DOCSLIB.ORG

1 Ligand Concentration (Μμ)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
1 Ligand Concentration (Μμ) ) ( 1 (51) International Patent Classification: (71) Applicant: OBSIDIAN THERAPEUTICS, INC. C12N 9/88 (2006.01) A61K 39/00 (2006.01) [US/US]; 1030 Massachusetts Avenue, Suite 400, Cam- C07K 14/705 (2006.01) bridge, MA 02138 (US). (21) International Application Number: (72) Inventors: SURI, Vipin; 3 Coolidge Road, Belmont, MA PCT/US2020/021596 02478 (US). RICHARDSON, Celeste; 199 Wolcott Road, Brookline, MA 02467 (US). DOLINSKI, Brian; c/o Ob¬ (22) International Filing Date: sidian Therapeutics, Inc., 1030 Massachusetts Avenue, 06 March 2020 (06.03.2020) Suite 400, Cambridge, MA 02138 (US). KULKARNI, Ab- (25) Filing Language: English hishek; 360 Tappan Street #3, Brookline, MA 02445 (US). INNISS, Mara Christine; 11 Highland Ave., Unit 2, Bev¬ (26) Publication Language: English erly, MA 01915 (US). SUN, Dexue; c/o Obsidian Thera¬ (30) Priority Data: peutics, Inc., 1030 Massachusetts Avenue, Suite 400, Cam¬ 62/815,399 08 March 2019 (08.03.2019) US bridge, MA 02138 (US). WEISMAN, Elizabeth Jane; c/ 62/815,402 08 March 2019 (08.03.2019) US o Obsidian Therapeutics, Inc., 1030 Massachusetts Avenue, 62/826,487 29 March 2019 (29.03.2019) US Suite 400, Cambridge, MA 02138 (US). OLINGER, Grace 62/826,443 29 March 2019 (29.03.2019) US Y.; 22 Water Street, #43 1, Cambridge, MA 02141 (US). 62/835,552 18 April 2019 (18.04.2019) US HELLER, Scott Francis; 559 Plain St., Stoughton, MA 62/835,548 18 April 2019 (18.04.2019) US 02072 (US). GORI, Jennifer Leah; 20 Spalding Street, 62/860,388 12 June 2019 (12.06.2019) US Unit 1, Jamaica Plain, MA 02130 (US). OLS, Michelle Lynn; 65 Oak Avenue, Northborough, MA 01532 (US). ELPEK, Kutlu Goksu; c/o Obsidian Therapeutics, Inc., (54) Title: HUMAN CARBONIC ANHYDRASE 2 COMPOSITIONS AND METHODS FOR TUNABLE REGULATION FIGURE 1 Ligand concentration (µΜ) (57) Abstract: The present disclosure provides regulatable biocircuit systems. Such systems provide modular and tunable protein expression systems in support of the discovery and development of therapeutic modalities. In particular, the present application is directed to fusion proteins comprising a fragment of human human carbonic anhydrase 2 and a chimeric antigen receptor (CAR). The activity of the destabilizing domain can be regulated by externally administered agents. [Continued on nextpage] 1030 Massachusets Avenue, Suite 400, Cambridge, MA 02138 (US). EZELL, Tucker; c/o Obsidian Therapeutics, Inc., 1030 Massachusetts Avenue, Suite 400, Cambridge, MA 02138 (US). SCHEBESTA, Michael; c/o Obsidian Therapeutics, Inc., 1030 Massachusetts Avenue, Suite 400, Cambridge, MA 02138 (US). FLEURY, Michelle Lois; 63 Dana Street, Apartment 7, Cambridge, MA 02138 (US). SETHI, Dhruv Kam; 8 1 Burgess Avenue, Westwood, MA 02090 (US). (74) Agent: ALBERDI, Fernando; HonigmanLLP, 650 Trade Centre Way, Suite 200, Kalamazoo, MI 49002-0402 (US). (81) Designated States (unless otherwise indicated, for every kind of national protection available) : AE, AG, AL, AM, AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KH, KN, KP, KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, SC, SD, SE, SG, SK, SL, ST, SV, SY, TH, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, WS, ZA, ZM, ZW. (84) Designated States (unless otherwise indicated, for every kind of regional protection available) : ARIPO (BW, GH, GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, TZ, UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, LV, MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, TR), OAPI (BF, BJ, CF, CG, Cl, CM, GA, GN, GQ, GW, KM, ML, MR, NE, SN, TD, TG). Published: — with international search report (Art. 21(3)) — before the expiration of the time limit for amending the claims and to be republished in the event of receipt of amendments (Rule 48.2(h)) — with sequence listing part of description (Rule 5.2(a)) HUMAN CARBONIC ANHYDRASE 2 COMPOSITIONS AND METHODS FOR TUNABLE REGULATION CROSS REFERENCE TO RELATED APPLICATIONS [0001] This application claims benefit of priority to U.S. Provisional Application No. 62/815,399, filed March 8, 2019; U.S. Provisional Application No. 62/815,402, filed March 8, 2019; U.S. Provisional Application No. 62/826,487, filed March 29, 2019; U.S. Provisional Application No. 62/826,443 filed March 29, 2019; U.S. Provisional Application No. 62/835,548 filed April 18, 2019; U.S. Provisional Application No. 62/835,552, filed April 18, 2019; and U.S. Provisional Application No. 62/860,388, filed June 12, 2019. The entire contents of the aforementioned applications are incorporated herein by reference in their entireties. REFERENCE TO THE SEQUENCE LISTING [0002] The instant application contains a "lengthy" Sequence Listing which has been submitted via CD-R in lieu of a printed paper copy and is hereby incorporated by reference in its entirety. Said CD-R, created and recorded on March 6, 2020, are labeled "CRF", "Copy 1", "Copy 2" "Copy 3," and “Copy 4” respectively, and each contains only one identical 699,270,904 bytes (measured in MS-WINDOWS) file named 268052-462540_SL.txt. The machine-readable format of each CD-R is IBM-PC and the operating system of each compact disc is MS-Windows. FIELD [0003] The present disclosure relates to destabilizing domains (DDs) derived from human carbonic anhydrase 2 (CA2) which can tune protein stability for at least one payload, and compositions and methods of use thereof. Provided in the present disclosure include polypeptides of CA2 biocircuit systems, CA2 effector modules, stimulus response elements (SREs), polynucleotides encoding the same, vectors and cells containing the polypeptides and/or polynucleotides for use in cancer immunotherapy. BACKGROUND [0004] Gene and cell therapies are revolutionizing medicine and offering new promise for the treatment of previously intractable conditions. However, most current technologies do not allow titration of the timing or levels of target protein induction. This has rendered many potential gene and cell therapy applications difficult or impossible to safely and effectively deploy. [0005] Inadequate exogenous and/or endogenous gene control is a critical issue in many gene and cell therapy settings. This lack of tunability also makes it difficult to safely express proteins with narrow or uncertain therapeutic windows or those requiring more titrated or transient expression. [0006] One approach to regulated protein expression or function is the use of Destabilizing Domains (DDs). Destabilizing domains are small protein domains that can be appended to a target protein of interest. DDs render the attached protein of interest unstable in the absence of a DD-binding ligand and the protein of interest is rapidly degraded by the ubiquitin-proteasome system of the cell. However, when a specific small molecule DD-binding ligand binds to the DD, the attached protein of interest is stabilized, and protein function is achieved. [0007] DD technology forms the basis of a new class of cell and gene therapies that can deliver tunable and temporal control of gene expression and function, expanding the universe of protein therapeutics that can be safely and effectively incorporated into cell and gene therapy modalities. SUMMARY [0008] The present disclosure provides novel protein domains derived from human carbonic anhydrase 2 (CA2) displaying small molecule dependent stability. Such protein domains are called destabilizing domains (DDs). In the absence of its binding ligand, the DD is destabilizing and causes degradation of a payload fused to the DD (e.g., a protein of interest (POI), while in the presence of its binding ligand, the fused DD and payload can be stabilized, and its stability is dose dependent. [0009] In a first aspect, the present disclosure provides a composition comprising an effector module. The effector module comprises a stimulus response element (SRE) and at least one payload which is operably linked to the SRE. In various embodiments, the SRE comprises a destabilizing domain (DD), wherein the DD comprises a region of or the whole human carbonic anhydrase 2 (CA2; SEQ ID NO. 11717), and further comprises a H122Y mutation in the amino acid at position 122 (H122) of SEQ ID NO. 11717. [0010] In a second aspect, the present disclosure provides a composition comprising an effector module. The effector module comprises a stimulus response element (SRE) and at least one payload which is operably linked to the SRE. In various embodiments, the SRE comprises a destabilizing domain (DD), wherein the DD comprises a region of or the whole human carbonic anhydrase 2 (CA2; SEQ ID NO. 11717), and further comprises a E106D mutation in the amino acid at position 106 (E106) of SEQ ID NO. 11717. [0011] In a third aspect of the present disclosure, a composition comprising an effector module is provided. The effector module comprises a stimulus response element (SRE) and at least one payload which is operably linked to the SRE. In various embodiments, the SRE comprises a destabilizing domain (DD), wherein the DD comprises a region of or the whole human carbonic anhydrase 2 (CA2; SEQ ID NO. 11717), and further comprises a W208S mutation in the amino acid at position 208 (W208) of SEQ ID NO. 11717. [0012] In a fourth aspect of the present disclosure, a composition comprising an effector module is provided.
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Association Analyses of Known Genetic Variants with Gene
    ASSOCIATION ANALYSES OF KNOWN GENETIC VARIANTS WITH GENE EXPRESSION IN BRAIN by Viktoriya Strumba A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Bioinformatics) in The University of Michigan 2009 Doctoral Committee: Professor Margit Burmeister, Chair Professor Huda Akil Professor Brian D. Athey Assistant Professor Zhaohui S. Qin Research Statistician Thomas Blackwell To Sam and Valentina Dmitriy and Elizabeth ii ACKNOWLEDGEMENTS I would like to thank my advisor Professor Margit Burmeister, who tirelessly guided me though seemingly impassable corridors of graduate work. Throughout my thesis writing period she provided sound advice, encouragement and inspiration. Leading by example, her enthusiasm and dedication have been instrumental in my path to becoming a better scientist. I also would like to thank my co-advisor Tom Blackwell. His careful prodding always kept me on my toes and looking for answers, which taught me the depth of careful statistical analysis. His diligence and dedication have been irreplaceable in most difficult of projects. I also would like to thank my other committee members: Huda Akil, Brian Athey and Steve Qin as well as David States. You did not make it easy for me, but I thank you for believing and not giving up. Huda’s eloquence in every subject matter she explained have been particularly inspiring, while both Huda’s and Brian’s valuable advice made the completion of this dissertation possible. I would also like to thank all the members of the Burmeister lab, both past and present: Sandra Villafuerte, Kristine Ito, Cindy Schoen, Karen Majczenko, Ellen Schmidt, Randi Burns, Gang Su, Nan Xiang and Ana Progovac.
    [Show full text]
  • Recombinant Human Carbonic Anhydrase XIII Protein Catalog Number: ATGP3059
    Recombinant human Carbonic Anhydrase XIII protein Catalog Number: ATGP3059 PRODUCT INPORMATION Expression system E.coli Domain 1-262aa UniProt No. Q8N1Q1 NCBI Accession No. NP_940986.1 Alternative Names Carbonic anhydrase 13, CAXIII PRODUCT SPECIFICATION Molecular Weight 31.8 kDa (285aa) confirmed by MALDI-TOF Concentration 0.5mg/ml (determined by Bradford assay) Formulation Liquid in. Phosphate-Buffered Saline (pH 7.4) containing 10% glycerol, 1mM DTT Purity > 90% by SDS-PAGE Biological Activity Specific activity is > 2,500pmol/min/ug, and is defined as the amount of enzyme that hydrolyze 1.0pmole of 4- nitrophenyl acetate to 4-nitrophenol per minute at pH 7.5 at 37C. Tag His-Tag Application SDS-PAGE, Enzyme Activity Storage Condition Can be stored at +2C to +8C for 1 week. For long term storage, aliquot and store at -20C to -80C. Avoid repeated freezing and thawing cycles. BACKGROUND Description CA13 also known as carbonic anhydrase 13 belongs to the alpha-carbonic anhydrase family. The carbonic anhydrase from a family of enzymes that catalyze the rapid interconversion of carbon dioxide and water to bicarbonate and protons, a reversible reaction that occurs relatively slowly in the absence of catalyst. The active 1 Recombinant human Carbonic Anhydrase XIII protein Catalog Number: ATGP3059 site of most carbonic anhydrases contains a zinc ion; they are claasified as metalloenzymes. There are at least five distinct CA families (alpha, beta, gamma, delta, and epsilon). These families have no significant amino acid sequence similarity and in most cases are thought to be an example of convergent evolution. The alpha-CAs are found in humans.
    [Show full text]
  • Table 2. Significant
    Table 2. Significant (Q < 0.05 and |d | > 0.5) transcripts from the meta-analysis Gene Chr Mb Gene Name Affy ProbeSet cDNA_IDs d HAP/LAP d HAP/LAP d d IS Average d Ztest P values Q-value Symbol ID (study #5) 1 2 STS B2m 2 122 beta-2 microglobulin 1452428_a_at AI848245 1.75334941 4 3.2 4 3.2316485 1.07398E-09 5.69E-08 Man2b1 8 84.4 mannosidase 2, alpha B1 1416340_a_at H4049B01 3.75722111 3.87309653 2.1 1.6 2.84852656 5.32443E-07 1.58E-05 1110032A03Rik 9 50.9 RIKEN cDNA 1110032A03 gene 1417211_a_at H4035E05 4 1.66015788 4 1.7 2.82772795 2.94266E-05 0.000527 NA 9 48.5 --- 1456111_at 3.43701477 1.85785922 4 2 2.8237185 9.97969E-08 3.48E-06 Scn4b 9 45.3 Sodium channel, type IV, beta 1434008_at AI844796 3.79536664 1.63774235 3.3 2.3 2.75319499 1.48057E-08 6.21E-07 polypeptide Gadd45gip1 8 84.1 RIKEN cDNA 2310040G17 gene 1417619_at 4 3.38875643 1.4 2 2.69163229 8.84279E-06 0.0001904 BC056474 15 12.1 Mus musculus cDNA clone 1424117_at H3030A06 3.95752801 2.42838452 1.9 2.2 2.62132809 1.3344E-08 5.66E-07 MGC:67360 IMAGE:6823629, complete cds NA 4 153 guanine nucleotide binding protein, 1454696_at -3.46081884 -4 -1.3 -1.6 -2.6026947 8.58458E-05 0.0012617 beta 1 Gnb1 4 153 guanine nucleotide binding protein, 1417432_a_at H3094D02 -3.13334396 -4 -1.6 -1.7 -2.5946297 1.04542E-05 0.0002202 beta 1 Gadd45gip1 8 84.1 RAD23a homolog (S.
    [Show full text]
  • Classification of Medicinal Drugs and Driving: Co-Ordination and Synthesis Report
    Project No. TREN-05-FP6TR-S07.61320-518404-DRUID DRUID Driving under the Influence of Drugs, Alcohol and Medicines Integrated Project 1.6. Sustainable Development, Global Change and Ecosystem 1.6.2: Sustainable Surface Transport 6th Framework Programme Deliverable 4.4.1 Classification of medicinal drugs and driving: Co-ordination and synthesis report. Due date of deliverable: 21.07.2011 Actual submission date: 21.07.2011 Revision date: 21.07.2011 Start date of project: 15.10.2006 Duration: 48 months Organisation name of lead contractor for this deliverable: UVA Revision 0.0 Project co-funded by the European Commission within the Sixth Framework Programme (2002-2006) Dissemination Level PU Public PP Restricted to other programme participants (including the Commission x Services) RE Restricted to a group specified by the consortium (including the Commission Services) CO Confidential, only for members of the consortium (including the Commission Services) DRUID 6th Framework Programme Deliverable D.4.4.1 Classification of medicinal drugs and driving: Co-ordination and synthesis report. Page 1 of 243 Classification of medicinal drugs and driving: Co-ordination and synthesis report. Authors Trinidad Gómez-Talegón, Inmaculada Fierro, M. Carmen Del Río, F. Javier Álvarez (UVa, University of Valladolid, Spain) Partners - Silvia Ravera, Susana Monteiro, Han de Gier (RUGPha, University of Groningen, the Netherlands) - Gertrude Van der Linden, Sara-Ann Legrand, Kristof Pil, Alain Verstraete (UGent, Ghent University, Belgium) - Michel Mallaret, Charles Mercier-Guyon, Isabelle Mercier-Guyon (UGren, University of Grenoble, Centre Regional de Pharmacovigilance, France) - Katerina Touliou (CERT-HIT, Centre for Research and Technology Hellas, Greece) - Michael Hei βing (BASt, Bundesanstalt für Straßenwesen, Germany).
    [Show full text]
  • Steroid-Dependent Regulation of the Oviduct: a Cross-Species Transcriptomal Analysis
    University of Kentucky UKnowledge Theses and Dissertations--Animal and Food Sciences Animal and Food Sciences 2015 Steroid-dependent regulation of the oviduct: A cross-species transcriptomal analysis Katheryn L. Cerny University of Kentucky, [email protected] Right click to open a feedback form in a new tab to let us know how this document benefits ou.y Recommended Citation Cerny, Katheryn L., "Steroid-dependent regulation of the oviduct: A cross-species transcriptomal analysis" (2015). Theses and Dissertations--Animal and Food Sciences. 49. https://uknowledge.uky.edu/animalsci_etds/49 This Doctoral Dissertation is brought to you for free and open access by the Animal and Food Sciences at UKnowledge. It has been accepted for inclusion in Theses and Dissertations--Animal and Food Sciences by an authorized administrator of UKnowledge. For more information, please contact [email protected]. STUDENT AGREEMENT: I represent that my thesis or dissertation and abstract are my original work. Proper attribution has been given to all outside sources. I understand that I am solely responsible for obtaining any needed copyright permissions. I have obtained needed written permission statement(s) from the owner(s) of each third-party copyrighted matter to be included in my work, allowing electronic distribution (if such use is not permitted by the fair use doctrine) which will be submitted to UKnowledge as Additional File. I hereby grant to The University of Kentucky and its agents the irrevocable, non-exclusive, and royalty-free license to archive and make accessible my work in whole or in part in all forms of media, now or hereafter known.
    [Show full text]
  • P-Glycoprotein-Mediated Chemoresistance Is Reversed by Carbonic Anhydrase XII Inhibitors
    www.impactjournals.com/oncotarget/ Oncotarget, Advance Publications 2016 P-glycoprotein-mediated chemoresistance is reversed by carbonic anhydrase XII inhibitors Joanna Kopecka1, Gregory M. Rankin2, Iris C. Salaroglio1, Sally-Ann Poulsen2,*, Chiara Riganti1,* 1Department of Oncology, University of Torino, 10126 Torino, Italy 2Eskitis Institute for Drug Discovery, Griffith University, Brisbane, Nathan, Queensland, 4111, Australia *These authors contributed equally to this work Correspondence to: Sally-Ann Poulsen, email: [email protected] Chiara Riganti, email: [email protected] Keywords: carbonic anhydrase XII, P-glycoprotein, doxorubicin, chemoresistance, intracellular pH Received: August 26, 2016 Accepted: October 28, 2016 Published: November 03, 2016 ABSTRACT Carbonic anhydrase XII (CAXII) is a membrane enzyme that maintains pH homeostasis and sustains optimum P-glycoprotein (Pgp) efflux activity in cancer cells. Here, we investigated a panel of eight CAXII inhibitors (compounds 1–8), for their potential to reverse Pgp mediated tumor cell chemoresistance. Inhibitors (5 nM) were screened in human and murine cancer cells (colon, lung, breast, bone) with different expression levels of CAXII and Pgp. We identified three CAXII inhibitors (compounds 1, 2 and 4) that significantly (≥ 2 fold) increased the intracellular retention of the Pgp-substrate and chemotherapeutic doxorubicin, and restored its cytotoxic activity. The inhibitors lowered intracellular pH to indirectly impair Pgp activity. Ca12-knockout assays confirmed that the chemosensitizing property of the compounds was dependent on active CAXII. Furthermore, in a preclinical model of drug-resistant breast tumors compound 1 (1900 ng/kg) restored the efficacy of doxorubicin to the same extent as the direct Pgp inhibitor tariquidar. The expression of carbonic anhydrase IX had no effect on the intracellular doxorubicin accumulation.
    [Show full text]
  • PHARMACEUTICAL APPENDIX to the TARIFF SCHEDULE 2 Table 1
    Harmonized Tariff Schedule of the United States (2020) Revision 19 Annotated for Statistical Reporting Purposes PHARMACEUTICAL APPENDIX TO THE HARMONIZED TARIFF SCHEDULE Harmonized Tariff Schedule of the United States (2020) Revision 19 Annotated for Statistical Reporting Purposes PHARMACEUTICAL APPENDIX TO THE TARIFF SCHEDULE 2 Table 1. This table enumerates products described by International Non-proprietary Names INN which shall be entered free of duty under general note 13 to the tariff schedule. The Chemical Abstracts Service CAS registry numbers also set forth in this table are included to assist in the identification of the products concerned. For purposes of the tariff schedule, any references to a product enumerated in this table includes such product by whatever name known.
    [Show full text]
  • High-Throughput Screening Studies of Inhibition of Human Carbonic Anhydrase II and Bacterial Flagella Antimicrobial Activity
    Western Michigan University ScholarWorks at WMU Dissertations Graduate College 5-2010 High-Throughput Screening Studies of Inhibition of Human Carbonic Anhydrase II and Bacterial Flagella Antimicrobial Activity Albert A. Barrese III Western Michigan University Follow this and additional works at: https://scholarworks.wmich.edu/dissertations Part of the Biochemistry, Biophysics, and Structural Biology Commons, and the Biology Commons Recommended Citation Barrese, Albert A. III, "High-Throughput Screening Studies of Inhibition of Human Carbonic Anhydrase II and Bacterial Flagella Antimicrobial Activity" (2010). Dissertations. 500. https://scholarworks.wmich.edu/dissertations/500 This Dissertation-Open Access is brought to you for free and open access by the Graduate College at ScholarWorks at WMU. It has been accepted for inclusion in Dissertations by an authorized administrator of ScholarWorks at WMU. For more information, please contact [email protected]. HIGH-THROUGHPUT SCREENING STUDIES OF INHIBITION OF HUMAN CARBONIC ANHYDRASE II AND BACTERIAL FLAGELLA ANTIMICROBIAL ACTIVITY by Albert A. Barrese III A Dissertation Submitted to the Faculty of The Graduate College in partial fulfillment of the requirements for the Degree of Doctor of Philosophy Department of Biological Sciences Advisor: Brian C. Tripp, Ph.D. Western Michigan University Kalamazoo, Michigan May 2010 UMI Number: 3410393 All rights reserved INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted. In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if material had to be removed, a note will indicate the deletion. UMT Dissertation Publishing UMI 3410393 Copyright 2010 by ProQuest LLC.
    [Show full text]
  • Treatment of Pulmonary Hypertension with Carbonic Anhydrase Inhibitors in Combination with a Sympathomimetic Amine
    (19) TZZ _Z9B_T (11) EP 2 167 099 B1 (12) EUROPEAN PATENT SPECIFICATION (45) Date of publication and mention (51) Int Cl.: of the grant of the patent: A61K 31/7048 (2006.01) A61K 31/137 (2006.01) 17.10.2012 Bulletin 2012/42 A61K 31/423 (2006.01) A61K 31/433 (2006.01) A61K 45/06 (2006.01) A61P 9/12 (2006.01) (2006.01) (21) Application number: 08767969.2 A61P 11/00 (22) Date of filing: 30.05.2008 (86) International application number: PCT/US2008/006850 (87) International publication number: WO 2008/156550 (24.12.2008 Gazette 2008/52) (54) TREATMENT OF PULMONARY HYPERTENSION WITH CARBONIC ANHYDRASE INHIBITORS IN COMBINATION WITH A SYMPATHOMIMETIC AMINE BEHANLDUNG VON PULMONALER HYPERTONIE MIT CARBONSÄUREANHYDRASE- INHIBITOREN IN KOMBINATION MIT EINEM SYMPATHOMIMETISCHEN AMIN TRAITEMENT DE L’HYPERTENSION PULMONAIRE AVEC DES INHIBITEURS DE L’ANHYDRASE CARBONIQUE (84) Designated Contracting States: •TAM,Peter AT BE BG CH CY CZ DE DK EE ES FI FR GB GR Redwood City, CA 94061 (US) HR HU IE IS IT LI LT LU LV MC MT NL NO PL PT • WILSON, Leland RO SE SI SK TR Menlo Park, CA 94025 (US) • PETERSON, Craig (30) Priority: 13.06.2007 US 818306 Mountain View, CA 94040 (US) (43) Date of publication of application: (74) Representative: Finnie, Isobel Lara et al 31.03.2010 Bulletin 2010/13 Mintz Levin Cohn Ferris Glovsky and Popeo Intellectual Property LLP (60) Divisional application: Alder Castle 12172276.3 / 2 500 024 10 Noble Street London (73) Proprietor: Vivus, Inc. EC2V 7JX (GB) Mountain View, CA 94040 (US) (56) References cited: (72) Inventors: WO-A-00/76493 WO-A-2006/063078 • NAJARIAN, Thomas WO-A-2007/084290 WO-A-2008/060963 Los Osos, CA 93402 (US) Note: Within nine months of the publication of the mention of the grant of the European patent in the European Patent Bulletin, any person may give notice to the European Patent Office of opposition to that patent, in accordance with the Implementing Regulations.
    [Show full text]
  • Quantigene Flowrna Probe Sets Currently Available
    QuantiGene FlowRNA Probe Sets Currently Available Accession No. Species Symbol Gene Name Catalog No. NM_003452 Human ZNF189 zinc finger protein 189 VA1-10009 NM_000057 Human BLM Bloom syndrome VA1-10010 NM_005269 Human GLI glioma-associated oncogene homolog (zinc finger protein) VA1-10011 NM_002614 Human PDZK1 PDZ domain containing 1 VA1-10015 NM_003225 Human TFF1 Trefoil factor 1 (breast cancer, estrogen-inducible sequence expressed in) VA1-10016 NM_002276 Human KRT19 keratin 19 VA1-10022 NM_002659 Human PLAUR plasminogen activator, urokinase receptor VA1-10025 NM_017669 Human ERCC6L excision repair cross-complementing rodent repair deficiency, complementation group 6-like VA1-10029 NM_017699 Human SIDT1 SID1 transmembrane family, member 1 VA1-10032 NM_000077 Human CDKN2A cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) VA1-10040 NM_003150 Human STAT3 signal transducer and activator of transcripton 3 (acute-phase response factor) VA1-10046 NM_004707 Human ATG12 ATG12 autophagy related 12 homolog (S. cerevisiae) VA1-10047 NM_000737 Human CGB chorionic gonadotropin, beta polypeptide VA1-10048 NM_001017420 Human ESCO2 establishment of cohesion 1 homolog 2 (S. cerevisiae) VA1-10050 NM_197978 Human HEMGN hemogen VA1-10051 NM_001738 Human CA1 Carbonic anhydrase I VA1-10052 NM_000184 Human HBG2 Hemoglobin, gamma G VA1-10053 NM_005330 Human HBE1 Hemoglobin, epsilon 1 VA1-10054 NR_003367 Human PVT1 Pvt1 oncogene homolog (mouse) VA1-10061 NM_000454 Human SOD1 Superoxide dismutase 1, soluble (amyotrophic lateral sclerosis 1 (adult))
    [Show full text]
  • Partial Agreement in the Social and Public Health Field
    COUNCIL OF EUROPE COMMITTEE OF MINISTERS (PARTIAL AGREEMENT IN THE SOCIAL AND PUBLIC HEALTH FIELD) RESOLUTION AP (88) 2 ON THE CLASSIFICATION OF MEDICINES WHICH ARE OBTAINABLE ONLY ON MEDICAL PRESCRIPTION (Adopted by the Committee of Ministers on 22 September 1988 at the 419th meeting of the Ministers' Deputies, and superseding Resolution AP (82) 2) AND APPENDIX I Alphabetical list of medicines adopted by the Public Health Committee (Partial Agreement) updated to 1 July 1988 APPENDIX II Pharmaco-therapeutic classification of medicines appearing in the alphabetical list in Appendix I updated to 1 July 1988 RESOLUTION AP (88) 2 ON THE CLASSIFICATION OF MEDICINES WHICH ARE OBTAINABLE ONLY ON MEDICAL PRESCRIPTION (superseding Resolution AP (82) 2) (Adopted by the Committee of Ministers on 22 September 1988 at the 419th meeting of the Ministers' Deputies) The Representatives on the Committee of Ministers of Belgium, France, the Federal Republic of Germany, Italy, Luxembourg, the Netherlands and the United Kingdom of Great Britain and Northern Ireland, these states being parties to the Partial Agreement in the social and public health field, and the Representatives of Austria, Denmark, Ireland, Spain and Switzerland, states which have participated in the public health activities carried out within the above-mentioned Partial Agreement since 1 October 1974, 2 April 1968, 23 September 1969, 21 April 1988 and 5 May 1964, respectively, Considering that the aim of the Council of Europe is to achieve greater unity between its members and that this
    [Show full text]