the Smad pathway in response to TGF-β stimulation. E-cadherin 155 Chapter 4. Genome-wide determination of Id1/3 target genes expression was also examined by Western blot. (B) Densitometry analysis was performed on two independent duplicate western blot experiments. Gapdh was used as a control to normalize difference in loading. Densitometry value of each sample was compared to the value of Dox untreated sample (–Dox), set at 1. (C) Smad3 activation is examined by comparing the expression level of phosphorylated Smad3 protein to total Smad3 protein in the same sample. *p<0.05, unpaired t-test. N= 3. Error bars represent SEM. 4.2.5 Bmi1 expression was down-regulated in Id1/3 depleted 4T1 cells As described earlier, GSEA analysis showed significant enrichment for three BMI1/MEL18 related gene sets upon knockdown of Id1/3 in 4T1 cells. In addition, previous work from my Honours study identified BMI1 as one of the top candidate genes in the Id1/3 signature in MDA-MB-231 cells. BMI1 is a member of the family of PcG (polycomb) proteins that acts to epigenetically repress gene transcription through histone methylation. BMI1 is required for physiological stem cell homeostasis and is activated in numerous cancers and regulates many pathways in common with ID1 including p21, p16 and Cyclin D1 (Park et al., 2004; Qian et al., 2010; Wang et al., 2012a; Yan et al., 2012). I next tested whether BMI1 is a downstream target of ID1. In order to do that, I first performed a western blot analysis and quantitative real-time PCR of Bmi1 expression in the 4T1 cells depleted of Id1/3 expression. 4T1 pSLIK C8 and Control C1 cells were grown under the presence of Dox to knock down Id1/3 expression at several time points. In addition to the pSLIK C8 cells, another clonal cell line, the pSLIK C12 was also included in this experiment. Protein lysate and RNA was harvested and subjected to Western blot and quantitative real-time PCR. The result of both analyses was presented in Figure 14-13. Both protein and mRNA expression of Bmi1 was down-regulated upon Id1/3 knockdown in the 4T1 cells. As I had shown earlier that knockdown of Id1/3 affected cell proliferation of 4T1, I am currently performing experiments to overexpress Bmi1 in order to examine if the proliferative defect can be rescued. As Bmi1 has been documented to play a crucial role in controlling self-renewal phenotype in normal stem and progenitor cells as well as EMT and cancer stemness in several cancer types (Kreso et al., 2014; Park et al., 2004; Siddique and Saleem, 2012; Yang et al., 2010), I will also examine if 156 Chapter 4. Genome-wide determination of Id1/3 target genes overexpression of Bmi1 will rescue the self-renewal defect in the Id1/3 depleted 4T1 cells. 157 Chapter 4. Genome-wide determination of Id1/3 target genes Figure 14-13 Knockdown of Id1/3 in 4T1 cells down-regulates Bmi1 expression. (A) Western blot analysis of Bmi1 protein expression in 4T1 Control C1, pSLIK C8 and pSLIK 12 cells cultured under the treatment with or without Dox. (B) Quantitative real-time PCR analysis of Bmi1 mRNA expression in the 4T1 Control C1, pSLIK C8 and pSLIK C12 cells treated with or without Dox for 3 days. mRNA expression of Dox treated cells was normalized to the values of Dox untreated samples, set at 1. **p<0.0001, unpaired t-test, error bars represent SEM. 158 Chapter 4. Genome-wide determination of Id1/3 target genes 4.3 Discussion 4.3.1 Determination of Id1/3 target genes by gene expression profiling To gain further insight into the signalling pathways modulated by Id1/3 in driving the malignant phenotype of breast cancer, I performed gene expression profiling analysis on the 4T1 pSLIK C8 cells. Comparison of transcriptional profiles in Id1/3-depleted 4T1 cells and the control set has revealed a plethora of differentially expressed genes. By setting a Q-value cut-off of less than 0.05, 6081 differentially expressed genes were identified. Among them, 3310 genes were found to be up-regulated, and 2771 genes were downregulated in Id1/3- depleted 4T1 cells. This is a remarkably high number of differentially expressed genes. It may imply that Id1/3 control a large number of genes. This was not unexpected, as Id1/3 are known to regulate a number of different cellular processes. These differentially expressed genes can be either direct or indirect targets of Id1/3, although many could be indirectly regulated through proliferative arrest. Direct targets are defined as those with ID1/3 binding sites. ChIP and ChIP-Seq would be useful to distinguish between direct and indirect targets. As mentioned earlier in the introduction section, there are no published comprehensive reports of Id1/3 transcriptional targets in breast cancer, however a small number of candidate genes have been suggested to be regulated by Id1, including MT1-MMP (Fong et al., 2009; Lin et al., 2000a), p21 (Tang et al., 2002), p16 (Alani et al., 2001). Interestingly, none of these genes are found to be regulated by Id1/3 from this expression profile. This may be due to the tissue specific functions of Id1/3. There may be differences between Id1 targets in different cell types, since regulation of p16 by ID1 was reported in fibroblasts (Alani et al., 2001); the link between ID1 and MT1-MMP was discovered in T47D and MDA-MB-231 cells; and p21 in human endothelial cells. Furthermore, these genes may be “late” indirect targets of Id1 and hence were not altered in expression by 48 hours following Dox induction. qRT-PCR validation of potential targets from the microarray analysis using the Id1/3 KD cells generated by the pMISSION system has eliminated many potential targets but left a few for further analysis. Interestingly, the remaining targets (Tgbr3, Foxc2, Robo1, Vcam1 and Postn) were not similarly altered by ID1 KD in the MDA-MB-231 159 Chapter 4. Genome-wide determination of Id1/3 target genes cells which was performed during my Honours study described earlier. This could be due to the tissue specific role of IDs. In addition, the knockdown experiment in MDA-MB-231 was carried out by knockdown of only ID1 but not both ID1 and ID3. This could be another reason why these targets were not identified in ID1 depleted MDA-MB-231 due to compensation from ID3. 4.3.2 Induction of an interferon response by shRNA expression from the pSLIK vector in 4T1 cells A large number of genes related to the interferon response were found to be upregulated upon Id1/3 knockdown from the expression profiling. GSEA analysis also revealed several top ranked gene sets up-regulated in response to Id1/3 knockdown that were associated with pathways triggered by inflammatory and immune responses such as IFN and TNF. The IFN signalling represents an interesting candidate as it is well implicated in tumourigenesis (Ikeda et al., 2002; Zaidi and Merlino, 2011). IFN signalling has been reported to be silenced in a variety of cancer. For instance, Belinda Parker’s group at the Peter MacCallum Cancer Centre recently showed that several interferon regulatory factors such as Irf7 and Irf9 have a critical tumour supressing role. Silencing of these genes promotes breast cancer metastasis to the bone (Bidwell et al., 2012). In order to validate regulation of IFN by Id1/3, I performed quantitative real-time PCR to assess the expression of several IFN related genes, including Irf7, Irf9, Stat1 and Stat2 using RNA depleted of Id1/3 expression from the pSLIK C8 cells and RNA from the pSLIK shGFP cells. Another shRNA silencing vector system, the pMISSION vectors with independent shRNAs was also used to validate the expression profiling results. Expression of the four genes (Irf7, Irf9, Stat1 and Stat2) was found to be upregulated in both Dox treated pSLIK C8 and pSLIK shGFP cells, but not the pMSSION transduced cells. This finding suggested that the induction of interferon response was not specific to Id1/3 but rather was driven by shRNA expression from the pSLIK vector. This non- specific effect could also be an artefact of the pSLIK system. In addition, the shRNA sequences used in each of the 2 pSLIK and pMISSION vectors are not 160 Chapter 4. Genome-wide determination of Id1/3 target genes the same. There is a possibility that the artefactual immune/interferon response was specific to the particular shRNA sequences used in each of the 2 vectors. A number of studies from the literature have reported off-target gene regulation by RNA interference (Bridge et al., 2003; Jackson et al., 2003; Scacheri et al., 2004; Sledz et al., 2003). RNAi allows selective gene silencing, and is widely used for functional analysis of individual genes in mammalian cells. It also represents an attractive therapeutic option for treating certain diseases. However, growing evidence exists that the expression of shRNAs can trigger cellular immune response resulting in unspecific cellular phenotypes and side effects. An earlier study by Sledz and colleagues showed that transfection of siRNAs results in IFN-mediated activation of the Jak–Stat pathway and global upregulation of IFN-stimulated genes (Sledz et al., 2003). Jackson and co- workers reported a similar observation by utilizing gene expression profiling to characterize specificity of gene silencing by siRNAs. Transcript profiles revealed siRNA-specific rather than target-specific expression profiles in several cell lines they tested (Jackson et al., 2003). More recently, vectors that express shRNAs have been used extensively for stable and long term silencing of genes. The expression of shRNAs in these vectors is driven from RNA polymerase III promoters. shRNAs are then processed to siRNAs that guide the degradation of the target mRNA by the RISC complex. Although an increasing number of in vitro and in vivo studies have shown efficient and specific silencing of gene expression, similar to the transfection of siRNAs, growing evidence exists that vector-driven expression of first generation shRNAs can trigger cellular immune response and can lead to deleterious off-target effects (Brummelkamp et al., 2002). For example, a study by Alvarez et al (Alvarez et al., 2006) showed that activation of innate cellular immune response by shRNA expression in primary hippocampal neurons resulted in a retraction of synapses and dendritic spines. Similarly, Cao and colleagues showed that shRNA expression in zygotes caused early embryonic lethality, which was associated with increased expression of an interferon-induced gene (Cao et al., 2005). In general, the introduction of double stranded RNA (dsRNA) into a cell may provoke diverse antiviral effects mediated by several intracellular receptors. Studies have shown that dsRNA located and processed in the endosome may activate Toll-like 161 Chapter 4. Genome-wide determination of Id1/3 target genes receptors leading to the induction of type 1 interferons (Hornung et al., 2005; Kariko et al., 2004). In addition, it has also been reported that cytoplasmic sensors such as the RNA-dependent protein kinase can mediate dsRNA- triggered interferon response and in polymerase III driven shRNA expression systems, specific sequences around the transcription start site have been identified, which can also lead to interferon (IFN) induction (Pebernard and Iggo, 2004; Sledz et al., 2003). IFN can then bind to cell surface receptors in an auto- or paracrine fashion and confers a more global antiviral state by inducing a complex array of IFN-stimulated genes, including RNA-dependent protein kinase and a family of oligo adenylate synthetase (Oas) enzymes (Garcia- Sastre and Biron, 2006). More recently, second generation shRNA constructs have been designed, in which the stem of the endogenously expressed primary microRNA-30 (miRNA- 30) was replaced with gene-specific duplexes for different target genes (Boden et al., 2004; Zeng et al., 2002). It has been shown that these “second generation” shRNA constructs are more efficient in gene silencing and it has been speculated that due to its similarity to miRNAs, these constructs are less likely to induce immune response (Boden et al., 2004; Cullen, 2006). The pSLIK system (Shin et al., 2006) used in this study is a miRNA-30-adapted shRNA vector, hence we did not expect an induction of interferon response triggered by expression of shRNAs. No study has reported induction of immune/interferon response by any second generation miRNA-30-adapted shRNA vectors in mammalian cells. However, the non-specific effect observed here has prompted me to think if the changes in interferon gene expression can lead to measurable phenotypes (such as false positives) in my experiments. As described earlier, knockdown of Id1/3 was found to impair proliferation of 4T1 cells (Figure 3-5 in Chapter 3). This effect was only observed in the 4T1 pSLIK shId1/3 cells under Dox induction but not in the 4T1 pSLIK shGFP cells when treated with Dox. This indicates that the proliferative defect was indeed Id1/3 specific but not a false positive result. 162 Chapter 4. Genome-wide determination of Id1/3 target genes 4.3.3 A potential regulation of TGF-β signalling by Id1/3 One of the genes that was also validated to be regulated by Id1/3 by quantitative real-time PCR and shown to be their bona fide target was Tgfbr3, a component of the TGF-β signalling (Massague, 2008). Several studies have indicated that ID1 gene transcription is induced by transforming TGF-β (Anido et al., 2010; Kang et al., 2003a; Kowanetz et al., 2004; Padua et al., 2008; Stankic et al., 2013). However, on the other hand, whether TGF-β signalling could be regulated by ID1/3 is not clear. TGF-β plays a role in the regulation of ID1 in high grade glioma to control self renewal capacity of glioma initiating cells (Anido et al., 2010). In breast cancer, Padua and workers showed an activation of ANGPTL4 and ID1 by TGF-β to promote metastasis by priming breast cancer cells to the lungs and reinitiating colonization (Padua et al., 2008). A very recent report by Robert Benezra’s group showed that that ID1 expression is regulated by TGF-β. Upregulation of ID1 by TGF-β occurs in disseminated breast cancer cells that had undergone EMT, facilitating seeding of the cells in the lung and metastatic colonization (Stankic et al., 2013). Loss of Tgfbr3 expression promotes breast cancer progression. Tgfbr3 has been shown to supress breast tumour growth and metastasis in animal models by two separate groups using the MDA-MB-231 (Bandyopadhyay et al., 1999) and 4T1 cells (Dong et al., 2007). Both studies demonstrated that Tgfbr3 functions by undergoing ectodomain shedding to produce soluble Tgfbr3 which can antagonize the activity of TGF-β by sequestering active TGF-β isoforms in the cancer cells (Bandyopadhyay et al., 1999; Dong et al., 2007). Based on these report, I hypothesis that Id1/3 potentially regulate Tgfbr3 to promote breast cancer progression. To test this, I used cell proliferation as a phenotypic readout. I tested whether treatment of TGF-β would rescue the proliferation defect of Id1/3 depleted cells. However, result from the proliferation assay showed that the defect in proliferation in the Id1/3 depleted 4T1 cells could not be rescued solely by TGF-β treatment. Such an outcome could potentially be explained by the pleotropic effects of Id1/3, which could be regulating a myriad of other targets and pathways as indicated by the large number of genes and gene sets identified in the transcript profiling experiment. In addition, we could postulate that the tumour and metastasis promoting effect exhibited by Id1/3 is 163 Chapter 4. Genome-wide determination of Id1/3 target genes the coordinate regulation of multiple genes or critical pathways, yet to be identified. This is also further supported by the fact that from GSEA analysis, I observed an enrichment in a subset of genes involved in a number of important cellular processes, in particular, Id1/3 knockdown downregulated a number of gene sets involved in cell cycle progression. In addition to the rescue experiment with exogenous TGF-β described above, ectopic TGFBR3 expression represents an interesting experiment to test if we could phenocopy the effect of Id1/3 knockdown. However, due to time constraints, this experiment was not performed. 4.3.4 Bmi1 as a potential target of Id1/3 in 4T1 cells and may integrate the multiple pathways regulated by Id1/3 Analysis done by using the C6 gene sets showed there was an enrichment of genes involved in three BMI1/MEL18 oncogenic signatures. These BMI1 signatures comprised of genes down-regulated upon knockdown of BMI1 in a study done on medulloblastoma (Wiederschain et al., 2007). Western blot and real-time PCR analysis showed that both Bmi1 protein and mRNA expression were down-regulated in 4T1 pSLIK C8 and C12 clonal cell lines with Dox- induced Id1/3 knockdown. Consistent with this finding, BMI1 was previously identified to be an ID1 target gene from an expression profiling experiment I performed on the MDA-MB-231 cells depleted of ID1 expression by siRNA during my Honours study. BMI1 has a well characterised role as a stem cell regulator. It is a member of the family of PcG (polycomb) proteins which act to repress gene transcription. As described briefly before further elaboration later in this section, BMI1 regulates several pathways in common with ID1 and has been shown to regulate a number of known ID1 target genes, including p21, p16 and cyclin D1 (Park et al., 2004). Therefore, BMI1 may be a key downstream target of ID1. A study by Qian and colleagues in 2010 reported a regulation of MEL18 and BMI1 by ID1 in MDA-MB-231. It was shown that ID1 induces MEL18 downregulation via AKT signalling, and consequently upregulates c-MYC and ID1. However, the significance and the functional role 164 Chapter 4. Genome-wide determination of Id1/3 target genes of the regulation of MEL18/BMI1 by ID1 in controlling the malignant phenotypes of breast cancer were not explored in the study. ID1 has been reported in many studies to have critical functions in maintenance of proliferative potential and multipotency of normal stem cells. For example, upregulation and overexpression of Id1 causes mouse embryonic stem cells to maintain in an undifferentiated pluripotent state by inhibiting neural differentiation, on the other hand, deletion of Id1 transgene causes embryonic stem cells to differentiate (Ying et al., 2003). Furthermore, Id1 is required for self-renewal and the maintenance of an undifferentiated state of the haematopoetic stem cells. Jankovic and Perry (Jankovic et al., 2007; Perry et al., 2007) isolated haematopoetic stem cells from Id1-null mice and showed that the cells readily committed to myeloid differentiation in culture, and failed to repopulate bone marrow in in vivo competitive repopulation transplant studies. Similarly, BMI1 has also been reported to regulate self-renewal of stem cells such as hematopoitic stem cells and neuronal stem cells (Park et al., 2004; Schuringa and Vellenga, 2010). Self-renewal is a major characteristic of a stem cell to undergo numerous cell divisions while maintaining an undifferentiated manner. In cancer, Bmi1 has been shown to play a role in controlling stemness phenotype of several cancers, contribute to uncontrolled proliferation of stem- like cells and leads to unfavourable clinical outcome (Gargiulo et al., 2013; Lessard and Sauvageau, 2003; Polytarchou et al., 2012; Zhu et al., 2014). As reviewed in the introduction section, previous studies have implicated a role of ID1/3 in breast cancer development and progression. BMI1 also plays an important role in controlling cell cycle, cell proliferation and differentiation of mammary epithelial cells (Pietersen et al., 2008). Extensive evidence from the literature has also implicated BMI1 in breast cancer. BMI1 overexpression promotes mammary stem cell self-renewal and proliferation (Liu et al., 2006; Pietersen et al., 2008; Shimono et al., 2009); and invasion and metastasis in breast cancer (Guo et al., 2011). Overexpression of BMI1 induces telomerase activity and immortalizes human mammary epithelial cells (Dimri et al., 2002). More strikingly, similar to ID1 (Gupta et al., 2007), BMI1 was found to be overexpressed in the basal/triple-negative breast cancers (Storci et al., 2008; 165 Chapter 4. Genome-wide determination of Id1/3 target genes Wang et al., 2012b). In contrast, MEL18 was found to be downregulated in breast cancer tumours (Riis et al., 2010). These functional similarities between ID1 and BMI1 suggest that BMI1 may be a bone fide target of ID1 and a key mediator of ID1 action. The possibility that Bmi1 may be an effector of Id1 also helps us interpret several pathways previously reported to be regulated by Id1 in breast cancer as well as the phenotype associated. This also allows me to generate a number of testable hypotheses to pursue to complete this study. As described in the Introduction, ID1 is required for the proliferation of many cell types, including fibroblasts and mammary epithelial cells (Lin et al., 1999; Norton et al., 1998; Swarbrick et al., 2005). Id1 promotes cell proliferation by reducing the expression of Cyclin-dependent kinase inhibitor (CKI) such as p16 and p21 (Alani et al., 2001; Tang et al., 2002), which prevent cell cycle progression by inhibiting cyclin-dependent kinases such as CDK4 and CDK6 to prevent their binding with cyclin D and cyclin E (Serrano et al., 1993). p16 is also a modulator of cellular senescence, a premature growth arrest associated with progressive loss of telomeres following cell divisions (Huot et al., 2002). However, the mechanism of regulation of these CKIs by ID1 is unknown. BMI1 is a transcription repressor of p16 and p21 (Fasano et al., 2007; Meng et al., 2010), thus it is possible that ID1 regulates these genes via regulation of BMI1. A number of studies have shown that ID1 promotes tumourigenicity by activating the AKT/PKB (Protein Kinase B) signalling pathway in several cancers including prostate, esophageal cancer, head/neck, lung and breast cancer (Cheng et al., 2011; Lee et al., 2009; Li et al., 2009; Lin et al., 2010; Ling et al., 2003). In breast cancer cell, ID1 activates AKT-mediated WNT signaling to promote cell proliferation (Lee et al., 2009). However, the molecular link between ID1 and AKT activity was not described. Activation of AKT has been found in many types of cancer and is involved in many cellular pathways contributing to cancer progression such as malignant transformation, anti- apoptotic signalling and increased cellular survival (Vivanco and Sawyers, 2002). Active AKT signalling also upregulates cyclin D1 post-transcriptionally, and our laboratory has previously reported regulation of Cyclin D1 by ID1 166 Chapter 4. Genome-wide determination of Id1/3 target genes through an unknown mechanism (Swarbrick et al., 2005). More importantly, several studies have also shown that BMI1 modulates AKT activity in breast cancer cells (Guo et al., 2007b; Xu et al., 2011), raising the possibility that ID1 may signal via BMI1 to regulate this pathway. Taking together all this information, the regulation of Bmi1 pathway by Id1 remains an interesting model to be tested experimentally. It is attractive in that it connects previously unrelated functions of ID1 in controlling proliferation, differentiation, tumourigenesis and metastasis in cancer. As demonstrated in Chapter 3, knockdown of Id1/3 affected cell proliferation and self-renewal capacity of the 4T1 cells, it would be interesting to see if we could reverse the reverse the defects in cell proliferation and self-renewal by overexpressing Bmi1. This is an ongoing working that I am currently pursuing. In Chapter 5, I will describe several in vivo experiments that I undertook to dissect the role of Id1/3 in controlling the metastatic progression of breast cancer. I demonstrated that Id1/ 3 knockdown in vivo reduces primary tumour growth and spontaneous lung metastasis. Further work is required in future to address the requirement for Bmi1 in Id1/3-mediated tumour growth and metastasis in mouse models of breast cancer. 167 Chapter 5. The role of Id1 and Id3 in breast cancer metastasis Chapter 5. The role of Id1 and Id3 in breast cancer metastasis 5.1 Introduction 5.1.1 Breast cancer metastasis Metastasis is a process that involves the spread of a tumour to distant parts of the body from its original site. Metastasis is responsible for as much as 90% of cancer-associated mortality, yet it remains the most poorly understood component of cancer pathogenesis (Wan et al., 2013). Metastasis is a complex multistep process. Cancer cells which leave a primary tumour must overcome many barriers to generate aggressive secondary tumours at the distant sites. To begin a metastatic cascade, a rare minority of cancer cells within a tumour undergo phenotypic changes such as the acquisition of EMT phenotype and transform into metastatic cells to initiate invasion and early metastatic dissemination. During metastatic dissemination, cancer cells from a primary tumour execute the following sequence of steps, termed as the “metastasis cascade” (Figure 5- 1): The cells locally invade the surrounding tissue, enter the microvasculature of the lymph and blood systems (intravasation), survive and translocate largely through the bloodstream to microvessels of distant tissues, exit from the bloodstream (extravasation), survive in the microenvironment of distant tissues, and finally adapt to the foreign microenvironment of these tissues in ways that facilitate cell proliferation and the formation of a macroscopic secondary tumour, a process known as colonization (Gupta and Massague, 2006). How cancer cells moving from a tumour into the circulation manage to infiltrate distant organs and initiate metastatic growth is of interest to cancer biologist. Until today, the cellular and the molecular mechanisms controlling breast cancer metastatic largely remain to be elucidated. It is only until recently with the development of functional genomic approaches and suitable animal models, we have started to gain insights into the metastatic progression of breast cancer and other cancer types. Nonetheless, many questions still remain poorly understood. Many questions about breast cancer metastasis and its relationship 168 Chapter 5. The role of Id1 and Id3 in breast cancer metastasis to the cell of origin and the metastatic dormancy are still unclear. Besides that, there are two major clinically relevant questions. First is whether we can identify prognostic markers which can more accurately predict which breast cancer patients are at risk of metastasis and therefore require more aggressive treatment. Second, if the relapse has already occurred, whether we can identify molecular targets in the metastatic cells to suppress metastatic progression. Therefore, to advance our ability to better predict and treat metastatic breast cancer, we need to identify the key upstream coordinators of metastasis– the ‘metastasis genes’ that are as central to metastatic behaviour as how important the major oncogenes such as c-MYC, RAS, HER2 are in the breast oncogenic transformation and tumour initiation. Recently, using functional genomic and complex in vivo modelling approaches, multiple groups have identified a number of expression profiles that are differentially expressed in metastatic tumours compare to the primary tumours, and used different in vitro and in vivo assays to study the functions of these genes in individual steps of metastatic progression (Bos et al., 2009; Finak et al., 2008; Kang et al., 2003b; Landemaine et al., 2008; Minn et al., 2005a; Minn et al., 2005b; Ramaswamy et al., 2003; van 't Veer et al., 2002; Wang et al., 2005). For example, to investigate the transcriptional changes associated with breast cancer metastasis, Minn and colleagues (Minn et al., 2005a) used murine xenografts of MDA-MB-231 human breast cancer cells to select cell subpopulations highly metastatic to lung. Transcriptional profiling analysis revealed 95 genes differentially expressed by lung-tropic sublines. Many are key regulators that are required for breast cancer metastasis to the lung. A majority of them encode cell surface and secreted products such as chemokines that affect the interaction of the tumour cells with the microenvironment. Some of these genes collectively support tumour angiogenesis, entry of mammary tumour cells into the circulation, and tumour cell exit from lung capillaries into the pulmonary parenchyma. A notable exception is ID1, which is the only transcriptional regulator present this lung metastatic signature of breast cancer. 169 Chapter 5. The role of Id1 and Id3 in breast cancer metastasis Figure 5-1 The metastatic cascade. Metastasis can be envisioned as a process that occurs in two major phases, the physical translocation of cancer cells from the primary tumour to a distant organ and the colonization of the translocated cells within that organ. To begin the metastatic cascade, cancer cells within the primary tumour acquire an invasive phenotype, for instance, the acquisition of EMT and cancer stem like phenotype. Cancer cells can then invade into the surrounding matrix and toward blood vessels, where they intravasate to enter the circulation, which serves as their primary means of passage to distant organs. The cells then travel and exit the circulation and invade into the microenvironment of the target foreign tissue. Similar to intravasation, this extravasation process includes the invasion of the basement membrane and extracellular matrix. At the foreign site, cancer cells must be able to evade the innate immune response and also survive as a single cell (or as a small cluster of cells). In order to develop into an active macrometastatic deposit, the cancer cells adapt to the microenvironment and initiate proliferation and eventually colonize the distant organ. Recently, it has been proposed that the reversal of EMT, the mesenchymal-to-epithelial 170 Chapter 5. The role of Id1 and Id3 in breast cancer metastasis transition (MET), is necessary for efficient metastatic colonization (Brabletz, 2012b). Depending on the cancer type, some cancers have a rapid metastatic kinetics and develop secondary tumour within a short period of time, but some may survive in the specific organ and remain dormant for a very long period of time, such as breast cancer. The mechanism regulating breast cancer dormancy remains largely unknown. This also represents a major clinically relevant question. Some people believe that the cells survive in the secondary site and remain dormant without division, and they are resistant to current cancer therapies that target actively dividing cells. Recently, a number of studies also showed that the interaction between tumour cells and the stromal cells plays an important role in metastasis (Barcellos-Hoff et al., 2013). In addition, the cell non-autonomous interaction of cancer cells and the distant sites is critical. Studies have demonstrated that the tumours can remodel the metastatic niche in distant tissue at a very early stage of the metastatic cascade before the actual colonization occurs (Oskarsson et al., 2014). 5.1.2 Dissecting the role of ID1/3 in breast cancer metastasis In my previous chapter I described data demonstrating that loss of Id1/3 in breast cancer cells leads to a significant reduction in proliferation and self renewal. Our group and others have previously demonstrated that Id1 is required and sufficient for the metastasis of breast cancer in experimental models. Targeting ID1/3 reduces the metastatic capacity of human breast cancer cell lines in xenografts models (Fong et al., 2003; Gupta et al., 2007; Minn et al., 2005a; Swarbrick et al., 2008b). Suppression of ID1/3 results in a decrease number of peritoneal metastatic nodules and the size of gastric tumour (Tsuchiya et al., 2005) and pancreatic tumour (Shuno et al., 2010). However, the mechanism by which ID1/3 mediates metastasis remains poorly understood. Fong and colleagues showed that targeting ID1 expression using antisense oligonucleotide significantly reduces the invasive and metastatic spread of human breast cancer cells MDA-MB-231 in a xenograft mouse model via a mechanism which is partly due to a decrease in the expression of MT1- MMP (Fong et al., 2003). A further functional study from Joan Massague’s group (Gupta et al., 2007) demonstrated that silencing of ID1/3 impairs the metastatic colonization of the lungs using the highly lung metastatic LM2–4175 171 Chapter 5. The role of Id1 and Id3 in breast cancer metastasis cell line, a subpopulation that was derived from MDA-MB-231 (Minn et al., 2005a). This study provided a clue that ID1/3 may facilitate sustained proliferation during the progression of lung colonization to facilitate the formation of lethal macrometastases. However, whether ID1/3 have a functional role at other steps in the metastatic cascade remains to be identified. For example, ID1/3 may play a role in the physical translocation of cancer cells from the primary tumour to the distant organs or survival of the disseminated cancer cells in the lung microenvironment. Whether ID1/3 have a role in organ-specific function during lung metastasis of breast cancer, and the mechanisms of how they mediate metastatic dormancy and reinitiate proliferative programs to generate growth at the metastatic sites also represent exciting subjects of investigation. Whether ID1/3 are involved in metastatic dormancy is unclear. There is no clear evidence showing ID1/3 has a role in controlling dormancy. However, studies by Gupta et al (Gupta et al., 2007) and Stankic et al (Stankic et al., 2013) demonstrated a functional role of ID1/3 in reinitiating proliferative programs to generate growth at the metastatic sites. Whether ID1/3 have a role in enabling dormant breast cancer cells to reinitiate this secondary tumour outgrowth represent an interesting subject of investigation. Both studies from Fong et al and Gupta et al (Fong et al., 2003; Gupta et al., 2007) relied on xenograft models in which tumours develop in the context of a greatly compromised immune system, which may play an important role in regulating primary tumour growth and metastases. Xenograft models fail to recapitulate the heterogeneity of a spontaneous tumour and so cannot address the different roles of stem, progenitor or differentiated cells in metastasis (Kelly et al., 2007). In this chapter, I aim to mechanistically characterize the functional defect in Id1/Id3 knockdown breast cancer cells within the multistep cascade of metastasis, by conditional knockdown of Id1/3 in the 4T1 syngeneic mouse model of breast cancer metastasis. The 4T1 model is transplantable syngeneic tumour cell model. The 4T1 cells have a high propensity to spontaneously metastasize to distant sites often affected in aggressive human breast cancer including bone, lung, brain, liver and other sites (Aslakson and Miller, 1992; Eckhardt et al., 2005; Lelekakis et 172 Chapter 5. The role of Id1 and Id3 in breast cancer metastasis al., 1999; Pulaski and Ostrand-Rosenberg, 1998; Tao et al., 2008; Yoneda et al., 2000). Since the isolation of the 4T1 cell line by Fred Miller and colleagues (Miller, 1983; Miller et al., 1983), several 4T1 sublines have also been isolated and characterized with different metastatic properties. Some of these derivatives closely mimic the pathology of aggressive human breast cancer (Miller, 1983; Miller et al., 1983). Two sublines called 4T1.2 and 4T1.13 have a high propensity to metastasize to bone after orthotropic into the mammary fat pad. Other sublines such as 67NR and 4T07 are non- and weakly metastatic, respectively. The isolation of these sublines with different metastatic properties from a single parental 4T1 tumour suggests the heterogeneity of primary 4T1 tumour. In addition to this, a recent study by Kaur and colleagues (Kaur et al., 2012) demonstrated isolation of tumour-initiating cells from the 4T1 cell line, further suggesting that the 4T1 model is not a homogeneous cell model. 5.1.3 Hypothesis Id1/3 are required for the progression of breast cancer metastasis, therefore altering their expression will result in impaired tumour growth and affecting the multistep cascade of tumour metastasis. 5.1.4 Aims In this chapter, I will describe the research I conducted to pursue the following specific aims: 1. Determine the tissue expression of ID1 and ID3 in human breast tumours and their resulting distant metastases in clinical samples of human breast cancer. 2. Determine whether Id1/3 are required for the maintenance of metastatic growth in a syngeneic mouse model of breast cancer. 3. Determine the function and mechanism of Id1/3 in regulating breast cancer metastasis, more specifically, at which point Id1/3 act in the metastatic cascade. 173 Chapter 5. The role of Id1 and Id3 in breast cancer metastasis 5.2 Results 5.2.1 ID1 expression is enriched in metastasis If ID1/3 augments the metastatic potential of breast tumour cells, one would predict that a greater proportion of metastases should contain ID1/3 expressing cancer cells. To determine whether metastasis is associated with altered expression patterns of Ids, we collaborated with Sunil Lakhani’s group at the University of Queensland to investigate the expression of ID1 in primary malignancies and metastases to brain of breast cancer. ID1 immunohistochemistry was performed in Sunil Lakhani’s laboratory on 49 brain metastasis lesions surgically extracted from breast cancer patients together with the patient matched primary breast tumours. However, only 13 cases were positively stained for ID1 in the primary tumour or the brain metastases (Figure 5-2). Twelve of 13 of these cases were stained ID1 positive in the brain metastasis lesions and 6 of 13 cases showed Id1 positive staining in the matched primary tumours (Table 5-1). As mentioned in Chapter 1 and Chapter 3, ID1 is only expressed in a proportion of breast cancers, that is the triple- negative and the HER2-enriched breast tumours (Gupta et al., 2007; Perk et al., 2006a). The small number of cases being stained for ID1 positive in our cohort is of expected since these tumour/metastases are from all subtypes. Quantitative evaluation of ID1 expression was done by using H score which took into account the percentage of Id1 positive cells (0-100%) and the staining intensity (0-3+). Analysis showed that ID1 expression is enriched in brain metastases compared to patient matched primary breast tumours in 11/13 cases (Figure 5-3). Hormone receptor status was also determined by IHC staining of ER, PR and HER2. Interestingly, ID1 expression was observed in several cases of ER+ tumours here. No correlation was found between ER/PR/HER2 status and ID1 enrichment in the brain metastases. Nonetheless, the data suggests a positive selection for ID1 in the metastatic process and is consistent with the hypothesis that ID1 expressing cells have a selectable advantage during secondary metastasis to the distant organs. We are currently examining the expression of ID3 as well as expanding the staining on the patient matched lung metastases in addition to the brain metastases. 174 Chapter 5. The role of Id1 and Id3 in breast cancer metastasis Sample Brain metastasis Patient matched Hormone receptor positivity name primary tumour Intensity & H Score Intensity & H Score ER PR HER2 Percentage Percentage of cells of cells positive positive CZ1 3+ ,50% 150 2+,1% 2 2+ 0 3 CZ2 3+ ,50% 150 2+,1% 2 2+ 0 3 CZ3 3+ ,50% 150 2+,5% 10 0 0 2 CZ4 2+,5% 10 3+, 30% 90 0 2+ 2 CZ6 0 0 3+, 1% 3 0 2+ 1 CZ7 2+,1% 2 0 0 0 2+ 1 CZ17 2+,5% 10 0 0 0 0 0 CZ18 1+,10% 10 0 0 0 0 0 IN12 2+,5% 10 0 0 0 0 0 IN19 1+5% 5 0 0 1+ 0 3 IN21 1+5% 5 0 0 2+ 0 1 SZ1 1+5% 5 1+5% 6 0 0 2 SZ2 1+1% 1 0 0 0 2+ 2 Table 5-1 Tabulated results of ID1 immunohistochemistry performed on 13 primary breast tumours and patient matched brain metastases. H Score was obtained by multiplying the percentage of Id1 positive cells by the intensity. 175 Chapter 5. The role of Id1 and Id3 in breast cancer metastasis (A) (B) Figure 5-2 Representative ID1 immunohistochemistry images of a primary tumour (A) and matched brain metastasis (B). Analysis showed a higher ID1 expression in the brain metastases compared to their primary counterparts from the same patient. Figure 5-3 ID1 expression is enriched in brain metastases compared to matched primary cancers in 11/13 cases. 176 Chapter 5. The role of Id1 and Id3 in breast cancer metastasis 5.2.2 In vivo characterisation of the 4T1 mouse breast cancer cell line In order to investigate the function of Id1/Id3 in metastatic progression, I undertook in vivo experiments using the 4T1 mouse breast cancer cell line and conditional transgenesis to switch off Id1/3 expression during breast tumour progression. The 4T1 cell line serves as a good model for investigating the mode of action of Id1/3 in metastasis. The 4T1 cells are highly invasive and have growth characteristics which resemble human metastatic breast cancer in a syngeneic host with an intact immune system and a homogenous genetic background. Previous studies have reported that, following transplantation, the 4T1 cells are capable to metastasize efficiently to lungs and brain, which are sites often affected in aggressive human breast cancer (Tao et al., 2008). The 4T1 cells have also been reported to express a high level of Id1 (Fong et al., 2003; Gumireddy et al., 2009; Stankic et al., 2013). In Chapter 3, by IHC, I showed that 15% of the 4T1 cells express Id1. Hence, the 4T1 serves as a good syngeneic mouse model of metastatic breast cancer in this study. Two most commonly used approaches to model breast cancer metastasis are the spontaneous metastasis assay in which cancer cells are orthotopically implanted into the mammary gland, and the experimental metastasis assay by tail vein injection of cancer cells (Eckhardt et al., 2012). Previous studies have reported methods for orthotopic transplantation and tail vein injection of 4T1 cells. However, there appears to be a discrepancy in the literature regarding the number of cells used for the transplantation, with cell numbers ranging from 7x103 to 1x106 for orthotopic transplantation (Cho et al., 2012; Le Devedec et al., 2009; Lou et al., 2011; Smith et al., 2004; Tao et al., 2008) and 5x105 to 1x106 for tail veil injection (Lou et al., 2011; Smith et al., 2004). Hence, I perform a series of limiting dilution assays to characterise the 4T1 cell line. This includes determining the threshold number of cells required to form a primary tumour, the growth rate of the tumour, and its metastatic capacity in both spontaneous and experimental metastasis assay. 177 Chapter 5. The role of Id1 and Id3 in breast cancer metastasis 5.2.3 The number of 4T1 cells required to form a primary mammary tumour in orthotopic transplantation In order to determine the number of cells required for tumour formation in an orthotopic transplantation, I injected a range of doses of 4T1-Enh-luc cells into the right thoracic mammary fat pads of BALB/c mice with intact immune system. The numbers of cells used are 1.0x103 ,3.0x103 ,1.0x104 ,3.0x104 ,1.0x105 ,1.0x106. Tumour formation was assessed by visual inspection and palpation after inoculation of tumour cells. Tumour growth was measured twice a week. The number of cells implanted did not have any significant effect on tumour initiation (Table 5-2). Five of 6 mice injected with 1.0x103 and 3.0x103 cells developed a primary tumour, whereas all 6 mice which received 1.0x104 ,3.0x104 ,1.0x105 ,1.0x106 cells developed a tumour (Table 5-2), which grew at a similar rate (Figure 5-4). This experiment suggested that the threshold number of 4T1 cells required for a successful engraftment is between 3.0x103 and 1.0x104. The number of cells transplanted did not affect tumour growth rate, although it occurred that the mice which received 1.0x103 and 3.0x103 cells developed tumours with lower growth rate and slower appearance of tumour masses (Figure 5-4). Subsequent orthotopic transplantations of 4T1 cells in this project were performed by using 7.0x103 cells. 178 Chapter 5. The role of Id1 and Id3 in breast cancer metastasis Number of cells 1.0x103 3.0x103 1.0x104 3.0x104 1.0x105 1.0x106 transplanted Tumour formation 5/6 5/6 6/6 6/6 6/6 6/6 Table 5-2 Tumour initiation frequency in mice orthotopically transplanted with different number of 4T1 cells. Number with primary tumour/total mice for each cell dose is shown. Figure 5-4. Tumour growth following the orthotopic transplantation of 4T1 cells into the mammary fat pad. The number of cells transplanted did not affect tumour growth rate. Error bars indicate SEM. n=6 per group. 179 Chapter 5. The role of Id1 and Id3 in breast cancer metastasis 5.2.4 The number of 4T1 cells required to form experimental metastases by tail vein injection I next performed tail vein injection experiments to determine the minimum number of 4T1 cells that are required to form metastases in an experimental metastasis assay. A different number of 4T1-Enh-luc cells in 100ul was injected into the median tail vein of BALB/c mice. The numbers of cells used are 2.5x104 ,7.5x104 ,2.25x105 ,6.75x105 ,1.3x106. Metastatic outgrowth was monitored by using noninvasive bioluminescence imaging. Mice were aged till ethical end point or in the case of no metastasis formation, a minimum of 6 months. Only 1 of 6 mice injected with 2.5x104 cells developed metastases, whereas all 6 mice which received 7.5x104 cells and above developed metastases (Table 5-3 and Figure 5-5). This experiment suggested that the threshold number of 4T1 cells required to form metastases in an experimental metastasis assay is between 2.5x104 and 7.5x104. The subsequent experimental metastasis assays in this Chapter were performed by using 7.5x104 cells. 180 Chapter 5. The role of Id1 and Id3 in breast cancer metastasis Number of cells injected 2.5x104 7.5x104 2.25x105 6.75x105 1.3x106 Formation of metastases 1/6 6/6 6/6 6/6 6/6 Table 5-3. The frequency of metastasis formation in mice transplanted with different number of 4T1 cells at six months post tail vein injection. Number with metastases/total mice for each cell dose is shown. Figure 5-5 Limiting dilution assays revealed the threshold number of cells required to form metastases in an experimental metastasis assay is 7.5x104. Bioluminescence images of mice from each cohort at Day 15 are shown. 181 Chapter 5. The role of Id1 and Id3 in breast cancer metastasis 5.2.5 Loss of Id1/3 leads to a delay in tumour growth, prolonged survival and suppresses spontaneous lung metastasis To study the effect of Id1/3 on tumour growth, 4T1 cells with constitutive expression of luciferase and inducible expression of Id1/3 shRNAs (4T1 pSLIK C8) or the control cell line with constitutive expression of luciferase (4T1 Enh luc Thy1.1) were cultured with or without Dox for 48 hours. Prior to being used for the transplantation, a proportion of cells were collected and subjected to Western blot analysis to confirm Id1/3 knockdown (result not shown). Seven thousand cells were injected separately into the mammary fat pad of BALB/c mice (n=10). Mice were given Dox diet immediately post surgery to knock down Id1/3 expression (Figure 5-6). Spontaneous metastatic outgrowth was monitored by using bioluminescence imaging. No difference in tumour growth and metastasis was observed between the Dox treated and untreated 4T1 Enh luc Thy1.1 tumours. As for 4T1 pSLIK C8 tumours, knockdown of both Id1 and Id3 expression resulted in partial inhibition of mammary tumour growth, as shown in Figure 5-7. The average tumour volume in the knockdown group (4T1 pSLIK C8 +Dox) was smaller than that of the control group (4T1 pSLIK C8 - Dox). The tumours from the control group also had a shorter latency to ethical endpoint when compared to the Id1/3 knockdown group. Mice from the control group all reached ethical end point approximately 10 days before the Id1/3 knockdown cohort of mice. Mice were culled and analysed at terminal end point when the tumours reached the same size at a diameter of 20mm. Various organs such as lung, liver, lymph nodes, pancreas, spleen and brain were harvested and visually examined to detect the presence of metastases and later quantified. Tumours depleted of Id1/3 expression generated fewer lung metastatic lesions compared to the control despite growing in the host for a longer time (Figure 5-8). This result demonstrated a functional requirement of Id1/3 for spontaneous lung metastasis of breast cancer. However, whether this was due to a defect in the physical translocation of the cancer cells from the primary tumour to the lung or an impairment of the cancer cells to proliferate at the lung microenvironment was unclear. 182 Chapter 5. The role of Id1 and Id3 in breast cancer metastasis Figure 5-6 Experimental strategy to determine the role of Id1/3 in tumour growth and spontaneous metastasis. 183 Chapter 5. The role of Id1 and Id3 in breast cancer metastasis Figure 5-7 Knockdown of Id1/3 delays tumour progression and prolongs survival. Growth rate of tumours, tumour size and survival plot of Id1/3 knockdown and control cohorts. Each curve in the graph was carried out to when the first animal in that cohort reached ethical endpoint. Representative in vivo bioluminescence images of mice bearing the control (4T1 pSLIK C8 -Dox) and Id1/3 KD tumour (4T1 pSLIK C8 +Dox) at day 14 are shown on the left panel. Error bars indicate average +/- SEM. p=0.0026, based on a two-tailed t test. n=10 per group. 184 Chapter 5. The role of Id1 and Id3 in breast cancer metastasis Figure 5-8 Knockdown of Id1/3 supressed spontaneous lung metastasis. Error bars represent SEM. p=0.0001, based on a two-tailed t test. n=10 per group. 185 Chapter 5. The role of Id1 and Id3 in breast cancer metastasis 5.2.6 Loss of Id1/3 increases experimental lung metastatic outgrowth and colonization. We have observed an enrichment of Id1 expression in brain metastases compared to patient matched primary cancers (Figure 5-3). Id1 is required for the proliferation of breast cancer cells in vitro (Lin et al., 1999; Swarbrick et al., 2005). We then questioned if Id1/3 has a role in enabling efficient secondary tumour reinitiation and supporting the proliferative activity of metastatic tumour cells during colonization in vivo. In order to test this hypothesis, I performed an experimental metastasis assay to determine if Id1/3 expression is required for lung metastatic colonization. In the experimental metastasis assay, cancer cells injected directly to the systemic circulation may develop distant metastases at a number of anatomic locations throughout the body, such as the lung as it is the first capillary bed they encounter. This assay will allow us to test whether the function of Id1/3 in metastasis is before or after the point of engraftment. Experimental metastasis assay provides several advantages. The time course for model maturity is generally rapid, the biology of metastasis is reproducible and consistent (Eckhardt et al., 2012). Similar to the spontaneous metastasis assay, in this experiment, 4T1 cells with inducible expression of Id1/3 shRNAs (4T1 pSLIK C8) or constitutive expression of luciferase (4T1 Enh-luc) were cultured with or without Dox for 48 hours. Seventy-five thousand cells were then intravenously injected into 10 BALB/c mice. Mice were fed with Dox food immediately following tail vein injection. Metastatic outgrowth was monitored by bioluminescence imaging. Surprisingly, in vivo imaging revealed an increased rate of outgrowth during the progression of lung colonization in the mice injected with the Id1/3 knockdown cells (Figure 5-9 A). The Id1/3 knockdown cells colonized the lung more rapidly compared to the control. Mice were euthanised at terminal end point. Various organs with macroscopically visible metastases were collected and the number of metastases was quantified. Mice injected with the Id1/3 knockdown 4T1 cells developed extensive lung metastases (Figure 5-9 B). Interestingly, this increase of metastatic outgrowth was only observed in the lung but not other organs. Whereas the control group developed metastases at other distant sites but not lung (Figure 5-9 A). 186 Chapter 5. The role of Id1 and Id3 in breast cancer metastasis (A) (B) (C) Figure 5-9 Loss of Id1/3 increases experimental lung metastatic colonization. (A) Bioluminescence images of representative mice from each cohort at Day 7, Day 9 and Day 14. (B) The number of macroscopically visible metastases on the lung surface was quantified. Error bars represent SEM. p=0.0054, based on a two-tailed t test. n=4 per group. (C) Representative images of the lungs taken from the Control and Id1/3 KD mouse at ethical endpoint. There were multiple visible lung tumours in the Id1/3 KD mouse but not the Control. 187 Chapter 5. The role of Id1 and Id3 in breast cancer metastasis 5.2.7 Loss of Id1/3 increases extravasation and metastatic cell seeding in the lung To further characterize the function of Id1/3 in lung metastatic colonization, I carried out an in vivo experimental lung metastatic seeding assay. 4T1 cells with inducible expression of Id1/3 shRNAs (4T1 pSLIK C8) were cultured with or without Dox for 48 hours. The cells were then intravenously injected into 6 BALB/c mice. Two hours post injection, the mice were sacrificed. Lung was collected and subject to ex vivo bioluminescence imaging. Lungs from mice which received the Id1/3 depleted 4T1 cells have strong bioluminescence signals, whereas no signal was detected at the lung from mice which received the control cells (Figure 5-10 A). Quantification of bioluminescence signals revealed statistically significant effect (Figure 5-10 B). The result from this experiment suggested that the extensive metastatic colonization in lung of the mice receiving Id1/3 knockdown cells (Figure 5-9) might be attributed to an increase extravasation of the cells into the lung tissue through the extracellular matrix and endothelial barriers and trapped in the lung circulation, or an increased capability of the cancer cells to seed the lung and survive from immune response. 188 Chapter 5. The role of Id1 and Id3 in breast cancer metastasis (A) (B) Figure 5-10 Knockdown of Id1/3 increases extravasation and seeding of tumour cells in the lung. (A) Representative ex vivo bioluminescence images of lung harvested from each cohort at two hours post tail vein injection. (B) Quantification of bioluminescence showing an increase signals in the lung from mice receiving the Id1/3 knockdown cells. Error bars represent SEM. p=0.0022, based on a two-tailed t test. n=6 per group. 189 Chapter 5. The role of Id1 and Id3 in breast cancer metastasis 5.2.8 Loss of Id1/3 has no effect on lung metastatic colonization following extravasation After having observed a delay in tumour growth and lung metastasis in the spontaneous metastasis assay, but an increase in lung metastatic colonization in the experimental metastasis assay, we hypothesised Id1/3 may play a distinct role in different processes in the metastatic cascade. Id1/3 may function in promoting early event of tumourigenesis such as tumour initiation and early stage in the metastatic progression during the physical translocation of cancer cells from the primary tumour, dissemination of the cells, invasion and intravasation into the distant tissue or establishment of pre-metastatic niches. However, both genes may have a metastatic supressing role in the later stage of metastatic cascade such as extravasation, in vivo selection, organ-specific survival, reactivation and colonization of the cancer cells in the foreign tissue environment. A very good example of a molecule which plays such as dual role in tumour progression is the TGF-β family of proteins as described in previous chapters. Our next question was to investigate at which point Id1/3 become required in the metastatic cascade, and whether Id1/3 exert their function in metastasis after tumour cell intravasation. I.e. Does targeting Id1/3 at the colonization step prevent or promote the metastatic growth of already-disseminated cells in the lung? I went on to perform a timecourse analysis to test the effect of Id1/3 knockdown during the course of lung colonization. The aim is to knockdown Id1/3 and to test its effect during the course of lung colonization and other processes affecting metastatic outgrowth such as extravasation, survival of cells in lung microenvironment and ability of cells to passage through lung capillaries in order to spread to other distant organs. In this experiment, 4T1 cells with inducible expression of Id1/3 shRNAs (4T1 pSLIK C8) were cultured with or without Dox for 48 hours. I then intravenously inoculated the cells by tail vein injection into 5 BABL/c mice and allow the cells to reside in the lungs (and other organs) for different lengths of time before administering Dox to supress Id1/3 expression. This experiment also allowed us to model the therapeutic targeting of Id1/3 in advanced breast cancer. One cohort of mice were fed with Dox food immediately following tail vein injection, the other 3 cohort of mice were fed with 190 Chapter 5. The role of Id1 and Id3 in breast cancer metastasis Dox food starting from 1, 3 after receiving the cells and when lung metastases were detected by in vivo imaging at day 8 post injection. Mice were culled at ethical end point and organs with macroscopically visible metastases were collected and analysed. Quantification of metastases in the lung revealed no statistically significant difference between the control mice and the mice where the knockdown was initiated at Day 1 or later after inoculation (Figure 5-11). However, the effect of Id1/3 KD prior to inoculation (from Day 0) was as previously observed and shown in Figure 5-9. This results indicated that knockdown of Id1/3 has no effect on the metastatic outgrowth after the cancer cells have extravasated and seeded the lung. 191 Chapter 5. The role of Id1 and Id3 in breast cancer metastasis Figure 5-11 Loss of Id1/3 has no effect on lung metastatic colonization following extravasation into the lung tissue. Error bars represent SEM. p value is based on a two-tailed t test. n=5 per group. 5.2.9 Assessing the induction of interferon response by pSLIK in vivo As described in Chapter 4, I observed an induction of an interferon response by shRNA expression from the pSLIK vector in 4T1 cells. A large number of interferon related genes were found to be upregulated in the 4T1 pSLIK C8 cells upon Dox induction. Quantitative real-time PCR validation showed that the activation of IFN signalling was not specific to Id1/3 but rather was driven by shRNA expression from the pSLIK vector. IFN signalling is silenced in a variety of cancers and activation of IFN signalling suppress tumour progression (Bidwell et al., 2012; Ikeda et al., 2002; Zaidi and Merlino, 2011). 192 Chapter 5. The role of Id1 and Id3 in breast cancer metastasis The non-specific interferon response observed in vitro has prompted me to think if the changes in IFN gene expression can lead to measurable phenotypes (such as false positives) in my in vivo experiments. Hence an experiment was conducted to examine if interferon response was induced upon Dox induction in the mice. 4T1 pSLIK C8 cells were orthotopically transplanted into BALB/c mice as described in earlier section. Upon tumour and metastasis formation, mice were treated acutely with Dox for 5 days. Primary tumours were collected. RNA was extracted from these tissues. Quantitative real-time PCR was performed using Taqman assays to assess the expression level of Irf7, Irf9, Stat1 and Stat2. No difference in expression of any of these four genes was found between the Dox treated and untreated tumours (Figure 5-12). This indicates that the expression of shRNAs did not activate the interferon response in vivo. This could be attributed to the lower dose of the Dox used in animals compared to in vitro cell culture. In addition, it is also possible that there is a difference in co-stimulatory molecules required to trigger the immune response in between in vivo and in vitro setting. 193 Chapter 5. The role of Id1 and Id3 in breast cancer metastasis Figure 5-12 Validation of interferon response in 4T1 pSLIK tumour with acute Id1/3 knockdown. Relative mRNA expression of Irf7, Irf9, Stat1 and Stat2 in tumours derived from 4T1 pSLIK shId1/3 Clonal cell line 8 (pSLIK C8), from mice treated with or without Dox for 5 days. Error bars represent SEM. Unpaired t-test, NS for all four genes when comparing between -Dox and +Dox. 194 Chapter 5. The role of Id1 and Id3 in breast cancer metastasis 5.3 Discussion Breast cancer is the most commonly diagnosed malignancy and the major cause of cancer mortality in Western women. While locally confined disease has an excellent prognosis, ~50% of breast cancers ultimately spread to the lymph nodes, lung, pleura, liver and bone marrow, causing the majority of the morbidity and mortality associated with breast cancer (Redig and McAllister, 2013). Unfortunately, the ability to predict which patients are at risk of metastasis, and therefore require more aggressive treatment, is limited by the lack of accurate prognostic markers for local and distant metastatic disease. There is, therefore, an urgent need to identify more accurate prognostic markers for women with metastatic cancer as well as to identify molecular targets in the metastatic cells to rationally design therapeutics that can target metastatic progression. Metastases represent the end products of a multistep process of the metastatic cascade, which involves the physical dissemination of cancer cells from the primary tumour to the anatomically distant organ sites and their subsequent adaptation to and colonization of the foreign tissue microenvironment. Each of these events is driven by the acquisition of genetic and/or epigenetic alterations within tumour cells and the co-option of nonneoplastic stromal cells, which together endow incipient metastatic cells with traits needed to generate macroscopic metastases. A major focus of study of the metastasis problem is understanding the mechanisms by which tumour cells escape the local environment and colonize distant metastatic organs. From a therapeutic standpoint, it is important to understand the cellular and molecular mechanisms that govern each steps of the metastatic cascade to identify which of them are amenable to therapeutic targeting. Understanding the mechanisms of physical translocation is important for preventing metastasis in patients who are diagnosed with early cancer lesions, whereas understanding the mechanisms leading to escape of breast cancer metastatic dormancy and successful colonization may lead to effective therapies for patients with already-established metastases. 195 Chapter 5. The role of Id1 and Id3 in breast cancer metastasis Recent advances in genomic technology have provided provocative insights into the mechanisms controlling breast cancer metastasis. Genomic profiling of clinical tumour samples and animal models of cancer metastasis has led to the identification of a number of genes with prognostic values for metastatic relapses and organtropic metastasis (Bos et al., 2009; Finak et al., 2008; Kang et al., 2003b; Landemaine et al., 2008; Minn et al., 2005a; Minn et al., 2005b; Ramaswamy et al., 2003; van 't Veer et al., 2002; Wang et al., 2005). These genes include master cell fate regulators, tumour microenvironment-induced factors as well as transcription factors, such as GATA3, ELF5, HIF1, TWIST1, ZEB1/2, SNAIL1/2, PRRX1, ID1/3, just to name a few. As reviewed earlier, work in our laboratory and elsewhere implicates that ID1 is one of the very few genes that play key role in breast cancer proliferation, differentiation and metastasis. And based on the clinical and experimental evidence for an involvement of ID1/3 in advanced breast cancer, I hypothesized that ID1/3 coordinate multiple steps of the metastatic program and hence could potentially serve as therapeutic targets for metastasis intervention. In order to address this hypothesis, my first aim in this chapter was to determine the tissue expression of ID1 in human breast cancer and it correlation with metastasis. This was done by collaborating with Sunil Lakhani’s group at the University of Queensland by examining ID1 protein expression in matched primary and metastatic tumours from patients. Our IHC results showed a large enrichment for ID1 protein expression in brain metastases compared to patient matched primary breast cancers. These findings imply a role of ID1 as a mediator in the tumour cells that give rise to metastatic lesions and their resulting distant metastases. The proliferative functions mediated by ID1 may be a limiting requirement in the development of brain metastases in patients. The ID1 expressing cells may have a selectable advantage during secondary metastasis to the brain. The main barrier to the treatment of metastases is the biological heterogeneity of cancer cells in the primary neoplasm and in metastases. Emerging evidence suggests that the failure to respond to current therapies may be due to heterogeneity in the drug sensitivity of cells within the tumour. Thus a small population of cells that are de novo resistant to treatment may drive subsequent recurrence or remission (Valent et al., 2012). Several 196 Chapter 5. The role of Id1 and Id3 in breast cancer metastasis studies have reported that increased expression of ID1/3 is associated with chemoresistance and/or radioresistance in prostate and lung cancer. Higher ID1/3 levels are associated with a shorter disease-free survival in these cancers (Castanon et al., 2013; Lin et al., 2005a, b; Ponz-Sarvise et al., 2011; Yu et al., 2006). These findings imply ID1/3 as promising candidates for future therapy. Inhibiting the ID1 expressing cells in the primary tumour as well as the metastatic lesions may lead to positive therapeutic outcomes in metastatic diseases. This brought us to an ongoing work that I am currently pursuing in collaboration with my co-supervisor Dr Radhika Nair to examine the association of ID1/3 expression with therapy in breast cancer. We have recently obtained samples from a cohort of breast cancer patients that have had biopsies taken pre- and post- neo adjuvant chemotherapy as well as during surgical resection. We are currently performing IHC to examine if there is an association between ID1/3 expression and the response to chemotherapy, and whether ID1/3 expression level is modulated in frequency or intensity by chemotherapy. To define mechanisms of Id1/3 function in breast cancer metastasis, I utilized the 4T1 cell model for inducible knockdown of Id1/3 to determine whether Id1/3 are required for the maintenance of metastatic growth in vivo, and if so, at at which point Id1/3 act in the metastatic cascade to promote metastatic progression. In vivo tumour growth assay showed that silencing of Id1/3 resulted in partial inhibition of tumour growth, suggesting a functional requirement of Id1/3 expression for sustained tumour progression. This could be attributed to impairment in proliferation capacity. The tumours cells could also possibly undergo apoptosis or senescence. Further in-depth immunohistochemical analysis is required to delineate this observed phenotype. Besides tumour growth, I also observed that knockdown of Id1/3 prolonged the survival of mice when compared to the control. Majority mice from the control group reached ethical end point approximately 10 days before the Id1/3 knockdown cohort. Although I noticed that once the tumours starting growing, it mirrored a similar growth rate to the control cohort, indicating that Id1/3 are possibly involved with regulating the early events of tumourigenesis or the tumour cells depleted of Id1/3 expression must have circumvented the anti- 197 Chapter 5. The role of Id1 and Id3 in breast cancer metastasis tumourigenic effects and requirement of Id1/3 through different mechanisms during the later stages of tumour progression. In addition to the effect on tumour growth, knockdown of Id1/3 resulted in a significant decrease in spontaneous metastasis to the lung. There were fewer distant lung metastases in the mice bearing tumours depleted of Id1/3, when compared to the control. This data suggests that Id1/3 are key controllers of the metastatic phenotype in breast cancer. Number of secondary tumours at other organs was also quantified but it appeared to be no difference between the control and Id1/3 KD (The number of secondary tumours detected at other organs was very small. And with a cohort size of 10 mice, it made the statistical power rather low). However, this observation may indicate that Id1/3 activity in the 4T1 breast tumour is selectively associated with lung metastasis. Id1/3 may control biologically selective mechanisms to regulate breast cancer lung metastasis. The impairment in spontaneous lung metastasis could be attributed to several reasons. Defect in each individual step within the metastatic cascade, right from the spread of the cancer cells from the tumour to successful colonization of the lung, could contribute to a decrease in metastatic burden. Knockdown of Id1/3 may prevent dissociation and physical translocation of the cancer cells from the primary tumour. This could be supported by several studies which demonstrated a role of Id1/3 in regulating MMP protein expression in breast cancer (Desprez et al., 1998; Fong et al., 2003) as well as EMT (Gumireddy et al., 2009; Tobin et al., 2011) and cancer stem cell phenotype (Stankic et al., 2013). Multiple studies have demonstrated that cancer stem cells display an EMT phenotype (Mani et al., 2008) which may prevent dissociation and physical translocation of the cancer cells from the primary tumour following knockdown of Id1/3 in vivo. Knockdown of Id1/3 could also possibly affect establishment of pre-metastatic niche as shown by Gao and co-workers in lung cancer (Gao et al., 2008). Defect in other events in the metastatic cascade such as intravasation, survival in circulation, extravasation and sustained metastatic dormancy could also be a cause, although there is no study suggesting a role of Id1/3 in controlling these traits. 198 Chapter 5. The role of Id1 and Id3 in breast cancer metastasis In order to gain further insights into how Id1/3 control breast cancer metastasis to lung, my next question was to investigate at which point Id1/3 become required in the metastatic cascade. For example, whether Id1/3 exert their function in metastasis before or after tumour cell intravasation, whether targeting Id1/3 at the colonization step would prevent metastatic growth of already-disseminated cells in the lung. In theory, inhibition of any of the steps in the metastatic process, from the initial release of cells into the circulation at the site of the primary tumour, to the final stages of growth in the new organ, could offer therapeutic targets. But clinically, by the time a primary tumour is detected, it might be too late. The primary tumour might have already seeded tumour cells to secondary sites. So, targeting early steps in metastasis is less likely to be effective, as they might have already occurred at the time of diagnosis. On other hand, the later steps might not have occurred at the time of cancer diagnosis, so it may offer more promising targets for therapy. It is widely agreed that the rate-limiting step in metastasis is metastatic colonization—the growth of metastases in the distant organs. Many circulating tumour cells can seed in experimental models of metastasis, but only a few are able to colonize, initiate growth and form macrometastases (Chambers et al., 2002; Weiss, 1990). Thus, growth of metastases is the main determinant of metastatic outcome and understanding the colonization process is of the utmost relevance. The growth phase of the metastatic process is a promising therapeutic target. Based on my in vitro result which showed Id1/3 are required for 4T1 cell proliferation and other reported role of Id1/3 in controlling cell cycle progression (Swarbrick et al., 2005) and senescence (Swarbrick et al., 2008b) from the literature, I hypothesised knockdown of Id1/3 after engraftment would affect proliferation of cancer cells in the lung microenvironment thus affecting colonization. In order to test this, I performed an experimental metastasis assay in which I intravenously inoculated 4T1 cells depleted of Id1/3 into the circulation of the mice by tail vein injection and monitored for metastatic outgrowth. Surprisingly, I observed increased lung colonization from loss of Id1/3. This result was unexpected and intriguing. I came out with several explanations or hypotheses that could possibly explain this observation. First, this result may imply a complex context-dependency of Id1/3 function in cancer, 199 Chapter 5. The role of Id1 and Id3 in breast cancer metastasis where Id1/3 can play opposing roles at times in neoplastic progression. One good example of molecules which can promote or inhibit oncogenesis in different cellular contexts is the TGF-β. The actions of TGF-β are dependent on several factors including cell type, growth conditions, and the presence of other growth factors (Massague, 2008). One of the biological effects of TGF-β is the inhibition of proliferation of most normal epithelial cells using an autocrine mechanism of action, and this suggests a tumour suppressor role for TGF-β. Loss of autocrine TGF-β activity and/or responsiveness to exogenous TGF-β appears to provide some epithelial cells with a growth advantage leading to malignant progression (Massague, 2008). This suggests a pro-oncogenic role for TGF-β in addition to its tumour suppressor role. During the early phase of epithelial tumourigenesis, TGF-β inhibits primary tumour development and growth by inducing cell cycle arrest and apoptosis. In late stages of tumour progression when tumour cells become resistant to growth inhibition by TGF-β, the role of TGF-β becomes one of tumour promotion. Resistance to TGF-β- mediated inhibition of proliferation is frequently observed in multiple human cancers including breast cancer (Barcellos-Hoff and Akhurst, 2009). Alterations in the complex TGF-β signaling and cell cycle pathways have also been observed. TGF-β can exert effects on tumour and stromal cells as well as alter the responsiveness of tumour cells to TGF-β to stimulate invasion, angiogenesis, and metastasis, and to inhibit immune surveillance (Massague, 2008). While a dual role of ID1 as a tumour suppressor and pro-oncogenic factor has not been reported, however other members of ID proteins possess diverse patterns of expression and function in cancer. Recent data from several groups demonstrates that ID3 is a tumour suppressor in Burkitt’s lymphoma, and is inactivated through somatic mutation in up to 68% of cases (Love et al., 2012; Richter et al., 2012; Schmitz et al., 2012). ID3 inactivation promotes tumour cell survival through ligand-independent signaling by the B-cell receptor (BCR) to the PI3K pathway. Interestingly, ID3 is not mutated in other B-cell lymphomas, perhaps reflecting ID3’s role in specific phases of B cell maturation (Richter et al., 2012). Similarly, ID4 is epigenetically silenced through promoter hypermethylation in subsets of cancers, including human leukemia (Chen et al., 2011c; Yu et al., 2005), suggesting a tumour suppressive function. Conversely, ID4 acts as a proto-oncogene in serous ovarian cancer (SOC) where it is 200 Chapter 5. The role of Id1 and Id3 in breast cancer metastasis genomically amplified, overexpressed and required for SOC cell line proliferation (Ren et al., 2012b). These data suggest that in different cellular contexts ID proteins can exert divergent functions and can act as oncoproteins or tumour suppressors. These also demonstrate the importance of context in understanding ID protein function in cancer. A very recent study by Stankic and colleague (Stankic et al., 2013) may also support the idea that the molecular mechanisms mediated by ID1 in cancer are contextual dependent. They showed that ID1 acts as a critical regulator of cancer stem-like properties and metastasis, by mediating phenotypic switching and dynamic interactions among EMT-mesenchymal and MET-epithelial states. Under the control of TGF-β signaling, ID1 induces MET at the metastatic site by antagonizing the activity of the the basic helix-loop-helix transcription factor Twist1. However, in the primary tumour when EMT occurs, this state is controlled by the zinc finger protein Snail1 (Stankic et al., 2013). This observation has also shed light on a possible role of ID1 in regulating the dynamic interactions among epithelial, self-renewal, and mesenchymal gene programs which determine the plasticity of metastatic cells. Several previous studies have reported a functional redundancy among the four members of the mammalian Id family, in particular Id1 and Id3, and their widespread, overlapping expression patterns during development as well as in cancer (Anido et al., 2010; Gupta et al., 2007; Lyden et al., 1999; Niola et al., 2013; O'Brien et al., 2012a). In human breast cancer, Gupta and colleagues have previously shown a highly significant coexpression of Id1 and Id3 in triple- negative human breast cancer as well as mouse model of triple-negative disease (Gupta et al., 2007). The same study also demonstrated that knockdown of both Id1 and Id3 caused a higher inhibition of breast cancer metastasis compared to Id1 or Id3 single knockdown using the MDA-MB-231 cells and a highly lung metastatic subline derived from MDA-MB-231 cells (Gupta et al., 2007). However, whether Id1 and Id3 control the same cellular processes and share common gene targets in breast cancer remain unclear. As decribed in Chapter 4, transcript prolifing has identified a number of metastasis related genes whose expressions change in response to Id1/3 knockdown (Figure 4-5 and Table 4-7). These genes comprised not only metastasis- 201 Chapter 5. The role of Id1 and Id3 in breast cancer metastasis supressing genes but also metastasis-promoting genes. Several genes which were known to promote metastasis were up-regulated when Id1/3 were knocked down. These include genes that play role in regulating several critical events in the metastatic cascade such as EMT/invasion (Angptl4, Cxcl1, Il6, Zeb2, Pdgf, Fermt1 and Sparc), survival in circulation or distant organs (Vcam1, Src, Robo1) and several genes controlling metastatic niches such as Tnc, Postn, Ccl5. The increase in lung metastatic outgrowth observed in my experimental metastasis assay can also be attributed to the upregulation of these genes. Subsequent qPCR validation in Chapter 4 has confirmed several of the genes above, which are Tgfbr3, Foxc2, Vcam1, Robo1 and Postn. Interestingly, Postn has been shown to regulate breast cancer stem cells and their metastatic niche via TGF-β signalling in a recent elegant study which investigated the function of breast cancer stem cells in metastasis (Malanchi et al., 2012). Similarly, Angptl4 has been reported to promote lung metastatic seeding of breast cancer cells and its expression is upreguated by TGF-β (Padua et al., 2008). Interestingly, the same study by Padua et al also observed an upregulation of ID1 expression in their TGF-β signatures. Another gene which was upregulated upon Id1/3 knockdown is Vcam1. It plays a critical role in mediating tumour cells intravation to control lung metastasis of breast cancer (Chen et al., 2011a). Having observed an increase metastatic growth in response to Id1/3 knockdown, I went on to perform a timecourse analysis to test the effect of Id1/3 knockdown during the course of lung colonization. The aim was to knockdown Id1/3 and to test the effect during lung colonization and other processes affecting metastatic outgrowth such as extravasation, engraftment/seeding, survival of cells in lung microenvironment and ability of cells to passage through lung capillaries in order to spread to other distant organs. In this experiment, I intravenously inoculated the 4T1 cells by tail vein injection into mice and allowed the cells to reside in the organs for different lengths of time for 1, 3 and 8 days before administering Dox to supress Id1/3 expression. This experiment also modelled the therapeutic targeting of Id1/3 in advanced breast cancer. No difference in lung metastatic growth was observed between the control and the Id1/3 knockdown cohorts. This results indicated that knockdown of Id1/3 has no effect on the metastatic outgrowth after the cancer cells have extravasated and 202 Chapter 5. The role of Id1 and Id3 in breast cancer metastasis seeded the lung. Id1/3 do not control metastatic colonization of lung-- the growth of the metastatic cells into a colony or micrometastasis, and subsequent growth into a secondary tumour/macrometastasis at the lung. Result from this experiment also suggests that the increase lung metastatic colonization observed from Id1/3 knockdown from Day 0 (before the cells were transplated into the mice) might be attributed to a role of Id1/3 in enhancing the extravasation of cancer cells into the lung tissue through the extracellular matrix and endothelial barriers or promoting metastatic seeding to allow the cancer cells to seed and engraft the lung or increase cell survival from immune surveillance. This hypothesis is also supported by the result I obtained from the experimental lung metastatic seeding assay, in which an increase bioluminescence signal was observed 24 hours post tail vein injection in the lung of mice inoculated with cells depleted of Id1/3 but not the control. Taken together, the data present in this chapter showed ID1 expression is enriched in brain metastases compared to patient matched primary breast cancers. Silencing of Id1/3 reduces primary tumour growth and significantly impairs spontaneous lung metastasis of breast cancer. However, Id1/3 may play an opposing role in promoting metastatic seeding of lung. These findings suggest an enigmatic double-edged characteristic and a complex context dependency of Id1/3 function in breast neoplastic and metastatic progression. Id1/3 may have fundamental roles in sensing and integrating different extracellular cues to control breast cancer metastasis, via cell autonomous and extrinsic pathways such as proliferation, self renewal, formation of the metastatic niche, and interaction with the stroma. 203 Chapter 6. Discussion Chapter 6. Discussion Breast cancer is the most common female malignancy and kills more than 500,000 women per year. While surgical resection of primary breast cancers is curative for a majority of patients, 90% of those with metastatic disease will die of breast cancer. Cancer recurrence and secondary metastasis are still poorly prevented and treated. Patients with hormone responsive metastatic disease receive antiestrogens and/or chemotherapy, yet the median survival across all treatments is still poor. The survival rates and clinical outcomes for patients with triple-negative breast cancer are extremely poor due to the lack of targeted therapies available. Currently, patients who are stratified into triple-negative subtype rely only on standard chemotherapies. Those with triple-negative disease currently only have cytotoxic chemotherapy available to them. Despite early data suggesting a good clinical response to chemotherapy in patients with triple-negative disease, long term survival in patients with triple negative disease is still poorer than that of ER+ cases (Carey et al., 2007b). For patients with HER2-enriched disease the development of Trastuzumab therapy has made a major impact on the management of early breast cancer. However, its efficacy against metastatic breast cancer is still modest: less than 50% of HER2-enriched patients show any response and overall Trastuzumab therapy only extends by 5 months the median survival for women with HER2 enriched metastatic disease (Spector, 2008). Trastuzumab is particularly ineffective against brain metastases, which occur in ~ 30% of HER2-enriched cases. Furthermore, HER2-enriched patients often suffer from relapse and become resistant to the Trastuzumab treatment. The outlook for these patients is poor, as they tend to develop high grade tumours which are very aggressive and highly metastatic. Our understanding of the genetics of breast cancer initiation has advanced greatly in the past few decades. However metastasis of breast cancer is still poorly understood. Elucidation of the genetic pathways disrupted in breast cancer metastasis has been limited by conceptual hurdles, the lack of informative models and the complex, multi-factorial nature of the metastatic process. It is crucial that we identify potential pathways in triple-negative breast 204 Chapter 6. Discussion cancer that may be exploited or targeted for therapeutic benefit. The studies undertaken in this thesis are relevant to this key problem. Multiple lines of evidence suggest that the genetic and cellular mechanisms controlling metastasis differ from those regulating the primary tumour mass. This difference is manifest clinically as a relative ineffectiveness of the therapies currently used to treat metastatic breast cancer, suggests that the cells that give rise to metastatic lesions, and their resulting distant metastases, are insensitive to the current repertoire of anti-neoplastic agents. In recent times, cancer biologists have been able to delineate the multi-stage metastatic cascade into specific cellular events including cell migration, invasion, intravasation, extravasation, angiogenesis and colonisation (Chaffer and Weinberg, 2011). Gene expression profiling studies in mouse and human breast tumour and their resulting metastases indicate a requirement of a cohort of pro-metastatic genes to be actively overexpressed in the cancer cells for a successful metastatic progression (Bos et al., 2009; Finak et al., 2008; Kang et al., 2003b; Landemaine et al., 2008; Minn et al., 2005a; Minn et al., 2005b; Ramaswamy et al., 2003; van 't Veer et al., 2002; Wang et al., 2005). Some of the regulatory networks within these genes have subsequently been functionally and/or computationally de-convoluted to allow the identification of candidate gene drivers of metastasis. One of the genes identified to be required for breast cancer metastasis is ID1. Based on a large number of clinical and experimental evidence for an involvement of ID1/3 in cancer, I hypothesise that ID1/3 play a key role in coordinating multiple steps of the metastatic program. The overall aim of this thesis is to define the mechanism of Id1/3 function in breast cancer metastasis. In this study, I reported that ID1 expression is present in the triple-negative and HER2-enriched subtypes of human breast tumours but not in other subtypes. I also provided evidence that ID1 expression is enriched in clinically obtained lung metastases. I have developed a triple- negative breast cancer cell model for inducible loss of Id1/3 function that could accurately recapitulate breast cancer metastasis and allow us to address mechanisms of Id1/3 action in metastatic progression. Using this model, I showed that knockdown of Id1/3 reduces breast cancer cell proliferation and self-renewal. Id1/3 is required to drive tumour growth and spontaneous 205 Chapter 6. Discussion metastatic progression of breast cancer in a syngeneic mouse model. Further in vivo characterisation of the role of Id1/3 showed a dual contextual dependent role of Id1/3 function in breast cancer metastasis. Id1/3 may play a metastasis- promoting role in enhancing lung metastatic seeding. Transcript profiling of the cells depleted of Id1/3 revealed several novel Id1/3 target genes. I identified that the polycomb-group protein, Bmi1, is downregulated in Id1/3 depleted cells. Bmi1 may serve as a novel mediator of Id1/3 function in cell proliferation, self- renewal and metastasis. In addition, I showed that Id1/3 may act as a regulator of the TGF-β signalling pathway. The novel Id1/3 target genes identified provide potential mechanisms by which Id1/3 regulates metastasis. However, further validation of these results in relevant breast cancer cell lines and mouse models of breast cancer is needed to give us additional insights into their role in breast cancer. Characterisation of molecular pathways that are regulated by Id1/3 will allow us to identify potential drug targets for metastatic breast cancer. In the following paragraphs, I will discuss in more detail some of the implications of these results in breast cancer metastasis as well as how these may influence management of breast cancer. To investigate the role of ID1/3 in breast cancer, I first determined the tissue expression of ID1/3 in human breast cancer. Although early studies using commercially available polyclonal antibodies described broad overexpression of ID1 protein in a majority of human primary breast tumours, recent data from studies using a new highly specific monoclonal antibody indicate that the expression of ID1 is not nearly as widespread (Gupta et al., 2007; Perk et al., 2006a). My IHC result supported these findings. We showed that ID1 is only expressed in the triple-negative and HER2-enriched subset of human breast tumours. ID1 expression in cancer cells is rarely seen in tumours characterized by hormone receptor expression. In addition, examination of primary breast tumour and brain metastases from breast cancer patients revealed an enrichment of ID1 expression in the brain metastases compared to the patient- matched primary tumours. We postulate that within the triple-negative and HER2-enriched patient samples, higher expression of ID1 may prospectively identify patients who have a faster onset of metastasis and poorer survival. To truly validate ID1 as a biomarker, this study will need to be expanded into a 206 Chapter 6. Discussion larger cohort of patients as well as to determine if ID1 protein expression correlated with better patient outcome. In terms of clinical application, ID1/3 can potentially serve as a diagnostic tool to help identify women who are more susceptible to developing metastatic disease. Moreover, they could potentially be used to stratify patients more accurately into their respective subtypes, and assist in determining drug sensitivity and the appropriate course of treatment. My co-supervisor Dr Radhika Nair has generated strong unpublished data showing Id1-expressing cells are enriched for tumourigenicity and self-renewal capacity in several mouse model of triple-negative breast cancer such as the p53 null (Herschkowitz et al., 2007; Herschkowitz et al., 2012; Kuperwasser et al., 2000) and C3Tag (Green et al., 2000) model. It remains highly possible that ID1 expression in human breast tumours and metastases may also coincide with an increased frequency of intratumoral cancer stem-like cells. As metastases are thought to be clonally derived from a poorly differentiated single cell with high self-renewal capacity, it will be interesting to examine if ID1 expression in metastatic lesions is associated with cancer stem cell markers. Consistent with this notion, a gene expression studies of human breast tumours identified coexpression of ID family genes and stem-like genes in a subset of breast tumour-initiating cells (Shipitsin et al., 2007). As reviewed in Introduction, several recent studies have also demonstrated a role of ID1 in controlling cancer stem cell phenotype of colon and brain cancer (Anido et al., 2010; Niola et al., 2013; O'Brien et al., 2012a). Rigorous investigation of a potential causal link between ID1/3 expression and cancer stem-like properties in breast cancer is a major subject of current studies in our laboratory. Numerous studies have now demonstrated the phenomenon of ‘oncogene addiction’ whereby tumours become dependent on a single mutated oncogene or tumour suppressor for their maintanance (Weinstein and Joe, 2006). One example of these genes is the oncogene Neu, which is required for both primary tumour growth and metastatic maintenance (Moody et al., 2002). To validate new gene targets for therapy of metastatic disease, we can address a similar question as it relates to metastasis to test whether disruption of metastasis genes limit metastatic progression. In this study, I tested the requirement in metastatic progression for Id1/3 which are known to control a 207 Chapter 6. Discussion variety of cellular processes involved in tumourigenesis. I hypothesised that Id1/3 are required for metastatic maintenance. To address this issue and model the therapeutic targeting of Id1/3 in advanced breast cancer, I used conditional transgenesis to ‘switch off’ Id1/3 expression during tumour progression and assay subsequent metastatic load. Using inducible RNAi, I first investigated the requirement for Id1/3 in metastatic maintenance and progression. My data showed that knockdown of Id1/3 reduces tumour growth and significantly impairs spontaneous lung metastasis. This finding may be useful in improving the therapy and management of breast cancer. It indicates that Id1/3 protein may serve as potential molecular targets for blocking breast tumour metastasis. In principle, suppression of any of the steps in the metastatic process, from the initial dissemination of primary tumour cells into the circulation, to the final stage of the metastatic outgrowth in the distant organs, can offer therapeutic value (Chambers et al., 2002). However clinically, cancer cells can disseminate from a tumour very early in the life of a tumour. Therefore, targeting early steps in metastasis, which may have already occurred at the time of diagnosis, is less likely to be effective. On other hand, the later steps of the metastatic cascade, such as reactivation from metastatic dormancy and metastatic colonization offer more promising targets for therapy. The fact that Id1 and Id3 may be required in vivo for the sustained proliferative activity of metastatic tumour cells during tumour reinitiation and colonization suggests that both genes and their associated pathways are promising therapeutic targets that can inhibit the growth of metastases, the main determinant of metastatic outcome. We hypothesize that Id1/3 would be effective and selective targets for breast cancer therapy. First, Id1/3 are not transcription factors per se. As reviewed earlier, Id1/3 has been shown to regulate the activity of several important regulatory proteins involved in transcriptional regulation. Id1/3 proteins are central to the pathways regulating different cellular processes involved in tumourigenesis including proliferation, differentiation, self-renewal, migration and invasion. Therefore, using Id1/3 as targets could affect different aspects of breast carcinogenesis and progression. Second, even though Id1/3 are widely expressed during development and tumourigenesis, their expression is restricted in most of the mature adult tissues. The scarcity of Id1/3 expression in 208 Chapter 6. Discussion adult tissues could be an advantage for systemic therapy because the majority of the normal cells will not be affected. There is tremendous potential for the use of therapies targeting transcriptional regulation during metastasis (Ell and Kang, 2013). As mentioned earlier, systems-level analyses have led to the discovery of multigenic gene expression programs related to general or organtropic metastasis. Targeting downstream metastasis effector proteins can potentially achieve a success in controlling the metastatic spread of cancer. While transcription factors are notoriously difficult to target with small molecule inhibitors, several groups have used a variety of alternative methods to disrupt ID protein complexes in cancer cells. For example, treatment with cell permeable peptides aimed at disrupting the interaction of ID1/ID3 with the bHLH protein E47 led to marked activation of E47 transcriptional activity and the induction of cell cycle arrest and apoptosis in breast (Mern et al., 2010b) and ovarian (Mern et al., 2010a) cancer cells. The broader effectiveness of targeting ID1/3 protein binding depends on the nature of the biochemical or transcriptional complexes in which ID1/3 proteins act, which in many instances has not been elucidated and remains a major knowledge gap in this field. Several other groups have targeted ID1 expression rather than function. Anido and colleagues used clinically-approved small molecule inhibitiors of TGF-β receptor to downregulate Id1/3 in a mouse model of glioblastoma, leading to reduced tumour initiation and tumour growth (Anido et al., 2010). Soroceanu and colleagues showed that treatment of mice bearing glioma tumours with a small molecule known to downregulate Id1, cannabidiol, led to marked inhibition of tumour growth in vivo (Soroceanu et al., 2013). Overall, these approaches that alter ID1/3 expression level or pharmacological inactivation of ID1/3 and their associated pathways may prove to be therapeutically beneficial if translated into the clinic. 209 References References: Aceto, N., Sausgruber, N., Brinkhaus, H., Gaidatzis, D., Martiny-Baron, G., Mazzarol, G., Confalonieri, S., Quarto, M., Hu, G., Balwierz, P.J., et al. (2012). Tyrosine phosphatase SHP2 promotes breast cancer progression and maintains tumor-initiating cells via activation of key transcription factors and a positive feedback signaling loop. Nature medicine 18, 529-537. Aguirre-Ghiso, J.A. (2007). Models, mechanisms and clinical evidence for cancer dormancy. Nature reviews Cancer 7, 834-846. Al-Ejeh, F., Shi, W., Miranda, M., Simpson, P.T., Vargas, A.C., Song, S., Wiegmans, A.P., Swarbrick, A., Welm, A.L., Brown, M.P., et al. (2013). Treatment of triple-negative breast cancer using anti-EGFR-directed radioimmunotherapy combined with radiosensitizing chemotherapy and PARP inhibitor. Journal of nuclear medicine : official publication, Society of Nuclear Medicine 54, 913-921. Alani, R.M., Hasskarl, J., Grace, M., Hernandez, M.C., Israel, M.A., and Munger, K. (1999). Immortalization of primary human keratinocytes by the helix- loop-helix protein, Id-1. Proceedings of the National Academy of Sciences of the United States of America 96, 9637-9641. Alani, R.M., Young, A.Z., and Shifflett, C.B. (2001). Id1 regulation of cellular senescence through transcriptional repression of p16/Ink4a. Proceedings of the National Academy of Sciences of the United States of America 98, 7812-7816. Allred, D.C., Harvey, J.M., Berardo, M., and Clark, G.M. (1998). Prognostic and predictive factors in breast cancer by immunohistochemical analysis. Modern pathology : an official journal of the United States and Canadian Academy of Pathology, Inc 11, 155-168. Alvarez, V.A., Ridenour, D.A., and Sabatini, B.L. (2006). Retraction of synapses and dendritic spines induced by off-target effects of RNA interference. The Journal of neuroscience : the official journal of the Society for Neuroscience 26, 7820-7825. Anido, J., Saez-Borderias, A., Gonzalez-Junca, A., Rodon, L., Folch, G., Carmona, M.A., Prieto-Sanchez, R.M., Barba, I., Martinez-Saez, E., Prudkin, L., et al. (2010). TGF-beta Receptor Inhibitors Target the CD44(high)/Id1(high) Glioma-Initiating Cell Population in Human Glioblastoma. Cancer cell 18, 655- 668. Aslakson, C.J., and Miller, F.R. (1992). Selective events in the metastatic process defined by analysis of the sequential dissemination of subpopulations of a mouse mammary tumor. Cancer research 52, 1399-1405. 210 References Bain, G., Cravatt, C.B., Loomans, C., Alberola-Ila, J., Hedrick, S.M., and Murre, C. (2001a). Regulation of the helix-loop-helix proteins, E2A and Id3, by the Ras- ERK MAPK cascade. Nature immunology 2, 165-171. Baldwin, A.S. (2001). Control of oncogenesis and cancer therapy resistance by the transcription factor NF-kappaB. The Journal of clinical investigation 107, 241-246. Bandyopadhyay, A., Zhu, Y., Cibull, M.L., Bao, L., Chen, C., and Sun, L. (1999). A soluble transforming growth factor beta type III receptor suppresses tumorigenicity and metastasis of human breast cancer MDA-MB-231 cells. Cancer research 59, 5041-5046. Barcellos-Hoff, M.H., and Akhurst, R.J. (2009). Transforming growth factor-beta in breast cancer: too much, too late. Breast cancer research : BCR 11, 202. Barcellos-Hoff, M.H., Lyden, D., and Wang, T.C. (2013). The evolution of the cancer niche during multistage carcinogenesis. Nature reviews Cancer 13, 511- 518. Barrett, L.E., Granot, Z., Coker, C., Iavarone, A., Hambardzumyan, D., Holland, E.C., Nam, H.S., and Benezra, R. (2012). Self-renewal does not predict tumor growth potential in mouse models of high-grade glioma. Cancer cell 21, 11-24. Bartlett, J.M., Brookes, C.L., Robson, T., van de Velde, C.J., Billingham, L.J., Campbell, F.M., Grant, M., Hasenburg, A., Hille, E.T., Kay, C., et al. (2011). Estrogen receptor and progesterone receptor as predictive biomarkers of response to endocrine therapy: a prospectively powered pathology study in the Tamoxifen and Exemestane Adjuvant Multinational trial. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 29, 1531- 1538. Belletti, B., Drakas, R., Morrione, A., Tu, X., Prisco, M., Yuan, T., Casaburi, I., and Baserga, R. (2002). Regulation of Id1 protein expression in mouse embryo fibroblasts by the type 1 insulin-like growth factor receptor. Experimental cell research 277, 107-118. Belletti, B., Prisco, M., Morrione, A., Valentinis, B., Navarro, M., and Baserga, R. (2001). Regulation of Id2 gene expression by the insulin-like growth factor I receptor requires signaling by phosphatidylinositol 3-kinase. The Journal of biological chemistry 276, 13867-13874. Bellido, M., Aventin, A., Lasa, A., Estivill, C., Carnicer, M.J., Pons, C., Matias- Guiu, X., Bordes, R., Baiget, M., Sierra, J., et al. (2003). Id4 is deregulated by a t(6;14)(p22;q32) chromosomal translocation in a B-cell lineage acute lymphoblastic leukemia. Haematologica 88, 994-1001. Benezra, R., Davis, R.L., Lockshon, D., Turner, D.L., and Weintraub, H. (1990). The protein Id: a negative regulator of helix-loop-helix DNA binding proteins. Cell 61, 49-59. 211 References Bertram, J.S. (2000). The molecular biology of cancer. Mol Aspects Med 21, 167-223. Bettini, M., Xi, H., Milbrandt, J., and Kersh, G.J. (2002). Thymocyte development in early growth response gene 1-deficient mice. Journal of immunology 169, 1713-1720. Bhattacharya, R., Kowalski, J., Larson, A.R., Brock, M., and Alani, R.M. (2010). Id1 promotes tumor cell migration in nonsmall cell lung cancers. Journal of oncology 2010, 856105. Bi, X., Hameed, M., Mirani, N., Pimenta, E.M., Anari, J., and Barnes, B.J. (2011). Loss of interferon regulatory factor 5 (IRF5) expression in human ductal carcinoma correlates with disease stage and contributes to metastasis. Breast cancer research : BCR 13, R111. Bibby, M.C. (2004). Orthotopic models of cancer for preclinical drug evaluation: advantages and disadvantages. European journal of cancer 40, 852-857. Bidwell, B.N., Slaney, C.Y., Withana, N.P., Forster, S., Cao, Y., Loi, S., Andrews, D., Mikeska, T., Mangan, N.E., Samarajiwa, S.A., et al. (2012). Silencing of Irf7 pathways in breast cancer cells promotes bone metastasis through immune escape. Nature medicine 18, 1224-1231. Boden, D., Pusch, O., Silbermann, R., Lee, F., Tucker, L., and Ramratnam, B. (2004). Enhanced gene silencing of HIV-1 specific siRNA using microRNA designed hairpins. Nucleic Acids Res 32, 1154-1158. Boiani, M., and Scholer, H.R. (2005). Regulatory networks in embryo-derived pluripotent stem cells. Nature reviews Molecular cell biology 6, 872-884. Bos, P.D., Zhang, X.H., Nadal, C., Shu, W., Gomis, R.R., Nguyen, D.X., Minn, A.J., van de Vijver, M.J., Gerald, W.L., Foekens, J.A., et al. (2009). Genes that mediate breast cancer metastasis to the brain. Nature 459, 1005-1009. Bouker, K.B., Skaar, T.C., Riggins, R.B., Harburger, D.S., Fernandez, D.R., Zwart, A., Wang, A., and Clarke, R. (2005). Interferon regulatory factor-1 (IRF- 1) exhibits tumor suppressor activities in breast cancer associated with caspase activation and induction of apoptosis. Carcinogenesis 26, 1527-1535. Brabletz, T. (2012a). To differentiate or not--routes towards metastasis. Nat Rev Cancer 12, 425-436. Bridge, A.J., Pebernard, S., Ducraux, A., Nicoulaz, A.L., and Iggo, R. (2003). Induction of an interferon response by RNAi vectors in mammalian cells. Nat Genet 34, 263-264. Browne, E.P., Wing, B., Coleman, D., and Shenk, T. (2001). Altered cellular mRNA levels in human cytomegalovirus-infected fibroblasts: viral block to the accumulation of antiviral mRNAs. Journal of virology 75, 12319-12330. 212 References Brummelkamp, T.R., Bernards, R., and Agami, R. (2002). A system for stable expression of short interfering RNAs in mammalian cells. Science 296, 550-553. Cai, L., Morrow, E.M., and Cepko, C.L. (2000). Misexpression of basic helix- loop-helix genes in the murine cerebral cortex affects cell fate choices and neuronal survival. Development (Cambridge, England) 127, 3021-3030. Caldon, C.E., Daly, R.J., Sutherland, R.L., and Musgrove, E.A. (2006). Cell cycle control in breast cancer cells. Journal of cellular biochemistry 97, 261-274. Cao, W., Hunter, R., Strnatka, D., McQueen, C.A., and Erickson, R.P. (2005). DNA constructs designed to produce short hairpin, interfering RNAs in transgenic mice sometimes show early lethality and an interferon response. Journal of applied genetics 46, 217-225. Carey, L.A., Dees, E.C., Sawyer, L., Gatti, L., Moore, D.T., Collichio, F., Ollila, D.W., Sartor, C.I., Graham, M.L., and Perou, C.M. (2007a). The Triple Negative Paradox: Primary Tumor Chemosensitivity of Breast Cancer Subtypes. Clinical Cancer Research 13, 2329-2334. Carter, C.L., Allen, C., and Henson, D.E. (1989). Relation of tumor size, lymph node status, and survival in 24,740 breast cancer cases. Cancer 63, 181-187. Castanon, E., Bosch-Barrera, J., Lopez, I., Collado, V., Moreno, M., Lopez- Picazo, J.M., Arbea, L., Lozano, M.D., Calvo, A., and Gil-Bazo, I. (2013). Id1 and Id3 co-expression correlates with clinical outcome in stage III-N2 non-small cell lung cancer patients treated with definitive chemoradiotherapy. J Transl Med 11, 13. Casula, M., Ascierto, P.A., Cossu, A., Sini, M.C., Tore, S., Colombino, M., Satta, M.P., Manca, A., Rozzo, C., Satriano, S.M., et al. (2003). Mutation analysis of candidate genes in melanoma-prone families: evidence of different pathogenetic mechanisms at chromosome 9P21. Melanoma Res 13, 571-579. Chaffer, C.L., and Weinberg, R.A. (2011). A perspective on cancer cell metastasis. Science 331, 1559-1564. Chambers, A.F., Groom, A.C., and MacDonald, I.C. (2002). Dissemination and growth of cancer cells in metastatic sites. Nature reviews Cancer 2, 563-572. Charafe-Jauffret, E., Ginestier, C., Iovino, F., Wicinski, J., Cervera, N., Finetti, P., Hur, M.H., Diebel, M.E., Monville, F., Dutcher, J., et al. (2009). Breast cancer cell lines contain functional cancer stem cells with metastatic capacity and a distinct molecular signature. Cancer research 69, 1302-1313. Cheang, M.C., Chia, S.K., Voduc, D., Gao, D., Leung, S., Snider, J., Watson, M., Davies, S., Bernard, P.S., Parker, J.S., et al. (2009). Ki67 index, HER2 status, and prognosis of patients with luminal B breast cancer. Journal of the National Cancer Institute 101, 736-750. 213 References Chen, Q., Zhang, X.H., and Massague, J. (2011a). Macrophage binding to receptor VCAM-1 transmits survival signals in breast cancer cells that invade the lungs. Cancer cell 20, 538-549. Chen, S.-S., Claus, R., Lucas, D.M., Yu, L., Qian, J., Ruppert, A.S., West, D.A., Williams, K.E., Johnson, A.J., Sablitzky, F., et al. (2011b). Silencing of the inhibitor of DNA binding protein 4 (ID4) contributes to the pathogenesis of mouse and human CLL. Blood 117, 862-871. Cheng, Y.J., Tsai, J.W., Hsieh, K.C., Yang, Y.C., Chen, Y.J., Huang, M.S., and Yuan, S.S. (2011). Id1 promotes lung cancer cell proliferation and tumor growth through Akt-related pathway. Cancer letters 307, 191-199. Cheung, P.Y., Yip, Y.L., Tsao, S.W., Ching, Y.P., and Cheung, A.L. (2011). Id-1 induces cell invasiveness in immortalized epithelial cells by regulating cadherin switching and Rho GTPases. Journal of cellular biochemistry 112, 157-168. Cho, H.J., Jung, J.I., Lim do, Y., Kwon, G.T., Her, S., Park, J.H., and Park, J.H. (2012). Bone marrow-derived, alternatively activated macrophages enhance solid tumor growth and lung metastasis of mammary carcinoma cells in a Balb/C mouse orthotopic model. Breast cancer research : BCR 14, R81. Ciarrocchi, A., Piana, S., Valcavi, R., Gardini, G., and Casali, B. (2011). Inhibitor of DNA binding-1 induces mesenchymal features and promotes invasiveness in thyroid tumour cells. European journal of cancer 47, 934-945. Cook, K.L., Shajahan, A.N., and Clarke, R. (2011). Autophagy and endocrine resistance in breast cancer. Expert review of anticancer therapy 11, 1283-1294. Coppe, J.P., Itahana, Y., Moore, D.H., Bennington, J.L., and Desprez, P.Y. (2004). Id-1 and Id-2 proteins as molecular markers for human prostate cancer progression. Clinical Cancer Research 10, 2044-2051. Coppe, J.P., Smith, A.P., and Desprez, P.Y. (2003). Id proteins in epithelial cells. Experimental cell research 285, 131-145. Cullen, B.R. (2006). Induction of stable RNA interference in mammalian cells. Gene therapy 13, 503-508. Curtis, C., Shah, S.P., Chin, S.F., Turashvili, G., Rueda, O.M., Dunning, M.J., Speed, D., Lynch, A.G., Samarajiwa, S., Yuan, Y., et al. (2012b). The genomic and transcriptomic architecture of 2,000 breast tumours reveals novel subgroups. Nature 486, 346-352. Dalton, L.W., Page, D.L., and Dupont, W.D. (1994). Histologic grading of breast carcinoma. A reproducibility study. Cancer 73, 2765-2770. Davis, R.L., Weintraub, H., and Lassar, A.B. (1987). Expression of a single transfected cDNA converts fibroblasts to myoblasts. Cell 51, 987-1000. 214 References de Candia, P., Benera, R., and Solit, D.B. (2004a). A role for Id proteins in mammary gland physiology and tumorigenesis. Adv Cancer Res 92, 81-94. De Wever, O., and Mareel, M. (2003). Role of tissue stroma in cancer cell invasion. The Journal of pathology 200, 429-447. Der, S.D., Zhou, A., Williams, B.R., and Silverman, R.H. (1998). Identification of genes differentially regulated by interferon alpha, beta, or gamma using oligonucleotide arrays. Proceedings of the National Academy of Sciences of the United States of America 95, 15623-15628. Desprez, P.Y., Lin, C.Q., Thomasset, N., Sympson, C.J., Bissell, M.J., and Campisi, J. (1998). A novel pathway for mammary epithelial cell invasion induced by the helix-loop-helix protein Id-1. Molecular and cellular biology 18, 4577-4588. Dimri, G.P., Martinez, J.L., Jacobs, J.J., Keblusek, P., Itahana, K., Van Lohuizen, M., Campisi, J., Wazer, D.E., and Band, V. (2002). The Bmi-1 oncogene induces telomerase activity and immortalizes human mammary epithelial cells. Cancer research 62, 4736-4745. Ding, R., Han, S., Lu, Y., Guo, C., Xie, H., Zhang, N., Song, Z., Cai, L., Liu, J., and Dou, K. (2010). Overexpressed Id-1 is associated with patient prognosis and HBx expression in hepatitis B virus-related hepatocellular carcinoma. Cancer biology & therapy 10, 299-307. Ding, Y., Wang, G., Ling, M.T., Wong, Y.C., Li, X., Na, Y., Zhang, X., Chua, C.W., Wang, X., and Xin, D. (2006). Significance of Id-1 up-regulation and its association with EGFR in bladder cancer cell invasion. International journal of oncology 28, 847-854. Donegan, W.L., and Spratt, J.S. (2002). Cancer of the breast, 5th edn (Philadelphia: Saunders). Dong, M., How, T., Kirkbride, K.C., Gordon, K.J., Lee, J.D., Hempel, N., Kelly, P., Moeller, B.J., Marks, J.R., and Blobe, G.C. (2007). The type III TGF-beta receptor suppresses breast cancer progression. The Journal of clinical investigation 117, 206-217. Dong, Z.Q., Liu, S.H., Zhou, C.J., Sumida, T., Hamakawa, H., Chen, Z.G., Liu, P., and Wei, F.C. (2010). Overexpression of Id-1 is associated with tumor angiogenesis and poor clinical outcome in oral squamous cell carcinoma. Oral oncology 46, 154-157. Dontu, G., Abdallah, W.M., Foley, J.M., Jackson, K.W., Clarke, M.F., Kawamura, M.J., and Wicha, M.S. (2003). In vitro propagation and transcriptional profiling of human mammary stem/progenitor cells. Genes & development 17, 1253-1270. 215 References Dowsett, M., Allred, C., Knox, J., Quinn, E., Salter, J., Wale, C., Cuzick, J., Houghton, J., Williams, N., Mallon, E., et al. (2008). Relationship between quantitative estrogen and progesterone receptor expression and human epidermal growth factor receptor 2 (HER-2) status with recurrence in the Arimidex, Tamoxifen, Alone or in Combination trial. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 26, 1059-1065. Dull, T., Zufferey, R., Kelly, M., Mandel, R.J., Nguyen, M., Trono, D., and Naldini, L. (1998). A third-generation lentivirus vector with a conditional packaging system. Journal of virology 72, 8463-8471. Easton, D.F. (1999). How many more breast cancer predisposition genes are there? Breast cancer research : BCR 1, 14-17. Eccles, S.A., Box, G., Court, W., Sandle, J., and Dean, C.J. (1994). Preclinical models for the evaluation of targeted therapies of metastatic disease. Cell biophysics 24-25, 279-291. Eckhardt, B.L., Francis, P.A., Parker, B.S., and Anderson, R.L. (2012). Strategies for the discovery and development of therapies for metastatic breast cancer. Nature reviews Drug discovery 11, 479-497. Eckhardt, B.L., Parker, B.S., van Laar, R.K., Restall, C.M., Natoli, A.L., Tavaria, M.D., Stanley, K.L., Sloan, E.K., Moseley, J.M., and Anderson, R.L. (2005). Genomic analysis of a spontaneous model of breast cancer metastasis to bone reveals a role for the extracellular matrix. Mol Cancer Res 3, 1-13. Egeblad, M., and Werb, Z. (2002). New functions for the matrix metalloproteinases in cancer progression. Nature reviews Cancer 2, 161-174. Ell, B., and Kang, Y. (2013). Transcriptional control of cancer metastasis. Trends Cell Biol 23, 603-611. Ephrussi, A., Church, G.M., Tonegawa, S., and Gilbert, W. (1985). B lineage-- specific interactions of an immunoglobulin enhancer with cellular factors in vivo. Science 227, 134-140. Fasano, C.A., Dimos, J.T., Ivanova, N.B., Lowry, N., Lemischka, I.R., and Temple, S. (2007). shRNA knockdown of Bmi-1 reveals a critical role for p21-Rb pathway in NSC self-renewal during development. Cell stem cell 1, 87-99. Ferrantini, M., Capone, I., and Belardelli, F. (2007). Interferon-alpha and cancer: mechanisms of action and new perspectives of clinical use. Biochimie 89, 884- 893. Fidler, I.J. (2003). The pathogenesis of cancer metastasis: the 'seed and soil' hypothesis revisited. Nature reviews Cancer 3, 453-458. 216 References Finak, G., Bertos, N., Pepin, F., Sadekova, S., Souleimanova, M., Zhao, H., Chen, H., Omeroglu, G., Meterissian, S., Omeroglu, A., et al. (2008). Stromal gene expression predicts clinical outcome in breast cancer. Nature medicine 14, 518-527. Fong, P.C., Boss, D.S., Yap, T.A., Tutt, A., Wu, P., Mergui-Roelvink, M., Mortimer, P., Swaisland, H., Lau, A., O'Connor, M.J., et al. (2009). Inhibition of poly(ADP-ribose) polymerase in tumors from BRCA mutation carriers. The New England journal of medicine 361, 123-134. Fong, S., Itahana, Y., Sumida, T., Singh, J., Coppe, J.P., Liu, Y., Richards, P.C., Bennington, J.L., Lee, N.M., Debs, R.J., et al. (2003). Id-1 as a molecular target in therapy for breast cancer cell invasion and metastasis. Proceedings of the National Academy of Sciences of the United States of America 100, 13543- 13548. Fulford, L.G., Reis-Filho, J.S., Ryder, K., Jones, C., Gillett, C.E., Hanby, A., Easton, D., and Lakhani, S.R. (2007). Basal-like grade III invasive ductal carcinoma of the breast: patterns of metastasis and long-term survival. Breast cancer research : BCR 9, R4. Gao, D., Nolan, D.J., Mellick, A.S., Bambino, K., McDonnell, K., and Mittal, V. (2008). Endothelial progenitor cells control the angiogenic switch in mouse lung metastasis. Science 319, 195-198. Garcia-Sastre, A., and Biron, C.A. (2006). Type 1 interferons and the virus-host relationship: a lesson in detente. Science 312, 879-882. Garcia, M., Jemal, A., Ward, E.M., Center, M.M., Hao, Y., Siegel, R.L., and Thun, M.J. (2007). Global Cancer Facts & Figures 2007 (Atlanta, GA, USA: The American Cancer Society). Gargiulo, G., Cesaroni, M., Serresi, M., de Vries, N., Hulsman, D., Bruggeman, S.W., Lancini, C., and van Lohuizen, M. (2013). In vivo RNAi screen for BMI1 targets identifies TGF-beta/BMP-ER stress pathways as key regulators of neural- and malignant glioma-stem cell homeostasis. Cancer cell 23, 660-676. Ghajar, C.M., Peinado, H., Mori, H., Matei, I.R., Evason, K.J., Brazier, H., Almeida, D., Koller, A., Hajjar, K.A., Stainier, D.Y., et al. (2013). The perivascular niche regulates breast tumour dormancy. Nat Cell Biol. Goel, H.L., and Mercurio, A.M. (2013). VEGF targets the tumour cell. Nature reviews Cancer 13, 871-882. Gossen, M., and Bujard, H. (1992). Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Proceedings of the National Academy of Sciences of the United States of America 89, 5547-5551. 217 References Goumans, M.J., Valdimarsdottir, G., Itoh, S., Rosendahl, A., Sideras, P., and ten Dijke, P. (2002). Balancing the activation state of the endothelium via two distinct TGF-beta type I receptors. The EMBO journal 21, 1743-1753. Green, J.E., Shibata, M.A., Yoshidome, K., Liu, M.L., Jorcyk, C., Anver, M.R., Wigginton, J., Wiltrout, R., Shibata, E., Kaczmarczyk, S., et al. (2000). The C3(1)/SV40 T-antigen transgenic mouse model of mammary cancer: ductal epithelial cell targeting with multistage progression to carcinoma. Oncogene 19, 1020-1027. Gumireddy, K., Li, A., Gimotty, P.A., Klein-Szanto, A.J., Showe, L.C., Katsaros, D., Coukos, G., Zhang, L., and Huang, Q. (2009). KLF17 is a negative regulator of epithelial-mesenchymal transition and metastasis in breast cancer. Nature cell biology 11, 1297-1304. Guo, B.H., Feng, Y., Zhang, R., Xu, L.H., Li, M.Z., Kung, H.F., Song, L.B., and Zeng, M.S. (2011). Bmi-1 promotes invasion and metastasis, and its elevated expression is correlated with an advanced stage of breast cancer. Molecular cancer 10, 10. Guo, W.J., Datta, S., Band, V., and Dimri, G.P. (2007a). Mel-18, a polycomb group protein, regulates cell proliferation and senescence via transcriptional repression of Bmi-1 and c-Myc oncoproteins. Mol Biol Cell 18, 536-546. Guo, W.J., Zeng, M.S., Yadav, A., Song, L.B., Guo, B.H., Band, V., and Dimri, G.P. (2007b). Mel-18 acts as a tumor suppressor by repressing Bmi-1 expression and down-regulating Akt activity in breast cancer cells. Cancer research 67, 5083-5089. Gupta, G.P., and Massague, J. (2006). Cancer metastasis: building a framework. Cell 127, 679-695. Gupta, G.P., Perk, J., Acharyya, S., de Candia, P., Mittal, V., Todorova- Manova, K., Gerald, W.L., Brogi, E., Benezra, R., and Massague, J. (2007). ID genes mediate tumor reinitiation during breast cancer lung metastasis. Proceedings of the National Academy of Sciences of the United States of America 104, 19506-19511. Haibe-Kains, B., Desmedt, C., Loi, S., Culhane, A.C., Bontempi, G., Quackenbush, J., and Sotiriou, C. (2012). A three-gene model to robustly identify breast cancer molecular subtypes. Journal of the National Cancer Institute 104, 311-325. Han, S.A., Guo, C.C., Hong, L., Liu, H., ZheyiHan, Liu, C.J., Wang, J., Wu, K.C., Ding, J., and Fan, D.M. (2004). Expression and significance of Id1 helix- loop-helix protein overexpression in gastric cancer. Cancer letters 216, 63-71. Hanahan, D., and Weinberg, R.A. (2000). The hallmarks of cancer. Cell 100, 57-70. 218 References Hanahan, D., and Weinberg, R.A. (2011). Hallmarks of cancer: the next generation. Cell 144, 646-674. Harvey, J.M., de Klerk, N.H., and Sterrett, G.F. (1992). Histological grading in breast cancer: interobserver agreement, and relation to other prognostic factors including ploidy. Pathology 24, 63-68. Hayashi, S.I., Eguchi, H., Tanimoto, K., Yoshida, T., Omoto, Y., Inoue, A., Yoshida, N., and Yamaguchi, Y. (2003). The expression and function of estrogen receptor alpha and beta in human breast cancer and its clinical application. Endocrine-related cancer 10, 193-202. Hedenfalk, I., Duggan, D., Chen, Y., Radmacher, M., Bittner, M., Simon, R., Meltzer, P., Gusterson, B., Esteller, M., Kallioniemi, O.P., et al. (2001). Gene- expression profiles in hereditary breast cancer. The New England journal of medicine 344, 539-548. Henke, E., Perk, J., Vider, J., de Candia, P., Chin, Y., Solit, D.B., Ponomarev, V., Cartegni, L., Manova, K., Rosen, N., et al. (2008). Peptide-conjugated antisense oligonucleotides for targeted inhibition of a transcriptional regulator in vivo. Nature biotechnology 26, 91-100. Herbert, B.S., Wright, W.E., and Shay, J.W. (2001). Telomerase and breast cancer. Breast cancer research : BCR 3, 146-149. Herschkowitz, J.I., Simin, K., Weigman, V.J., Mikaelian, I., Usary, J., Hu, Z., Rasmussen, K.E., Jones, L.P., Assefnia, S., Chandrasekharan, S., et al. (2007). Identification of conserved gene expression features between murine mammary carcinoma models and human breast tumors. Genome biology 8, R76. Herschkowitz, J.I., Zhao, W., Zhang, M., Usary, J., Murrow, G., Edwards, D., Knezevic, J., Greene, S.B., Darr, D., Troester, M.A., et al. (2012). Comparative oncogenomics identifies breast tumors enriched in functional tumor-initiating cells. Proceedings of the National Academy of Sciences of the United States of America 109, 2778-2783. Hoffman, R.M. (1999). Orthotopic metastatic mouse models for anticancer drug discovery and evaluation: a bridge to the clinic. Investigational new drugs 17, 343-359. Hollnagel, A., Oehlmann, V., Heymer, J., Ruther, U., and Nordheim, A. (1999). Id genes are direct targets of bone morphogenetic protein induction in embryonic stem cells. The Journal of biological chemistry 274, 19838-19845. Hopton, D.S., Thorogood, J., Clayden, A.D., and MacKinnon, D. (1989). Observer variation in histological grading of breast cancer. European journal of surgical oncology : the journal of the European Society of Surgical Oncology and the British Association of Surgical Oncology 15, 21-23. 219 References Hornung, V., Guenthner-Biller, M., Bourquin, C., Ablasser, A., Schlee, M., Uematsu, S., Noronha, A., Manoharan, M., Akira, S., de Fougerolles, A., et al. (2005). Sequence-specific potent induction of IFN-alpha by short interfering RNA in plasmacytoid dendritic cells through TLR7. Nature medicine 11, 263- 270. Huang, S., Bucana, C.D., Van Arsdall, M., and Fidler, I.J. (2002). Stat1 negatively regulates angiogenesis, tumorigenicity and metastasis of tumor cells. Oncogene 21, 2504-2512. Hui, A.Y., and Friedman, S.L. (2003). Molecular basis of hepatic fibrosis. Expert reviews in molecular medicine 5, 1-23. Hui, M., Cazet, A., Nair, R., Watkins, D.N., O'Toole, S.A., and Swarbrick, A. (2013). The Hedgehog signalling pathway in breast development, carcinogenesis and cancer therapy. Breast cancer research : BCR 15, 203. Huot, T.J., Rowe, J., Harland, M., Drayton, S., Brookes, S., Gooptu, C., Purkis, P., Fried, M., Bataille, V., Hara, E., et al. (2002). Biallelic mutations in p16(INK4a) confer resistance to Ras- and Ets-induced senescence in human diploid fibroblasts. Molecular and cellular biology 22, 8135-8143. Hutchinson, J.N., and Muller, W.J. (2000). Transgenic mouse models of human breast cancer. Oncogene 19, 6130-6137. Ikeda, H., Old, L.J., and Schreiber, R.D. (2002). The roles of IFN gamma in protection against tumor development and cancer immunoediting. Cytokine & growth factor reviews 13, 95-109. Iwatsuki, M., Fukagawa, T., Mimori, K., Nakanishi, H., Ito, S., Ishii, H., Yokobori, T., Sasako, M., Baba, H., and Mori, M. (2009). Bone marrow and peripheral blood expression of ID1 in human gastric carcinoma patients is a bona fide indicator of lymph node and peritoneal metastasis. British journal of cancer 100, 1937-1942. Jackson, A.L., Bartz, S.R., Schelter, J., Kobayashi, S.V., Burchard, J., Mao, M., Li, B., Cavet, G., and Linsley, P.S. (2003). Expression profiling reveals off-target gene regulation by RNAi. Nature biotechnology 21, 635-637. Jankovic, V., Ciarrocchi, A., Boccuni, P., DeBlasio, T., Benezra, R., and Nimer, S.D. (2007). Id1 restrains myeloid commitment, maintaining the self-renewal capacity of hematopoietic stem cells. Proceedings of the National Academy of Sciences of the United States of America 104, 1260-1265. Jemal, A., Bray, F., Center, M.M., Ferlay, J., Ward, E., and Forman, D. (2011). Global cancer statistics. CA: a cancer journal for clinicians 61, 69-90. Jen, Y., Manova, K., and Benezra, R. (1997a). Each member of the Id gene family exhibits a unique expression pattern in mouse gastrulation and 220 References neurogenesis. Developmental dynamics : an official publication of the American Association of Anatomists 208, 92-106. Jen, Y., Weintraub, H., and Benezra, R. (1992). Overexpression of Id protein inhibits the muscle differentiation program: in vivo association of Id with E2A proteins. Genes & development 6, 1466-1479. Jin, X., Yin, J., Kim, S.H., Sohn, Y.W., Beck, S., Lim, Y.C., Nam, D.H., Choi, Y.J., and Kim, H. (2011). EGFR-AKT-Smad signaling promotes formation of glioma stem-like cells and tumor angiogenesis by ID3-driven cytokine induction. Cancer research 71, 7125-7134. Jumppanen, M., Gruvberger-Saal, S., Kauraniemi, P., Tanner, M., Bendahl, P.O., Lundin, M., Krogh, M., Kataja, P., Borg, A., Ferno, M., et al. (2007). Basal- like phenotype is not associated with patient survival in estrogen-receptor- negative breast cancers. Breast cancer research : BCR 9, R16. Kang, Y., Chen, C.R., and Massague, J. (2003a). A self-enabling TGFbeta response coupled to stress signaling: Smad engages stress response factor ATF3 for Id1 repression in epithelial cells. Mol Cell 11, 915-926. Kang, Y., Siegel, P.M., Shu, W., Drobnjak, M., Kakonen, S.M., Cordon-Cardo, C., Guise, T.A., and Massague, J. (2003b). A multigenic program mediating breast cancer metastasis to bone. Cancer cell 3, 537-549. Kariko, K., Bhuyan, P., Capodici, J., and Weissman, D. (2004). Small interfering RNAs mediate sequence-independent gene suppression and induce immune activation by signaling through toll-like receptor 3. Journal of immunology 172, 6545-6549. Katagiri, T., Yamaguchi, A., Komaki, M., Abe, E., Takahashi, N., Ikeda, T., Rosen, V., Wozney, J.M., Fujisawa-Sehara, A., and Suda, T. (1994). Bone morphogenetic protein-2 converts the differentiation pathway of C2C12 myoblasts into the osteoblast lineage. J Cell Biol 127, 1755-1766. Kaur, P., Nagaraja, G.M., Zheng, H., Gizachew, D., Galukande, M., Krishnan, S., and Asea, A. (2012). A mouse model for triple-negative breast cancer tumor- initiating cells (TNBC-TICs) exhibits similar aggressive phenotype to the human disease. BMC cancer 12, 120. Kebebew, E., Peng, M., Treseler, P.A., Clark, O.H., Duh, Q.Y., Ginzinger, D., and Miner, R. (2004). Id1 gene expression is up-regulated in hyperplastic and neoplastic thyroid tissue and regulates growth and differentiation in thyroid cancer cells. The Journal of clinical endocrinology and metabolism 89, 6105- 6111. Kee, B.L. (2009). E and ID proteins branch out. Nat Rev Immunol 9, 175-184. 221 References Kee, B.L., Rivera, R.R., and Murre, C. (2001). Id3 inhibits B lymphocyte progenitor growth and survival in response to TGF-beta. Nature immunology 2, 242-247. Kelly, P.N., Dakic, A., Adams, J.M., Nutt, S.L., and Strasser, A. (2007). Tumor growth need not be driven by rare cancer stem cells. Science 317, 337-337. Kim, H., Chung, H., Kim, H.J., Lee, J.Y., Oh, M.Y., Kim, Y., and Kong, G. (2008). Id-1 regulates Bcl-2 and Bax expression through p53 and NF-kappaB in MCF-7 breast cancer cells. Breast cancer research and treatment 112, 287- 296. Kleeff, J., Ishiwata, T., Friess, H., Buchler, M.W., Israel, M.A., and Korc, M. (1998). The helix-loop-helix protein Id2 is overexpressed in human pancreatic cancer. Cancer research 58, 3769-3772. Kobayashi, H., Boelte, K.C., and Lin, P.C. (2007). Endothelial cell adhesion molecules and cancer progression. Current medicinal chemistry 14, 377-386. Kohrmann, A., Kammerer, U., Kapp, M., Dietl, J., and Anacker, J. (2009). Expression of matrix metalloproteinases (MMPs) in primary human breast cancer and breast cancer cell lines: New findings and review of the literature. BMC cancer 9, 188. Kowanetz, M., Valcourt, U., Bergstrom, R., Heldin, C.H., and Moustakas, A. (2004). Id2 and Id3 define the potency of cell proliferation and differentiation responses to transforming growth factor beta and bone morphogenetic protein. Molecular and cellular biology 24, 4241-4254. Kreider, B.L., Benezra, R., Rovera, G., and Kadesch, T. (1992). Inhibition of myeloid differentiation by the helix-loop-helix protein Id. Science 255, 1700- 1702. Kreso, A., van Galen, P., Pedley, N.M., Lima-Fernandes, E., Frelin, C., Davis, T., Cao, L., Baiazitov, R., Du, W., Sydorenko, N., et al. (2014). Self-renewal as a therapeutic target in human colorectal cancer. Nature medicine 20, 29-36. Kuperwasser, C., Hurlbut, G.D., Kittrell, F.S., Dickinson, E.S., Laucirica, R., Medina, D., Naber, S.P., and Jerry, D.J. (2000). Development of spontaneous mammary tumors in BALB/c p53 heterozygous mice. A model for Li-Fraumeni syndrome. The American journal of pathology 157, 2151-2159. Landemaine, T., Jackson, A., Bellahcene, A., Rucci, N., Sin, S., Abad, B.M., Sierra, A., Boudinet, A., Guinebretiere, J.M., Ricevuto, E., et al. (2008). A six- gene signature predicting breast cancer lung metastasis. Cancer research 68, 6092-6099. Lane, D.P. (1992). Cancer. p53, guardian of the genome. Nature 358, 15-16. 222 References Lasorella, A., Benezra, R., and Iavarone, A. (2014). The ID proteins: master regulators of cancer stem cells and tumour aggressiveness. Nature reviews Cancer 14, 77-91. Lasorella, A., Noseda, M., Beyna, M., Yokota, Y., and Iavarone, A. (2000). Id2 is a retinoblastoma protein target and mediates signalling by Myc oncoproteins. Nature 407, 592-598. Lasorella, A., Stegmuller, J., Guardavaccaro, D., Liu, G., Carro, M.S., Rothschild, G., de la Torre-Ubieta, L., Pagano, M., Bonni, A., and Iavarone, A. (2006). Degradation of Id2 by the anaphase-promoting complex couples cell cycle exit and axonal growth. Nature 442, 471-474. Le Devedec, S.E., van Roosmalen, W., Maria, N., Grimbergen, M., Pont, C., Lalai, R., and van de Water, B. (2009). An improved model to study tumor cell autonomous metastasis programs using MTLn3 cells and the Rag2(-/-) gammac (-/-) mouse. Clin Exp Metastas 26, 673-684. Lee, J.Y., Kang, M.B., Jang, S.H., Qian, T., Kim, H.J., Kim, C.H., Kim, Y., and Kong, G. (2009). Id-1 activates Akt-mediated Wnt signaling and p27(Kip1) phosphorylation through PTEN inhibition. Oncogene 28, 824-831. Lee, S.H., Hao, E., Kiselyuk, A., Shapiro, J., Shields, D.J., Lowy, A., Levine, F., and Itkin-Ansari, P. (2011). The Id3/E47 axis mediates cell-cycle control in human pancreatic ducts and adenocarcinoma. Mol Cancer Res 9, 782-790. Lelekakis, M., Moseley, J.M., Martin, T.J., Hards, D., Williams, E., Ho, P., Lowen, D., Javni, J., Miller, F.R., Slavin, J., et al. (1999). A novel orthotopic model of breast cancer metastasis to bone. Clin Exp Metastas 17, 163-170. Lengauer, C., Kinzler, K.W., and Vogelstein, B. (1998). Genetic instabilities in human cancers. Nature 396, 643-649. Lessard, J., and Sauvageau, G. (2003). Bmi-1 determines the proliferative capacity of normal and leukaemic stem cells. Nature 423, 255-260. Lewis Phillips, G.D., Li, G., Dugger, D.L., Crocker, L.M., Parsons, K.L., Mai, E., Blattler, W.A., Lambert, J.M., Chari, R.V., Lutz, R.J., et al. (2008). Targeting HER2-positive breast cancer with trastuzumab-DM1, an antibody-cytotoxic drug conjugate. Cancer research 68, 9280-9290. Li, B., Tsao, S.W., Li, Y.Y., Wang, X., Ling, M.T., Wong, Y.C., He, Q.Y., and Cheung, A.L. (2009). Id-1 promotes tumorigenicity and metastasis of human esophageal cancer cells through activation of PI3K/AKT signaling pathway. International journal of cancer Journal international du cancer 125, 2576-2585. Li, C.I., Uribe, D.J., and Daling, J.R. (2005). Clinical characteristics of different histologic types of breast cancer. British journal of cancer 93, 1046-1052. 223 References Li, X., Zhang, Z., Xin, D., Chua, C.W., Wong, Y.C., Leung, S.C., Na, Y., and Wang, X. (2007a). Prognostic significance of Id-1 and its association with EGFR in renal cell cancer. Histopathology 50, 484-490. Li, Y.J., Yang, J.W., Luo, J.H., Dedhar, S., and Liu, Y.H. (2007b). Tubular epithelial cell dedifferentiation is driven by the helix-loop-helix transcriptional inhibitor Id1. Journal of the American Society of Nephrology 18, 449-460. Lim, E., Vaillant, F., Wu, D., Forrest, N.C., Pal, B., Hart, A.H., Asselin-Labat, M.L., Gyorki, D.E., Ward, T., Partanen, A., et al. (2009). Aberrant luminal progenitors as the candidate target population for basal tumor development in BRCA1 mutation carriers. Nature medicine 15, 907-913. Lin, C.Q., Parrinello, S., Campisi, J., and Desprez, P.Y. (1999). Regulation of mammary epithelial cell phenotypes by the helix-loop-helix protein, Id-1. Endocrine-related cancer 6, 49-50. Lin, C.Q., Singh, J., Murata, K., Itahana, Y., Parrinello, S., Liang, S.H., Gillett, C.E., Campisi, J., and Desprez, P.Y. (2000a). A role for Id-1 in the aggressive phenotype and steroid hormone response of human breast cancer cells. Cancer research 60, 1332-1340. Lin, J., Guan, Z., Wang, C., Feng, L., Zheng, Y., Caicedo, E., Bearth, E., Peng, J.R., Gaffney, P., and Ondrey, F.G. (2010). Inhibitor of differentiation 1 contributes to head and neck squamous cell carcinoma survival via the NF- kappaB/survivin and phosphoinositide 3-kinase/Akt signaling pathways. Clinical cancer research : an official journal of the American Association for Cancer Research 16, 77-87. Lin, J.C., Chang, S.Y., Hsieh, D.S., Lee, C.F., and Yu, D.S. (2005a). The association of Id-1, MIF and GSTpi with acquired drug resistance in hormone independent prostate cancer cells. Oncology reports 13, 983-988. Ling, M.T., Wang, X.H., Ouyang, X.S., Xu, K.X., Tsao, S.W., and Wong, Y.C. (2003). Id-1 expression promotes cell survival through activation of NF-kappa B signalling pathway in prostate cancer cells. Oncogene 22, 4498-4508. Liu, R., Wang, X., Chen, G.Y., Dalerba, P., Gurney, A., Hoey, T., Sherlock, G., Lewicki, J., Shedden, K., and Clarke, M.F. (2007). The prognostic role of a gene signature from tumorigenic breast-cancer cells. The New England journal of medicine 356, 217-226. Liu, S., Dontu, G., Mantle, I.D., Patel, S., Ahn, N.S., Jackson, K.W., Suri, P., and Wicha, M.S. (2006). Hedgehog signaling and Bmi-1 regulate self-renewal of normal and malignant human mammary stem cells. Cancer research 66, 6063- 6071. Lopez-Rovira, T., Chalaux, E., Massague, J., Rosa, J.L., and Ventura, F. (2002). Direct binding of Smad1 and Smad4 to two distinct motifs mediates 224 References bone morphogenetic protein-specific transcriptional activation of Id1 gene. The Journal of biological chemistry 277, 3176-3185. Lou, Y., McDonald, P.C., Oloumi, A., Chia, S., Ostlund, C., Ahmadi, A., Kyle, A., Auf dem Keller, U., Leung, S., Huntsman, D., et al. (2011). Targeting tumor hypoxia: suppression of breast tumor growth and metastasis by novel carbonic anhydrase IX inhibitors. Cancer research 71, 3364-3376. Love, C., Sun, Z., Jima, D., Li, G., Zhang, J., Miles, R., Richards, K.L., Dunphy, C.H., Choi, W.W., Srivastava, G., et al. (2012). The genetic landscape of mutations in Burkitt lymphoma. Nat Genet 44, 1321-1325. Luck, A.A., Evans, A.J., Green, A.R., Rakha, E.A., Paish, C., and Ellis, I.O. (2008). The influence of basal phenotype on the metastatic pattern of breast cancer. Clin Oncol (R Coll Radiol) 20, 40-45. Luo, K.J., Wen, J., Xie, X., Fu, J.H., Luo, R.Z., Wu, Q.L., and Hu, Y. (2012). Prognostic relevance of Id-1 expression in patients with resectable esophageal squamous cell carcinoma. The Annals of thoracic surgery 93, 1682-1688. Lyden, D., Hattori, K., Dias, S., Costa, C., Blaikie, P., Butros, L., Chadburn, A., Heissig, B., Marks, W., Witte, L., et al. (2001a). Impaired recruitment of bone- marrow-derived endothelial and hematopoietic precursor cells blocks tumor angiogenesis and growth. Nature Medicine 7, 1194-1201. Lyden, D., Hattori, K., Dias, S., Costa, C., Blaikie, P., Butros, L., Chadburn, A., Heissig, B., Marks, W., Witte, L., et al. (2001b). Impaired recruitment of bone- marrow-derived endothelial and hematopoietic precursor cells blocks tumor angiogenesis and growth. Nature medicine 7, 1194-1201. Lyden, D., Young, A.Z., Zagzag, D., Yan, W., Gerald, W., O'Reilly, R., Bader, B.L., Hynes, R.O., Zhuang, Y., Manova, K., et al. (1999). Id1 and Id3 are required for neurogenesis, angiogenesis and vascularization of tumour xenografts. Nature 401, 670-677. Macleod, K. (2000). Tumor suppressor genes. Current opinion in genetics & development 10, 81-93. Malanchi, I., Santamaria-Martinez, A., Susanto, E., Peng, H., Lehr, H.A., Delaloye, J.F., and Huelsken, J. (2012). Interactions between cancer stem cells and their niche govern metastatic colonization. Nature 481, 85-89. Mani, S.A., Guo, W., Liao, M.J., Eaton, E.N., Ayyanan, A., Zhou, A.Y., Brooks, M., Reinhard, F., Zhang, C.C., Shipitsin, M., et al. (2008). The epithelial- mesenchymal transition generates cells with properties of stem cells. Cell 133, 704-715. Manjunath, N., Wu, H., Subramanya, S., and Shankar, P. (2009). Lentiviral delivery of short hairpin RNAs. Adv Drug Deliv Rev 61, 732-745. 225 References Maruyama, H., Kleeff, J., Wildi, S., Friess, H., Buchler, M.W., Israel, M.A., and Korc, M. (1999). Id-1 and Id-2 are overexpressed in pancreatic cancer and in dysplastic lesions in chronic pancreatitis. The American journal of pathology 155, 815-822. Massague, J. (2008). TGFbeta in Cancer. Cell 134, 215-230. Massari, M.E., and Murre, C. (2000). Helix-loop-helix proteins: regulators of transcription in eucaryotic organisms. Molecular and cellular biology 20, 429- 440. Matsuda, Y., Yamagiwa, S., Takamura, M., Honda, Y., Ishimoto, Y., Ichida, T., and Aoyagi, Y. (2005). Overexpressed Id-1 is associated with a high risk of hepatocellular carcinoma development in patients with cirrhosis without transcriptional repression of p16. Cancer 104, 1037-1044. Meng, S., Luo, M., Sun, H., Yu, X., Shen, M., Zhang, Q., Zhou, R., Ju, X., Tao, W., Liu, D., et al. (2010). Identification and characterization of Bmi-1-responding element within the human p16 promoter. The Journal of biological chemistry 285, 33219-33229. Mern, D.S., Hasskarl, J., and Burwinkel, B. (2010a). Inhibition of Id proteins by a peptide aptamer induces cell-cycle arrest and apoptosis in ovarian cancer cells. Br J Cancer 103, 1237-1244. Mern, D.S., Hoppe-Seyler, K., Hoppe-Seyler, F., Hasskarl, J., and Burwinkel, B. (2010b). Targeting Id1 and Id3 by a specific peptide aptamer induces E-box promoter activity, cell cycle arrest, and apoptosis in breast cancer cells. Breast Cancer Res Treat 124, 623-633. Miller, F.R. (1983). Tumor Subpopulation Interactions in Metastasis. Invas Metast 3, 234-242. Miller, F.R., Miller, B.E., and Heppner, G.H. (1983). Characterization of Metastatic Heterogeneity among Subpopulations of a Single-Mouse Mammary- Tumor - Heterogeneity in Phenotypic Stability. Invas Metast 3, 22-31. Minn, A.J., Gupta, G.P., Siegel, P.M., Bos, P.D., Shu, W., Giri, D.D., Viale, A., Olshen, A.B., Gerald, W.L., and Massague, J. (2005a). Genes that mediate breast cancer metastasis to lung. Nature 436, 518-524. Minn, A.J., Kang, Y., Serganova, I., Gupta, G.P., Giri, D.D., Doubrovin, M., Ponomarev, V., Gerald, W.L., Blasberg, R., and Massague, J. (2005b). Distinct organ-specific metastatic potential of individual breast cancer cells and primary tumors. The Journal of clinical investigation 115, 44-55. Mistry, H., Hsieh, G., Buhrlage, S.J., Huang, M., Park, E., Cuny, G.D., Galinsky, I., Stone, R.M., Gray, N.S., D'Andrea, A.D., et al. (2013). Small-Molecule Inhibitors of USP1 Target ID1 Degradation in Leukemic Cells. Mol Cancer Ther 12, 2651-2662. 226 References Moody, S.E., Sarkisian, C.J., Hahn, K.T., Gunther, E.J., Pickup, S., Dugan, K.D., Innocent, N., Cardiff, R.D., Schnall, M.D., and Chodosh, L.A. (2002). Conditional activation of Neu in the mammary epithelium of transgenic mice results in reversible pulmonary metastasis. Cancer cell 2, 451-461. Morel, A.P., Lievre, M., Thomas, C., Hinkal, G., Ansieau, S., and Puisieux, A. (2008). Generation of breast cancer stem cells through epithelial-mesenchymal transition. PloS one 3, e2888. Muller, P.A., and Vousden, K.H. (2014). Mutant p53 in Cancer: New Functions and Therapeutic Opportunities. Cancer cell 25, 304-317. Murre, C. (2005). Helix-loop-helix proteins and lymphocyte development. Nature immunology 6, 1079-1086. Nair, R., Junankar, S., O'Toole, S., Shah, J., Borowsky, A.D., Bishop, J.M., and Swarbrick, A. (2010). Redefining the expression and function of the inhibitor of differentiation 1 in mammary gland development. PloS one 5, e11947. Nair, R., Roden, D.L., Teo, W.S., McFarland, A., Junankar, S., Ye, S., Nguyen, A., Yang, J., Nikolic, I., Hui, M., et al. (2013). c-Myc and Her2 cooperate to drive a stem-like phenotype with poor prognosis in breast cancer. Oncogene. Nair, R., Teo, W.S., Mittal, V., and Swarbrick, A. (2014). ID Proteins Regulate Diverse Aspects of Cancer Progression and Provide Novel Therapeutic Opportunities. Molecular therapy : the journal of the American Society of Gene Therapy 22, 1407-1415. Nakashima, K., Takizawa, T., Ochiai, W., Yanagisawa, M., Hisatsune, T., Nakafuku, M., Miyazono, K., Kishimoto, T., Kageyama, R., and Taga, T. (2001). BMP2-mediated alteration in the developmental pathway of fetal mouse brain cells from neurogenesis to astrocytogenesis. Proceedings of the National Academy of Sciences of the United States of America 98, 5868-5873. Nam, H.S., and Benezra, R. (2009). High levels of Id1 expression define B1 type adult neural stem cells. Cell stem cell 5, 515-526. Nambiar, M., Kari, V., and Raghavan, S.C. (2008). Chromosomal translocations in cancer. Biochimica et biophysica acta 1786, 139-152. Nathanson, K.L., Wooster, R., and Weber, B.L. (2001). Breast cancer genetics: what we know and what we need. Nature medicine 7, 552-556. Natividad, K.D., Junankar, S.R., Mohd Redzwan, N., Nair, R., Wirasinha, R.C., King, C., Brink, R., Swarbrick, A., and Batten, M. (2013). Interleukin-27 signaling promotes immunity against endogenously arising murine tumors. PloS one 8, e57469. Nguyen, D.X., Bos, P.D., and Massague, J. (2009). Metastasis: from dissemination to organ-specific colonization. Nature reviews Cancer 9, 274-284. 227 References Nickoloff, B.J., Chaturvedi, V., Bacon, P., Qin, J.Z., Denning, M.F., and Diaz, M.O. (2000). Id-1 delays senescence but does not immortalize keratinocytes. The Journal of biological chemistry 275, 27501-27504. Nieborowska-Skorska, M., Hoser, G., Rink, L., Malecki, M., Kossev, P., Wasik, M.A., and Skorski, T. (2006). Id1 transcription inhibitor-matrix metalloproteinase 9 axis enhances invasiveness of the breakpoint cluster region/abelson tyrosine kinase-transformed leukemia cells. Cancer research 66, 4108-4116. Nielsen, T.O., Parker, J.S., Leung, S., Voduc, D., Ebbert, M., Vickery, T., Davies, S.R., Snider, J., Stijleman, I.J., Reed, J., et al. (2010). A comparison of PAM50 intrinsic subtyping with immunohistochemistry and clinical prognostic factors in tamoxifen-treated estrogen receptor-positive breast cancer. Clinical cancer research : an official journal of the American Association for Cancer Research 16, 5222-5232. Niola, F., Zhao, X., Singh, D., Sullivan, R., Castano, A., Verrico, A., Zoppoli, P., Friedmann-Morvinski, D., Sulman, E., Barrett, L., et al. (2013). Mesenchymal high-grade glioma is maintained by the ID-RAP1 axis. The Journal of clinical investigation 123, 405-417. Norton, J.D. (2000). ID helix-loop-helix proteins in cell growth, differentiation and tumorigenesis. Journal of cell science 113 ( Pt 22), 3897-3905. Norton, J.D., Deed, R.W., Craggs, G., and Sablitzky, F. (1998). Id helix-loop- helix proteins in cell growth and differentiation. Trends Cell Biol 8, 58-65. O'Brien, C.A., Kreso, A., Ryan, P., Hermans, K.G., Gibson, L., Wang, Y., Tsatsanis, A., Gallinger, S., and Dick, J.E. (2012a). ID1 and ID3 regulate the self-renewal capacity of human colon cancer-initiating cells through p21. Cancer cell 21, 777-792. O'Brien, Catherine A., Kreso, A., Ryan, P., Hermans, Karin G., Gibson, L., Wang, Y., Tsatsanis, A., Gallinger, S., and Dick, John E. (2012b). ID1 and ID3 Regulate the Self-Renewal Capacity of Human Colon Cancer-Initiating Cells through p21. Cancer Cell 21, 777-792. O'Shaughnessy, J., Osborne, C., Pippen, J.E., Yoffe, M., Patt, D., Rocha, C., Koo, I.C., Sherman, B.M., and Bradley, C. (2011). Iniparib plus Chemotherapy in Metastatic Triple-Negative Breast Cancer. New England Journal of Medicine 364, 205-214. O'Toole, S.A., Machalek, D.A., Shearer, R.F., Millar, E.K., Nair, R., Schofield, P., McLeod, D., Cooper, C.L., McNeil, C.M., McFarland, A., et al. (2011). Hedgehog overexpression is associated with stromal interactions and predicts for poor outcome in breast cancer. Cancer Res 71, 4002-4014. O’Shaughnessy J., S.L.S., Danso M.A., Rugo H.S., Miller K., Yardley D.A., et al. (2011b). A randomized phase III study of iniparib (BSI-201) in combination with 228 References gemcitabine/carboplatin (G/C) in metastatic triple-negative breast cancer (TNBC). In 2011 ASCO Annual Meeting. Ogata, T., Wozney, J.M., Benezra, R., and Noda, M. (1993). Bone morphogenetic protein 2 transiently enhances expression of a gene, Id (inhibitor of differentiation), encoding a helix-loop-helix molecule in osteoblast-like cells. Proceedings of the National Academy of Sciences of the United States of America 90, 9219-9222. Ohtani, N., Zebedee, Z., Huot, T.J., Stinson, J.A., Sugimoto, M., Ohashi, Y., Sharrocks, A.D., Peters, G., and Hara, E. (2001a). Opposing effects of Ets and Id proteins on p16INK4a expression during cellular senescence. Nature 409, 1067-1070. Olmeda, D., Moreno-Bueno, G., Flores, J.M., Fabra, A., Portillo, F., and Cano, A. (2007). SNAI1 is required for tumor growth and lymph node metastasis of human breast carcinoma MDA-MB-231 cells. Cancer research 67, 11721- 11731. Oskarsson, T., Batlle, E., and Massague, J. (2014). Metastatic Stem Cells: Sources, Niches, and Vital Pathways. Cell stem cell 14, 306-321. Padua, D., Zhang, X.H., Wang, Q., Nadal, C., Gerald, W.L., Gomis, R.R., and Massague, J. (2008). TGFbeta primes breast tumors for lung metastasis seeding through angiopoietin-like 4. Cell 133, 66-77. Park, I.K., Morrison, S.J., and Clarke, M.F. (2004). Bmi1, stem cells, and senescence regulation. The Journal of clinical investigation 113, 175-179. Pebernard, S., and Iggo, R.D. (2004). Determinants of interferon-stimulated gene induction by RNAi vectors. Differentiation; research in biological diversity 72, 103-111. Perk, J., Gil-Bazo, I., Chin, Y., de Candia, P., Chen, J.J., Zhao, Y., Chao, S., Cheong, W., Ke, Y., Al-Ahmadie, H., et al. (2006a). Reassessment of id1 protein expression in human mammary, prostate, and bladder cancers using a monospecific rabbit monoclonal anti-id1 antibody. Cancer research 66, 10870- 10877. Perk, J., Iavarone, A., and Benezra, R. (2005a). Id family of helix-loop-helix proteins in cancer. Nat Rev Cancer 5, 603-614. Perou, C.M., Sorlie, T., Eisen, M.B., van de Rijn, M., Jeffrey, S.S., Rees, C.A., Pollack, J.R., Ross, D.T., Johnsen, H., Akslen, L.A., et al. (2000). Molecular portraits of human breast tumours. Nature 406, 747-752. Perry, S.S., Zhao, Y., Nie, L., Cochrane, S.W., Huang, Z., and Sun, X.H. (2007). Id1, but not Id3, directs long-term repopulating hematopoietic stem-cell maintenance. Blood 110, 2351-2360. 229 References Piccart, M. (2008). Circumventing de novo and acquired resistance to trastuzumab: new hope for the care of ErbB2-positive breast cancer. Clinical breast cancer 8 Suppl 3, S100-113. Pietersen, A.M., Evers, B., Prasad, A.A., Tanger, E., Cornelissen-Steijger, P., Jonkers, J., and van Lohuizen, M. (2008). Bmi1 regulates stem cells and proliferation and differentiation of committed cells in mammary epithelium. Current biology : CB 18, 1094-1099. Pillai, S., Rizwani, W., Li, X., Rawal, B., Nair, S., Schell, M.J., Bepler, G., Haura, E., Coppola, D., and Chellappan, S. (2011). ID1 facilitates the growth and metastasis of non-small cell lung cancer in response to nicotinic acetylcholine receptor and epidermal growth factor receptor signaling. Molecular and cellular biology 31, 3052-3067. Polytarchou, C., Iliopoulos, D., and Struhl, K. (2012). An integrated transcriptional regulatory circuit that reinforces the breast cancer stem cell state. Proceedings of the National Academy of Sciences of the United States of America 109, 14470-14475. Ponz-Sarvise, M., Nguewa, P.A., Pajares, M.J., Agorreta, J., Lozano, M.D., Redrado, M., Pio, R., Behrens, C., Wistuba, II, Garcia-Franco, C.E., et al. (2011). Inhibitor of differentiation-1 as a novel prognostic factor in NSCLC patients with adenocarcinoma histology and its potential contribution to therapy resistance. Clinical cancer research : an official journal of the American Association for Cancer Research 17, 4155-4166. Prat, A., Parker, J.S., Karginova, O., Fan, C., Livasy, C., Herschkowitz, J.I., He, X., and Perou, C.M. (2010). Phenotypic and molecular characterization of the claudin-low intrinsic subtype of breast cancer. Breast cancer research : BCR 12, R68. Prat, A., and Perou, C.M. (2010). Deconstructing the molecular portraits of breast cancer. Molecular oncology 5, 5-23. Psaila, B., and Lyden, D. (2009). The metastatic niche: adapting the foreign soil. Nature reviews Cancer 9, 285-293. Pulaski, B.A., and Ostrand-Rosenberg, S. (1998). Reduction of established spontaneous mammary carcinoma metastases following immunotherapy with major histocompatibility complex class II and B7.1 cell-based tumor vaccines. Cancer research 58, 1486-1493. Qian, T., Lee, J.Y., Park, J.H., Kim, H.J., and Kong, G. (2010). Id1 enhances RING1b E3 ubiquitin ligase activity through the Mel-18/Bmi-1 polycomb group complex. Oncogene 29, 5818-5827. Quail, D.F., and Joyce, J.A. (2013). Microenvironmental regulation of tumor progression and metastasis. Nature medicine 19, 1423-1437. 230 References Rabinovich, B.A., Ye, Y., Etto, T., Chen, J.Q., Levitsky, H.I., Overwijk, W.W., Cooper, L.J., Gelovani, J., and Hwu, P. (2008). Visualizing fewer than 10 mouse T cells with an enhanced firefly luciferase in immunocompetent mouse models of cancer. Proceedings of the National Academy of Sciences of the United States of America 105, 14342-14346. Ramaswamy, S., Ross, K.N., Lander, E.S., and Golub, T.R. (2003). A molecular signature of metastasis in primary solid tumors. Nat Genet 33, 49-54. Redig, A.J., and McAllister, S.S. (2013). Breast cancer as a systemic disease: a view of metastasis. Journal of internal medicine 274, 113-126. Redrado, M., Bodegas, E., Villaro, A.C., Nguewa, P.A., Lopez, I., Gil-Bazo, I., and Calvo, A. (2013). Spatial-temporal protein expression of Inhibitor of Differentiation-1 (Id1) during fetal embryogenesis and in different mouse and human cancer types. Histology and histopathology. Ren, Y., Cheung, H.W., von Maltzhan, G., Agrawal, A., Cowley, G.S., Weir, B.A., Boehm, J.S., Tamayo, P., Karst, A.M., Liu, J.F., et al. (2012a). Targeted tumor-penetrating siRNA nanocomplexes for credentialing the ovarian cancer oncogene ID4. Science translational medicine 4, 147ra112. Ren, Y., Cheung, H.W., von Maltzhan, G., Agrawal, A., Cowley, G.S., Weir, B.A., Boehm, J.S., Tamayo, P., Karst, A.M., Liu, J.F., et al. (2012b). Targeted tumor-penetrating siRNA nanocomplexes for credentialing the ovarian cancer oncogene ID4. Sci Transl Med 4, 147ra112. Renne, C., Martin-Subero, J.I., Eickernjager, M., Hansmann, M.L., Kuppers, R., Siebert, R., and Brauninger, A. (2006). Aberrant expression of ID2, a suppressor of B-cell-specific gene expression, in Hodgkin's lymphoma. The American journal of pathology 169, 655-664. Richter, J., Schlesner, M., Hoffmann, S., Kreuz, M., Leich, E., Burkhardt, B., Rosolowski, M., Ammerpohl, O., Wagener, R., Bernhart, S.H., et al. (2012). Recurrent mutation of the ID3 gene in Burkitt lymphoma identified by integrated genome, exome and transcriptome sequencing. Nat Genet 44, 1316-1320. Riis, M.L., Luders, T., Nesbakken, A.J., Vollan, H.S., Kristensen, V., and Bukholm, I.R. (2010). Expression of BMI-1 and Mel-18 in breast tissue--a diagnostic marker in patients with breast cancer. BMC cancer 10, 686. Roberts, E.C., Deed, R.W., Inoue, T., Norton, J.D., and Sharrocks, A.D. (2001). Id helix-loop-helix proteins antagonize pax transcription factor activity by inhibiting DNA binding. Molecular and cellular biology 21, 524-533. Rockman, S.P., Currie, S.A., Ciavarella, M., Vincan, E., Dow, C., Thomas, R.J., and Phillips, W.A. (2001). Id2 is a target of the beta-catenin/T cell factor pathway in colon carcinoma. The Journal of biological chemistry 276, 45113- 45119. 231 References Romero-Lanman, E.E., Pavlovic, S., Amlani, B., Chin, Y., and Benezra, R. (2012). Id1 maintains embryonic stem cell self-renewal by up-regulation of Nanog and repression of Brachyury expression. Stem cells and development 21, 384-393. Rosen, E.M., Fan, S., Pestell, R.G., and Goldberg, I.D. (2003). BRCA1 gene in breast cancer. Journal of cellular physiology 196, 19-41. Russell, L.J., Akasaka, T., Majid, A., Sugimoto, K.-j., Loraine Karran, E., Nagel, I., Harder, L., Claviez, A., Gesk, S., Moorman, A.V., et al. (2008). t(6;14)(p22;q32): a new recurrent IGH@ translocation involving ID4 in B-cell precursor acute lymphoblastic leukemia (BCP-ALL). Blood 111, 387-391. Ruzinova, M.B., and Benezra, R. (2003). Id proteins in development, cell cycle and cancer. Trends Cell Biol 13, 410-418. Ruzinova, M.B., Schoer, R.A., Gerald, W., Egan, J.E., Pandolfi, P.P., Rafii, S., Manova, K., Mittal, V., and Benezra, R. (2003). Effect of angiogenesis inhibition by Id loss and the contribution of bone-marrow-derived endothelial cells in spontaneous murine tumors. Cancer cell 4, 277-289. Saez, R.A., McGuire, W.L., and Clark, G.M. (1989). Prognostic factors in breast cancer. Seminars in surgical oncology 5, 102-110. Samanta, J., and Kessler, J.A. (2004). Interactions between ID and OLIG proteins mediate the inhibitory effects of BMP4 on oligodendroglial differentiation. Development (Cambridge, England) 131, 4131-4142. Savitsky, D., Tamura, T., Yanai, H., and Taniguchi, T. (2010). Regulation of immunity and oncogenesis by the IRF transcription factor family. Cancer immunology, immunotherapy : CII 59, 489-510. Scacheri, P.C., Rozenblatt-Rosen, O., Caplen, N.J., Wolfsberg, T.G., Umayam, L., Lee, J.C., Hughes, C.M., Shanmugam, K.S., Bhattacharjee, A., Meyerson, M., et al. (2004). Short interfering RNAs can induce unexpected and divergent changes in the levels of untargeted proteins in mammalian cells. Proceedings of the National Academy of Sciences of the United States of America 101, 1892- 1897. Schefe, J.H., Lehmann, K.E., Buschmann, I.R., Unger, T., and Funke-Kaiser, H. (2006). Quantitative real-time RT-PCR data analysis: current concepts and the novel "gene expression's CT difference" formula. J Mol Med 84, 901-910. Schindl, M., Oberhuber, G., Obermair, A., Schoppmann, S.F., Karner, B., and Birner, P. (2001). Overexpression of Id-1 protein is a marker for unfavorable prognosis in early-stage cervical cancer. Cancer research 61, 5703-5706. Schindl, M., Schoppmann, S.F., Strobel, T., Heinzl, H., Leisser, C., Horvat, R., and Birner, P. (2003). Level of Id-1 protein expression correlates with poor differentiation, enhanced malignant potential, and more aggressive clinical 232 References behavior of epithelial ovarian tumors. Clinical cancer research : an official journal of the American Association for Cancer Research 9, 779-785. Schmitz, R., Young, R.M., Ceribelli, M., Jhavar, S., Xiao, W., Zhang, M., Wright, G., Shaffer, A.L., Hodson, D.J., Buras, E., et al. (2012). Burkitt lymphoma pathogenesis and therapeutic targets from structural and functional genomics. Nature 490, 116-120. Schoppmann, S.F., Schindl, M., Bayer, G., Aumayr, K., Dienes, J., Horvat, R., Rudas, M., Gnant, M., Jakesz, R., and Birner, P. (2003a). Overexpression of Id- 1 is associated with poor clinical outcome in node negative breast cancer. International Journal of Cancer 104, 677-682. Schroeder, J.A., and Lee, D.C. (1997). Transgenic mice reveal roles for TGFalpha and EGF receptor in mammary gland development and neoplasia. Journal of mammary gland biology and neoplasia 2, 119-129. Schuringa, J.J., and Vellenga, E. (2010). Role of the polycomb group gene BMI1 in normal and leukemic hematopoietic stem and progenitor cells. Current opinion in hematology 17, 294-299. Scobey, M.J., Fix, C.A., and Walker, W.H. (2004). The Id2 transcriptional repressor is induced by follicle-stimulating hormone and cAMP. The Journal of biological chemistry 279, 16064-16070. Serrano, M., Hannon, G.J., and Beach, D. (1993). A new regulatory motif in cell- cycle control causing specific inhibition of cyclin D/CDK4. Nature 366, 704-707. Sharma, P., Patel, D., and Chaudhary, J. (2012). Id1 and Id3 expression is associated with increasing grade of prostate cancer: Id3 preferentially regulates CDKN1B. Cancer medicine 1, 187-197. Shimono, Y., Zabala, M., Cho, R.W., Lobo, N., Dalerba, P., Qian, D., Diehn, M., Liu, H., Panula, S.P., Chiao, E., et al. (2009). Downregulation of miRNA-200c links breast cancer stem cells with normal stem cells. Cell 138, 592-603. Shin, K.J., Wall, E.A., Zavzavadjian, J.R., Santat, L.A., Liu, J., Hwang, J.I., Rebres, R., Roach, T., Seaman, W., Simon, M.I., et al. (2006). A single lentiviral vector platform for microRNA-based conditional RNA interference and coordinated transgene expression. Proceedings of the National Academy of Sciences of the United States of America 103, 13759-13764. Shipitsin, M., Campbell, L.L., Argani, P., Weremowicz, S., Bloushtain-Qimron, N., Yao, J., Nikolskaya, T., Serebryiskaya, T., Beroukhim, R., Hu, M., et al. (2007). Molecular definition of breast tumor heterogeneity. Cancer cell 11, 259- 273. Shuno, Y., Tsuno, N.H., Okaji, Y., Tsuchiya, T., Sakurai, D., Nishikawa, T., Yoshikawa, N., Sasaki, K., Hongo, K., Tsurita, G., et al. (2010). Id1/Id3 233 References knockdown inhibits metastatic potential of pancreatic cancer. The Journal of surgical research 161, 76-82. Siddique, H.R., and Saleem, M. (2012). Role of BMI1, a stem cell factor, in cancer recurrence and chemoresistance: preclinical and clinical evidences. Stem cells 30, 372-378. Sikder, H.A., Devlin, M.K., Dunlap, S., Ryu, B., and Alani, R.M. (2003). Id proteins in cell growth and tumorigenesis. Cancer cell 3, 525-530. Skinner, M.K., Rawls, A., Wilson-Rawls, J., and Roalson, E.H. (2010). Basic helix-loop-helix transcription factor gene family phylogenetics and nomenclature. Differentiation; research in biological diversity 80, 1-8. Slamon, D.J., Clark, G.M., Wong, S.G., Levin, W.J., Ullrich, A., and McGuire, W.L. (1987). Human breast cancer: correlation of relapse and survival with amplification of the HER-2/neu oncogene. Science 235, 177-182. Sledz, C.A., Holko, M., de Veer, M.J., Silverman, R.H., and Williams, B.R. (2003). Activation of the interferon system by short-interfering RNAs. Nature cell biology 5, 834-839. Smith, M.C., Luker, K.E., Garbow, J.R., Prior, J.L., Jackson, E., Piwnica- Worms, D., and Luker, G.D. (2004). CXCR4 regulates growth of both primary and metastatic breast cancer. Cancer research 64, 8604-8612. Sorlie, T., Perou, C.M., Tibshirani, R., Aas, T., Geisler, S., Johnsen, H., Hastie, T., Eisen, M.B., van de Rijn, M., Jeffrey, S.S., et al. (2001). Gene expression patterns of breast carcinomas distinguish tumor subclasses with clinical implications. Proceedings of the National Academy of Sciences of the United States of America 98, 10869-10874. Sorlie, T., Tibshirani, R., Parker, J., Hastie, T., Marron, J.S., Nobel, A., Deng, S., Johnsen, H., Pesich, R., Geisler, S., et al. (2003). Repeated observation of breast tumor subtypes in independent gene expression data sets. Proceedings of the National Academy of Sciences of the United States of America 100, 8418-8423. Soroceanu, L., Murase, R., Limbad, C., Singer, E., Allison, J., Adrados, I., Kawamura, R., Pakdel, A., Fukuyo, Y., Nguyen, D., et al. (2013). Id-1 is a key transcriptional regulator of glioblastoma aggressiveness and a novel therapeutic target. Cancer Res 73, 1559-1569. Spector, N. (2008). Treatment of metastatic ErbB2-positive breast cancer: options after progression on trastuzumab. Clinical breast cancer 8 Suppl 3, S94-99. Stankic, M., Pavlovic, S., Chin, Y., Brogi, E., Padua, D., Norton, L., Massague, J., and Benezra, R. (2013). TGF-beta-Id1 Signaling Opposes Twist1 and 234 References Promotes Metastatic Colonization via a Mesenchymal-to-Epithelial Transition. Cell reports 5, 1228-1242. Stighall, M., Manetopoulos, C., Axelson, H., and Landberg, G. (2005). High ID2 protein expression correlates with a favourable prognosis in patients with primary breast cancer and reduces cellular invasiveness of breast cancer cells. International journal of cancer Journal international du cancer 115, 403-411. Storci, G., Sansone, P., Trere, D., Tavolari, S., Taffurelli, M., Ceccarelli, C., Guarnieri, T., Paterini, P., Pariali, M., Montanaro, L., et al. (2008). The basal-like breast carcinoma phenotype is regulated by SLUG gene expression. The Journal of pathology 214, 25-37. Strasser, A., Cory, S., and Adams, J.M. (2011). Deciphering the rules of programmed cell death to improve therapy of cancer and other diseases. The EMBO journal 30, 3667-3683. Subramanian, A., Tamayo, P., Mootha, V.K., Mukherjee, S., Ebert, B.L., Gillette, M.A., Paulovich, A., Pomeroy, S.L., Golub, T.R., Lander, E.S., et al. (2005). Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proceedings of the National Academy of Sciences of the United States of America 102, 15545-15550. Sugai, M., Gonda, H., Nambu, Y., Yokota, Y., and Shimizu, A. (2004). Role of Id proteins in B lymphocyte activation: new insights from knockout mouse studies. Journal of molecular medicine 82, 592-599. Sun, W., Guo, M.M., Han, P., Lin, J.Z., Liang, F.Y., Tan, G.M., Li, H.B., Zeng, M., and Huang, X.M. (2012). Id-1 and the p65 subunit of NF-kappaB promote migration of nasopharyngeal carcinoma cells and are correlated with poor prognosis. Carcinogenesis 33, 810-817. Suter, R., and Marcum, J.A. (2007). The molecular genetics of breast cancer and targeted therapy. Biologics : targets & therapy 1, 241-258. Swarbrick, A., Akerfeldt, M.C., Lee, C.S., Sergio, C.M., Caldon, C.E., Hunter, L.J., Sutherland, R.L., and Musgrove, E.A. (2005). Regulation of cyclin expression and cell cycle progression in breast epithelial cells by the helix-loop- helix protein Id1. Oncogene 24, 381-389. Swarbrick, A., Roy, E., Allen, T., and Bishop, J.M. (2008a). Id1 cooperates with oncogenic Ras to induce metastatic mammary carcinoma by subversion of the cellular senescence response. PNAS 105, 5402-5407. Swarbrick, A., Roy, E., Allen, T., and Bishop, J.M. (2008b). Id1 cooperates with oncogenic Ras to induce metastatic mammary carcinoma by subversion of the cellular senescence response. Proceedings of the National Academy of Sciences of the United States of America 105, 5402-5407. 235 References Takai, N., Miyazaki, T., Fujisawa, K., Nasu, K., and Miyakawa, I. (2001). Id1 expression is associated with histological grade and invasive behavior in endometrial carcinoma. Cancer letters 165, 185-193. Tam, W.F., Gu, T.L., Chen, J., Lee, B.H., Bullinger, L., Frohling, S., Wang, A., Monti, S., Golub, T.R., and Gilliland, D.G. (2008). Id1 is a common downstream target of oncogenic tyrosine kinases in leukemic cells. Blood 112, 1981-1992. Tang, B., Yoo, N., Vu, M., Mamura, M., Nam, J.S., Ooshima, A., Du, Z., Desprez, P.Y., Anver, M.R., Michalowska, A.M., et al. (2007). Transforming growth factor-beta can suppress tumorigenesis through effects on the putative cancer stem or early progenitor cell and committed progeny in a breast cancer xenograft model. Cancer research 67, 8643-8652. Tang, J., Gordon, G.M., Nickoloff, B.J., and Foreman, K.E. (2002). The helix- loop-helix protein id-1 delays onset of replicative senescence in human endothelial cells. Laboratory investigation; a journal of technical methods and pathology 82, 1073-1079. Tao, K., Fang, M., Alroy, J., and Sahagian, G.G. (2008). Imagable 4T1 model for the study of late stage breast cancer. BMC cancer 8, 228. Taube, J.H., Herschkowitz, J.I., Komurov, K., Zhou, A.Y., Gupta, S., Yang, J., Hartwell, K., Onder, T.T., Gupta, P.B., Evans, K.W., et al. (2010). Core epithelial-to-mesenchymal transition interactome gene-expression signature is associated with claudin-low and metaplastic breast cancer subtypes. Proceedings of the National Academy of Sciences of the United States of America 107, 15449-15454. TCGA (2012). Comprehensive molecular portraits of human breast tumours. Nature 490, 61-70. Theissig, F., Kunze, K.D., Haroske, G., and Meyer, W. (1990). Histological grading of breast cancer. Interobserver, reproducibility and prognostic significance. Pathology, research and practice 186, 732-736. Thiery, J.P., Acloque, H., Huang, R.Y., and Nieto, M.A. (2009). Epithelial- mesenchymal transitions in development and disease. Cell 139, 871-890. Tobin, N.P., Sims, A.H., Lundgren, K.L., Lehn, S., and Landberg, G. (2011). Cyclin D1, Id1 and EMT in breast cancer. BMC cancer 11. Trinchieri, G. (2010). Type I interferon: friend or foe? The Journal of experimental medicine 207, 2053-2063. Tsuchiya, T., Okaji, Y., Tsuno, N.H., Sakurai, D., Tsuchiya, N., Kawai, K., Yazawa, K., Asakage, M., Yamada, J., Yoneyama, S., et al. (2005). Targeting Id1 and Id3 inhibits peritoneal metastasis of gastric cancer. Cancer science 96, 784-790. 236 References Turner, N.C., and Reis-Filho, J.S. (2006). Basal-like breast cancer and the BRCA1 phenotype. Oncogene 25, 5846-5853. Tutt, A., Robson, M., Garber, J.E., Domchek, S.M., Audeh, M.W., Weitzel, J.N., Friedlander, M., Arun, B., Loman, N., Schmutzler, R.K., et al. (2010). Oral poly(ADP-ribose) polymerase inhibitor olaparib in patients with BRCA1 or BRCA2 mutations and advanced breast cancer: a proof-of-concept trial. Lancet 376, 235-244. Umetani, N., Mori, T., Koyanagi, K., Shinozaki, M., Kim, J., Giuliano, A.E., and Hoon, D.S. (2005a). Aberrant hypermethylation of ID4 gene promoter region increases risk of lymph node metastasis in T1 breast cancer. Oncogene 24, 4721-4727. Umetani, N., Mori, T., Koyanagi, K., Shinozaki, M., Kim, J., Giuliano, A.E., and Hoon, D.S.B. (2005b). Aberrant hypermethylation of ID4 gene promoter region increases risk of lymph node metastasis in T1 breast cancer. Oncogene 24, 4721-4727. Valastyan, S., and Weinberg, R.A. (2011). Tumor metastasis: molecular insights and evolving paradigms. Cell 147, 275-292. Valent, P., Bonnet, D., De Maria, R., Lapidot, T., Copland, M., Melo, J.V., Chomienne, C., Ishikawa, F., Schuringa, J.J., Stassi, G., et al. (2012). Cancer stem cell definitions and terminology: the devil is in the details. Nature reviews Cancer 12, 767-775. van 't Veer, L.J., Dai, H., van de Vijver, M.J., He, Y.D., Hart, A.A., Mao, M., Peterse, H.L., van der Kooy, K., Marton, M.J., Witteveen, A.T., et al. (2002). Gene expression profiling predicts clinical outcome of breast cancer. Nature 415, 530-536. Vernon, A.E., Bakewell, S.J., and Chodosh, L.A. (2007). Deciphering the molecular basis of breast cancer metastasis with mouse models. Reviews in endocrine & metabolic disorders 8, 199-213. Visvader, J.E., and Lindeman, G.J. (2012). Cancer stem cells: current status and evolving complexities. Cell stem cell 10, 717-728. Vivanco, I., and Sawyers, C.L. (2002). The phosphatidylinositol 3-Kinase AKT pathway in human cancer. Nature reviews Cancer 2, 489-501. Vogelstein, B., and Kinzler, K.W. (2004). Cancer genes and the pathways they control. Nature medicine 10, 789-799. Volpert, O.V., Pili, R., Sikder, H.A., Nelius, T., Zaichuk, T., Morris, C., Shiflett, C.B., Devlin, M.K., Conant, K., and Alani, R.M. (2002). Id1 regulates angiogenesis through transcriptional repression of thrombospondin-1. Cancer cell 2, 473-483. 237 References Wakasugi, E., Kobayashi, T., Tamaki, Y., Nakano, Y., Ito, Y., Miyashiro, I., Komoike, Y., Miyazaki, M., Takeda, T., Monden, T., et al. (1997). Analysis of phosphorylation of pRB and its regulatory proteins in breast cancer. Journal of clinical pathology 50, 407-412. Wan, L., Pantel, K., and Kang, Y. (2013). Tumor metastasis: moving new biological insights into the clinic. Nature medicine 19, 1450-1464. Wang, H., Wang, X.-Q., Xu, X.-P., and Lin, G.-W. (2010). ID4 methylation predicts high risk of leukemic transformation in patients with myelodysplastic syndrome. Leukemia Research 34, 598-604. Wang, Y., Klijn, J.G., Zhang, Y., Sieuwerts, A.M., Look, M.P., Yang, F., Talantov, D., Timmermans, M., Meijer-van Gelder, M.E., Yu, J., et al. (2005). Gene-expression profiles to predict distant metastasis of lymph-node-negative primary breast cancer. Lancet 365, 671-679. Wang, Y., Zang, X., Wang, Y., and Chen, P. (2012a). High expression of p16INK4a and low expression of Bmi1 are associated with endothelial cellular senescence in the human cornea. Molecular vision 18, 803-815. Wang, Y., Zhe, H., Ding, Z., Gao, P., Zhang, N., and Li, G. (2012b). Cancer stem cell marker Bmi-1 expression is associated with basal-like phenotype and poor survival in breast cancer. World journal of surgery 36, 1189-1194. Weigelt, B., Peterse, J.L., and van 't Veer, L.J. (2005). Breast cancer metastasis: markers and models. Nature reviews Cancer 5, 591-602. Weinberg, R.A. (1991). Tumor suppressor genes. Science 254, 1138-1146. Weinstein, I.B., and Joe, A.K. (2006). Mechanisms of disease: Oncogene addiction--a rationale for molecular targeting in cancer therapy. Nature clinical practice Oncology 3, 448-457. Weiss, L. (1990). Metastatic inefficiency. Adv Cancer Res 54, 159-211. Wiederschain, D., Chen, L., Johnson, B., Bettano, K., Jackson, D., Taraszka, J., Wang, Y.K., Jones, M.D., Morrissey, M., Deeds, J., et al. (2007). Contribution of polycomb homologues Bmi-1 and Mel-18 to medulloblastoma pathogenesis. Molecular and cellular biology 27, 4968-4979. Williams, S.A., Maecker, H.L., French, D.M., Liu, J., Gregg, A., Silverstein, L.B., Cao, T.C., Carano, R.A., and Dixit, V.M. (2011a). USP1 deubiquitinates ID proteins to preserve a mesenchymal stem cell program in osteosarcoma. Cell 146, 918-930. Williams, Samuel A., Maecker, Heather L., French, Dorothy M., Liu, J., Gregg, A., Silverstein, Leah B., Cao, Tim C., Carano, Richard A.D., and Dixit, Vishva M. (2011b). USP1 Deubiquitinates ID Proteins to Preserve a Mesenchymal Stem Cell Program in Osteosarcoma. Cell 146, 918-930. 238 References Wilson, J.W., Deed, R.W., Inoue, T., Balzi, M., Becciolini, A., Faraoni, P., Potten, C.S., and Norton, J.D. (2001). Expression of Id helix-loop-helix proteins in colorectal adenocarcinoma correlates with p53 expression and mitotic index. Cancer research 61, 8803-8810. Witton, C.J., Reeves, J.R., Going, J.J., Cooke, T.G., and Bartlett, J.M. (2003). Expression of the HER1-4 family of receptor tyrosine kinases in breast cancer. The Journal of pathology 200, 290-297. Xu, Z., Liu, H., Lv, X., Liu, Y., Li, S., and Li, H. (2011). Knockdown of the Bmi-1 oncogene inhibits cell proliferation and induces cell apoptosis and is involved in the decrease of Akt phosphorylation in the human breast carcinoma cell line MCF-7. Oncology reports 25, 409-418. Yan, K.S., Chia, L.A., Li, X., Ootani, A., Su, J., Lee, J.Y., Su, N., Luo, Y., Heilshorn, S.C., Amieva, M.R., et al. (2012). The intestinal stem cell markers Bmi1 and Lgr5 identify two functionally distinct populations. Proceedings of the National Academy of Sciences 109, 466-471. Yang, H.Y., Liu, H.L., Liu, G.Y., Zhu, H., Meng, Q.W., Qu, L.D., Liu, L.X., and Jiang, H.C. (2011). Expression and prognostic values of Id-1 and Id-3 in gastric adenocarcinoma. The Journal of surgical research 167, 258-266. Yang, M.H., Hsu, D.S., Wang, H.W., Wang, H.J., Lan, H.Y., Yang, W.H., Huang, C.H., Kao, S.Y., Tzeng, C.H., Tai, S.K., et al. (2010). Bmi1 is essential in Twist1-induced epithelial-mesenchymal transition. Nature cell biology 12, 982-992. Yarden, Y., and Sliwkowski, M.X. (2001). Untangling the ErbB signalling network. Nature reviews Molecular cell biology 2, 127-137. Yates, P.R., Atherton, G.T., Deed, R.W., Norton, J.D., and Sharrocks, A.D. (1999). Id helix-loop-helix proteins inhibit nucleoprotein complex formation by the TCF ETS-domain transcription factors. The EMBO journal 18, 968-976. Ying, Q.L., Nichols, J., Chambers, I., and Smith, A. (2003). BMP induction of Id proteins suppresses differentiation and sustains embryonic stem cell self- renewal in collaboration with STAT3. Cell 115, 281-292. Yokota, Y., and Mori, S. (2002). Role of Id family proteins in growth control. Journal of cellular physiology 190, 21-28. Yoneda, T., Michigami, T., Yi, B., Williams, P.J., Niewolna, M., and Hiraga, T. (2000). Actions of bisphosphonate on bone metastasis in animal models of breast carcinoma. Cancer 88, 2979-2988. Yu, D.S., Hsieh, D.S., and Chang, S.Y. (2006). Increasing expression of GST-pi MIF, and ID1 genes in chemoresistant prostate cancer cells. Arch Androl 52, 275-281. 239 References Yu, L., Liu, C., Vandeusen, J., Becknell, B., Dai, Z., Wu, Y.Z., Raval, A., Liu, T.H., Ding, W., Mao, C., et al. (2005). Global assessment of promoter methylation in a mouse model of cancer identifies ID4 as a putative tumor- suppressor gene in human leukemia. Nat Genet 37, 265-274. Yuen, H.F., Chua, C.W., Chan, Y.P., Wong, Y.C., Wang, X., and Chan, K.W. (2006). Id proteins expression in prostate cancer: high-level expression of Id-4 in primary prostate cancer is associated with development of metastases. Modern pathology : an official journal of the United States and Canadian Academy of Pathology, Inc 19, 931-941. Zaidi, M.R., and Merlino, G. (2011). The two faces of interferon-gamma in cancer. Clinical cancer research : an official journal of the American Association for Cancer Research 17, 6118-6124. Zeng, W., Rushing, E.J., Hartmann, D.P., and Azumi, N. (2010). Increased inhibitor of differentiation 4 (id4) expression in glioblastoma: a tissue microarray study. Journal of Cancer 1, 1-5. Zeng, Y., Wagner, E.J., and Cullen, B.R. (2002). Both natural and designed micro RNAs can inhibit the expression of cognate mRNAs when expressed in human cells. Molecular cell 9, 1327-1333. Zhang, X., Ling, M.T., Wang, Q., Lau, C.K., Leung, S.C., Lee, T.K., Cheung, A.L., Wong, Y.C., and Wang, X. (2007). Identification of a novel inhibitor of differentiation-1 (ID-1) binding partner, caveolin-1, and its role in epithelial- mesenchymal transition and resistance to apoptosis in prostate cancer cells. The Journal of biological chemistry 282, 33284-33294. Zhao, Z.R., Zhang, Z.Y., Zhang, H., Jiang, L., Wang, M.W., and Sun, X.F. (2008). Overexpression of Id-1 protein is a marker in colorectal cancer progression. Oncology reports 19, 419-424. Zhu, D., Wan, X., Huang, H., Chen, X., Liang, W., Zhao, F., Lin, T., Han, J., and Xie, W. (2014). Knockdown of Bmi1 inhibits the stemness properties and tumorigenicity of human bladder cancer stem cell-like side population cells. Oncology reports 31, 727-736. 240 Appendix Appendix: Genes which showed significant expression changes in Id1/3 knockdown 4T1 cells. List of differentially expressed genes from comparison of transcriptional profiles in the Id/3-depleted 4T1 cells and the control. A number of 6081 differentially expressed genes were identified by setting a Q-value threshold of 0.05. Among the 6081 genes, 3310 genes were up-regulated, and 2771 genes were downregulated. The table below presents the top 500 up- and downregulated genes. Gene Direction Fold Q-value Change Mx2 :: myxovirus (influenza virus) resistance 2 up 26.6015 7.592E-08 Oas1g :: 2'-5' oligoadenylate synthetase 1G up 14.9574 1.041E-07 Oas3 :: 2'-5' oligoadenylate synthetase 3 up 15.124 1.951E-07 Cmpk2 :: cytidine monophosphate (UMP-CMP) up 24.33 2.319E-07 kinase 2, mitochondrial Stat1 :: signal transducer and activator of up 6.8186 3.287E-07 transcription 1 Xaf1 :: XIAP associated factor 1 up 9.0697 4.063E-07 Usp18 :: ubiquitin specific peptidase 18 up 30.489 4.104E-07 Oas2 :: 2'-5' oligoadenylate synthetase 2 up 36.1304 4.104E-07 Ifit1 :: interferon-induced protein with up 18.5318 4.576E-07 tetratricopeptide repeats 1 Gpr56 :: G protein-coupled receptor 56 up 21.8355 4.723E-07 Zbp1 :: Z-DNA binding protein 1 up 13.582 4.723E-07 Olfr65 :: olfactory receptor 65 up 8.3323 4.723E-07 Parp14 :: poly (ADP-ribose) polymerase family, up 5.9386 5.221E-07 member 14 Angptl4 :: angiopoietin-like 4 up 12.113 5.221E-07 Irf7 :: interferon regulatory factor 7 up 13.4442 5.221E-07 Gbp3 :: guanylate binding protein 3 up 10.1348 5.678E-07 Stat2 :: signal transducer and activator of up 5.0425 6.796E-07 transcription 2 Oasl2 :: 2'-5' oligoadenylate synthetase-like 2 up 5.7617 7.455E-07 Bst2 :: bone marrow stromal cell antigen 2 up 8.4297 7.455E-07 Lypd3 :: Ly6/Plaur domain containing 3 up 4.2202 7.455E-07 Iigp1 :: interferon inducible GTPase 1 up 14.3364 7.931E-07 Pvrl1 :: poliovirus receptor-related 1 up 4.7014 7.931E-07 Oas1b :: 2'-5' oligoadenylate synthetase 1B up 9.7557 8.896E-07 Megf10 :: multiple EGF-like-domains 10 up 11.0025 1.044E-06 Rtp4 :: receptor transporter protein 4 up 9.0028 1.044E-06 Dhx58 :: DEXH (Asp-Glu-X-His) box polypeptide 58 up 9.4499 1.146E-06 Irgm1 :: immunity-related GTPase family M member up 3.8284 1.580E-06 1 Fst :: follistatin up 6.2072 1.787E-06 241 Appendix Twf2 :: twinfilin, actin-binding protein, homolog 2 up 3.1538 1.932E-06 (Drosophila) Ifih1 :: interferon induced with helicase C domain 1 up 4.387 1.932E-06 Gbp7 :: guanylate binding protein 7 up 7.9922 1.932E-06 BC006779 :: cDNA sequence BC006779 up 4.0514 2.011E-06 Eif2ak2 :: eukaryotic translation initiation factor 2- up 3.4611 2.068E-06 alpha kinase 2 Oas1a :: 2'-5' oligoadenylate synthetase 1A up 8.1417 2.114E-06 Shf :: Src homology 2 domain containing F up 2.7861 2.125E-06 Ecscr :: endothelial cell surface expressed up 4.0889 2.128E-06 chemotaxis and apoptosis regulator Ifi44 :: interferon-induced protein 44 up 36.7438 2.345E-06 Gbp9 :: guanylate-binding protein 9 up 6.0431 3.161E-06 Lcp1 :: lymphocyte cytosolic protein 1 up 3.8833 3.281E-06 Gstm5 :: glutathione S-transferase, mu 5 up 5.9087 3.495E-06 Sp100 :: nuclear antigen Sp100 up 6.721 3.585E-06 Igtp :: interferon gamma induced GTPase up 14.6899 3.645E-06 Ubash3b :: ubiquitin associated and SH3 domain up 3.4231 3.645E-06 containing, B Scube3 :: signal peptide, CUB domain, EGF-like 3 up 3.1924 3.677E-06 Cercam :: cerebral endothelial cell adhesion up 9.0451 3.677E-06 molecule Cxcl11 :: chemokine (C-X-C motif) ligand 11 up 14.2066 3.677E-06 Ddx60 :: DEAD (Asp-Glu-Ala-Asp) box polypeptide up 8.6686 3.677E-06 60 Fam132a :: family with sequence similarity 132, up 5.3714 3.788E-06 member A Znfx1 :: zinc finger, NFX1-type containing 1 up 3.329 3.822E-06 Ccl17 :: chemokine (C-C motif) ligand 17 up 2.8979 3.822E-06 Syt1 :: synaptotagmin I up 5.0561 4.275E-06 Sp100 :: nuclear antigen Sp100 up 4.266 4.324E-06 Ube2l6 :: ubiquitin-conjugating enzyme E2L 6 up 3.6812 4.399E-06 Gm12250 :: predicted gene 12250 up 9.2053 5.384E-06 Irgm2 :: immunity-related GTPase family M member up 12.0539 5.384E-06 2 Psmb8 :: proteasome (prosome, macropain) subunit, up 2.3881 5.667E-06 beta type 8 (large multifunctional peptidase 7) Ifi35 :: interferon-induced protein 35 up 3.5528 6.139E-06 Samd9l :: sterile alpha motif domain containing 9- up 3.0087 6.144E-06 like Ifitm3 :: interferon induced transmembrane protein 3 up 2.3806 6.178E-06 Dach1 :: dachshund 1 (Drosophila) up 6.3173 6.208E-06 Parp9 :: poly (ADP-ribose) polymerase family, up 3.2316 6.208E-06 member 9 Sp110 :: Sp110 nuclear body protein up 4.8378 6.208E-06 H2-T22 :: histocompatibility 2, T region locus 22 up 2.8977 6.530E-06 Susd2 :: sushi domain containing 2 up 4.9835 6.825E-06 Olfr56 :: olfactory receptor 56 up 3.002 7.120E-06 Rsad2 :: radical S-adenosyl methionine domain up 5.5686 7.295E-06 containing 2 Socs5 :: suppressor of cytokine signaling 5 up 2.5173 7.386E-06 Isg15 :: ISG15 ubiquitin-like modifier up 6.4119 8.204E-06 242 Appendix Casp1 :: caspase 1 up 6.8354 8.452E-06 Adar :: adenosine deaminase, RNA-specific up 2.367 8.515E-06 Fgd3 :: FYVE, RhoGEF and PH domain containing 3 up 4.1439 8.557E-06 Ifi27l1 :: interferon, alpha-inducible protein 27 like 1 up 3.2827 9.147E-06 Mmp9 :: matrix metallopeptidase 9 up 2.6528 9.268E-06 Pdgfc :: platelet-derived growth factor, C polypeptide up 3.3665 1.065E-05 Mitd1 :: MIT, microtubule interacting and transport, up 2.1024 1.065E-05 domain containing 1 Acta2 :: actin, alpha 2, smooth muscle, aorta up 2.6307 1.115E-05 Fkbpl :: FK506 binding protein-like up 4.8736 1.115E-05 Rnf213 :: ring finger protein 213 up 2.6992 1.275E-05 Icam1 :: intercellular adhesion molecule 1 up 2.6904 1.430E-05 F830016B08Rik :: RIKEN cDNA F830016B08 gene up 3.3407 1.569E-05 Parp10 :: poly (ADP-ribose) polymerase family, up 2.4568 1.606E-05 member 10 Tap1 :: transporter 1, ATP-binding cassette, sub- up 3.6049 1.618E-05 family B (MDR/TAP) Clip4 :: CAP-GLY domain containing linker protein up 3.5595 1.623E-05 family, member 4 Tmem158 :: transmembrane protein 158 up 5.1927 1.653E-05 Gbp4 :: guanylate binding protein 4 up 7.6954 1.656E-05 D14Ertd668e :: DNA segment, Chr 14, ERATO Doi up 8.0936 1.721E-05 668, expressed Atp6v1a :: ATPase, H+ transporting, lysosomal V1 up 2.2864 1.728E-05 subunit A Trim34b :: tripartite motif-containing 34B up 6.5291 1.728E-05 Gbp10 :: guanylate-binding protein 10 up 4.6989 1.728E-05 Tnc :: tenascin C up 3.4374 1.728E-05 Abca13 :: ATP-binding cassette, sub-family A up 2.8414 1.728E-05 (ABC1), member 13 17549066 up 2.5411 1.728E-05 H2-T24 :: histocompatibility 2, T region locus 24 up 6.1579 1.731E-05 Hsh2d :: hematopoietic SH2 domain containing up 3.7064 1.772E-05 Parp12 :: poly (ADP-ribose) polymerase family, up 2.3063 1.824E-05 member 12 Gm7609 :: predicted pseudogene 7609 up 4.1608 1.850E-05 Herc6 :: hect domain and RLD 6 up 2.9494 1.886E-05 Cpeb2 :: cytoplasmic polyadenylation element up 2.6939 2.029E-05 binding protein 2 Uba7 :: ubiquitin-like modifier activating enzyme 7 up 3.6242 2.092E-05 Sema7a :: sema domain, immunoglobulin domain up 2.921 2.195E-05 (Ig), and GPI membrane anchor, (semaphorin) 7A Scly :: selenocysteine lyase up 2.1004 2.198E-05 Usp31 :: ubiquitin specific peptidase 31 up 2.1014 2.274E-05 Ifi205 :: interferon activated gene 205 up 10.3761 2.312E-05 Plekhf1 :: pleckstrin homology domain containing, up 2.283 2.342E-05 family F (with FYVE domain) member 1 Lgals9 :: lectin, galactose binding, soluble 9 up 2.9632 2.401E-05 Hap1 :: huntingtin-associated protein 1 up 2.2452 2.457E-05 Lgals3bp :: lectin, galactoside-binding, soluble, 3 up 2.9462 2.516E-05 binding protein Trim21 :: tripartite motif-containing 21 up 2.8037 2.516E-05 243 Appendix Ly6e :: lymphocyte antigen 6 complex, locus E up 4.9649 2.516E-05 Gm4841 :: predicted gene 4841 up 6.4057 2.733E-05 Tmem106a :: transmembrane protein 106A up 2.4788 2.796E-05 Lgals3bp :: lectin, galactoside-binding, soluble, 3 up 3.0211 2.960E-05 binding protein Tgtp2 :: T cell specific GTPase 2 up 6.8662 3.043E-05 Fhl2 :: four and a half LIM domains 2 up 2.255 3.231E-05 Trafd1 :: TRAF type zinc finger domain containing 1 up 2.4981 3.355E-05 Ptplad1 :: protein tyrosine phosphatase-like A up 1.943 3.384E-05 domain containing 1 Trim25 :: tripartite motif-containing 25 up 2.189 3.384E-05 Gpc4 :: glypican 4 up 1.921 3.533E-05 Gbp1 :: guanylate binding protein 1 up 3.7993 3.533E-05 Trim14 :: tripartite motif-containing 14 up 2.3098 3.533E-05 Tlr3 :: toll-like receptor 3 up 2.4438 3.708E-05 Cdkn2d :: cyclin-dependent kinase inhibitor 2D (p19, up 2.5774 3.812E-05 inhibits CDK4) Gm20559 :: predicted gene, 20559 up 5.5136 3.812E-05 Obfc2a :: oligonucleotide/oligosaccharide-binding up 2.4474 4.000E-05 fold containing 2A Mir1952 :: microRNA 1952 up 5.1108 4.000E-05 Irf9 :: interferon regulatory factor 9 up 3.459 4.136E-05 Ggct :: gamma-glutamyl cyclotransferase up 4.5308 4.321E-05 Ddx58 :: DEAD (Asp-Glu-Ala-Asp) box polypeptide up 2.3119 4.447E-05 58 Mx1 :: myxovirus (influenza virus) resistance 1 up 5.764 4.642E-05 C3 :: complement component 3 up 5.9853 4.693E-05 Ssh3 :: slingshot homolog 3 (Drosophila) up 2.1675 5.065E-05 Cxcl10 :: chemokine (C-X-C motif) ligand 10 up 4.6263 5.144E-05 Plau :: plasminogen activator, urokinase up 2.3192 5.256E-05 Gm6548 :: eukaryotic translation elongation factor 1 up 2.915 5.328E-05 alpha 1 pseudogene ENSMUST00000030975 :: cdna:known up 2.9963 5.358E-05 chromosome:NCBIM37:5:45546250:45560803:-1 gene:ENSMUSG00000029092 gene_biotype:protein_coding transcript_biotype:protein_coding Parp3 :: poly (ADP-ribose) polymerase family, up 2.0846 5.799E-05 member 3 Gbp2 :: guanylate binding protein 2 up 3.5738 5.886E-05 Madcam1 :: mucosal vascular addressin cell up 1.9429 6.148E-05 adhesion molecule 1 Ell2 :: elongation factor RNA polymerase II 2 up 2.0905 6.198E-05 Gm20290 :: predicted gene, 20290 up 3.2594 6.198E-05 Klhl30 :: kelch-like 30 (Drosophila) up 4.7811 6.235E-05 17549188 up 1.9986 6.359E-05 Hexim1 :: hexamethylene bis-acetamide inducible 1 up 2.1063 6.371E-05 Tor3a :: torsin family 3, member A up 2.1128 6.451E-05 Sp110 :: Sp110 nuclear body protein up 3.9988 6.451E-05 Apol9b :: apolipoprotein L 9b up 2.7101 6.605E-05 Kat2b :: K(lysine) acetyltransferase 2B up 2.0437 6.722E-05 H28 :: histocompatibility 28 up 7.2352 6.731E-05 244 Appendix Tor1aip1 :: torsin A interacting protein 1 up 1.7678 6.750E-05 Casp4 :: caspase 4, apoptosis-related cysteine up 7.3234 6.818E-05 peptidase Tnrc6b :: trinucleotide repeat containing 6b up 1.9376 6.843E-05 Ogfr :: opioid growth factor receptor up 1.7821 6.948E-05 Gbp8 :: guanylate-binding protein 8 up 5.5263 6.948E-05 Sec14l2 :: SEC14-like 2 (S. cerevisiae) up 2.0169 7.057E-05 Mycbp :: c-myc binding protein up 2.4889 7.072E-05 Trim30a :: tripartite motif-containing 30A up 9.3212 7.072E-05 Ccl5 :: chemokine (C-C motif) ligand 5 up 2.685 7.072E-05 Cd74 :: CD74 antigen (invariant polypeptide of major up 2.9818 7.072E-05 histocompatibility complex, class II antigen- associated) 1110008P14Rik :: RIKEN cDNA 1110008P14 gene up 2.0527 7.363E-05 Ifi202b :: interferon activated gene 202B up 2.2025 7.476E-05 Nmi :: N-myc (and STAT) interactor up 1.999 7.506E-05 Gm17757 :: GTPase, very large interferon inducible up 3.3385 7.866E-05 1 pseudogene Naip6 :: NLR family, apoptosis inhibitory protein 6 up 2.2053 8.540E-05 Gdf11 :: growth differentiation factor 11 up 1.6696 8.638E-05 Tgfbr3 :: transforming growth factor, beta receptor III up 2.7242 8.638E-05 Ncf4 :: neutrophil cytosolic factor 4 up 2.3511 8.659E-05 AU018091 :: expressed sequence AU018091 up 2.9179 8.659E-05 Sp100 :: nuclear antigen Sp100 up 4.425 8.873E-05 Prl2c5 :: prolactin family 2, subfamily c, member 5 up 8.457 9.157E-05 Sp110 :: Sp110 nuclear body protein up 2.7162 9.292E-05 Rnd3 :: Rho family GTPase 3 up 2.2092 9.292E-05 Psmb9 :: proteasome (prosome, macropain) subunit, up 2.798 9.292E-05 beta type 9 (large multifunctional peptidase 2) Slfn2 :: schlafen 2 up 6.016 9.396E-05 Dtx3l :: deltex 3-like (Drosophila) up 1.9987 9.431E-05 Itm2b :: integral membrane protein 2B up 1.7374 9.558E-05 Tspan9 :: tetraspanin 9 up 1.7163 9.702E-05 Slfn8 :: schlafen 8 up 2.9554 9.939E-05 Apol9a :: apolipoprotein L 9a up 2.9618 9.957E-05 Myo10 :: myosin X up 1.8368 9.957E-05 H2-Q4 :: histocompatibility 2, Q region locus 4 up 1.9649 1.014E-04 Adamts9 :: a disintegrin-like and metallopeptidase up 2.9962 1.041E-04 (reprolysin type) with thrombospondin type 1 motif, 9 Tgtp2 :: T cell specific GTPase 2 up 1.7415 1.044E-04 Itm2c :: integral membrane protein 2C up 1.9111 1.054E-04 Psme1 :: proteasome (prosome, macropain) 28 up 1.7804 1.102E-04 subunit, alpha Neu1 :: neuraminidase 1 up 2.1503 1.104E-04 Gm4902 :: predicted gene 4902 up 4.1743 1.130E-04 Plxnd1 :: plexin D1 up 2.7331 1.132E-04 BC023105 :: cDNA sequence BC023105 up 2.9111 1.164E-04 Impdh1 :: inosine 5'-phosphate dehydrogenase 1 up 1.9116 1.197E-04 Nck2 :: non-catalytic region of tyrosine kinase up 1.7101 1.263E-04 adaptor protein 2 Tnfsf10 :: tumor necrosis factor (ligand) superfamily, up 5.0064 1.400E-04 member 10 245 Appendix Stap2 :: signal transducing adaptor family member 2 up 1.9762 1.401E-04 P2rx4 :: purinergic receptor P2X, ligand-gated ion up 2.318 1.459E-04 channel 4 Six1 :: sine oculis-related homeobox 1 homolog up 2.1575 1.478E-04 (Drosophila) Shisa5 :: shisa homolog 5 (Xenopus laevis) up 1.8809 1.499E-04 Gvin1 :: GTPase, very large interferon inducible 1 up 3.143 1.527E-04 Mef2c :: myocyte enhancer factor 2C up 2.7066 1.566E-04 Gatsl2 :: GATS protein-like 2 up 2.1166 1.566E-04 AW112010 :: expressed sequence AW112010 up 2.6547 1.587E-04 Adam9 :: a disintegrin and metallopeptidase domain up 1.6341 1.608E-04 9 (meltrin gamma) Lamc2 :: laminin, gamma 2 up 1.6911 1.610E-04 Synpo :: synaptopodin up 1.868 1.705E-04 1700017B05Rik :: RIKEN cDNA 1700017B05 gene up 1.7825 1.711E-04 Tap2 :: transporter 2, ATP-binding cassette, sub- up 2.1286 1.720E-04 family B (MDR/TAP) Gm4951 :: predicted gene 4951 up 5.1779 1.739E-04 Il17rc :: interleukin 17 receptor C up 1.5952 1.760E-04 H2-Q5 :: histocompatibility 2, Q region locus 5 up 3.0369 1.791E-04 Gm17757 :: GTPase, very large interferon inducible up 3.5359 1.864E-04 1 pseudogene ENSMUST00000170589 :: cdna:known up 5.2695 1.867E-04 supercontig:NCBIM37:NT_166281:226405:229375:- 1 gene:ENSMUSG00000091330 gene_biotype:protein_coding transcript_biotype:protein_coding Kank3 :: KN motif and ankyrin repeat domains 3 up 2.1617 1.867E-04 Ell :: elongation factor RNA polymerase II up 1.8385 1.903E-04 Ptpn7 :: protein tyrosine phosphatase, non-receptor up 2.0592 1.921E-04 type 7 Acbd5 :: acyl-Coenzyme A binding domain up 2.2132 1.941E-04 containing 5 AK143364 :: Mus musculus 2 days pregnant adult up 3.1608 1.986E-04 female ovary cDNA, RIKEN full-length enriched library, clone:E330016A15 product:hypothetical protein, full insert sequence. Map3k14 :: mitogen-activated protein kinase kinase up 2.0362 2.057E-04 kinase 14 Nlgn2 :: neuroligin 2 up 2.0074 2.057E-04 Gadd45g :: growth arrest and DNA-damage- up 2.3751 2.082E-04 inducible 45 gamma Ysk4 :: Yeast Sps1/Ste20-related kinase 4 (S. up 1.9905 2.082E-04 cerevisiae) Ccl2 :: chemokine (C-C motif) ligand 2 up 3.963 2.089E-04 Gm10499 :: predicted gene 10499 up 1.7192 2.179E-04 Prkce :: protein kinase C, epsilon up 2.0697 2.179E-04 Ddx24 :: DEAD (Asp-Glu-Ala-Asp) box polypeptide up 1.6905 2.179E-04 24 Adam32 :: a disintegrin and metallopeptidase up 1.6716 2.179E-04 domain 32 Anxa7 :: annexin A7 up 1.6824 2.210E-04 Daxx :: Fas death domain-associated protein up 2.0027 2.214E-04 246 Appendix Nod1 :: nucleotide-binding oligomerization domain up 2.413 2.219E-04 containing 1 Gm4070 :: predicted gene 4070 up 3.1138 2.219E-04 Gss :: glutathione synthetase up 2.0622 2.219E-04 Pla2g10 :: phospholipase A2, group X up 3.304 2.254E-04 Tapbp :: TAP binding protein up 1.7931 2.278E-04 Agrn :: agrin up 1.7337 2.303E-04 Osbpl7 :: oxysterol binding protein-like 7 up 1.7516 2.303E-04 Wdr81 :: WD repeat domain 81 up 1.6621 2.315E-04 Trim12c :: tripartite motif-containing 12C up 1.8493 2.327E-04 Grk5 :: G protein-coupled receptor kinase 5 up 2.1827 2.327E-04 BC034090 :: cDNA sequence BC034090 up 1.6763 2.347E-04 6430548M08Rik :: RIKEN cDNA 6430548M08 gene up 1.7804 2.394E-04 Akr1d1 :: aldo-keto reductase family 1, member D1 up 1.7233 2.394E-04 Clock :: circadian locomotor output cycles kaput up 1.6531 2.394E-04 Myo7a :: myosin VIIA up 2.3219 2.400E-04 Slc29a3 :: solute carrier family 29 (nucleoside up 2.7626 2.446E-04 transporters), member 3 Tcirg1 :: T cell, immune regulator 1, ATPase, H+ up 1.7046 2.452E-04 transporting, lysosomal V0 protein A3 Cfb :: complement factor B up 3.1096 2.465E-04 Trim12c :: tripartite motif-containing 12C up 3.7025 2.529E-04 Itga5 :: integrin alpha 5 (fibronectin receptor alpha) up 1.61 2.571E-04 ENSMUST00000165131 :: cdna:known up 1.9867 2.607E-04 chromosome:NCBIM37:18:31979516:31980067:-1 gene:ENSMUSG00000091561 gene_biotype:protein_coding transcript_biotype:protein_coding H2-Q7 :: histocompatibility 2, Q region locus 7 up 2.4378 2.634E-04 Aif1 :: allograft inflammatory factor 1 up 1.8467 2.640E-04 Slc12a5 :: solute carrier family 12, member 5 up 1.7144 2.663E-04 Mndal :: myeloid nuclear differentiation antigen like up 2.0324 2.705E-04 Gm8989 :: very large inducible GTPase 1 up 2.8539 2.726E-04 pseudogene March3 :: membrane-associated ring finger (C3HC4) up 2.0228 2.726E-04 3 Pcp4 :: Purkinje cell protein 4 up 2.0302 2.748E-04 Tdrd7 :: tudor domain containing 7 up 2.1252 2.796E-04 Ly6a :: lymphocyte antigen 6 complex, locus A up 4.9823 2.796E-04 Rab11b :: RAB11B, member RAS oncogene family up 2.1966 2.805E-04 2210403K04Rik :: RIKEN cDNA 2210403K04 gene up 2.019 2.875E-04 Atxn1 :: ataxin 1 up 1.8557 2.883E-04 Osbpl5 :: oxysterol binding protein-like 5 up 1.5267 2.960E-04 Prdx1 :: peroxiredoxin 1 up 2.0121 2.960E-04 Stat3 :: signal transducer and activator of up 1.8456 3.087E-04 transcription 3 Fcer2a :: Fc receptor, IgE, low affinity II, alpha up 6.1578 3.198E-04 polypeptide 17549474 up 1.7196 3.225E-04 17549018 up 1.9925 3.257E-04 Fnbp1 :: formin binding protein 1 up 1.5107 3.258E-04 Igf1 :: insulin-like growth factor 1 up 2.0962 3.422E-04 247 Appendix C130026I21Rik :: RIKEN cDNA C130026I21 gene up 3.1223 3.422E-04 Cdc42se1 :: CDC42 small effector 1 up 1.4888 3.422E-04 C1ra :: complement component 1, r subcomponent up 2.0106 3.422E-04 A Clu :: clusterin up 1.6208 3.423E-04 ENSMUST00000136542 :: cdna:known up 2.999 3.435E-04 chromosome:NCBIM37:11:120096548:120097436:- 1 gene:ENSMUSG00000085501 gene_biotype:antisense transcript_biotype:antisense Il6 :: interleukin 6 up 2.4102 3.497E-04 Postn :: periostin, osteoblast specific factor up 3.2937 3.595E-04 Selm :: selenoprotein M up 1.6114 3.648E-04 Opn3 :: opsin 3 up 1.8148 3.648E-04 Ptplad2 :: protein tyrosine phosphatase-like A up 2.0678 3.656E-04 domain containing 2 Dnmt3a :: DNA methyltransferase 3A up 1.6544 3.674E-04 Cyba :: cytochrome b-245, alpha polypeptide up 1.5113 3.713E-04 Slc2a6 :: solute carrier family 2 (facilitated glucose up 2.2558 3.713E-04 transporter), member 6 Src :: Rous sarcoma oncogene up 1.4906 3.767E-04 Pik3r3 :: phosphatidylinositol 3 kinase, regulatory up 2.5033 3.804E-04 subunit, polypeptide 3 (p55) Dctn6 :: dynactin 6 up 1.516 3.812E-04 Lamc1 :: laminin, gamma 1 up 1.5094 3.826E-04 D19Wsu162e :: DNA segment, Chr 19, Wayne State up 1.5018 3.829E-04 University 162, expressed 17359966 up 1.7963 3.863E-04 ENSMUST00000157929 :: ncrna:misc_RNA up 2.4815 3.888E-04 chromosome:NCBIM37:10:108527054:108527331:- 1 gene:ENSMUSG00000088554 gene_biotype:misc_RNA transcript_biotype:misc_RNA 17257041 up 3.239 3.905E-04 Gm5431 :: predicted gene 5431 up 3.7232 3.929E-04 Parp11 :: poly (ADP-ribose) polymerase family, up 1.9647 3.942E-04 member 11 Ifi203 :: interferon activated gene 203 up 2.17 4.079E-04 Cxcl15 :: chemokine (C-X-C motif) ligand 15 up 4.0505 4.083E-04 Wdfy1 :: WD repeat and FYVE domain containing 1 up 1.583 4.083E-04 Fut8 :: fucosyltransferase 8 up 1.7026 4.146E-04 17549028 up 1.4865 4.205E-04 Kank2 :: KN motif and ankyrin repeat domains 2 up 1.5794 4.220E-04 Asah2 :: N-acylsphingosine amidohydrolase 2 up 1.9625 4.259E-04 Gdap10 :: ganglioside-induced differentiation- up 1.9389 4.405E-04 associated-protein 10 Fyco1 :: FYVE and coiled-coil domain containing 1 up 1.7646 4.484E-04 17259528 up 1.8346 4.484E-04 Itga1 :: integrin alpha 1 up 2.7485 4.490E-04 Gfap :: glial fibrillary acidic protein up 2.5238 4.490E-04 H2-Q7 :: histocompatibility 2, Q region locus 7 up 1.6251 4.572E-04 Ppp1r37 :: protein phosphatase 1, regulatory subunit up 1.5692 4.573E-04 37 248 Appendix Tor1aip2 :: torsin A interacting protein 2 up 1.4583 4.599E-04 Fndc3b :: fibronectin type III domain containing 3B up 1.545 4.603E-04 Krtap1-5 :: keratin associated protein 1-5 up 2.6145 4.613E-04 Pear1 :: platelet endothelial aggregation receptor 1 up 1.632 4.698E-04 Gm8979 :: very large inducible GTPase 1 up 2.7637 4.773E-04 pseudogene Flnc :: filamin C, gamma up 1.4782 4.801E-04 17549606 up 1.7383 4.819E-04 Etl4 :: enhancer trap locus 4 up 2.0844 4.877E-04 Itpr1 :: inositol 1,4,5-trisphosphate receptor 1 up 1.6638 4.878E-04 Cxcl1 :: chemokine (C-X-C motif) ligand 1 up 2.4248 4.954E-04 4933431E20Rik :: RIKEN cDNA 4933431E20 gene up 1.7723 4.962E-04 Mnda :: myeloid cell nuclear differentiation antigen up 1.472 4.962E-04 2010002M12Rik :: RIKEN cDNA 2010002M12 gene up 1.9569 4.998E-04 Ifi27l2a :: interferon, alpha-inducible protein 27 like up 3.0918 5.001E-04 2A Mir3095 :: microRNA 3095 up 2.8075 5.046E-04 Il13ra1 :: interleukin 13 receptor, alpha 1 up 1.6069 5.057E-04 Nlrc5 :: NLR family, CARD domain containing 5 up 1.91 5.061E-04 Erap1 :: endoplasmic reticulum aminopeptidase 1 up 1.5512 5.061E-04 Ldhd :: lactate dehydrogenase D up 2.2276 5.061E-04 Man2b2 :: mannosidase 2, alpha B2 up 1.7274 5.170E-04 Cux1 :: cut-like homeobox 1 up 1.4666 5.191E-04 Lmtk3 :: lemur tyrosine kinase 3 up 1.5066 5.290E-04 Csprs :: component of Sp100-rs up 1.7363 5.290E-04 Tnfsf9 :: tumor necrosis factor (ligand) superfamily, up 1.6032 5.290E-04 member 9 Clec2d :: C-type lectin domain family 2, member d up 2.0308 5.293E-04 Isg20 :: interferon-stimulated protein up 1.5723 5.293E-04 D1Ertd622e :: DNA segment, Chr 1, ERATO Doi up 1.6774 5.311E-04 622, expressed Spry1 :: sprouty homolog 1 (Drosophila) up 1.5163 5.311E-04 March2 :: membrane-associated ring finger (C3HC4) up 1.7001 5.311E-04 2 Mapkbp1 :: mitogen-activated protein kinase binding up 1.7445 5.340E-04 protein 1 Gm4841 :: predicted gene 4841 up 2.4516 5.380E-04 17549612 up 1.7625 5.463E-04 Cd82 :: CD82 antigen up 1.5699 5.463E-04 Sybu :: syntabulin (syntaxin-interacting) up 2.1187 5.548E-04 Gprc5a :: G protein-coupled receptor, family C, up 1.6188 5.580E-04 group 5, member A Cnp :: 2',3'-cyclic nucleotide 3' phosphodiesterase up 1.7326 5.580E-04 Olfr631 :: olfactory receptor 631 up 2.6762 5.580E-04 Il6ra :: interleukin 6 receptor, alpha up 1.7381 5.580E-04 ENSMUST00000074761 :: cdna:known up 1.7625 5.580E-04 chromosome:NCBIM37:2:28361615:28361995:1 gene:ENSMUSG00000063611 gene_biotype:protein_coding transcript_biotype:protein_coding Gbp5 :: guanylate binding protein 5 up 3.4652 5.644E-04 LOC100036513 :: uncharacterized LOC100036513 up 1.5705 5.648E-04 249 Appendix Cacfd1 :: calcium channel flower domain containing up 1.5468 5.683E-04 1 Cryab :: crystallin, alpha B up 1.9623 5.683E-04 17418254 up 1.6105 5.684E-04 Iqsec1 :: IQ motif and Sec7 domain 1 up 1.4911 5.736E-04 Cxcl9 :: chemokine (C-X-C motif) ligand 9 up 2.5978 5.767E-04 Glrx :: glutaredoxin up 1.9875 5.932E-04 Trak2 :: trafficking protein, kinesin binding 2 up 1.4569 5.932E-04 Ecm1 :: extracellular matrix protein 1 up 1.5528 6.016E-04 Zfand3 :: zinc finger, AN1-type domain 3 up 1.4779 6.208E-04 17283544 up 1.5003 6.291E-04 Fam129b :: family with sequence similarity 129, up 1.544 6.291E-04 member B Fam43a :: family with sequence similarity 43, up 2.1864 6.412E-04 member A Akap2 :: A kinase (PRKA) anchor protein 2 up 1.4939 6.511E-04 H2-Q6 :: histocompatibility 2, Q region locus 6 up 2.3983 6.512E-04 Arap1 :: ArfGAP with RhoGAP domain, ankyrin up 1.4877 6.561E-04 repeat and PH domain 1 Sync :: syncoilin up 2.1623 6.876E-04 Spr :: sepiapterin reductase up 1.9348 6.932E-04 Sgsh :: N-sulfoglucosamine sulfohydrolase up 1.6819 6.932E-04 (sulfamidase) Uhmk1 :: U2AF homology motif (UHM) kinase 1 up 1.5133 6.982E-04 Ttyh2 :: tweety homolog 2 (Drosophila) up 2.1077 7.137E-04 Grn :: granulin up 1.5693 7.153E-04 Necap2 :: NECAP endocytosis associated 2 up 1.5582 7.196E-04 Mvp :: major vault protein up 1.6351 7.197E-04 B4galt5 :: UDP-Gal:betaGlcNAc beta 1,4- up 1.673 7.214E-04 galactosyltransferase, polypeptide 5 17283547 up 1.9305 7.331E-04 Ctso :: cathepsin O up 2.1399 7.331E-04 H2-T23 :: histocompatibility 2, T region locus 23 up 2.8043 7.377E-04 Epsti1 :: epithelial stromal interaction 1 (breast) up 2.1484 7.377E-04 E130308A19Rik :: RIKEN cDNA E130308A19 gene up 1.6298 7.453E-04 Fkbp14 :: FK506 binding protein 14 up 1.8929 7.453E-04 Nmu :: neuromedin U up 1.5609 7.522E-04 Psmb10 :: proteasome (prosome, macropain) up 1.7519 7.971E-04 subunit, beta type 10 Mink1 :: misshapen-like kinase 1 (zebrafish) up 1.4195 7.973E-04 Trex1 :: three prime repair exonuclease 1 up 2.5122 8.073E-04 Dnajc3 :: DnaJ (Hsp40) homolog, subfamily C, up 1.9496 8.073E-04 member 3 Pml :: promyelocytic leukemia up 1.5316 8.073E-04 H47 :: histocompatibility 47 up 2.1708 8.089E-04 Nacc2 :: nucleus accumbens associated 2, BEN and up 1.4655 8.116E-04 BTB (POZ) domain containing Gm14137 :: predicted gene 14137 up 1.4915 8.116E-04 Zfp36 :: zinc finger protein 36 up 1.956 8.134E-04 Gm20300 :: predicted gene, 20300 up 1.856 8.215E-04 Pvrl2 :: poliovirus receptor-related 2 up 1.4418 8.230E-04 17257043 up 3.6957 8.230E-04 250 Appendix Il11ra2 :: interleukin 11 receptor, alpha chain 2 up 1.4494 8.230E-04 Il11ra2 :: interleukin 11 receptor, alpha chain 2 up 1.4494 8.230E-04 Il11ra2 :: interleukin 11 receptor, alpha chain 2 up 1.4494 8.230E-04 Il11ra2 :: interleukin 11 receptor, alpha chain 2 up 1.4494 8.230E-04 Gm15998 :: predicted gene 15998 up 1.8208 8.311E-04 Ust :: uronyl-2-sulfotransferase up 1.5439 8.347E-04 Ficd :: FIC domain containing up 1.7903 8.347E-04 Icosl :: icos ligand up 2.2187 8.347E-04 Mpeg1 :: macrophage expressed gene 1 up 1.7483 8.593E-04 Ankrd50 :: ankyrin repeat domain 50 up 1.7182 8.595E-04 Plekhb2 :: pleckstrin homology domain containing, up 1.5676 8.627E-04 family B (evectins) member 2 Ralgps1 :: Ral GEF with PH domain and SH3 up 1.5127 8.706E-04 binding motif 1 Ocel1 :: occludin/ELL domain containing 1 up 1.46 8.762E-04 Tapbp :: TAP binding protein up 1.4493 8.762E-04 Ppp2r5b :: protein phosphatase 2, regulatory subunit up 1.9745 8.834E-04 B (B56), beta isoform Il1a :: interleukin 1 alpha up 3.7645 8.960E-04 Keap1 :: kelch-like ECH-associated protein 1 up 1.4951 8.973E-04 Ceacam16 :: carcinoembryonic antigen-related cell up 1.5 9.080E-04 adhesion molecule 16 Sdc3 :: syndecan 3 up 1.5984 9.090E-04 Nucb2 :: nucleobindin 2 up 1.6487 9.113E-04 17283540 up 1.8014 9.123E-04 ENSMUST00000174778 :: cdna:known up 2.0738 9.125E-04 chromosome:NCBIM37:17:36278703:36282689:-1 gene:ENSMUSG00000073403 gene_biotype:pseudogene transcript_biotype:retained_intron Lhfpl2 :: lipoma HMGIC fusion partner-like 2 up 1.7733 9.125E-04 Zfpm1 :: zinc finger protein, multitype 1 up 1.458 9.208E-04 17369867 up 1.57 9.214E-04 B230312A22Rik :: RIKEN cDNA B230312A22 gene up 1.5579 9.243E-04 H2-K1 :: histocompatibility 2, K1, K region up 1.4158 9.404E-04 Mir30a :: microRNA 30a up 2.4489 9.404E-04 Gba :: glucosidase, beta, acid up 1.6045 9.432E-04 Fam160b2 :: family with sequence similarity 160, up 1.4895 9.434E-04 member B2 17359953 up 1.6424 9.456E-04 Atp9a :: ATPase, class II, type 9A up 1.5489 9.510E-04 Fcgrt :: Fc receptor, IgG, alpha chain transporter up 2.8501 9.542E-04 Tagln :: transgelin up 1.5719 9.546E-04 Csad :: cysteine sulfinic acid decarboxylase up 1.5408 9.671E-04 Itfg3 :: integrin alpha FG-GAP repeat containing 3 up 1.5493 9.760E-04 Cog1 :: component of oligomeric golgi complex 1 up 1.4382 9.795E-04 Gnptg :: N-acetylglucosamine-1- up 1.5739 9.795E-04 phosphotransferase, gamma subunit Zbtb6 :: zinc finger and BTB domain containing 6 up 1.4649 9.913E-04 Pde3a :: phosphodiesterase 3A, cGMP inhibited up 1.6696 9.913E-04 Flrt3 :: fibronectin leucine rich transmembrane up 2.1319 9.968E-04 protein 3 251 Appendix Gm16340 :: predicted gene 16340 up 1.8516 1.005E-03 17512458 up 1.4859 1.011E-03 Sfxn5 :: sideroflexin 5 up 1.5356 1.021E-03 Arrdc2 :: arrestin domain containing 2 up 1.4699 1.021E-03 Ttc21a :: tetratricopeptide repeat domain 21A up 2.1394 1.021E-03 Dab2ip :: disabled 2 interacting protein up 1.363 1.034E-03 Tgfb1 :: transforming growth factor, beta 1 up 1.5247 1.037E-03 Sp140 :: Sp140 nuclear body protein up 1.6233 1.043E-03 Ppp3ca :: protein phosphatase 3, catalytic subunit, up 1.7784 1.043E-03 alpha isoform BC100451 :: cDNA sequence BC100451 up 1.5566 1.065E-03 Agpat4 :: 1-acylglycerol-3-phosphate O- up 1.7163 1.078E-03 acyltransferase 4 (lysophosphatidic acid acyltransferase, delta) Ddx39b :: DEAD (Asp-Glu-Ala-Asp) box polypeptide up 1.4409 1.078E-03 39B C1rl :: complement component 1, r subcomponent- up 1.9729 1.078E-03 like ENSMUST00000082631 :: ncrna:snRNA up 1.6102 1.089E-03 chromosome:NCBIM37:16:11167198:11167360:-1 gene:ENSMUSG00000064565 gene_biotype:snRNA transcript_biotype:snRNA Arhgap23 :: Rho GTPase activating protein 23 up 1.4233 1.106E-03 Dnajb11 :: DnaJ (Hsp40) homolog, subfamily B, up 1.7178 1.108E-03 member 11 Batf2 :: basic leucine zipper transcription factor, up 1.4991 1.110E-03 ATF-like 2 H2-Q10 :: histocompatibility 2, Q region locus 10 up 1.8078 1.110E-03 Cdc42bpg :: CDC42 binding protein kinase gamma up 1.4592 1.123E-03 (DMPK-like) Tnip1 :: TNFAIP3 interacting protein 1 up 1.5441 1.129E-03 Tmem120b :: transmembrane protein 120B up 1.7729 1.129E-03 Hexa :: hexosaminidase A up 2.4964 1.129E-03 Rasgef1b :: RasGEF domain family, member 1B up 1.7704 1.133E-03 Sik1 :: salt inducible kinase 1 up 1.6372 1.136E-03 H19 :: H19 fetal liver mRNA down 2.8526 3.677E-06 Mpzl2 :: myelin protein zero-like 2 down 3.1982 3.862E-06 Cpox :: coproporphyrinogen oxidase down 2.5431 4.324E-06 Gpr116 :: G protein-coupled receptor 116 down 2.9257 5.335E-06 Cep78 :: centrosomal protein 78 down 2.5606 8.087E-06 Gpt2 :: glutamic pyruvate transaminase (alanine down 3.2592 8.294E-06 aminotransferase) 2 Cth :: cystathionase (cystathionine gamma-lyase) down 4.9146 1.009E-05 Zfp420 :: zinc finger protein 420 down 2.6201 1.065E-05 Gja1 :: gap junction protein, alpha 1 down 2.2993 1.728E-05 Cldn9 :: claudin 9 down 4.2349 1.824E-05 Rtkn2 :: rhotekin 2 down 3.3638 1.926E-05 Aqp1 :: aquaporin 1 down 3.4829 2.796E-05 Fermt1 :: fermitin family homolog 1 (Drosophila) down 2.1462 3.047E-05 Taf5 :: TAF5 RNA polymerase II, TATA box binding down 1.9337 3.624E-05 protein (TBP)-associated factor 252 Appendix Slc7a11 :: solute carrier family 7 (cationic amino acid down 7.3157 3.722E-05 transporter, y+ system), member 11 B4galnt4 :: beta-1,4-N-acetyl-galactosaminyl down 2.2432 3.812E-05 transferase 4 Gls2 :: glutaminase 2 (liver, mitochondrial) down 2.3353 3.933E-05 Fbln2 :: fibulin 2 down 2.0405 4.051E-05 2610021K21Rik :: RIKEN cDNA 2610021K21 gene down 2.9111 4.506E-05 Gstcd :: glutathione S-transferase, C-terminal down 1.8478 4.650E-05 domain containing Rps6ka6 :: ribosomal protein S6 kinase polypeptide down 2.1709 5.279E-05 6 Hspa1l :: heat shock protein 1-like down 1.9999 5.886E-05 Dyrk3 :: dual-specificity tyrosine-(Y)-phosphorylation down 2.8598 6.145E-05 regulated kinase 3 Hmgn5 :: high-mobility group nucleosome binding down 3.2189 6.359E-05 domain 5 Deptor :: DEP domain containing MTOR-interacting down 4.1093 6.371E-05 protein Morc4 :: microrchidia 4 down 2.4329 6.580E-05 4930547N16Rik :: RIKEN cDNA 4930547N16 gene down 2.5346 6.580E-05 Mfap3l :: microfibrillar-associated protein 3-like down 2.2621 6.601E-05 Asns :: asparagine synthetase down 1.8847 6.948E-05 Anxa8 :: annexin A8 down 3.8224 7.057E-05 Nadkd1 :: NAD kinase domain containing 1 down 1.8247 7.072E-05 Pck2 :: phosphoenolpyruvate carboxykinase 2 down 2.0406 7.072E-05 (mitochondrial) Tfdp2 :: transcription factor Dp 2 down 1.9832 7.346E-05 Aldh18a1 :: aldehyde dehydrogenase 18 family, down 1.7703 7.483E-05 member A1 Deptor :: DEP domain containing MTOR-interacting down 3.1578 7.506E-05 protein Chac1 :: ChaC, cation transport regulator 1 down 1.8824 8.659E-05 Acsbg1 :: acyl-CoA synthetase bubblegum family down 1.7788 8.746E-05 member 1 Tdp1 :: tyrosyl-DNA phosphodiesterase 1 down 1.823 9.396E-05 Shmt2 :: serine hydroxymethyltransferase 2 down 1.9779 9.558E-05 (mitochondrial) Spire2 :: spire homolog 2 (Drosophila) down 1.7725 9.764E-05 Fgfbp1 :: fibroblast growth factor binding protein 1 down 5.9169 1.005E-04 Mdm1 :: transformed mouse 3T3 cell double minute down 1.8829 1.054E-04 1 Tigit :: T cell immunoreceptor with Ig and ITIM down 3.7766 1.054E-04 domains Slc22a4 :: solute carrier family 22 (organic cation down 2.0018 1.113E-04 transporter), member 4 Slc7a11 :: solute carrier family 7 (cationic amino acid down 3.4499 1.132E-04 transporter, y+ system), member 11 Noa1 :: nitric oxide associated 1 down 2.0012 1.132E-04 Hyls1 :: hydrolethalus syndrome 1 down 2.0694 1.132E-04 Dcbld1 :: discoidin, CUB and LCCL domain down 2.0121 1.286E-04 containing 1 Cav1 :: caveolin 1, caveolae protein down 1.9449 1.453E-04 Glrp1 :: glutamine repeat protein 1 down 1.8831 1.459E-04 253 Appendix Tmem43 :: transmembrane protein 43 down 1.8263 1.459E-04 Arhgap19 :: Rho GTPase activating protein 19 down 2.3883 1.462E-04 Wdr67 :: WD repeat domain 67 down 2.0214 1.465E-04 BC048355 :: cDNA sequence BC048355 down 2.0372 1.465E-04 Lars :: leucyl-tRNA synthetase down 1.9252 1.478E-04 Klk10 :: kallikrein related-peptidase 10 down 2.893 1.478E-04 Psrc1 :: proline/serine-rich coiled-coil 1 down 2.9084 1.482E-04 Pomt1 :: protein-O-mannosyltransferase 1 down 1.8364 1.565E-04 Kif18a :: kinesin family member 18A down 2.7177 1.570E-04 2310002L13Rik :: RIKEN cDNA 2310002L13 gene down 3.9309 1.587E-04 1700102H20Rik :: RIKEN cDNA 1700102H20 gene down 1.723 1.686E-04 Ttl :: tubulin tyrosine ligase down 1.7765 1.719E-04 Rfc4 :: replication factor C (activator 1) 4 down 2.3625 1.762E-04 D530008I23 :: uncharacterized LOC329358 down 1.8974 1.766E-04 Bcl11a :: B cell CLL/lymphoma 11A (zinc finger down 1.6684 1.791E-04 protein) Mthfd2 :: methylenetetrahydrofolate dehydrogenase down 2.3012 1.795E-04 (NAD+ dependent), methenyltetrahydrofolate cyclohydrolase Oxnad1 :: oxidoreductase NAD-binding domain down 1.8502 1.830E-04 containing 1 Stag1 :: stromal antigen 1 down 1.7342 1.867E-04 Nusap1 :: nucleolar and spindle associated protein 1 down 2.0153 1.961E-04 Miip :: migration and invasion inhibitory protein down 1.9918 2.026E-04 Odz4 :: odd Oz/ten-m homolog 4 (Drosophila) down 1.6585 2.068E-04 Cenpl :: centromere protein L down 2.1099 2.068E-04 7530420F21Rik :: RIKEN cDNA 7530420F21 gene down 2.003 2.082E-04 Ddx20 :: DEAD (Asp-Glu-Ala-Asp) box polypeptide down 1.8475 2.082E-04 20 Ctxn1 :: cortexin 1 down 2.0497 2.179E-04 Cep192 :: centrosomal protein 192 down 1.6919 2.219E-04 Ddx26b :: DEAD/H (Asp-Glu-Ala-Asp/His) box down 1.8644 2.219E-04 polypeptide 26B Rnf125 :: ring finger protein 125 down 2.1811 2.221E-04 ENSMUST00000172174 :: cdna:known down 1.8835 2.226E-04 chromosome:NCBIM37:6:112387465:112389330:1 gene:ENSMUSG00000091626 gene_biotype:protein_coding transcript_biotype:protein_coding Hhip :: Hedgehog-interacting protein down 3.3907 2.236E-04 Gpr124 :: G protein-coupled receptor 124 down 1.8846 2.303E-04 Bub1 :: budding uninhibited by benzimidazoles 1 down 2.6551 2.303E-04 homolog (S. cerevisiae) ENSMUST00000050763 :: cdna:pseudogene down 2.2961 2.303E-04 chromosome:NCBIM37:7:49361266:49362555:-1 gene:ENSMUSG00000048574 gene_biotype:pseudogene transcript_biotype:pseudogene Ephb6 :: Eph receptor B6 down 2.2009 2.311E-04 S100a3 :: S100 calcium binding protein A3 down 1.9038 2.357E-04 Adam8 :: a disintegrin and metallopeptidase domain down 1.8461 2.394E-04 8 254 Appendix Sirt1 :: sirtuin 1 (silent mating type information down 1.6301 2.409E-04 regulation 2, homolog) 1 (S. cerevisiae) Poc1b :: POC1 centriolar protein homolog B down 2.3914 2.420E-04 (Chlamydomonas) Fdft1 :: farnesyl diphosphate farnesyl transferase 1 down 1.9099 2.420E-04 Epha1 :: Eph receptor A1 down 1.5683 2.446E-04 Pycr1 :: pyrroline-5-carboxylate reductase 1 down 2.6982 2.446E-04 Ckap2 :: cytoskeleton associated protein 2 down 2.2689 2.452E-04 Cd109 :: CD109 antigen down 2.4191 2.452E-04 Zfp647 :: zinc finger protein 647 down 1.6259 2.452E-04 1190002F15Rik :: RIKEN cDNA 1190002F15 gene down 1.9967 2.452E-04 Kif11 :: kinesin family member 11 down 2.5383 2.452E-04 Vrk1 :: vaccinia related kinase 1 down 1.8484 2.462E-04 Dars2 :: aspartyl-tRNA synthetase 2 (mitochondrial) down 2.2525 2.497E-04 ENSMUST00000083300 :: ncrna:snRNA down 2.4402 2.529E-04 chromosome:NCBIM37:5:32477472:32477578:1 gene:ENSMUSG00000065234 gene_biotype:snRNA transcript_biotype:snRNA Mbnl3 :: muscleblind-like 3 (Drosophila) down 1.7104 2.529E-04 Racgap1 :: Rac GTPase-activating protein 1 down 2.2696 2.529E-04 Haus1 :: HAUS augmin-like complex, subunit 1 down 2.1665 2.529E-04 Cdkn3 :: cyclin-dependent kinase inhibitor 3 down 2.1241 2.543E-04 Pcyt1b :: phosphate cytidylyltransferase 1, choline, down 2.5492 2.543E-04 beta isoform Dlk2 :: delta-like 2 homolog (Drosophila) down 1.5774 2.543E-04 Nubpl :: nucleotide binding protein-like down 1.8756 2.607E-04 Pdp1 :: pyruvate dehyrogenase phosphatase down 1.7667 2.607E-04 catalytic subunit 1 Ube2cbp :: ubiquitin-conjugating enzyme E2C down 1.9826 2.638E-04 binding protein Aspm :: asp (abnormal spindle)-like, microcephaly down 2.6156 2.680E-04 associated (Drosophila) Slc4a8 :: solute carrier family 4 (anion exchanger), down 1.6492 2.680E-04 member 8 Pitpnc1 :: phosphatidylinositol transfer protein, down 2.3082 2.705E-04 cytoplasmic 1 Gyk :: glycerol kinase down 1.701 2.705E-04 Katnal2 :: katanin p60 subunit A-like 2 down 1.5238 2.712E-04 F630043A04Rik :: RIKEN cDNA F630043A04 gene down 2.6209 2.810E-04 Mastl :: microtubule associated serine/threonine down 2.1746 2.875E-04 kinase-like 4930503L19Rik :: RIKEN cDNA 4930503L19 gene down 2.1844 2.875E-04 Mutyh :: mutY homolog (E. coli) down 1.7491 2.883E-04 2810408A11Rik :: RIKEN cDNA 2810408A11 gene down 2.0092 2.898E-04 Ccdc41 :: coiled-coil domain containing 41 down 1.8158 2.898E-04 Lancl3 :: LanC lantibiotic synthetase component C- down 1.5967 2.905E-04 like 3 (bacterial) Ell3 :: elongation factor RNA polymerase II-like 3 down 1.8087 2.927E-04 Fam71f1 :: family with sequence similarity 71, down 2.037 2.927E-04 member F1 Scd1 :: stearoyl-Coenzyme A desaturase 1 down 3.0674 2.969E-04 Pgap1 :: post-GPI attachment to proteins 1 down 2.5735 3.025E-04 255 Appendix Steap2 :: six transmembrane epithelial antigen of down 1.6744 3.089E-04 prostate 2 Rcc2 :: regulator of chromosome condensation 2 down 1.8744 3.103E-04 Tmem107 :: transmembrane protein 107 down 1.9317 3.126E-04 Phf10 :: PHD finger protein 10 down 2.2978 3.126E-04 Klhdc2 :: kelch domain containing 2 down 1.6455 3.160E-04 Efnb1 :: ephrin B1 down 1.5826 3.224E-04 Fam185a :: family with sequence similarity 185, down 1.9959 3.300E-04 member A Polr1c :: polymerase (RNA) I polypeptide C down 1.568 3.323E-04 Cdc25b :: cell division cycle 25B down 2.2996 3.327E-04 Ect2 :: ect2 oncogene down 2.108 3.422E-04 Tgfbi :: transforming growth factor, beta induced down 2.3141 3.422E-04 Crybg3 :: beta-gamma crystallin domain containing 3 down 1.7437 3.422E-04 Sesn2 :: sestrin 2 down 1.8745 3.443E-04 Abcb6 :: ATP-binding cassette, sub-family B down 1.862 3.443E-04 (MDR/TAP), member 6 Ero1l :: ERO1-like (S. cerevisiae) down 1.75 3.443E-04 Brca2 :: breast cancer 2 down 2.2658 3.449E-04 Ube2ql1 :: ubiquitin-conjugating enzyme E2Q family- down 2.0183 3.450E-04 like 1 Tmem194 :: transmembrane protein 194 down 2.2167 3.497E-04 Oip5 :: Opa interacting protein 5 down 2.7421 3.616E-04 Atg9b :: autophagy related 9B down 1.8863 3.648E-04 Eri2 :: exoribonuclease 2 down 1.9303 3.648E-04 Acsl3 :: acyl-CoA synthetase long-chain family down 1.6829 3.668E-04 member 3 Klf5 :: Kruppel-like factor 5 down 1.613 3.674E-04 Mtmr14 :: myotubularin related protein 14 down 1.6809 3.674E-04 Mir1199 :: microRNA 1199 down 1.6375 3.678E-04 Mest :: mesoderm specific transcript down 1.7307 3.826E-04 ENSMUST00000124336 :: cdna:known down 1.7963 3.826E-04 chromosome:NCBIM37:2:132079093:132087069:1 gene:ENSMUSG00000087377 gene_biotype:antisense transcript_biotype:antisense 17453132 down 2.0387 3.829E-04 Zfp69 :: zinc finger protein 69 down 1.7347 3.840E-04 Ptch1 :: patched homolog 1 down 1.6261 3.929E-04 Ints10 :: integrator complex subunit 10 down 1.6585 3.929E-04 Arhgap11a :: Rho GTPase activating protein 11A down 2.2619 4.043E-04 Ift140 :: intraflagellar transport 140 down 1.6136 4.099E-04 Mthfd1l :: methylenetetrahydrofolate dehydrogenase down 1.8439 4.136E-04 (NADP+ dependent) 1-like Nsun5 :: NOL1/NOP2/Sun domain family, member 5 down 1.6386 4.236E-04 Fam131b :: family with sequence similarity 131, down 2.1336 4.395E-04 member B Gm5088 :: poly(A)-binding protein, cytoplasmic down 1.5178 4.484E-04 pseudogene Txnrd2 :: thioredoxin reductase 2 down 1.5213 4.490E-04 Lsp1 :: lymphocyte specific 1 down 1.8604 4.504E-04 Gmcl1 :: germ cell-less homolog 1 (Drosophila) down 1.7067 4.603E-04 Sgol1 :: shugoshin-like 1 (S. pombe) down 2.3812 4.603E-04 256 Appendix Slc25a30 :: solute carrier family 25, member 30 down 1.7272 4.641E-04 Megf9 :: multiple EGF-like-domains 9 down 1.7228 4.645E-04 Sip1 :: survival of motor neuron protein interacting down 2.0195 4.714E-04 protein 1 Arntl2 :: aryl hydrocarbon receptor nuclear down 1.5175 4.714E-04 translocator-like 2 2610528E23Rik :: RIKEN cDNA 2610528E23 gene down 1.7065 4.746E-04 Nup37 :: nucleoporin 37 down 1.7374 4.846E-04 Osr2 :: odd-skipped related 2 down 3.424 4.905E-04 Lrrc40 :: leucine rich repeat containing 40 down 1.6636 4.962E-04 Prcp :: prolylcarboxypeptidase (angiotensinase C) down 1.5497 4.962E-04 Slc1a4 :: solute carrier family 1 (glutamate/neutral down 1.749 4.962E-04 amino acid transporter), member 4 9930014A18Rik :: RIKEN cDNA 9930014A18 gene down 1.8349 5.026E-04 Zfp131 :: zinc finger protein 131 down 1.768 5.061E-04 Psat1 :: phosphoserine aminotransferase 1 down 2.1972 5.068E-04 Fads1 :: fatty acid desaturase 1 down 1.7441 5.145E-04 Gm1045 :: predicted gene 1045 down 1.8953 5.170E-04 Fam110c :: family with sequence similarity 110, down 2.5588 5.190E-04 member C Car5b :: carbonic anhydrase 5b, mitochondrial down 1.999 5.195E-04 Gpr97 :: G protein-coupled receptor 97 down 1.5768 5.195E-04 Sh3yl1 :: Sh3 domain YSC-like 1 down 2.7031 5.311E-04 2410127L17Rik :: RIKEN cDNA 2410127L17 gene down 1.6675 5.325E-04 Gemin6 :: gem (nuclear organelle) associated down 1.8388 5.339E-04 protein 6 Lbr :: lamin B receptor down 1.6899 5.362E-04 Mid1ip1 :: Mid1 interacting protein 1 (gastrulation down 1.64 5.380E-04 specific G12-like (zebrafish)) Ndc80 :: NDC80 homolog, kinetochore complex down 1.9924 5.580E-04 component (S. cerevisiae) 9030625A04Rik :: RIKEN cDNA 9030625A04 gene down 1.8119 5.648E-04 Nob1 :: NIN1/RPN12 binding protein 1 homolog (S. down 1.6839 5.648E-04 cerevisiae) Nde1 :: nuclear distribution gene E homolog 1 (A down 1.5657 5.648E-04 nidulans) Kcnk1 :: potassium channel, subfamily K, member 1 down 1.5632 5.683E-04 Fam64a :: family with sequence similarity 64, down 2.3023 5.683E-04 member A BC030867 :: cDNA sequence BC030867 down 2.292 5.733E-04 Dbf4 :: DBF4 homolog (S. cerevisiae) down 2.1175 5.785E-04 Cpsf4 :: cleavage and polyadenylation specific factor down 1.645 5.795E-04 4 Rad1 :: RAD1 homolog (S. pombe) down 1.5728 5.795E-04 Stc2 :: stanniocalcin 2 down 2.3114 5.806E-04 Aurka :: aurora kinase A down 2.2109 5.806E-04 Camk1d :: calcium/calmodulin-dependent protein down 1.7042 5.813E-04 kinase ID Lmo4 :: LIM domain only 4 down 1.8357 5.822E-04 4632434I11Rik :: RIKEN cDNA 4632434I11 gene down 1.9932 5.837E-04 Rab23 :: RAB23, member RAS oncogene family down 1.486 5.846E-04 Cdc20 :: cell division cycle 20 down 2.1606 5.877E-04 257 Appendix Rhebl1 :: Ras homolog enriched in brain like 1 down 1.7199 6.026E-04 Fam83d :: family with sequence similarity 83, down 2.7053 6.026E-04 member D Styk1 :: serine/threonine/tyrosine kinase 1 down 1.7334 6.026E-04 Cdca7l :: cell division cycle associated 7 like down 1.6534 6.197E-04 Pop4 :: processing of precursor 4, ribonuclease down 1.6029 6.247E-04 P/MRP family, (S. cerevisiae) Csrp2 :: cysteine and glycine-rich protein 2 down 1.7072 6.247E-04 Trmt1 :: TRM1 tRNA methyltransferase 1 homolog down 1.5278 6.264E-04 (S. cerevisiae) Gm4610 :: predicted gene 4610 down 1.5926 6.363E-04 Tmem74 :: transmembrane protein 74 down 2.16 6.562E-04 Cenpe :: centromere protein E down 2.2528 6.635E-04 Flywch1 :: FLYWCH-type zinc finger 1 down 1.4813 6.635E-04 G2e3 :: G2/M-phase specific E3 ubiquitin ligase down 1.6352 6.734E-04 Gemin8 :: gem (nuclear organelle) associated down 1.6129 6.761E-04 protein 8 Plac1 :: placental specific protein 1 down 1.4991 6.802E-04 Tmpo :: thymopoietin down 1.7217 6.840E-04 Slc4a11 :: solute carrier family 4, sodium down 3.3742 6.871E-04 bicarbonate transporter-like, member 11 Nek4 :: NIMA (never in mitosis gene a)-related down 1.6017 6.932E-04 expressed kinase 4 Rbbp8 :: retinoblastoma binding protein 8 down 1.6913 6.932E-04 Tle1 :: transducin-like enhancer of split 1, homolog down 1.8382 6.932E-04 of Drosophila E(spl) Oxct1 :: 3-oxoacid CoA transferase 1 down 1.4604 6.949E-04 Csgalnact1 :: chondroitin sulfate N- down 1.992 7.008E-04 acetylgalactosaminyltransferase 1 Las1l :: LAS1-like (S. cerevisiae) down 1.4826 7.127E-04 Ctcf :: CCCTC-binding factor down 1.502 7.137E-04 Alg10b :: asparagine-linked glycosylation 10B down 1.5257 7.150E-04 (alpha-1,2-glucosyltransferase) Kctd15 :: potassium channel tetramerisation domain down 1.679 7.153E-04 containing 15 Pank1 :: pantothenate kinase 1 down 2.0588 7.297E-04 Alg13 :: asparagine-linked glycosylation 13 down 1.7093 7.298E-04 Nt5e :: 5' nucleotidase, ecto down 1.9431 7.331E-04 Kif4 :: kinesin family member 4 down 2.0372 7.331E-04 Rp9 :: retinitis pigmentosa 9 (human) down 1.5437 7.377E-04 Cdt1 :: chromatin licensing and DNA replication down 1.9934 7.377E-04 factor 1 Adh7 :: alcohol dehydrogenase 7 (class IV), mu or down 2.2936 7.395E-04 sigma polypeptide Ivns1abp :: influenza virus NS1A binding protein down 1.542 7.468E-04 Cyp51 :: cytochrome P450, family 51 down 2.2561 7.557E-04 Fzd7 :: frizzled homolog 7 (Drosophila) down 1.7934 7.751E-04 Reep4 :: receptor accessory protein 4 down 1.8692 7.811E-04 Gclc :: glutamate-cysteine ligase, catalytic subunit down 1.9443 7.998E-04 Fndc4 :: fibronectin type III domain containing 4 down 1.5773 8.073E-04 Fv1 :: Friend virus susceptibility 1 down 1.6673 8.073E-04 Mtr :: 5-methyltetrahydrofolate-homocysteine down 1.6466 8.073E-04 258 Appendix methyltransferase 4930520O04Rik :: RIKEN cDNA 4930520O04 gene down 1.6335 8.074E-04 D2Ertd750e :: DNA segment, Chr 2, ERATO Doi down 1.7712 8.089E-04 750, expressed Bend6 :: BEN domain containing 6 down 1.6369 8.089E-04 Nars :: asparaginyl-tRNA synthetase down 1.4294 8.089E-04 Gclm :: glutamate-cysteine ligase, modifier subunit down 1.846 8.116E-04 Ccnb2 :: cyclin B2 down 1.756 8.225E-04 Cep57l1 :: centrosomal protein 57-like 1 down 1.5321 8.230E-04 Fam84b :: family with sequence similarity 84, down 1.8584 8.347E-04 member B Zfand4 :: zinc finger, AN1-type domain 4 down 1.7128 8.347E-04 Whsc1 :: Wolf-Hirschhorn syndrome candidate 1 down 1.5034 8.347E-04 (human) Pgm2l1 :: phosphoglucomutase 2-like 1 down 1.4427 8.347E-04 Rpgr :: retinitis pigmentosa GTPase regulator down 1.953 8.347E-04 Mfsd7b :: major facilitator superfamily domain down 1.5555 8.347E-04 containing 7B Trip13 :: thyroid hormone receptor interactor 13 down 2.1745 8.354E-04 Zik1 :: zinc finger protein interacting with K protein 1 down 1.7426 8.593E-04 Prrg4 :: proline rich Gla (G-carboxyglutamic acid) 4 down 1.708 8.593E-04 (transmembrane) Adam12 :: a disintegrin and metallopeptidase down 2.0368 8.706E-04 domain 12 (meltrin alpha) Ccbe1 :: collagen and calcium binding EGF domains down 1.6417 8.759E-04 1 Tmem55b :: transmembrane protein 55b down 1.5642 8.762E-04 Bzw2 :: basic leucine zipper and W2 domains 2 down 1.5224 8.762E-04 Mtbp :: Mdm2, transformed 3T3 cell double minute down 1.9629 8.762E-04 p53 binding protein Herpud1 :: homocysteine-inducible, endoplasmic down 1.4125 8.762E-04 reticulum stress-inducible, ubiquitin-like domain member 1 Cep76 :: centrosomal protein 76 down 1.6949 8.834E-04 17420432 down 1.6302 8.913E-04 Cubn :: cubilin (intrinsic factor-cobalamin receptor) down 1.5351 8.913E-04 Rbpj :: recombination signal binding protein for down 1.4511 8.933E-04 immunoglobulin kappa J region 17428864 down 2.0381 8.935E-04 Bmp7 :: bone morphogenetic protein 7 down 1.6642 9.125E-04 Mis18bp1 :: MIS18 binding protein 1 down 2.2037 9.125E-04 0610010F05Rik :: RIKEN cDNA 0610010F05 gene down 1.386 9.125E-04 Neil3 :: nei like 3 (E. coli) down 1.9564 9.131E-04 Prc1 :: protein regulator of cytokinesis 1 down 1.9925 9.206E-04 Poli :: polymerase (DNA directed), iota down 1.6252 9.234E-04 Wdr36 :: WD repeat domain 36 down 1.4064 9.255E-04 Rnf39 :: ring finger protein 39 down 1.5839 9.255E-04 Krt18 :: keratin 18 down 1.4307 9.277E-04 Tpx2 :: TPX2, microtubule-associated protein down 1.8328 9.392E-04 homolog (Xenopus laevis) Sephs2 :: selenophosphate synthetase 2 down 1.6087 9.404E-04 Glud1 :: glutamate dehydrogenase 1 down 1.4023 9.434E-04 259 Appendix A930018M24Rik :: RIKEN cDNA A930018M24 gene down 2.5163 9.510E-04 Cenpn :: centromere protein N down 2.3433 9.515E-04 Gm11543 :: predicted gene 11543 down 1.6154 9.580E-04 Slain1 :: SLAIN motif family, member 1 down 1.6912 9.760E-04 Tmem64 :: transmembrane protein 64 down 1.7551 9.782E-04 Wdr60 :: WD repeat domain 60 down 1.5852 9.913E-04 Nid1 :: nidogen 1 down 1.9811 9.913E-04 Zfp940 :: zinc finger protein 940 down 1.863 9.926E-04 Orc5 :: origin recognition complex, subunit 5 down 1.6563 9.949E-04 Tfb1m :: transcription factor B1, mitochondrial down 1.7891 9.968E-04 Slc19a2 :: solute carrier family 19 (thiamine down 1.7277 1.010E-03 transporter), member 2 Ipmk :: inositol polyphosphate multikinase down 1.5017 1.024E-03 Pkn3 :: protein kinase N3 down 1.5551 1.033E-03 Mpp7 :: membrane protein, palmitoylated 7 (MAGUK down 1.5703 1.033E-03 p55 subfamily member 7) Lipg :: lipase, endothelial down 2.8822 1.043E-03 Cdc25c :: cell division cycle 25C down 2.6541 1.044E-03 17453130 down 1.6539 1.045E-03 Rdh10 :: retinol dehydrogenase 10 (all-trans) down 1.8249 1.048E-03 Cdca3 :: cell division cycle associated 3 down 1.8416 1.059E-03 Wdr74 :: WD repeat domain 74 down 1.5171 1.065E-03 Dkc1 :: dyskeratosis congenita 1, dyskerin homolog down 1.7087 1.066E-03 (human) Zfp599 :: zinc finger protein 599 down 1.4265 1.077E-03 2810468N07Rik :: RIKEN cDNA 2810468N07 gene down 1.9558 1.078E-03 Aim1 :: absent in melanoma 1 down 1.7005 1.089E-03 Lipt2 :: lipoyl(octanoyl) transferase 2 (putative) down 1.5733 1.093E-03 17453126 down 1.8148 1.094E-03 Mettl4 :: methyltransferase like 4 down 1.6154 1.112E-03 2010002N04Rik :: RIKEN cDNA 2010002N04 gene down 1.4346 1.114E-03 Alms1 :: Alstrom syndrome 1 down 1.6736 1.114E-03 Camkk1 :: calcium/calmodulin-dependent protein down 1.5236 1.115E-03 kinase kinase 1, alpha Krt19 :: keratin 19 down 1.9266 1.120E-03 Exoc3l :: exocyst complex component 3-like down 1.607 1.165E-03 Cd24a :: CD24a antigen down 1.5458 1.176E-03 Mrps22 :: mitochondrial ribosomal protein S22 down 1.485 1.176E-03 Mpp6 :: membrane protein, palmitoylated 6 (MAGUK down 1.5058 1.176E-03 p55 subfamily member 6) 17308481 down 1.3805 1.176E-03 Rbl1 :: retinoblastoma-like 1 (p107) down 1.7782 1.176E-03 Nedd1 :: neural precursor cell expressed, down 1.6361 1.176E-03 developmentally down-regulated gene 1 Lsm11 :: U7 snRNP-specific Sm-like protein LSM11 down 1.6957 1.176E-03 Ccdc18 :: coiled-coil domain containing 18 down 2.5009 1.179E-03 Slc35e4 :: solute carrier family 35, member E4 down 1.4806 1.180E-03 Cdk5rap2 :: CDK5 regulatory subunit associated down 1.5838 1.182E-03 protein 2 Lin9 :: lin-9 homolog (C. elegans) down 1.5851 1.182E-03 Suv39h2 :: suppressor of variegation 3-9 homolog 2 down 2.2273 1.197E-03 (Drosophila) 260 Appendix Mfsd2a :: major facilitator superfamily domain down 1.7554 1.201E-03 containing 2A Kif22 :: kinesin family member 22 down 2.3531 1.214E-03 Trib3 :: tribbles homolog 3 (Drosophila) down 2.7424 1.214E-03 Anln :: anillin, actin binding protein down 1.9097 1.214E-03 Ckap5 :: cytoskeleton associated protein 5 down 1.4491 1.214E-03 Slc3a2 :: solute carrier family 3 (activators of dibasic down 1.4234 1.217E-03 and neutral amino acid transport), member 2 Parp16 :: poly (ADP-ribose) polymerase family, down 1.5225 1.217E-03 member 16 Casp2 :: caspase 2 down 1.6211 1.217E-03 Prkar2b :: protein kinase, cAMP dependent down 1.4364 1.223E-03 regulatory, type II beta Gatc :: glutamyl-tRNA(Gln) amidotransferase, down 1.6846 1.229E-03 subunit C homolog (bacterial) Ulk4 :: unc-51-like kinase 4 down 1.8093 1.229E-03 Kcnn4 :: potassium intermediate/small conductance down 1.4941 1.243E-03 calcium-activated channel, subfamily N, member 4 Spin4 :: spindlin family, member 4 down 1.6231 1.243E-03 6720463M24Rik :: RIKEN cDNA 6720463M24 gene down 1.7148 1.251E-03 Mmachc :: methylmalonic aciduria cblC type, with down 1.5293 1.253E-03 homocystinuria Mettl8 :: methyltransferase like 8 down 1.4995 1.255E-03 Cxcr7 :: chemokine (C-X-C motif) receptor 7 down 1.9753 1.255E-03 Cdh10 :: cadherin 10 down 1.7875 1.257E-03 Msh2 :: mutS homolog 2 (E. coli) down 1.6663 1.259E-03 Cenpv :: centromere protein V down 1.4986 1.270E-03 Ppip5k2 :: diphosphoinositol pentakisphosphate down 1.5589 1.270E-03 kinase 2 Polr3g :: polymerase (RNA) III (DNA directed) down 1.4096 1.270E-03 polypeptide G Ept1 :: ethanolaminephosphotransferase 1 (CDP- down 1.4009 1.275E-03 ethanolamine-specific) Slc1a5 :: solute carrier family 1 (neutral amino acid down 1.7424 1.280E-03 transporter), member 5 Depdc1b :: DEP domain containing 1B down 2.1786 1.280E-03 Idh2 :: isocitrate dehydrogenase 2 (NADP+), down 1.4343 1.280E-03 mitochondrial Mbd4 :: methyl-CpG binding domain protein 4 down 1.5319 1.280E-03 Moxd1 :: monooxygenase, DBH-like 1 down 1.6878 1.281E-03 ENSMUST00000082848 :: ncrna:snRNA down 1.7078 1.286E-03 chromosome:NCBIM37:4:49302170:49302275:1 gene:ENSMUSG00000064782 gene_biotype:snRNA transcript_biotype:snRNA Htr5b :: 5-hydroxytryptamine (serotonin) receptor 5B down 1.9098 1.286E-03 Vps4a :: vacuolar protein sorting 4a (yeast) down 1.5143 1.289E-03 Eif4ebp1 :: eukaryotic translation initiation factor 4E down 1.46 1.289E-03 binding protein 1 Nup43 :: nucleoporin 43 down 1.637 1.291E-03 Adat2 :: adenosine deaminase, tRNA-specific 2 down 1.4875 1.293E-03 1700001P01Rik :: RIKEN cDNA 1700001P01 gene down 1.6217 1.294E-03 Tmtc3 :: transmembrane and tetratricopeptide down 1.4767 1.296E-03 261 Appendix repeat containing 3 Fam171a1 :: family with sequence similarity 171, down 1.5517 1.296E-03 member A1 Sass6 :: spindle assembly 6 homolog (C. elegans) down 1.7704 1.296E-03 Grhl2 :: grainyhead-like 2 (Drosophila) down 1.5298 1.296E-03 Zcchc8 :: zinc finger, CCHC domain containing 8 down 1.3794 1.299E-03 2700007P21Rik :: RIKEN cDNA 2700007P21 gene down 1.6117 1.308E-03 Plekha5 :: pleckstrin homology domain containing, down 1.7132 1.308E-03 family A member 5 Cldn12 :: claudin 12 down 1.4039 1.312E-03 Idh1 :: isocitrate dehydrogenase 1 (NADP+), soluble down 2.3155 1.317E-03 Zdhhc2 :: zinc finger, DHHC domain containing 2 down 1.5338 1.347E-03 Gpm6b :: glycoprotein m6b down 1.8246 1.363E-03 Zfp639 :: zinc finger protein 639 down 1.839 1.363E-03 Cep72 :: centrosomal protein 72 down 1.9707 1.363E-03 Nudcd2 :: NudC domain containing 2 down 1.5801 1.369E-03 Tnnt3 :: troponin T3, skeletal, fast down 1.6609 1.396E-03 Casc5 :: cancer susceptibility candidate 5 down 2.03 1.402E-03 2810408B13Rik :: RIKEN cDNA 2810408B13 gene down 1.7292 1.412E-03 Gsto1 :: glutathione S-transferase omega 1 down 1.3601 1.412E-03 Ppp3cc :: protein phosphatase 3, catalytic subunit, down 1.6383 1.428E-03 gamma isoform Artn :: artemin down 2.0141 1.437E-03 Tnfrsf21 :: tumor necrosis factor receptor down 2.1997 1.437E-03 superfamily, member 21 Ndst3 :: N-deacetylase/N-sulfotransferase (heparan down 1.7517 1.443E-03 glucosaminyl) 3 Wdr70 :: WD repeat domain 70 down 1.4373 1.443E-03 Ncaph :: non-SMC condensin I complex, subunit H down 1.8277 1.444E-03 Rtn2 :: reticulon 2 (Z-band associated protein) down 1.5577 1.444E-03 Stil :: Scl/Tal1 interrupting locus down 2.1206 1.444E-03 AI646023 :: expressed sequence AI646023 down 1.3679 1.448E-03 Armcx4 :: armadillo repeat containing, X-linked 4 down 1.4996 1.448E-03 1700066M21Rik :: RIKEN cDNA 1700066M21 gene down 2.0392 1.457E-03 Mre11a :: meiotic recombination 11 homolog A (S. down 1.558 1.459E-03 cerevisiae) Sdcbp2 :: syndecan binding protein (syntenin) 2 down 1.5485 1.459E-03 1500010J02Rik :: RIKEN cDNA 1500010J02 gene down 1.7655 1.460E-03 Cenpk :: centromere protein K down 2.0568 1.461E-03 Zfp280c :: zinc finger protein 280C down 1.6822 1.470E-03 Hist1h2bh :: histone cluster 1, H2bh down 2.9803 1.470E-03 Hmga2 :: high mobility group AT-hook 2 down 1.4069 1.470E-03 Nap1l1 :: nucleosome assembly protein 1-like 1 down 1.4744 1.470E-03 Anp32b :: acidic (leucine-rich) nuclear down 1.3951 1.470E-03 phosphoprotein 32 family, member B Kcnk5 :: potassium channel, subfamily K, member 5 down 2.2249 1.474E-03 Mnd1 :: meiotic nuclear divisions 1 homolog (S. down 2.0323 1.480E-03 cerevisiae) Rbpj :: recombination signal binding protein for down 1.747 1.485E-03 immunoglobulin kappa J region Fyn :: Fyn proto-oncogene down 1.7955 1.510E-03 Lipt1 :: lipoyltransferase 1 down 1.6443 1.510E-03 262 Appendix Mettl7b :: methyltransferase like 7B down 1.4728 1.510E-03 Rttn :: rotatin down 1.7185 1.510E-03 Slc6a9 :: solute carrier family 6 (neurotransmitter down 2.2758 1.513E-03 transporter, glycine), member 9 Gtf2h4 :: general transcription factor II H, down 1.428 1.519E-03 polypeptide 4 Cdkn2aipnl :: CDKN2A interacting protein N-terminal down 1.419 1.520E-03 like AK129341 :: cDNA sequence AK129341 down 2.0825 1.520E-03 Gtpbp10 :: GTP-binding protein 10 (putative) down 1.4721 1.527E-03 Mtap6 :: microtubule-associated protein 6 down 1.3781 1.531E-03 Ibtk :: inhibitor of Bruton agammaglobulinemia down 1.4677 1.534E-03 tyrosine kinase Sacs :: sacsin down 1.671 1.534E-03 Gadd45a :: growth arrest and DNA-damage- down 2.1357 1.534E-03 inducible 45 alpha Tmem138 :: transmembrane protein 138 down 1.9305 1.536E-03 Pola1 :: polymerase (DNA directed), alpha 1 down 1.9541 1.537E-03 Usp44 :: ubiquitin specific peptidase 44 down 1.4467 1.557E-03 Cachd1 :: cache domain containing 1 down 1.4111 1.567E-03 Elovl5 :: ELOVL family member 5, elongation of long down 1.33 1.567E-03 chain fatty acids (yeast) Tead2 :: TEA domain family member 2 down 1.4369 1.569E-03 17428866 down 1.5897 1.570E-03 4632415L05Rik :: RRS1 ribosome biogenesis down 1.6279 1.572E-03 regulator homolog pseudogene C330027C09Rik :: RIKEN cDNA C330027C09 gene down 2.0085 1.588E-03 Ctps2 :: cytidine 5'-triphosphate synthase 2 down 1.6074 1.588E-03 4930558J18Rik :: RIKEN cDNA 4930558J18 gene down 1.4618 1.588E-03 Stard3nl :: STARD3 N-terminal like down 1.5206 1.590E-03 Kif14 :: kinesin family member 14 down 1.9614 1.591E-03 Nipal1 :: NIPA-like domain containing 1 down 1.6097 1.601E-03 Tesk2 :: testis-specific kinase 2 down 1.4915 1.613E-03 Phf6 :: PHD finger protein 6 down 1.4253 1.617E-03 Plscr4 :: phospholipid scramblase 4 down 1.5344 1.623E-03 Eml1 :: echinoderm microtubule associated protein down 1.4108 1.623E-03 like 1 17391486 down 2.0103 1.623E-03 Kif20a :: kinesin family member 20A down 1.9718 1.624E-03 Nadsyn1 :: NAD synthetase 1 down 1.6417 1.646E-03 Spag5 :: sperm associated antigen 5 down 1.9288 1.646E-03 Syde2 :: synapse defective 1, Rho GTPase, down 1.5544 1.646E-03 homolog 2 (C. elegans) Dis3 :: DIS3 mitotic control homolog (S. cerevisiae) down 1.5972 1.646E-03 Psph :: phosphoserine phosphatase down 1.5757 1.646E-03 Ttc39c :: tetratricopeptide repeat domain 39C down 1.3939 1.646E-03 Gtdc1 :: glycosyltransferase-like domain containing down 1.4444 1.647E-03 1 Wee1 :: WEE 1 homolog 1 (S. pombe) down 1.8937 1.656E-03 Xpot :: exportin, tRNA (nuclear export receptor for down 1.9974 1.670E-03 tRNAs) Frmd4a :: FERM domain containing 4A down 1.3938 1.670E-03 263 Appendix Nek1 :: NIMA (never in mitosis gene a)-related down 1.8363 1.678E-03 expressed kinase 1 Mecom :: MDS1 and EVI1 complex locus down 1.8757 1.679E-03 Slc38a2 :: solute carrier family 38, member 2 down 1.3666 1.691E-03 5730419I09Rik :: RIKEN cDNA 5730419I09 gene down 1.4572 1.695E-03 Igsf9 :: immunoglobulin superfamily, member 9 down 1.6133 1.701E-03 Usp43 :: ubiquitin specific peptidase 43 down 1.476 1.701E-03 Efna4 :: ephrin A4 down 1.4449 1.722E-03 Nek2 :: NIMA (never in mitosis gene a)-related down 2.1314 1.722E-03 expressed kinase 2 Adh5 :: alcohol dehydrogenase 5 (class III), chi down 1.3316 1.725E-03 polypeptide Slc9a5 :: solute carrier family 9 (sodium/hydrogen down 1.4454 1.748E-03 exchanger), member 5 Ick :: intestinal cell kinase down 1.6202 1.770E-03 Mkrn2 :: makorin, ring finger protein, 2 down 1.5249 1.775E-03 Poln :: DNA polymerase N down 1.4292 1.787E-03 Prss12 :: protease, serine, 12 neurotrypsin down 1.4962 1.787E-03 (motopsin) Etv5 :: ets variant gene 5 down 1.7928 1.788E-03 Mum1l1 :: melanoma associated antigen (mutated) down 1.9714 1.788E-03 1-like 1 Wrb :: tryptophan rich basic protein down 1.4839 1.788E-03 Mrpl34 :: mitochondrial ribosomal protein L34 down 1.3739 1.789E-03 Myh10 :: myosin, heavy polypeptide 10, non-muscle down 1.4883 1.791E-03 Mcph1 :: microcephaly, primary autosomal recessive down 1.4595 1.794E-03 1 Wdr85 :: WD repeat domain 85 down 1.4787 1.794E-03 Siah1b :: seven in absentia 1B down 1.5885 1.795E-03 ENSMUST00000163646 :: cdna:known down 1.4456 1.802E-03 chromosome:NCBIM37:1:148267564:148268004:1 gene:ENSMUSG00000090323 gene_biotype:protein_coding transcript_biotype:protein_coding Chek2 :: checkpoint kinase 2 down 2.095 1.807E-03 Pcdh18 :: protocadherin 18 down 1.6346 1.807E-03 Ephb2 :: Eph receptor B2 down 1.3847 1.822E-03 17308465 down 1.4516 1.845E-03 Fam175a :: family with sequence similarity 175, down 1.7714 1.856E-03 member A Cenpt :: centromere protein T down 1.4437 1.866E-03 Katnb1 :: katanin p80 (WD40-containing) subunit B 1 down 1.4751 1.869E-03 Kif23 :: kinesin family member 23 down 1.8952 1.873E-03 Rerg :: RAS-like, estrogen-regulated, growth- down 2.0641 1.876E-03 inhibitor Dlc1 :: deleted in liver cancer 1 down 1.3824 1.876E-03 Ing3 :: inhibitor of growth family, member 3 down 1.3794 1.876E-03 A630066F11Rik :: RIKEN cDNA A630066F11 gene down 1.746 1.877E-03 Cenpf :: centromere protein F down 1.9377 1.877E-03 Cenpw :: centromere protein W down 1.9053 1.886E-03 Bub1b :: budding uninhibited by benzimidazoles 1 down 2.0699 1.886E-03 homolog, beta (S. cerevisiae) 264 Appendix Dusp9 :: dual specificity phosphatase 9 down 2.1159 1.906E-03 Dlat :: dihydrolipoamide S-acetyltransferase (E2 down 1.3534 1.921E-03 component of pyruvate dehydrogenase complex) Iars :: isoleucine-tRNA synthetase down 1.4632 1.926E-03 Gnb1l :: guanine nucleotide binding protein (G down 1.7181 1.926E-03 protein), beta polypeptide 1-like 17391447 down 1.6673 1.926E-03 Sash1 :: SAM and SH3 domain containing 1 down 1.6641 1.927E-03 Fbxl8 :: F-box and leucine-rich repeat protein 8 down 1.3315 1.936E-03 Pla2g7 :: phospholipase A2, group VII (platelet- down 2.1466 1.939E-03 activating factor acetylhydrolase, plasma) Fam69b :: family with sequence similarity 69, down 1.4554 1.942E-03 member B Pdlim1 :: PDZ and LIM domain 1 (elfin) down 1.5055 1.943E-03 Slc7a1 :: solute carrier family 7 (cationic amino acid down 1.4242 1.950E-03 transporter, y+ system), member 1 Cdca2 :: cell division cycle associated 2 down 1.8441 1.950E-03 Usp1 :: ubiquitin specific peptidase 1 down 1.6385 1.964E-03 265