DOCSLIB.ORG

<I>Moorella Thermoacetica</I>

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
<I>Moorella Thermoacetica</I> 1392 Journal of Food Protection, Vol. 78, No. 7, 2015, Pages 1392–1396 doi:10.4315/0362-028X.JFP-14-547 Copyright ©, International Association for Food Protection Research Note Detection and Quantification of Thermophilic Spore-Forming Moorella thermoacetica in Canned Beverages Using Real-Time PCR MIYO NAKANO* Division of Food Science, Toyo Institute of Food Technology, 23-2, 4-chome, Minami-hanayashiki, Kawanishi, Hyogo 666-0026, Japan Downloaded from http://meridian.allenpress.com/jfp/article-pdf/78/7/1392/1683743/0362-028x_jfp-14-547.pdf by guest on 29 September 2021 MS 14-547: Received 19 November 2014/Accepted 5 March 2015 ABSTRACT A quantitative real-time PCR assay was developed to specifically detect and quantify Moorella thermoacetica and/or Moorella thermoautotrophica from canned coffee beverages. Six different combinations of newly designed primers were examined, and primer pair v1-1F/v4R was found to specifically amplify M. thermoacetica and M. thermoautotrophica. The minimum detection sensitivity was 15 fg of pure culture DNA from M. thermoacetica. Twenty commercial canned coffee beverages were then screened for the presence of M. thermoacetica, and two were shown to contain >1.3 and >1.0 CFU/ml, respectively. Therefore, the assay developed in this study may be useful for accurately tracking and quantifying M. thermoacetica and M. thermoautotrophica in beverage samples. One of the most heat-resistant bacterial species, Moor- assessment. High concentrations of emulsifiers also cause ella thermoacetica, whose spores can survive autoclaving, deterioration in qualities such as flavor. has a decimal reduction time of 23 to 111 min at 121°C, To explore the distribution of M. thermoacetica in depending on sporulation conditions (3). Thermophilic, canned beverages and their original ingredients and enable spore-forming bacteria, later characterized as M. thermoace- a microbial risk assessment during industrial processing, a tica, were detected in the 1970s in Japan in hot vending rapid and sensitive microbial detection technique is needed machines serving canned coffee with milk, soup, and “shir- to complement existing methods. Traditional culture-based uko” (sweet beverage made from azuki bean powder), all of methods require multiple culture steps to achieve isolation, which were maintained at 55 to 60°C (8, 10, 22). This spe- which makes them time consuming, and they are not always cies has also been associated with the spoilage of canned successful if bacteria that are present fail to grow. Real-time food in other countries (1, 14). These contaminants result PCR-based identification and quantification is a suitable in strong acidification, abnormal odors and colors, pH alternative because it is comparatively easy, rapid, and has decrease, and separation and coagulation of milk compo- a high level of sensitivity. To date, this technique has not nents (8, 23). To guarantee microbiological stability, an been developed for the detection of M. thermoacetica.In additional heat treatment step was added to commercial this study, we developed a real-time PCR assay for the iden- food sterilization processes by many manufacturers; how- tification and enumeration of the most frequently isolated ever, this is a costly operation in terms of energy and its thermophilic spoilage bacterium, M. thermoacetica. The impact on the organoleptic quality and nutritional value of assay was used to screen commercial canned coffee bev- the product (15). erages in parallel with traditional culture techniques to detect To avoid food spoilage caused by germination of con- and quantify M. thermoacetica. taminating bacterial spores, hydrophobic food emulsifiers, such as sucrose monopalmitate and sucrose monooleate, have been used commercially in the food and beverage MATERIALS AND METHODS industries, to remarkable effect (9, 11, 19). The ingredients PCR primer design. The 16S rRNA gene of M. thermoacetica of many canned drink products, including starch, carbohy- JCM 9319 was chosen as the target for amplification. An alignment drates, and skim milk, inhibit the bacteriostatic effects of of the 16S rRNA gene sequences from M. thermoacetica and other fatty acid ester-type emulsifiers (2). Consequently, large related species belonging to the family Thermoanaerobacteriaceae, amounts of emulsifiers are often used, accounting for such as Caldanaerobacter, Tepianaerobacter,andThermoanaero- product variability, without a quantitative microbial risk monas species, along with nonrelated taxa, was performed using ClustalX (20). Overall, sequences from 170 bacterial species were obtained from the GenBank nucleotide database at the National Cen- * Author for correspondence. Tel: +81-72-740-3300; Fax: +81-72-758- ter for Biotechnology Information (http://www.ncbi.nlm.nih.gov/ 6934; E-mail: [email protected]. genbank/) and from the National Institute of Technology and J. Food Prot., Vol. 78, No. 7 DETECTION AND QUANTIFICATION OF M. THERMOACETICA 1393 TABLE 1. Real-time PCR specificity test of designed primers using representative strains Result of amplification with indicated primer combination (amplicon size [bp])b v1-1F/v3R v1-2F/v3R v1-1F/v4R v1-2F/v4R v3F-v4R v4F/v5R Species Strain and sourcea (161) (133) (436) (405) (296) (204) Moorella thermoacetica JCM 9319T ++++++ (ATCC 35608) Moorella thermoacetica JCM 9320T ++++++ (ATCC 39073) Moorella thermoacetica 24-1 (our collection) + + + + + + Moorella glycerini DSM 11254T ++−−+ − Moorella humiferrea DSM 23265T − + −−+ − Moorella mulderi DSM 14980T ++− + −− Moorella stamsii DSM 26217T − + −−−− Moorella thermoautotrophica DSM 1974T ++++++ Moorella perchloratireducens ATCC BAA-1531 − + −−−− Downloaded from http://meridian.allenpress.com/jfp/article-pdf/78/7/1392/1683743/0362-028x_jfp-14-547.pdf by guest on 29 September 2021 Ammonifex sp. NBRC 100904 −−−−−− Caldanaerobacter subterraneus NBRC 100824T − + −−−− subsp. tengcongensis Carboxydothermus pertinax NBRC 107576T −−−−−− (DSM 23698) Tepidanaerobacter syntrophicus NBRC 100060T −−−−−− (DSM 15584) Thermoaneromonas toyohensis NBRC 101528T − + − + −− (DSM 14490) Thermanaerobacter cellulolyticus NBRC 14436 −−−−−− Clostridium acetobutylicum NBRC 13948T −−−−−− (ATCC 824) Clostridium clariflavum NBRC 101661T − + −−−− (DSM 19732) Clostridium kluyveri NBRC 12016T ++− + −− (DSM 555) Clostridium thermocellum NBRC 103400T −−−−−− (ATCC 27405) Bacillus subtilis NBRC 13719T −−−+ −− (ATCC 6051) Bacillus coagulans ATCC 80078 + + −−−− Bacilus licheniformis NBRC 12200T − + −−−− (ATCC 14580) Paenibacillus polymyxa NBRC 15309T ++−−−− (ATCC 842) Geobacillus stearothermophilus NBRC 12550T −−−−−− (ATCC 12980) Staphylococcus aureus NBRC 100910T −−−−−− (ATCC 12600) Escherichia coli NBRC 102203T −−−−−− (ATCC 11775) a A designation in parentheses is the corresponding designation in an alternative collection. T, type strain; NBRC, NITE Biological Resource Center (Kisarazu, Chiba, Japan); ATCC, American Type Culture Collection (Manassas, VA); DSM, German Collection of Microorganisms and Cell Cultures (Braunschweig, Germany). b Forward primers are as follows: v1-1F, CAAGTCGAGCGGTCTTTAATTG; v1-2F, CTTCGGATGGAACCGATTAAAG; v3F, TACGGGAGGCATCTTCTGTAG; and v4F, CGAAGTCTTAAAGGCGAATAGC. Reverse primers are as follows: v3R, TACAGAA- GATGCCTCCCGTAGA; v4R, AGGCTATTCGCCTTTAAGACTTC; and v5R, AAGCCCGGCAGTTTCAAAT; +, positive real-time PCR result; −, negative real-time PCR result. Evaluation Biological Resource Center (http://www.nbrc.nite.go.jp/e/). were incubated at 55 to 60°C in modified TGC medium (mTGC Based on the alignment, nine specific primers were selected, using medium; Nissui Pharmaceutical Co., Tokyo, Japan) with an Anae- Primer3Plus (http://www.bioinformatics.nl/cgi-bin/primer3plus/ roPack (Mitsubishi Gas Chemical Company, Tokyo, Japan) in a primer3plus.cgi (21)). Primer sequences are listed in footnote b container. Trypticase soy broth (BD, LePont de Claix, France) of Table 1. was used to grow other nonrelated bacterial species. Bacterial strains and culture conditions. A total of 26 Extraction of bacterial genomic DNA. For the real-time strains from 24 bacterial species, including three M. thermoacetica PCR assay, M. thermoacetica JCM 9319 was used to produce stan- strains and strains of other close and distant genera, listed in Table dard curves. M. thermoacetica was grown until the culture reached 1, were used for primer specificity studies. Strains were obtained an optical density at 600 nm (OD600) of 0.3 to 0.4 (approximately from various culture collections (Table 1) and maintained in the 1 Â 108 CFU/ml). Genomic DNA was extracted using an Ultra laboratory according to the reference information. Moorella species clean DNA isolation kit (MO BIO Laboratories, Carlsbad, CA) 1394 NAKANO J. Food Prot., Vol. 78, No. 7 Downloaded from http://meridian.allenpress.com/jfp/article-pdf/78/7/1392/1683743/0362-028x_jfp-14-547.pdf by guest on 29 September 2021 FIGURE 1. Schematic of the experimental procedure for DNA extraction used for conventional PCR and real-time PCR analysis, and culture methods for M. thermoacetica from canned coffee beverage samples. following the manufacturer’s instructions, with a minor modifica- washed three times with 1Â phosphate-buffered saline (pH 7.4). tion for extraction of DNA from spores (17). Microbial genomic Next, 1 ml of M. thermoacetica microbial cell suspension (OD600 DNA was extracted as illustrated in Figure 1. Then, genomic of 0.3 to 0.4) was serially diluted (108 to 101 CFU/ml) and then DNA concentrations were determined using a spectrophotometer
Load more

Recommended publications
  • Supplementary Information
    doi: 10.1038/nature06269 SUPPLEMENTARY INFORMATION METAGENOMIC AND FUNCTIONAL ANALYSIS OF HINDGUT MICROBIOTA OF A WOOD FEEDING HIGHER TERMITE TABLE OF CONTENTS MATERIALS AND METHODS 2 • Glycoside hydrolase catalytic domains and carbohydrate binding modules used in searches that are not represented by Pfam HMMs 5 SUPPLEMENTARY TABLES • Table S1. Non-parametric diversity estimators 8 • Table S2. Estimates of gross community structure based on sequence composition binning, and conserved single copy gene phylogenies 8 • Table S3. Summary of numbers glycosyl hydrolases (GHs) and carbon-binding modules (CBMs) discovered in the P3 luminal microbiota 9 • Table S4. Summary of glycosyl hydrolases, their binning information, and activity screening results 13 • Table S5. Comparison of abundance of glycosyl hydrolases in different single organism genomes and metagenome datasets 17 • Table S6. Comparison of abundance of glycosyl hydrolases in different single organism genomes (continued) 20 • Table S7. Phylogenetic characterization of the termite gut metagenome sequence dataset, based on compositional phylogenetic analysis 23 • Table S8. Counts of genes classified to COGs corresponding to different hydrogenase families 24 • Table S9. Fe-only hydrogenases (COG4624, large subunit, C-terminal domain) identified in the P3 luminal microbiota. 25 • Table S10. Gene clusters overrepresented in termite P3 luminal microbiota versus soil, ocean and human gut metagenome datasets. 29 • Table S11. Operational taxonomic unit (OTU) representatives of 16S rRNA sequences obtained from the P3 luminal fluid of Nasutitermes spp. 30 SUPPLEMENTARY FIGURES • Fig. S1. Phylogenetic identification of termite host species 38 • Fig. S2. Accumulation curves of 16S rRNA genes obtained from the P3 luminal microbiota 39 • Fig. S3. Phylogenetic diversity of P3 luminal microbiota within the phylum Spirocheates 40 • Fig.
    [Show full text]
  • EXPERIMENTAL STUDIES on FERMENTATIVE FIRMICUTES from ANOXIC ENVIRONMENTS: ISOLATION, EVOLUTION, and THEIR GEOCHEMICAL IMPACTS By
    EXPERIMENTAL STUDIES ON FERMENTATIVE FIRMICUTES FROM ANOXIC ENVIRONMENTS: ISOLATION, EVOLUTION, AND THEIR GEOCHEMICAL IMPACTS By JESSICA KEE EUN CHOI A dissertation submitted to the School of Graduate Studies Rutgers, The State University of New Jersey In partial fulfillment of the requirements For the degree of Doctor of Philosophy Graduate Program in Microbial Biology Written under the direction of Nathan Yee And approved by _______________________________________________________ _______________________________________________________ _______________________________________________________ _______________________________________________________ New Brunswick, New Jersey October 2017 ABSTRACT OF THE DISSERTATION Experimental studies on fermentative Firmicutes from anoxic environments: isolation, evolution and their geochemical impacts by JESSICA KEE EUN CHOI Dissertation director: Nathan Yee Fermentative microorganisms from the bacterial phylum Firmicutes are quite ubiquitous in subsurface environments and play an important biogeochemical role. For instance, fermenters have the ability to take complex molecules and break them into simpler compounds that serve as growth substrates for other organisms. The research presented here focuses on two groups of fermentative Firmicutes, one from the genus Clostridium and the other from the class Negativicutes. Clostridium species are well-known fermenters. Laboratory studies done so far have also displayed the capability to reduce Fe(III), yet the mechanism of this activity has not been investigated
    [Show full text]
  • Process Performance and Microbial Community Structure in Thermophilic Trickling Biofilter Reactors for Biogas Upgrading
    Downloaded from orbit.dtu.dk on: Sep 24, 2021 Process performance and microbial community structure in thermophilic trickling biofilter reactors for biogas upgrading Porté, Hugo; Kougias, Panagiotis ; Alfaro, Natalia; Treu, Laura; Campanaro, Stefano; Angelidaki, Irini Published in: Science of the Total Environment Link to article, DOI: 10.1016/j.scitotenv.2018.11.289 Publication date: 2019 Document Version Peer reviewed version Link back to DTU Orbit Citation (APA): Porté, H., Kougias, P., Alfaro, N., Treu, L., Campanaro, S., & Angelidaki, I. (2019). Process performance and microbial community structure in thermophilic trickling biofilter reactors for biogas upgrading. Science of the Total Environment, 655, 529-538. https://doi.org/10.1016/j.scitotenv.2018.11.289 General rights Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. Users may download and print one copy of any publication from the public portal for the purpose of private study or research. You may not further distribute the material or use it for any profit-making activity or commercial gain You may freely distribute the URL identifying the publication in the public portal If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim. 1 Process performance and microbial community 2 structure in thermophilic trickling biofilter reactors for 3 biogas upgrading 4 5 Hugo Portéa+, Panagiotis G.
    [Show full text]
  • Genome-Based Comparison of All Species of the Genus Moorella, and Status of the Species Moorella Thermoacetica and Moorella Thermoautotrophica
    Downloaded from orbit.dtu.dk on: Oct 09, 2021 Genome-Based Comparison of All Species of the Genus Moorella, and Status of the Species Moorella thermoacetica and Moorella thermoautotrophica Redl, Stephanie Maria Anna; Poehlein, Anja; Esser, Carola; Bengelsdorf, Frank R.; Jensen, Torbjørn Ølshøj; Jendresen, Christian Bille; Tindall, Brian J.; Daniel, Rolf; Dürre, Peter; Nielsen, Alex Toftgaard Published in: Frontiers in Microbiology Link to article, DOI: 10.3389/fmicb.2019.03070 Publication date: 2020 Document Version Publisher's PDF, also known as Version of record Link back to DTU Orbit Citation (APA): Redl, S. M. A., Poehlein, A., Esser, C., Bengelsdorf, F. R., Jensen, T. Ø., Jendresen, C. B., Tindall, B. J., Daniel, R., Dürre, P., & Nielsen, A. T. (2020). Genome-Based Comparison of All Species of the Genus Moorella, and Status of the Species Moorella thermoacetica and Moorella thermoautotrophica. Frontiers in Microbiology, 10, [3070]. https://doi.org/10.3389/fmicb.2019.03070 General rights Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. Users may download and print one copy of any publication from the public portal for the purpose of private study or research. You may not further distribute the material or use it for any profit-making activity or commercial gain You may freely distribute the URL identifying the publication in the public portal If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim.
    [Show full text]
  • A Novel Cellulolytic, Anaerobic, and Thermophilic Bacterium, Moorella Sp
    Biosci. Biotechnol. Biochem., 67 (1), 183–185, 2003 Note A Novel Cellulolytic, Anaerobic, and Thermophilic Bacterium, Moorella sp. Strain F21 Shuichi KARITA,1,† Kengo NAKAYAMA,1 Masakazu GOTO,1 Kazuo SAKKA,1 Wan-Jae KIM,1 and Satoru OGAWA2 1Department of Sustainable Resource Science, Faculty of Bioresources, and 2Laboratory of Electron Microscope, School of Medicine, Mie University, Tsu 514-8507, Japan Received June 24, 2002; Accepted September 9, 2002 A cellulolytic and thermophilic anaerobe was isolated and fermenting cellulosic materials to organic acids from soil. This bacterium made a halo on a roll-tube was isolated. In this paper, we identiˆed the strain culture containing Avicel. Analysis of the PCR-based using DNA sequencing of the 16S rRNA coding 16S rRNA gene sequence showed that the bacterium was region and studied the enzyme activities and ferment- closely related to Moorella thermoacetica.Scanning ed products from the strain. electron microscopy showed the bacterium is a rod and Cellulolytic anaerobic bacteria were isolated in has no protuberant structure on the surface of cells anaerobic culture by the roll-tube method. The cul- growing on cellulose, suggesting that this strain is a non- ture medium for isolation was GS medium3) contain- cellulosomal cellulolytic bacterium. Carboxymethyl cel- ing Avicel as the sole carbon source. The bacteria lulase and xylanase activities were detected in the culture were grown at 609Cfor1week.Bacteriamaking broth. A major fermentation product from ball-milled haloes around their colonies were isolated as cellulo- cellulose was acetate. This strain has a potential to con- lyticanaerobes.Thesebacteriawerecultivatedwith vert cellulosic biomass to acetate, directly.
    [Show full text]
  • Genome Diversity of Spore-Forming Firmicutes MICHAEL Y
    Genome Diversity of Spore-Forming Firmicutes MICHAEL Y. GALPERIN National Center for Biotechnology Information, National Library of Medicine, National Institutes of Health, Bethesda, MD 20894 ABSTRACT Formation of heat-resistant endospores is a specific Vibrio subtilis (and also Vibrio bacillus), Ferdinand Cohn property of the members of the phylum Firmicutes (low-G+C assigned it to the genus Bacillus and family Bacillaceae, Gram-positive bacteria). It is found in representatives of four specifically noting the existence of heat-sensitive vegeta- different classes of Firmicutes, Bacilli, Clostridia, Erysipelotrichia, tive cells and heat-resistant endospores (see reference 1). and Negativicutes, which all encode similar sets of core sporulation fi proteins. Each of these classes also includes non-spore-forming Soon after that, Robert Koch identi ed Bacillus anthracis organisms that sometimes belong to the same genus or even as the causative agent of anthrax in cattle and the species as their spore-forming relatives. This chapter reviews the endospores as a means of the propagation of this orga- diversity of the members of phylum Firmicutes, its current taxon- nism among its hosts. In subsequent studies, the ability to omy, and the status of genome-sequencing projects for various form endospores, the specific purple staining by crystal subgroups within the phylum. It also discusses the evolution of the violet-iodine (Gram-positive staining, reflecting the pres- Firmicutes from their apparently spore-forming common ancestor ence of a thick peptidoglycan layer and the absence of and the independent loss of sporulation genes in several different lineages (staphylococci, streptococci, listeria, lactobacilli, an outer membrane), and the relatively low (typically ruminococci) in the course of their adaptation to the saprophytic less than 50%) molar fraction of guanine and cytosine lifestyle in a nutrient-rich environment.
    [Show full text]
  • Supplement of Biogeosciences, 16, 4229–4241, 2019 © Author(S) 2019
    Supplement of Biogeosciences, 16, 4229–4241, 2019 https://doi.org/10.5194/bg-16-4229-2019-supplement © Author(s) 2019. This work is distributed under the Creative Commons Attribution 4.0 License. Supplement of Identifying the core bacterial microbiome of hydrocarbon degradation and a shift of dominant methanogenesis pathways in the oil and aqueous phases of petroleum reservoirs of different temperatures from China Zhichao Zhou et al. Correspondence to: Ji-Dong Gu ([email protected]) and Bo-Zhong Mu ([email protected]) The copyright of individual parts of the supplement might differ from the CC BY 4.0 License. 1 Supplementary Data 1.1 Characterization of geographic properties of sampling reservoirs Petroleum fluids samples were collected from eight sampling sites across China covering oilfields of different geological properties. The reservoir and crude oil properties together with the aqueous phase chemical concentration characteristics were listed in Table 1. P1 represents the sample collected from Zhan3-26 well located in Shengli Oilfield. Zhan3 block region in Shengli Oilfield is located in the coastal area from the Yellow River Estuary to the Bohai Sea. It is a medium-high temperature reservoir of fluvial face, made of a thin layer of crossed sand-mudstones, pebbled sandstones and fine sandstones. P2 represents the sample collected from Ba-51 well, which is located in Bayindulan reservoir layer of Erlian Basin, east Inner Mongolia Autonomous Region. It is a reservoir with highly heterogeneous layers, high crude oil viscosity and low formation fluid temperature. It was dedicated to water-flooding, however, due to low permeability and high viscosity of crude oil, displacement efficiency of water-flooding driving process was slowed down along the increase of water-cut rate.
    [Show full text]
  • Anaerobic Degradation of 1-Methylnaphthalene by a Member of the Thermoanaerobacteraceae Contained in an Iron-Reducing Enrichment Culture
    Biodegradation (2018) 29:23–39 https://doi.org/10.1007/s10532-017-9811-z ORIGINAL PAPER Anaerobic degradation of 1-methylnaphthalene by a member of the Thermoanaerobacteraceae contained in an iron-reducing enrichment culture Sviatlana Marozava . Housna Mouttaki . Hubert Mu¨ller . Nidal Abu Laban . Alexander J. Probst . Rainer U. Meckenstock Received: 24 April 2017 / Accepted: 2 November 2017 / Published online: 24 November 2017 Ó The Author(s) 2017. This article is an open access publication Abstract An anaerobic culture (1MN) was enriched culture is mainly composed of two bacteria related to with 1-methylnaphthalene as sole source of carbon uncultured Gram-positive Thermoanaerobacteraceae and electrons and Fe(OH)3 as electron acceptor. and uncultured gram-negative Desulfobulbaceae. 1-Naphthoic acid was produced as a metabolite during Stable isotope probing showed that a 13C-carbon label 13 growth with 1-methylnaphthalene while 2-naphthoic from C10-naphthalene as growth substrate was acid was detected with naphthalene and 2-methyl- mostly incorporated by the Thermoanaerobacter- naphthalene. This indicates that the degradation aceae. The presence of putative genes involved in pathway of 1-methylnaphthalene might differ from naphthalene degradation in the genome of this organ- naphthalene and 2-methylnaphthalene degradation in ism was confirmed via assembly-based metagenomics sulfate reducers. Terminal restriction fragment length and supports that it is the naphthalene-degrading polymorphism and pyrosequencing revealed that the bacterium in the culture. Thermoanaerobacteraceae have previously been detected in oil sludge under thermophilic conditions, but have not been shown to Electronic supplementary material The online version of this article (https://doi.org/10.1007/s10532-017-9811-z) con- degrade hydrocarbons so far.
    [Show full text]
  • Occurrence of Thermophilic Microorganisms in Different Full
    International Journal of Molecular Sciences Article Occurrence of Thermophilic Microorganisms in Different Full Scale Biogas Plants Ivan Kushkevych 1,* , Jiˇrí Cejnar 1, Monika Vítˇezová 1, Tomáš Vítˇez 2, Dani Dordevi´c 3 and Yannick J. Bomble 4 1 Department of Experimental Biology, Faculty of Science, Masaryk University, 62500 Brno, Czech Republic; [email protected] (J.C.); [email protected] (M.V.) 2 Department of Agricultural, Food and Environmental Engineering, Faculty of AgriSciences, Mendel University, 61300 Brno, Czech Republic; [email protected] 3 Department of Plant Origin Foodstuffs Hygiene and Technology, Faculty of Veterinary Hygiene and Ecology, University of Veterinary and Pharmaceutical Sciences, 61242 Brno, Czech Republic; [email protected] 4 Bioscience Center, National Renewable Energy Laboratory, 16253 Denver West Parkway, Golden, CO 80401, USA; [email protected] * Correspondence: [email protected]; Tel.: +420-549-495-315 Received: 27 November 2019; Accepted: 30 December 2019; Published: 31 December 2019 Abstract: Background: In recent years, various substrates have been tested to increase the sustainable production of biomethane. The effect of these substrates on methanogenesis has been investigated mainly in small volume fermenters and were, for the most part, focused on studying the diversity of mesophilic microorganisms. However, studies of thermophilic communities in large scale operating mesophilic biogas plants do not yet exist. Methods: Microbiological, biochemical, biophysical methods, and statistical analysis were used to track thermophilic communities in mesophilic anaerobic digesters. Results: The diversity of the main thermophile genera in eight biogas plants located in the Czech Republic using different input substrates was investigated. In total, 19 thermophilic genera were detected after 16S rRNA gene sequencing.
    [Show full text]
  • Unique Evolution of Symbiobacterium Thermophilum Suggested from Gene Content and Orthologous Protein Sequence Comparisons
    SAGE-Hindawi Access to Research International Journal of Evolutionary Biology Volume 2011, Article ID 376831, 8 pages doi:10.4061/2011/376831 Research Article Unique Evolution of Symbiobacterium thermophilum Suggested from Gene Content and Orthologous Protein Sequence Comparisons Kenro Oshima,1 Kenji Ueda,2 Teruhiko Beppu,2 and Hiromi Nishida3 1 Department of Agricultural and Environmental Biology, Graduate School of Agricultural and Life Sciences, The University of Tokyo, Bunkyo-ku, Tokyo 113-8657, Japan 2 Life Science Research Center, College of Bioresource Sciences, Nihon University, 1866 Kameino, Fujisawa 252-8510, Japan 3 Agricultural Bioinformatics Research Unit, Graduate School of Agriculture and Life Sciences, The University of Tokyo, Bunkyo-ku, Tokyo 113-8657, Japan Correspondence should be addressed to Hiromi Nishida, [email protected] Received 21 September 2010; Accepted 27 November 2010 Academic Editor: Hideaki Nojiri Copyright © 2011 Kenro Oshima et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Comparisons of gene content and orthologous protein sequence constitute a major strategy in whole-genome comparison studies. It is expected that horizontal gene transfer between phylogenetically distant organisms and lineage-specific gene loss have greater influence on gene content-based phylogenetic analysis than orthologous protein sequence-based phylogenetic analysis. To determine the evolution of the syntrophic bacterium Symbiobacterium thermophilum, we analyzed phylogenetic relationships among Clostridia on the basis of gene content and orthologous protein sequence comparisons. These comparisons revealed that these 2 phylogenetic relationships are topologically different.
    [Show full text]
  • The Complete Genome Sequence of Moorella Thermoacetica (F
    Environmental Microbiology (2008) 10(10), 2550–2573 doi:10.1111/j.1462-2920.2008.01679.x The complete genome sequence of Moorella thermoacetica (f. Clostridium thermoaceticum) Elizabeth Pierce,1 Gary Xie,2,3 Ravi D. Barabote,2,3 functions, 665 (25.43%) matched genes of unknown Elizabeth Saunders,2,3 Cliff S. Han,2,3 function, and the remaining 24 (0.92%) had no data- John C. Detter,2,3 Paul Richardson,2,4 base match. A total of 2384 (91.17%) of the ORFs in Thomas S. Brettin,2,3 Amaresh Das,5 the M. thermoacetica genome can be grouped in Lars G. Ljungdahl5 and Stephen W. Ragsdale1* orthologue clusters. This first genome sequence of 1Department of Biological Chemistry, University of an acetogenic bacterium provides important informa- Michigan, Ann Arbor, MI, USA. tion related to how acetogens engage their extreme 2Los Alamos National Laboratory, Bioscience Division, metabolic diversity by switching among different Los Alamos, NM, USA. carbon substrates and electron donors/acceptors and 3Department of Energy Joint Genome Institute, how they conserve energy by anaerobic respiration. Walnut Creek, CA, USA. Our genome analysis indicates that the key genetic 4Lawrence Berkeley National Laboratory, Berkeley, CA, trait for homoacetogenesis is the core acs gene USA. cluster of the Wood–Ljungdahl pathway. 5Department of Biochemistry and Molecular Biology, University of Georgia, Athens, GA, USA. Introduction Here we report the first complete genome sequence of an Summary acetogenic bacterium. Acetogens are obligately anaero- This paper describes the genome sequence of bic bacteria that use a mechanism of anaerobic CO and Moorella thermoacetica (f.
    [Show full text]
  • CO-Dependent Hydrogen Production by the Facultative Anaerobe Parageobacillus Thermoglucosidasius
    Mohr et al. Microb Cell Fact (2018) 17:108 https://doi.org/10.1186/s12934-018-0954-3 Microbial Cell Factories RESEARCH Open Access CO‑dependent hydrogen production by the facultative anaerobe Parageobacillus thermoglucosidasius Teresa Mohr1,4* , Habibu Aliyu1, Raphael Küchlin1, Shamara Polliack2, Michaela Zwick1, Anke Neumann1, Don Cowan2 and Pieter de Maayer3 Abstract Background: The overreliance on dwindling fossil fuel reserves and the negative climatic efects of using such fuels are driving the development of new clean energy sources. One such alternative source is hydrogen (H­ 2), which can be generated from renewable sources. Parageobacillus thermoglucosidasius is a facultative anaerobic thermophilic bacte- rium which is frequently isolated from high temperature environments including hot springs and compost. Results: Comparative genomics performed in the present study showed that P. thermoglucosidasius encodes two evolutionary distinct ­H2-uptake [Ni-Fe]-hydrogenases and one ­H2-evolving hydrogenases. In addition, genes encod- ing an anaerobic CO dehydrogenase (CODH) are co-localized with genes encoding a putative ­H2-evolving hydroge- nase. The co-localized of CODH and uptake hydrogenase form an enzyme complex that might potentially be involved in catalyzing the water-gas shift reaction (CO ­H2O ­CO2 ­H2) in P. thermoglucosidasius. Cultivation of P. thermo- glucosidasius DSM ­2542T with an initial gas atmosphere+ → of 50%+ CO and 50% air showed it to be capable of growth at elevated CO concentrations (50%). Furthermore, GC analyses showed that it was capable of producing hydrogen at an equimolar conversion with a fnal yield of 1.08 ­H2/CO. Conclusions: This study highlights the potential of the facultative anaerobic P.
    [Show full text]