Elucidating the Role of Keratin 17 in Cervical Carcinogenesis
Total Page:16
File Type:pdf, Size:1020Kb

Load more
Recommended publications
-
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
Identification of Novel Pathways That Promote Anoikis Through Genome-Wide Screens
University of Massachusetts Medical School eScholarship@UMMS GSBS Dissertations and Theses Graduate School of Biomedical Sciences 2016-10-14 Identification of Novel Pathways that Promote Anoikis through Genome-wide Screens Victoria E. Pedanou University of Massachusetts Medical School Let us know how access to this document benefits ou.y Follow this and additional works at: https://escholarship.umassmed.edu/gsbs_diss Part of the Biology Commons, and the Cancer Biology Commons Repository Citation Pedanou VE. (2016). Identification of Novel Pathways that Promote Anoikis through Genome-wide Screens. GSBS Dissertations and Theses. https://doi.org/10.13028/M27G6D. Retrieved from https://escholarship.umassmed.edu/gsbs_diss/889 This material is brought to you by eScholarship@UMMS. It has been accepted for inclusion in GSBS Dissertations and Theses by an authorized administrator of eScholarship@UMMS. For more information, please contact [email protected]. i TITLE PAGE IDENTIFICATION OF NOVEL PATHWAYS THAT PROMOTE ANOIKIS THROUGH GENOME-WIDE SCREENS A Dissertation Presented By VICTORIA ELIZABETH PEDANOU Submitted to the Faculty of the University of Massachusetts Graduate School of Biomedical Sciences, Worcester in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY OCTOBER 14TH, 2016 CANCER BIOLOGY ii SIGNATURE PAGE IDENTIFICATION OF NOVEL PATHWAYS THAT PROMOTE ANOIKIS THROUGH GENOME-WIDE SCREENS A Dissertation Presented By VICTORIA ELIZABETH PEDANOU This work was undertaken in the Graduate School of Biomedical Sciences Cancer Biology The signature of the Thesis Advisor signifies validation of Dissertation content ___________________________ Michael R. Green, Thesis Advisor The signatures of the Dissertation Defense Committee signify completion and approval as to style and content of the Dissertation __________________________________ Eric H. -
Supplementary Materials
1 Supplementary Materials: Supplemental Figure 1. Gene expression profiles of kidneys in the Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice. (A) A heat map of microarray data show the genes that significantly changed up to 2 fold compared between Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice (N=4 mice per group; p<0.05). Data show in log2 (sample/wild-type). 2 Supplemental Figure 2. Sting signaling is essential for immuno-phenotypes of the Fcgr2b-/-lupus mice. (A-C) Flow cytometry analysis of splenocytes isolated from wild-type, Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice at the age of 6-7 months (N= 13-14 per group). Data shown in the percentage of (A) CD4+ ICOS+ cells, (B) B220+ I-Ab+ cells and (C) CD138+ cells. Data show as mean ± SEM (*p < 0.05, **p<0.01 and ***p<0.001). 3 Supplemental Figure 3. Phenotypes of Sting activated dendritic cells. (A) Representative of western blot analysis from immunoprecipitation with Sting of Fcgr2b-/- mice (N= 4). The band was shown in STING protein of activated BMDC with DMXAA at 0, 3 and 6 hr. and phosphorylation of STING at Ser357. (B) Mass spectra of phosphorylation of STING at Ser357 of activated BMDC from Fcgr2b-/- mice after stimulated with DMXAA for 3 hour and followed by immunoprecipitation with STING. (C) Sting-activated BMDC were co-cultured with LYN inhibitor PP2 and analyzed by flow cytometry, which showed the mean fluorescence intensity (MFI) of IAb expressing DC (N = 3 mice per group). 4 Supplemental Table 1. Lists of up and down of regulated proteins Accession No. -
Investigation of Candidate Genes and Mechanisms Underlying Obesity
Prashanth et al. BMC Endocrine Disorders (2021) 21:80 https://doi.org/10.1186/s12902-021-00718-5 RESEARCH ARTICLE Open Access Investigation of candidate genes and mechanisms underlying obesity associated type 2 diabetes mellitus using bioinformatics analysis and screening of small drug molecules G. Prashanth1 , Basavaraj Vastrad2 , Anandkumar Tengli3 , Chanabasayya Vastrad4* and Iranna Kotturshetti5 Abstract Background: Obesity associated type 2 diabetes mellitus is a metabolic disorder ; however, the etiology of obesity associated type 2 diabetes mellitus remains largely unknown. There is an urgent need to further broaden the understanding of the molecular mechanism associated in obesity associated type 2 diabetes mellitus. Methods: To screen the differentially expressed genes (DEGs) that might play essential roles in obesity associated type 2 diabetes mellitus, the publicly available expression profiling by high throughput sequencing data (GSE143319) was downloaded and screened for DEGs. Then, Gene Ontology (GO) and REACTOME pathway enrichment analysis were performed. The protein - protein interaction network, miRNA - target genes regulatory network and TF-target gene regulatory network were constructed and analyzed for identification of hub and target genes. The hub genes were validated by receiver operating characteristic (ROC) curve analysis and RT- PCR analysis. Finally, a molecular docking study was performed on over expressed proteins to predict the target small drug molecules. Results: A total of 820 DEGs were identified between -
Cellular and Molecular Signatures in the Disease Tissue of Early
Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of -
Table S1. the Clinicopathological Data of the Laryngeal Cancer Cases Involved in the Primary Tissue Culture
Table S1. The clinicopathological data of the laryngeal cancer cases involved in the primary tissue culture Case Gender Age at Smoking Alcohol Histological type TNM Tumor coding* diagnosis status status staging† differentiation LC01 male 63 Yes Yes Supraglottic squamous cell carcinoma T4N2M0 Moderate LC14 male 73 Yes Yes Supraglottic squamous cell carcinoma T3N2M0 Moderate LC53 male 54 Yes No Supraglottic squamous cell carcinoma T3N2M0 Moderate LC95 male 50 Yes Yes Glottic squmamous cell carcinoma T3N1M0 Poor *LC represents laryngeal cancer. † staged according to Sixth Edition (2002) of the AJCC-UICC TNM Staging System. Table S2. The clinical characteristics of the 149 patients with laryngeal SCC used for ELISA Variable N (%) Variable N(%) Age (years) Disease stage ≤55 58 (38.9) I 33 (22.1) >55 91 (61.1) II 32 (21.5) Median (range) 58 (35-82) III 41 (27.5) IV 41 (27.5) Missing 2 (1.3) Gender T stage* Male 140 (94.0) T1 33 (21.5) Female 9 (6.0) T2 36 (24.2) T3 52 (34.9) T4 26 (17.4) Missing 2 (1.3) Smoking status Lymph node status Ever 124 (83.2) pN0 110 (73.8) Never 11 (7.4) pN+ 37 (24.8) Missing 14 (9.4) Missing 2 (1.3) Alcohol status Tumor differentiation Yes 84 (56.4) well 34 (22.8) No 51(34.2) moderate 78 (52.3) Missing 14 (9.4) poor 24 (16.1) Missing 13 (8.7) Anatomical region Glottis 82 (55.0) Supraglottis 60 (40.3) Subglottis 1 (0.7) Missing 6 (4.0) *staged according to Sixth Edition (2002) of the AJCC-UICC TNM Staging System. -
140503 IPF Signatures Supplement Withfigs Thorax
Supplementary material for Heterogeneous gene expression signatures correspond to distinct lung pathologies and biomarkers of disease severity in idiopathic pulmonary fibrosis Daryle J. DePianto1*, Sanjay Chandriani1⌘*, Alexander R. Abbas1, Guiquan Jia1, Elsa N. N’Diaye1, Patrick Caplazi1, Steven E. Kauder1, Sabyasachi Biswas1, Satyajit K. Karnik1#, Connie Ha1, Zora Modrusan1, Michael A. Matthay2, Jasleen Kukreja3, Harold R. Collard2, Jackson G. Egen1, Paul J. Wolters2§, and Joseph R. Arron1§ 1Genentech Research and Early Development, South San Francisco, CA 2Department of Medicine, University of California, San Francisco, CA 3Department of Surgery, University of California, San Francisco, CA ⌘Current address: Novartis Institutes for Biomedical Research, Emeryville, CA. #Current address: Gilead Sciences, Foster City, CA. *DJD and SC contributed equally to this manuscript §PJW and JRA co-directed this project Address correspondence to Paul J. Wolters, MD University of California, San Francisco Department of Medicine Box 0111 San Francisco, CA 94143-0111 [email protected] or Joseph R. Arron, MD, PhD Genentech, Inc. MS 231C 1 DNA Way South San Francisco, CA 94080 [email protected] 1 METHODS Human lung tissue samples Tissues were obtained at UCSF from clinical samples from IPF patients at the time of biopsy or lung transplantation. All patients were seen at UCSF and the diagnosis of IPF was established through multidisciplinary review of clinical, radiological, and pathological data according to criteria established by the consensus classification of the American Thoracic Society (ATS) and European Respiratory Society (ERS), Japanese Respiratory Society (JRS), and the Latin American Thoracic Association (ALAT) (ref. 5 in main text). Non-diseased normal lung tissues were procured from lungs not used by the Northern California Transplant Donor Network. -
Method of Prognosing Cancers Verfahren Zur Prognose Von Krebsarten Procédé De Prognostic Des Cancers
(19) TZZ Z _T (11) EP 2 295 602 B1 (12) EUROPEAN PATENT SPECIFICATION (45) Date of publication and mention (51) Int Cl.: of the grant of the patent: G01N 33/574 (2006.01) C12Q 1/68 (2006.01) 11.07.2012 Bulletin 2012/28 (21) Application number: 10178350.4 (22) Date of filing: 26.07.2006 (54) Method of prognosing cancers Verfahren zur Prognose von Krebsarten Procédé de prognostic des cancers (84) Designated Contracting States: • KIHARA C ET AL: "Prediction of sensitivity of AT BE BG CH CY CZ DE DK EE ES FI FR GB GR esophageal tumors to adjuvant chemotherapy by HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI cDNA microarray analysis of gene-expression SK TR profiles", CANCER RESEARCH, AMERICAN ASSOCIATION FOR CANCER RESEARCH, (30) Priority: 27.07.2005 US 703263 P BALTIMORE, MD, US, vol. 61, no. 17, September 2001 (2001-09), pages 6474-6479, XP002960719, (43) Date of publication of application: ISSN: 0008-5472 16.03.2011 Bulletin 2011/11 • PORTE H ET AL: "Overexpression of stromelysin-3, BM-40/SPARC, and MET genes in (62) Document number(s) of the earlier application(s) in human esophageal carcinoma: implications for accordance with Art. 76 EPC: prognosis.", CLINICAL CANCER RESEARCH : 06782211.4 / 1 907 582 AN OFFICIAL JOURNAL OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH. JUN (73) Proprietor: Oncotherapy Science, Inc. 1998, vol. 4, no. 6, June 1998 (1998-06), pages Kawasaki-shi 1375-1382, XP002407525, ISSN: 1078-0432 Kanagawa 213-0012 (JP) • "Affimetrix GeneChip Human Genome U133 Array Set HG-U133A", GEO, 11 March 2002 (72) Inventors: (2002-03-11), XP002254749, • Nakamura, Yusuke • WIGLE DENNIS A ET AL: "Molecular profiling of Tokyo 1138654 (JP) non-small cell lung cancer and correlation with • Daigo, Yataro disease-free survival", CANCER RESEARCH, Tokyo 1138654 (JP) AMERICAN ASSOCIATION FOR CANCER • Nakatsuru, Shuichi REREARCH, US, vol. -
ITRAQ-Based Quantitative Proteomic Analysis of Processed Euphorbia Lathyris L
Zhang et al. Proteome Science (2018) 16:8 https://doi.org/10.1186/s12953-018-0136-6 RESEARCH Open Access ITRAQ-based quantitative proteomic analysis of processed Euphorbia lathyris L. for reducing the intestinal toxicity Yu Zhang1, Yingzi Wang1*, Shaojing Li2*, Xiuting Zhang1, Wenhua Li1, Shengxiu Luo1, Zhenyang Sun1 and Ruijie Nie1 Abstract Background: Euphorbia lathyris L., a Traditional Chinese medicine (TCM), is commonly used for the treatment of hydropsy, ascites, constipation, amenorrhea, and scabies. Semen Euphorbiae Pulveratum, which is another type of Euphorbia lathyris that is commonly used in TCM practice and is obtained by removing the oil from the seed that is called paozhi, has been known to ease diarrhea. Whereas, the mechanisms of reducing intestinal toxicity have not been clearly investigated yet. Methods: In this study, the isobaric tags for relative and absolute quantitation (iTRAQ) in combination with the liquid chromatography-tandem mass spectrometry (LC-MS/MS) proteomic method was applied to investigate the effects of Euphorbia lathyris L. on the protein expression involved in intestinal metabolism, in order to illustrate the potential attenuated mechanism of Euphorbia lathyris L. processing. Differentially expressed proteins (DEPs) in the intestine after treated with Semen Euphorbiae (SE), Semen Euphorbiae Pulveratum (SEP) and Euphorbiae Factor 1 (EFL1) were identified. The bioinformatics analysis including GO analysis, pathway analysis, and network analysis were done to analyze the key metabolic pathways underlying the attenuation mechanism through protein network in diarrhea. Western blot were performed to validate selected protein and the related pathways. Results: A number of differentially expressed proteins that may be associated with intestinal inflammation were identified. -
75 2. INTRODUCTION Triple-Negative Breast Cancer (TNBC)
[Frontiers in Bioscience, Scholar, 11, 75-88, March 1, 2019] The persisting puzzle of racial disparity in triple negative breast cancer: looking through a new lens Chakravarthy Garlapati1, Shriya Joshi1, Bikram Sahoo1, Shobhna Kapoor2, Ritu Aneja1 1Department of Biology, Georgia State University, Atlanta, GA, USA, 2Department of Chemistry, Indian Institute of Technology Bombay, Powai, India TABLE OF CONTENTS 1. Abstract 2. Introduction 3. Dissecting the TNBC racially disparate burden 3.1. Does race influence TNBC onset and progression? 3.2. Tumor microenvironment in TNBC and racial disparity 3.3. Differential gene signatures and pathways in racially distinct TNBC 3.4. Our Perspective: Looking racial disparity through a new lens 4. Conclusion 5. Acknowledgement 6. References 1. ABSTRACT 2. INTRODUCTION Triple-negative breast cancer (TNBC) Triple-negative breast cancer (TNBC), is characterized by the absence of estrogen a subtype of breast cancer (BC), accounts for and progesterone receptors and absence 15-20% of all BC diagnoses in the US. It has of amplification of human epidermal growth been recognized that women of African descent factor receptor (HER2). This disease has no are twice as likely to develop TNBC than approved treatment with a poor prognosis women of European descent (1). As the name particularly in African-American (AA) as foretells, TNBCs lack estrogen, progesterone, compared to European-American (EA) and human epidermal growth factor receptors. patients. Gene ontology analysis showed Unfortunately, TNBCs are defined by what they specific gene pathways that are differentially “lack” rather than what they “have” and thus this regulated and gene signatures that are negative nomenclature provides no actionable differentially expressed in AA as compared to information on “druggable” targets. -
The Role of Inherited Keratin Variants in Liver Disease Development
Department of Internal Medicine I, University Hospital Ulm Prof. Dr. Seufferlein The Role of Inherited Keratin Variants in Liver Disease Development Dissertation presented to the Medical Faculty of Ulm University to obtain the degree Doctor of Human Biology Özlem Kücükoglu From Gaziantep, Turkey 2013 Current Dean: Prof. Dr. Thomas Wirth Thesis reviewers: 1st reviewer: PD. Dr. Pavel Strnad 2nd reviewer: Prof. Dr. biol. hum. Uwe Knippschild Date of doctorate awarded: May 3, 2013 Parts of this dissertation have been published in the following journal article: Strnad P*, Kucukoglu O*, Lunova M, Guldiken N, Lienau TC, Stickel F, Omary MB., “Non-Coding Keratin Variants Associate With Liver Fibrosis Progression in Patients With Hemochromatosis” PloS One 2012;7(3). *These authors contributed equally to this work TABLE OF CONTENTS ABBREVIATIONS............................................................................................................IV 1. INTRODUCTION .......................................................................................................... 1 1.1. THE COMPOSITION AND FUNCTION OF CYTOSKELETON ......................................... 1 1.2. INTERMEDIATE FILAMENTS AND THEIR DISEASE ASSOCIATION ............................. 2 1.3. KERATINS............................................................................................................. 5 1.4. FUNCTION OF KERATINS: ...................................................................................... 5 1.5. REGULATION OF KERATINS (POSTTRANSLATIONAL MODIFICATIONS -
The Correlation of Keratin Expression with In-Vitro Epithelial Cell Line Differentiation
The correlation of keratin expression with in-vitro epithelial cell line differentiation Deeqo Aden Thesis submitted to the University of London for Degree of Master of Philosophy (MPhil) Supervisors: Professor Ian. C. Mackenzie Professor Farida Fortune Centre for Clinical and Diagnostic Oral Science Barts and The London School of Medicine and Dentistry Queen Mary, University of London 2009 Contents Content pages ……………………………………………………………………......2 Abstract………………………………………………………………………….........6 Acknowledgements and Declaration……………………………………………...…7 List of Figures…………………………………………………………………………8 List of Tables………………………………………………………………………...12 Abbreviations….………………………………………………………………..…...14 Chapter 1: Literature review 16 1.1 Structure and function of the Oral Mucosa……………..…………….…..............17 1.2 Maintenance of the oral cavity...……………………………………….................20 1.2.1 Environmental Factors which damage the Oral Mucosa………. ….…………..21 1.3 Structure and function of the Oral Mucosa ………………...….……….………...21 1.3.1 Skin Barrier Formation………………………………………………….……...22 1.4 Comparison of Oral Mucosa and Skin…………………………………….……...24 1.5 Developmental and Experimental Models used in Oral mucosa and Skin...……..28 1.6 Keratinocytes…………………………………………………….….....................29 1.6.1 Desmosomes…………………………………………….…...............................29 1.6.2 Hemidesmosomes……………………………………….…...............................30 1.6.3 Tight Junctions………………………….……………….…...............................32 1.6.4 Gap Junctions………………………….……………….….................................32