DOCSLIB.ORG

Single-Cell RNA-Sequencing-Based Crispri Screening Resolves Molecular Drivers of Early Human Endoderm Development

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Single-Cell RNA-Sequencing-Based Crispri Screening Resolves Molecular Drivers of Early Human Endoderm Development University of Massachusetts Medical School eScholarship@UMMS Open Access Articles Open Access Publications by UMMS Authors 2019-04-16 Single-Cell RNA-Sequencing-Based CRISPRi Screening Resolves Molecular Drivers of Early Human Endoderm Development Ryan M. Genga University of Massachusetts Medical School Et al. Let us know how access to this document benefits ou.y Follow this and additional works at: https://escholarship.umassmed.edu/oapubs Part of the Amino Acids, Peptides, and Proteins Commons, Cell Biology Commons, Cells Commons, Developmental Biology Commons, Embryonic Structures Commons, Genetic Phenomena Commons, and the Nucleic Acids, Nucleotides, and Nucleosides Commons Repository Citation Genga RM, Kernfeld EM, Parsi KM, Parsons TJ, Ziller MJ, Maehr R. (2019). Single-Cell RNA-Sequencing- Based CRISPRi Screening Resolves Molecular Drivers of Early Human Endoderm Development. Open Access Articles. https://doi.org/10.1016/j.celrep.2019.03.076. Retrieved from https://escholarship.umassmed.edu/oapubs/3818 Creative Commons License This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 4.0 License. This material is brought to you by eScholarship@UMMS. It has been accepted for inclusion in Open Access Articles by an authorized administrator of eScholarship@UMMS. For more information, please contact [email protected]. Report Single-Cell RNA-Sequencing-Based CRISPRi Screening Resolves Molecular Drivers of Early Human Endoderm Development Graphical Abstract Authors Ryan M.J. Genga, Eric M. Kernfeld, Krishna M. Parsi, Teagan J. Parsons, Michael J. Ziller, Rene´ Maehr Correspondence [email protected] In Brief Genga et al. utilize a single-cell RNA- sequencing-based CRISPR interference approach to screen transcription factors predicted to have a role in human definitive endoderm differentiation. The perturbation screen identifies an important role of TGFb signaling-related factors. Follow-up of FOXA2 reveals genome-wide molecular changes and altered differentiation competency in endoderm. Highlights d atacTFAP analysis predicts key factors during human ESC differentiation to endoderm d scRNA-seq CRISPRi identifies factors important for human endoderm differentiation d Targeting of the TGFb pathway affects differentiation in a target-specific manner d FOXA2 knockdown causes genome-wide changes and impairs differentiation Genga et al., 2019, Cell Reports 27, 708–718 April 16, 2019 ª 2019 The Author(s). https://doi.org/10.1016/j.celrep.2019.03.076 Cell Reports Report Single-Cell RNA-Sequencing-Based CRISPRi Screening Resolves Molecular Drivers of Early Human Endoderm Development Ryan M.J. Genga,1,3 Eric M. Kernfeld,1,3 Krishna M. Parsi,1 Teagan J. Parsons,1 Michael J. Ziller,2 and Rene´ Maehr1,4,* 1Program in Molecular Medicine, Diabetes Center of Excellence, University of Massachusetts Medical School, Worcester, MA 01605, USA 2Department of Translational Psychiatry, Max Planck Institute of Psychiatry, 80804 Munich, Germany 3These authors contributed equally 4Lead Contact *Correspondence: [email protected] https://doi.org/10.1016/j.celrep.2019.03.076 SUMMARY CRISPR interference (CRISPRi) systems can effectively disrupt gene function in human pluripotent stem cells (Kearns Studies in vertebrates have outlined conserved mo- et al., 2014; Mandegar et al., 2016), with low off-target effects lecular control of definitive endoderm (END) develop- (Gilbert et al., 2014). CRISPRi can also be combined with ment. However, recent work also shows that key droplet-based, single-cell RNA-sequencing (scRNA-seq) read- molecular aspects of human END regulation differ outs (Adamson et al., 2016; Xie et al., 2017), allowing functional even from rodents. Differentiation of human embry- analysis of molecular pathways guiding differentiation while onic stem cells (ESCs) to END offers a tractable sys- balancing resolution and throughput. Here, we predicted candi- date molecular drivers of END differentiation (END-Diff) by tem to study the molecular basis of normal and computationally integrating dynamics of chromatin accessibility defective human-specific END development. Here, and transcriptome-wide changes. To delineate candidate roles, we interrogated dynamics in chromatin accessibility we conducted a parallel scRNA-seq CRISPRi screen to perturb during differentiation of ESCs to END, predicting the factors during END-Diff. We uncover distinct blocks in early DNA-binding proteins that may drive this cell fate human END development mediated by loss of TFs involved in transition. We then combined single-cell RNA-seq transforming growth factor b (TGFb) signaling, while perturbation with parallel CRISPR perturbations to comprehen- of the TF FOXA2 results in an altered differentiation competency sively define the loss-of-function phenotype of those at later stages. factors in END development. Following a few candi- dates, we revealed distinct impairments in the differ- RESULTS entiation trajectories for mediators of TGFb signaling and expose a role for the FOXA2 transcription factor Chromatin Accessibility and Transcriptome Dynamics of in priming human END competence for human fore- END-Diff Using an efficient ESC differentiation platform (Figures S1A and gut and hepatic END specification. Together, this S1B), we compare ESC and END by RNA-seq and assay for single-cell functional genomics study provides transposase-accessible chromatin using sequencing (ATAC- high-resolution insight on human END development. seq) (Figure 1A) revealing 2,905 differentially expressed tran- scripts (Figure S1C; Table S2; false-discovery rate [FDR] < INTRODUCTION 0.01; log fold change R 1.0) and differential chromatin accessi- bility at 34,025 sites (Figures 1B and S1D; Table S2; FDR < 0.05; Human embryonic stem cell (ESC) differentiation strategies to log fold change R 1.0), respectively. Analysis by ATAC-seq tran- generate definitive endoderm (END) allow for interrogation of dif- scription factor activity prediction (atacTFAP) of ESC, END, and ferentiation-associated signaling requirements and chromatin pancreatic beta cells was applied to reveal putative molecular states (D’Amour et al., 2005; Gifford et al., 2013; Loh et al., drivers of END-Diff. While many of the predicted DNA-binding 2014). While various transcription factors (TFs) have been evalu- proteins have been associated with mesendoderm and END for- ated for their role in vertebrate END formation (Zorn and Wells, mation (e.g., GATA4, GATA6, GSC, SOX17, FOXH1, FOXA2, 2009), there are notable species differences in TF requirements OTX2, EOMES, SMAD2, SMAD4 , and MIXL1)(Zorn and Wells, (Shi et al., 2017; Tiyaboonchai et al., 2017; Zhu and Huangfu, 2009), other candidates have not been directly implicated in early 2013). For example, recent loss-of-function analyses revealed END-Diff (e.g., ZBTB33, ESRRA, ZNF410, and E2F6). In total, 50 important roles of TFs, including GATA6 and KLF8, specifically TF candidates were selected for functional follow-up, covering a in human END (Allison et al., 2018; Chu et al., 2016; Tiyaboonchai spectrum of potential facilitators and repressors of human END- et al., 2017), highlighting the need for increased throughput in Diff. Among the 50 candidates, two factors were included that functional analyses of TF dependencies in human. are implicated in structural aspects of chromatin organization 708 Cell Reports 27, 708–718, April 16, 2019 ª 2019 The Author(s). This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). A B 56kb 41kb ATAC-seq Transcription Factor Activity Prediction (atacTFAP) Analysis [0 - 150] [0 - 30] RNA-seq [0 - 6.00] [0 - 6.00] hESC ATAC-seq hESC Signal Motif TF candidate differential enriched TF expressed TFs [0 - 150] [0 - 30] ATAC peaks binding motifs with motif specificity RNA-seq [0 - 6.00] [0 - 6.00] hESC GATA1 GATA4 ATAC-seq hEND hEND hEND GATA2 GATA6 n=34,025 GATA3 DBA score ATAC-Seq 0 10 OCT4 SOX17 C delta atacTFAP atacTFAP −0.04 0 0.04 log2 FC RNAdiff −4.0 0 4.0 YY1 SP1 MNT MAX ZIC3 GSC ATF7 ATF3 E2F6 ELF3 ETV5 USF1 HSF2 PBX2 OTX2 HBP1 CTCF JUND NFYB ARNT PITX2 RARA TGIF2 MIXL1 MLXIP GATA6 GATA4 FOXJ3 SOX17 SOX11 FOXA2 FOXA3 NR5A2 FOXH1 MYBL2 CDC5L FOXQ1 RREB1 CREB3 FOXM1 SMAD2 SMAD4 ESRRA EOMES ZNF263 ZNF410 ZNF143 ZBTB33 NFE2L2 HMBOX1 D EF Scramble gRNA cells in END Deliver SNN clusters (END) Induce Differentiate Run scRNA-seq SNN (percent of cluster) gRNAs Pool dCas9-KRAB to END with gRNA detection cluster x160 0 4% 1 2 3% p < 2.2x10-16 3 versus random 2% allocation mRNA 1% gRNA ESC-AAVS1- 0 TetOn-dCas9-KRAB G 0 END Cluster 123 H Selected genes in END LEFTY2 MIXL1 LEFTY1 SOX17 CXCR4 FZD5 NODAL SOX17 POU5F1 Ln Normalized Expression Max ID1 ID3 POU5F1 ID1 Genes EPCAM 3 0 LHX1 0 MIXL1 CER1 -3 Standardized ln expression Cells (n=16,110) Figure 1. scRNA-Seq CRISPRi Screen Identifies Molecular Drivers of Human END-Diff (A) Representative integrative genomics viewer (IGV) tracks at the OCT4 and SOX17 loci. RNA-seq and ATAC-seq datasets for H1 ESC or END highlight dynamic transcriptome and chromatin changes. (legend continued on next page) Cell Reports 27, 708–718, April 16, 2019 709 (CTCF and YY1) with described roles in the exit of pluripotency to be regulated by TGFb signaling (SOX17)(Alexander and Stain- (Balakrishnan et al., 2012; Weintraub et al., 2017). ier, 1999)(Figures 2A and 2B; Table S3). FOXH1-specific gRNAs are significantly enriched in cluster 1, SMAD2- and SMAD4-spe- Single-Cell CRISPRi Screening Reveals Candidate cific gRNAs are significantly enriched in cluster 2, and SOX17- Regulators of END-Diff specific gRNAs are enriched in cluster 3 (Figure 2B; Table S3). We utilized a lentiviral guide RNA (gRNA) delivery system (Datlin- To see whether any cluster could be interpreted as a differen- ger et al., 2017) together with a gene-targeted H1-AAVS1- tiation block, we characterized a bulk RNA-seq END-Diff time TetOn-dCas9-KRAB ESC line (Figures S1E–S1H) to assay the course of control ESCs (Figure 2C; transcript list curated from transcriptomic effects of atacTFAP candidate repression on literature; Chu et al., 2016; Loh et al., 2014).
Load more

Recommended publications
  • Activated Peripheral-Blood-Derived Mononuclear Cells
    Transcription factor expression in lipopolysaccharide- activated peripheral-blood-derived mononuclear cells Jared C. Roach*†, Kelly D. Smith*‡, Katie L. Strobe*, Stephanie M. Nissen*, Christian D. Haudenschild§, Daixing Zhou§, Thomas J. Vasicek¶, G. A. Heldʈ, Gustavo A. Stolovitzkyʈ, Leroy E. Hood*†, and Alan Aderem* *Institute for Systems Biology, 1441 North 34th Street, Seattle, WA 98103; ‡Department of Pathology, University of Washington, Seattle, WA 98195; §Illumina, 25861 Industrial Boulevard, Hayward, CA 94545; ¶Medtronic, 710 Medtronic Parkway, Minneapolis, MN 55432; and ʈIBM Computational Biology Center, P.O. Box 218, Yorktown Heights, NY 10598 Contributed by Leroy E. Hood, August 21, 2007 (sent for review January 7, 2007) Transcription factors play a key role in integrating and modulating system. In this model system, we activated peripheral-blood-derived biological information. In this study, we comprehensively measured mononuclear cells, which can be loosely termed ‘‘macrophages,’’ the changing abundances of mRNAs over a time course of activation with lipopolysaccharide (LPS). We focused on the precise mea- of human peripheral-blood-derived mononuclear cells (‘‘macro- surement of mRNA concentrations. There is currently no high- phages’’) with lipopolysaccharide. Global and dynamic analysis of throughput technology that can precisely and sensitively measure all transcription factors in response to a physiological stimulus has yet to mRNAs in a system, although such technologies are likely to be be achieved in a human system, and our efforts significantly available in the near future. To demonstrate the potential utility of advanced this goal. We used multiple global high-throughput tech- such technologies, and to motivate their development and encour- nologies for measuring mRNA levels, including massively parallel age their use, we produced data from a combination of two distinct signature sequencing and GeneChip microarrays.
    [Show full text]
  • Single Cell Transcriptomics Reveal Temporal Dynamics of Critical Regulators of Germ Cell Fate During Mouse Sex Determination
    bioRxiv preprint doi: https://doi.org/10.1101/747279; this version posted November 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Single cell transcriptomics reveal temporal dynamics of critical regulators of germ 2 cell fate during mouse sex determination 3 Authors: Chloé Mayère1,2, Yasmine Neirijnck1,3, Pauline Sararols1, Chris M Rands1, 4 Isabelle Stévant1,2, Françoise Kühne1, Anne-Amandine Chassot3, Marie-Christine 5 Chaboissier3, Emmanouil T. Dermitzakis1,2, Serge Nef1,2,*. 6 Affiliations: 7 1Department of Genetic Medicine and Development, University of Geneva, 1211 Geneva, 8 Switzerland; 9 2iGE3, Institute of Genetics and Genomics of Geneva, University of Geneva, 1211 10 Geneva, Switzerland; 11 3Université Côte d'Azur, CNRS, Inserm, iBV, France; 12 Lead Contact: 13 *Corresponding Author: Serge Nef, 1 rue Michel-Servet CH-1211 Genève 4, 14 [email protected]. + 41 (0)22 379 51 93 15 Running Title: Single cell transcriptomics of germ cells 1 bioRxiv preprint doi: https://doi.org/10.1101/747279; this version posted November 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 16 Abbreviations; 17 AGC: Adrenal Germ Cell 18 GC: Germ cell 19 OGC: Ovarian Germ Cell 20 TGC: Testicular Germ Cell 21 scRNA-seq: Single-cell RNA-Sequencing 22 DEG: Differentially Expressed Gene 23 24 25 Keywords: 26 Single-cell RNA-Sequencing (scRNA-seq), sex determination, ovary, testis, gonocytes, 27 oocytes, prospermatogonia, meiosis, gene regulatory network, germ cells, development, 28 RNA splicing 29 2 bioRxiv preprint doi: https://doi.org/10.1101/747279; this version posted November 2, 2020.
    [Show full text]
  • Watsonjn2018.Pdf (1.780Mb)
    UNIVERSITY OF CENTRAL OKLAHOMA Edmond, Oklahoma Department of Biology Investigating Differential Gene Expression in vivo of Cardiac Birth Defects in an Avian Model of Maternal Phenylketonuria A THESIS SUBMITTED TO THE GRADUATE FACULTY In partial fulfillment of the requirements For the degree of MASTER OF SCIENCE IN BIOLOGY By Jamie N. Watson Edmond, OK June 5, 2018 J. Watson/Dr. Nikki Seagraves ii J. Watson/Dr. Nikki Seagraves Acknowledgements It is difficult to articulate the amount of gratitude I have for the support and encouragement I have received throughout my master’s thesis. Many people have added value and support to my life during this time. I am thankful for the education, experience, and friendships I have gained at the University of Central Oklahoma. First, I would like to thank Dr. Nikki Seagraves for her mentorship and friendship. I lucked out when I met her. I have enjoyed working on this project and I am very thankful for her support. I would like thank Thomas Crane for his support and patience throughout my master’s degree. I would like to thank Dr. Shannon Conley for her continued mentorship and support. I would like to thank Liz Bullen and Dr. Eric Howard for their training and help on this project. I would like to thank Kristy Meyer for her friendship and help throughout graduate school. I would like to thank my committee members Dr. Robert Brennan and Dr. Lilian Chooback for their advisement on this project. Also, I would like to thank the biology faculty and staff. I would like to thank the Seagraves lab members: Jailene Canales, Kayley Pate, Mckayla Muse, Grace Thetford, Kody Harvey, Jordan Guffey, and Kayle Patatanian for their hard work and support.
    [Show full text]
  • MYBL2 & E2F1 Protein Protein Interaction Antibody Pair
    MYBL2 & E2F1 Protein Protein Interaction Antibody Pair Catalog # : DI0186 規格 : [ 1 Set ] List All Specification Application Image Product This protein protein interaction antibody pair set comes with two In situ Proximity Ligation Assay (Cell) Description: antibodies to detect the protein-protein interaction, one against the MYBL2 protein, and the other against the E2F1 protein for use in in situ Proximity Ligation Assay. See Publication Reference below. enlarge Reactivity: Human Quality Control Protein protein interaction immunofluorescence result. Testing: Representative image of Proximity Ligation Assay of protein-protein interactions between MYBL2 and E2F1. HeLa cells were stained with anti-MYBL2 rabbit purified polyclonal antibody 1:1200 and anti-E2F1 mouse monoclonal antibody 1:50. Each red dot represents the detection of protein-protein interaction complex. The images were analyzed using an optimized freeware (BlobFinder) download from The Centre for Image Analysis at Uppsala University. Supplied Antibody pair set content: Product: 1. MYBL2 rabbit purified polyclonal antibody (20 ug) 2. E2F1 mouse monoclonal antibody (40 ug) *Reagents are sufficient for at least 30-50 assays using recommended protocols. Storage Store reagents of the antibody pair set at -20°C or lower. Please aliquot Instruction: to avoid repeated freeze thaw cycle. Reagents should be returned to - Page 1 of 4 2016/5/19 20°C storage immediately after use. MSDS: Download Publication Reference 1. An analysis of protein-protein interactions in cross-talk pathways reveals CRKL as a novel prognostic marker in hepatocellular carcinoma. Liu CH, Chen TC, Chau GY, Jan YH, Chen CH, Hsu CN, Lin KT, Juang YL, Lu PJ, Cheng HC, Chen MH, Chang CF, Ting YS, Kao CY, Hsiao M, Huang CY.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • 1 Supplementary Table S1. Primers Used for RT-Qpcr PROX1
    Supplementary Table S1. Primers used for RT-qPCR PROX1 (Prospero Homeobox 1) 5’ – CCAGCTCCAATATGCTGAAGACCTA – 3’ 5’ – CATCGTTGATGGCTTGACGTG – 3‘ MMP-1 (Matrix Metallopeptidase 1) 5' –CTGTCCCTGAACAGCCCAGTACTTA– 3' 5' –CTGGCCACAACTGCCAAATG– 3' FGF2 (Fibroblast Growth Factor 2) 5′ - GGCTTCTTCCTGCGCATCCA – 3′ 5′ – GCTCTTAGCAGACATTGGAAGA – 3′ MMP-3 (Matrix Metallopeptidase 3) GAAATGAGGTACGAGCTGGATACC– 3’ 5’ –ATGGCTGCATCGATTTTCCT– 3’ NUDT6 (Nudix Hydrolase 6) 5’ –GGCGAGCTGGACAGATTC– 3’ 5’ –GCAGCAGGGGCAATAAATCG– 3’ BAIAP2 (BAI1 Associated Protein 2) 5’ –AAGTCCACAGGCAGATCCAG– 3’ 5’ –GCCTTTGCTCCTTTGCTCAG– 3’ VEGFC (Vascular Endothelial Growth 5’ –GCCACGGCTTATGCAAGCAAAGAT– 3’ Factor C) 5’ –AGTTGAGGTTGGCCTGTTCTCTGT– 3’ ANGPT1 (Angiopoietin 1) 5’ –GAAGGGAACCGAGCCTATTC– 3’ 5’ –AGCATCAAACCACCATCCTC– 3’ KDR (Kinase Insert Domain Receptor) 5’ –AGGAGAGCGTGTCTTTGTGG– 3’ 5’ –GCCTGTCTTCAGTTCCCCTC– 3’ VEGFA (Vascular Endothelial Growth 5’ –CTTGCCTTGCTGCTCTACCT– 3’ Factor A) 5’ –AAGATGTCCACCAGGGTCTC– 3’ PLAT (Plasminogen Activator, Tissue 5’ –AGGAGAGCGTGTCTTTGTGG– 3’ Type) 5’ –GCCTGTCTTCAGTTCCCCTC– 3’ MDK (Midkine) 5’ –CCTGCAACTGGAAGAAGGAG– 3’ 5’ -- CTTTCCCTTCCCTTTCTTGG– 3’ ADAMTS9 (ADAM Metallopeptidase 5’ –ACGAAAAACCTGCCGTAATG– 3’ With Thrombospondin Type 1 Motif 9) 5’ –TCAGAGTCTCCATGCACCAG– 3’ TIMP3 (TIMP Metallopeptidase Inhibitor 5’ –CTGACAGGTCGCGTCTATGA– 3’ 3) 5’ –AGTCACAAAGCAAGGCAGGT– 3’ ACTB (Beta Actin) 5’ – GCCGAGGACTTTGATTGC – 3’ 5’– CTGTGTGGACTTGGGAGAG – 3’ 1 Figure S1. Efficient silencing of PROX1 in CGTH-W-1 and FTC-133 cells. Western blotting analysis shows a decrease in PROX1 protein level by targeting with siRNAs purchased from Santa Cruz (SC) and Sigma-Aldrich (SA) in both CGTH-W-1 and FTC-133 cell line. Beta-actin was used as a loading control of protein lysates. Figure S2. The tube formation assay. The silencing of PROX1 in CGTH-W-1 and FTC-133 cells enhances the angiogenesis in vitro of endothelial cells. HUVECs were cultured in 96-well plates coated with a semi-solid Matrigel.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • Subunit Gene Expression Through Smad-Binding and Homeobox Elements
    0888-8809/05/$15.00/0 Molecular Endocrinology 19(10):2610–2623 Printed in U.S.A. Copyright © 2005 by The Endocrine Society doi: 10.1210/me.2005-0047 Activin Regulates Luteinizing Hormone ␤-Subunit Gene Expression through Smad-Binding and Homeobox Elements Djurdjica Coss, Varykina G. Thackray, Chu-Xia Deng, and Pamela L. Mellon Departments of Reproductive Medicine and Neuroscience (D.C., V.G.T., P.L.M.), Center for Reproductive Science and Medicine, University of California, San Diego, La Jolla, California 92093- 0674; and Genetics of Development and Disease Branch (C.-X.D.), National Institute of Diabetes and Downloaded from https://academic.oup.com/mend/article/19/10/2610/2738010 by guest on 23 September 2021 Digestive and Kidney Diseases, National Institutes of Health, Bethesda, Maryland 20892 LH ␤-subunit (LH␤), which is essential for ovulation site found in this region of the promoter. Juxta- and reproductive fitness, is synthesized specifi- posed to the HB are three Smad-binding elements cally in pituitary gonadotropes. In this study, we (SBEs), which are essential for LH␤ induction. In- show that LH␤ gene expression is induced by ac- terestingly, two of the SBEs are also critical for tivin in mouse primary pituitary cells if the cells are basal expression of the LH␤ gene. We demonstrate treated within 24 h after dispersion in culture. Fur- that Smad proteins are necessary and sufficient for thermore, male mice deficient in Smad3, and there- activin induction of the LH␤ gene. Furthermore, fore in activin signaling, have lower expression of Smad proteins can bind one of the identified SBEs.
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • Single Cell Profiling of CRISPR/Cas9-Induced OTX2 Deficient Retinas Reveals Fate Switch from Restricted Progenitors
    bioRxiv preprint doi: https://doi.org/10.1101/538710; this version posted February 2, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Single cell profiling of CRISPR/Cas9-induced OTX2 deficient retinas reveals fate switch from restricted progenitors Miruna G. Ghinia Tegla1, Diego F. Buenaventura1, 2, Diana Y. Kim1, Cassandra Thakurdin1, Kevin C. Gonzalez1, 3, Mark M. Emerson1,2* 1 Department of Biology, The City College of New York, City University of New York, New York, NY, 10031; United States of America 2 Biology Ph.D. Program, Graduate Center, City University of New York, New York, NY, 10031; United States of America 3 Present address: Doctoral Program in Neurobiology and Behavior, Columbia University, New York, NY 10032; United States of America *Corresponding author: [email protected] Email addresses: Miruna G. Ghinia Tegla: [email protected] Diego F. Buenaventura: [email protected] Diana Y. Kim: [email protected] Cassandra Thakurdin: [email protected] Kevin C. Gonzalez: [email protected] Mark M. Emerson: [email protected] Running title: Single cell analysis of retinal cell fate changes induced by OTX2 mutagenesis bioRxiv preprint doi: https://doi.org/10.1101/538710; this version posted February 2, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Development of the vertebrate eye, like many developmental systems, depends on genes that are used iteratively in multiple distinct processes.
    [Show full text]
  • The Structure-Function Relationship of Angular Estrogens and Estrogen Receptor Alpha to Initiate Estrogen-Induced Apoptosis in Breast Cancer Cells S
    Supplemental material to this article can be found at: http://molpharm.aspetjournals.org/content/suppl/2020/05/03/mol.120.119776.DC1 1521-0111/98/1/24–37$35.00 https://doi.org/10.1124/mol.120.119776 MOLECULAR PHARMACOLOGY Mol Pharmacol 98:24–37, July 2020 Copyright ª 2020 The Author(s) This is an open access article distributed under the CC BY Attribution 4.0 International license. The Structure-Function Relationship of Angular Estrogens and Estrogen Receptor Alpha to Initiate Estrogen-Induced Apoptosis in Breast Cancer Cells s Philipp Y. Maximov, Balkees Abderrahman, Yousef M. Hawsawi, Yue Chen, Charles E. Foulds, Antrix Jain, Anna Malovannaya, Ping Fan, Ramona F. Curpan, Ross Han, Sean W. Fanning, Bradley M. Broom, Daniela M. Quintana Rincon, Jeffery A. Greenland, Geoffrey L. Greene, and V. Craig Jordan Downloaded from Departments of Breast Medical Oncology (P.Y.M., B.A., P.F., D.M.Q.R., J.A.G., V.C.J.) and Computational Biology and Bioinformatics (B.M.B.), University of Texas, MD Anderson Cancer Center, Houston, Texas; King Faisal Specialist Hospital and Research (Gen.Org.), Research Center, Jeddah, Kingdom of Saudi Arabia (Y.M.H.); The Ben May Department for Cancer Research, University of Chicago, Chicago, Illinois (R.H., S.W.F., G.L.G.); Center for Precision Environmental Health and Department of Molecular and Cellular Biology (C.E.F.), Mass Spectrometry Proteomics Core (A.J., A.M.), Verna and Marrs McLean Department of Biochemistry and Molecular Biology, Mass Spectrometry Proteomics Core (A.M.), and Dan L. Duncan molpharm.aspetjournals.org
    [Show full text]
  • 1 Supplementary Materials and Methods Plasmids the Pcdna3.1
    Supplementary Materials and Methods Plasmids The pcDNA3.1-CCNE2 (plasmid 19935) was purchased from Addgene (Addgene, Cambridge, MA). The pcDNA3.1-CCNA2 construct was generated by subcloning the full-length CCNA2 from Rc/CMV-CCNA2 (plasmid 8959, Addgene) into the pcDNA3.1 vector (Invitrogen). Establishment of LNCaP stable cell lines LNCaP cells were transfected with the pcDNA3.1-CCNE2 and the pcDNA3.1-CCNA2 constructs. Two days after transfection, cells were selected by G418 for 2 weeks. G418 resistant colonies were picked up and identified by Western Blots analysis. Correlation of FoxA1 cistrome in LNCaP and abl cells with clinical ADPC and CRPC microarray data. abl-specific binding sites (3,862) were defined as those regions with significant FoxA1 binding in abl (MAT-score 1 3.72, equivalent to p-value 0 110-4) while the corresponding binding in LNCaP was insignificant (MAT-score 0 1.28, p-value 1 0.1), whereas LNCaP-specific binding sites (717) were defined the other way around. Common binding sites (14,248) are those regions with significant FoxA1 binding (MAT- score 1 3.72) in both abl and LNCaP. In order to improve signal-to-noise ratio, all the remaining binding sites (grey points in Supplementary Fig. S3A) were not considered in this comparison. As a control, we randomized FoxA1 binding sites by keeping the chromosome and size unchanged while shuffled the genome coordinates using BEDTools 1 (1). Consequently, each group of binding sites has its matched random control, which was used to estimate the background distribution of number of genes associated with FoxA1 binding sites.
    [Show full text]