A Novel Cellulolytic, Anaerobic, and Thermophilic Bacterium, Moorella Sp
Total Page：16
File Type：pdf, Size：1020Kb
Biosci. Biotechnol. Biochem., 67 (1), 183–185, 2003 Note A Novel Cellulolytic, Anaerobic, and Thermophilic Bacterium, Moorella sp. Strain F21 Shuichi KARITA,1,† Kengo NAKAYAMA,1 Masakazu GOTO,1 Kazuo SAKKA,1 Wan-Jae KIM,1 and Satoru OGAWA2 1Department of Sustainable Resource Science, Faculty of Bioresources, and 2Laboratory of Electron Microscope, School of Medicine, Mie University, Tsu 514-8507, Japan Received June 24, 2002; Accepted September 9, 2002 A cellulolytic and thermophilic anaerobe was isolated and fermenting cellulosic materials to organic acids from soil. This bacterium made a halo on a roll-tube was isolated. In this paper, we identiˆed the strain culture containing Avicel. Analysis of the PCR-based using DNA sequencing of the 16S rRNA coding 16S rRNA gene sequence showed that the bacterium was region and studied the enzyme activities and ferment- closely related to Moorella thermoacetica.Scanning ed products from the strain. electron microscopy showed the bacterium is a rod and Cellulolytic anaerobic bacteria were isolated in has no protuberant structure on the surface of cells anaerobic culture by the roll-tube method. The cul- growing on cellulose, suggesting that this strain is a non- ture medium for isolation was GS medium3) contain- cellulosomal cellulolytic bacterium. Carboxymethyl cel- ing Avicel as the sole carbon source. The bacteria lulase and xylanase activities were detected in the culture were grown at 609Cfor1week.Bacteriamaking broth. A major fermentation product from ball-milled haloes around their colonies were isolated as cellulo- cellulose was acetate. This strain has a potential to con- lyticanaerobes.Thesebacteriawerecultivatedwith vert cellulosic biomass to acetate, directly. liquid medium including ball-milled cellulose (BMC) as a carbon source in Hungate tubes. The culture Key words: cellulase; xylanase; Moorella sp.; anaero- broths were examined to measure organic acid bic thermophile concentrations using high-pressure liquid chromato- graphy (TOSOH). The strain F21, which produced Cellulose is one of the most abundant renewable higher concentration of organic acids, about 60 mM resources, photobiosynthesized with sunlight. The of total organic acids, almost all acetate, from 1z e‹cient use of cellulose is one of the keys for achieve- BMC was selected for further study. The strain F21 is ment of a sustainable society. Cellulose can be a Gram-positive, strictly anaerobic, and thermophilic degraded to cellooligosaccharides by cellulolytic en- bacterium. At 609C, the cells grew well with BMC or zymes produced by cellulolytic microorganisms. Cel- Avicel as the sole carbon source. lulolytic bacteria inhabit soil or the rumens of herbi- Cells were collected with a ˆlter of 0.22-mm pore vore, and so on. These play a role in the carbon cycle size. Fixation was done with 2.5z glutaraldehyde in in the biosphere. Some of these have been isolated, phosphate-buŠered saline for 2 h and postˆxation identiˆed, and their cellulolytic enzymes character- was done with 1z osmium tetraoxide in phosphate- ized. The cellulolytic enzymes are grouped into famil- buŠered saline for 1.5 h. After the ˆxation, cells were ies, depending on similarity of their amino acid se- dehydrated with a series of ethanol concentrations quences.1) These cellulolytic bacteria have a multiple and critical-point dried. After ion-sputter coating enzyme system, containing several enzymes with with platinum-palladium, cells were observed with a diŠerent substrate speciˆcity, and reaction mode, scanning electron microscope (Hitachi S-4000). The and belonging to diŠerent families.2) scanning electron microscope showed that this bac- Cellulolytic anaerobic bacteria often digest cellu- terium is a rod and has no protuberance on the sur- lose and product organic material directly. For exam- faces of cells cultivated on a medium containing ple, rumen bacteria can degrade carbohydrates of glucose or cellulose as a carbon source (Fig. 1). This plan cell walls and ferment them to volatile fatty surface structure is diŠerent from other cellulolytic acids directly. These volatile fatty acids are absorbed anaerobic bacteria, such as Clostridium thermocel- and used by ruminants. We have isolated cellulolytic lum,4) and Ruminococcus albus.5,6) These bacteria bacteria from soil and compost. One of these, a bac- cultivated with cellulosic materials as a carbon source terium, strain F21, producing cellulolytic enzymes produce a protuberance on their cell surface. The † To whom correspondence should be addressed. Tel: +81-59-232-1211; Fax: +81-59-231-9637; E-mail: karita＠bio.mie-u.ac.jp 184 S. KARITA et al. Fig. 1. Scanning Electron Microscopy of Moorella sp. Strain F21. Cells were grown on glucose (A) or ball-milled cellulose (B) as the carbon source. Bar, 0.72 mm. protuberance is a cellulosome, a cellulase complex containing multiple cellulolytic enzyme subunits and cellulose-binding scaŠolding proteins. The bacterium is a non-cellulosomal cellulolytic anaerobic ther- mophilic bacterium, having a smooth cell surface. Identiˆcationofthisbacteriumwasdonebyread- Fig. 2. Phylogenetic Tree of Moorella-related Species. Phylogenetic analysis was done with programs in PHYLIP ing of the nucleotide sequence of DNA encoding 16S ver. 3.572 (by Joseph Felscentein and the University of Washin- rRNA (rDNA). The rDNA was ampliˆed with a set gton). A phylogenic tree was constructed with the tree-drawing of primers (27f, AGAGTTTGATCCTGGCTCAG program TreeView ver. 1.5 (by Roderic D. M. Page, University and 1492r, GGTTACCTTGTTACGACTT) and of Glasgow). Bootstrap values are shown inside each node (per- centage of 1,000 bootstrapsÀ50 ). The rDNA sequences used rTaq DNA polymerase (TAKARA). Ampliˆed frag- z in the analysis were retrieved from GenBankWEMBLWDDBJ ment was puriˆed with QIA quick gel extraction kit databases. (Qiagen) from agarose gels. Nucleotide sequences were analyzed with the ABI PRISM 310 Genetic Analyzer (PE Applied Biosystems) and BigDye Table 1. Various Enzyme Activities in Culture Broth of terminator cycle sequencing kit (PE Applied Moorella sp. Strain F21 Biosystems). Similarity searching was done with the Substrate Activity (U ml) BLAST algorithm in DNA databases. The sequence W showed 99z identity with the Moorella thermoaceti- Carboxymethyl cellulose 0.65 ca ET-5a 16S rRNA gene (accession No. AJ242494), Oat-spelt xylan 2.05 Lichenan 1.06 98z with the Moorella thermoautotrophica DSM Laminarin 0.02 1974 (accession No. X77849), 98z with the Moorella p-nitrophenyl-b-glucoside Trace* thermoacetica ATCC 39073 (accession No. M59121), p-nitrophenyl-a-glucoside — and 95z with the Moorella glycerini YS6 (accession p-nitrophenyl-b-mannoside — No. U82327), suggesting that this bacterium is p-nitrophenyl-a-mannoside — p-nitrophenyl-b-xyloside Trace a‹liated with Moorella species, and identiˆed tenta- p-nitrophenyl-a-xyloside — tively as M. thermoacetica (Fig. 2). M. thermoacetica * Trace: on the order of milliunits. is an acetogenic thermophile, converting H2–CO2 to 7) 8) One unit of activity is deˆned as the amount of enzyme that releases mmol acetate and makes hyper-thermotolerant spores. of glucose-equivalent or p-nitrophenol per minute. So far there has been no report of cellulolytic Moorella species. The hydrolytic activities toward various substrates in cell-free culture supernatant 410 nm. In culture broth with modiˆed GS medium were measured by a 10-min incubation at 589Cin containing 8.4 gWl urea, we detected xylanase, car- 50 mM potassium phosphate buŠer (pH 7.0) in the boxymethyl cellulase, and lichenase activities, and b- presence of 1.0z (wWv) substrates. Reducing sugars xylosidase and b-glucosidase activities also were ob- released from the substrates were measured with the served (Table 1). The urea content of the medium 3,5-dinitrosalicylic acid reagent as described by aŠected the enzyme activity positively (not shown). Miller.9) Activities toward p-nitrophenyl glycoside Carboxymethyl cellulase activity of this strain was derivatives (Sigma) were measured for p-nitrophenol lower than that of C. thermocellum (1.7 UWml in the released from 3 mM substrate at 589C. Samples were cell-free supernatant)10) and xylanase activity also incubated with a substrate and 60 mM potassium was lower than that of xylanolytic C. stercorarium phosphate buŠer. After 5 min of incubation, the (56 UWml in the supernatant).11) This strain produced reactions were stopped by the addition of 0.4 M acetate as a major fermentation product from cellu- Na2CO3, and the absorbance was measured at lose as described above. The enzyme activities were A Novel Cellulolytic Isolate, Moorella sp. 185 lower than other cellulolytic anaerobes', however, 5) Miron, J., Yokoyama, M. T., and Lamed, R., Bac- this strain made a halo against Avicel, indicating the terial cell surface structures involved in lucerne cell bacterium has a complete cellulose degrading system. wall degradation by pure cultures of cellulolytic ru- The C. thermocellum produces mixed products, such men bacteria. Appl. Microbiol. Biotechnol., 32, as ethanol, acetate, butyrate, and lactate.12) Moorella 218–222 (1989). 6) Kim,Y.S.,Singh,A.P.,Wi,S.G.,Myung,K.H., thermoacetica is used as a fermentation strain for Karita, S., and Ohmiya, K., Cellulosome-like struc- various substrate to make acetate.13,14) The strain can tures ruminal cellulolytic bacterium Ruminococcus convert cellulosic biomass to acetate directly, and cel- albus F-40 as revealed by electron microscopy. Asian- lulolytic Moorella species is interesting for