DOCSLIB.ORG

Genetic Studies of Salivary Cortisol Profiles and Their Influence on Chronic Disease Risk Factors

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Genetic Studies of Salivary Cortisol Profiles and Their Influence on Chronic Disease Risk Factors Genetic studies of salivary cortisol profiles and their influence on chronic disease risk factors by Erin K. Payne A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Epidemiological Science) in the University of Michigan 2013 Doctoral Committee: Professor Sharon L.R. Kardia, Co-Chair Professor Ana V. Diez-Roux, Co-Chair Associate Professor Bhramar Mukherjee Professor Patricia A. Peyser Assistant Research Scientist Jennifer A. Smith © Erin K. Payne 2013 Acknowledgements This dissertation would not have been possible without with generous support, guidance, and counsel from my advisor, Sharon Kardia, and the other members of my dissertation committee, Ana Diez-Roux, Bhramar Mukherjee, Pat Peyser, and Jennifer Smith. I would like to thank the past and current members of the Kardia Research Lab. Tracy for her assistance when I was an analysis novice, Koji for teaching me to navigate the servers, Wei and Josh for their programming prowess, and Linda for keeping us organized and her reminders to keep moving forward. A few special recognitions are needed. Thank you to Jen for extending her time, knowledge, mentorship, support, and a shoulder to lean on. To Erin, Alicia, and Stephanie, thank you for being the team that saw me through the highs and the lows. I will be forever grateful. To Caitlin, Colleen, and Casey, for answering the endless calls on how to finish the dissertation and start saving the world. To Steve, for his unfaltering love, enduring patience, and unending faith. To my brothers, for their constant inspiration. Lastly, to my parents, for their infinite wisdom, love, support, encouragement, and limitless belief in me. I love you all. [ii] Table of Contents Acknowledgements ............................................................................................................. ii List of Tables ..................................................................................................................... vi List of Figures .................................................................................................................... ix Abstract ............................................................................................................................ xiii CHAPTER 1: INTRODUCTION ....................................................................................... 1 Introduction ..................................................................................................................... 1 Psychosocial stress .......................................................................................................... 3 Cortisol ............................................................................................................................ 6 Epidemiologic studies of cortisol.................................................................................... 7 Stress response genes ...................................................................................................... 8 Biological mechanisms linking stressors and chronic disease risk factors ................... 11 CHAPTER 2: STUDY POPULATION AND VARIABLE MEASUREMENTS ........... 13 Study Population ........................................................................................................... 13 The MESA Study ...................................................................................................... 13 The MESA Stress Study ........................................................................................... 15 Cortisol Samples and Cortisol Features ........................................................................ 17 Daily Salivary Cortisol Samples ............................................................................... 17 Cortisol Features ....................................................................................................... 19 Genetic Data.................................................................................................................. 35 Chronic Disease Risk Factors ....................................................................................... 40 Body Mass Index ...................................................................................................... 40 Fasting Glucose ......................................................................................................... 43 Inflammatory Measures ............................................................................................ 47 CHAPTER 3: VARIATION IN STRESS RESPONSE GENES IS RELATED TO FEATURES OF DIURNAL CORTISOL CURVES IN THE MULTI-ETHNIC STUDY OF ATHEROSCLEROSIS ............................................................................................... 55 Introduction ................................................................................................................... 55 Methods......................................................................................................................... 57 Study Population ....................................................................................................... 57 Cortisol Sample Collection ....................................................................................... 58 Cortisol Features ....................................................................................................... 58 Genetic Data.............................................................................................................. 60 Stress Response Genes .............................................................................................. 61 [iii] Statistical Analysis ........................................................................................................ 61 Gene-level analyses .................................................................................................. 61 Meta-analysis ............................................................................................................ 62 Power Calculations ................................................................................................... 63 Results ........................................................................................................................... 65 Discussion ..................................................................................................................... 73 CHAPTER 4: INTERACTIONS BETWEEN CORTISOL LEVELS AND STRESS RESPONSE GENES IN PREDICTING CHRONIC DISEASE RISK FACTORS IN THE MULTI-ETHNIC STUDY OF ATHEROSCLEROSIS ................................................... 77 Introduction ................................................................................................................... 77 Methods......................................................................................................................... 79 Study Population ....................................................................................................... 79 Cortisol Sample Collection ....................................................................................... 79 Cortisol Features ....................................................................................................... 80 Genetic Data.............................................................................................................. 82 Stress Response Genes .............................................................................................. 82 Outcome variables .................................................................................................... 83 Statistical Analysis ........................................................................................................ 84 Power Calculations ................................................................................................... 85 Results ........................................................................................................................... 87 Discussion ................................................................................................................... 103 CHAPTER 5: A GENOME-WIDE ASSOCIATION STUDY (GWAS) OF SALIVARY CORTISOL CONCENTRATIONS: THE MULTI-ETHNIC STUDY OF ATHEROSCLEROSIS .................................................................................................. 107 Introduction ................................................................................................................. 107 Methods....................................................................................................................... 110 Study Population ..................................................................................................... 110 Cortisol Sample Collection ..................................................................................... 111 Cortisol Features ..................................................................................................... 111 Genetic Data............................................................................................................ 113 Statistical Strategy .................................................................................................. 113 Results ......................................................................................................................... 115 GWAS Results ........................................................................................................ 116 Meta-analysis Results ............................................................................................
Load more

Recommended publications
  • Genetic Basis of Simple and Complex Traits with Relevance to Avian Evolution
    Genetic basis of simple and complex traits with relevance to avian evolution Małgorzata Anna Gazda Doctoral Program in Biodiversity, Genetics and Evolution D Faculdade de Ciências da Universidade do Porto 2019 Supervisor Miguel Jorge Pinto Carneiro, Auxiliary Researcher, CIBIO/InBIO, Laboratório Associado, Universidade do Porto Co-supervisor Ricardo Lopes, CIBIO/InBIO Leif Andersson, Uppsala University FCUP Genetic basis of avian traits Nota Previa Na elaboração desta tese, e nos termos do número 2 do Artigo 4º do Regulamento Geral dos Terceiros Ciclos de Estudos da Universidade do Porto e do Artigo 31º do D.L.74/2006, de 24 de Março, com a nova redação introduzida pelo D.L. 230/2009, de 14 de Setembro, foi efetuado o aproveitamento total de um conjunto coerente de trabalhos de investigação já publicados ou submetidos para publicação em revistas internacionais indexadas e com arbitragem científica, os quais integram alguns dos capítulos da presente tese. Tendo em conta que os referidos trabalhos foram realizados com a colaboração de outros autores, o candidato esclarece que, em todos eles, participou ativamente na sua conceção, na obtenção, análise e discussão de resultados, bem como na elaboração da sua forma publicada. Este trabalho foi apoiado pela Fundação para a Ciência e Tecnologia (FCT) através da atribuição de uma bolsa de doutoramento (PD/BD/114042/2015) no âmbito do programa doutoral em Biodiversidade, Genética e Evolução (BIODIV). 2 FCUP Genetic basis of avian traits Acknowledgements Firstly, I would like to thank to my all supervisors Miguel Carneiro, Ricardo Lopes and Leif Andersson, for the demanding task of supervising myself last four years.
    [Show full text]
  • Noelia Díaz Blanco
    Effects of environmental factors on the gonadal transcriptome of European sea bass (Dicentrarchus labrax), juvenile growth and sex ratios Noelia Díaz Blanco Ph.D. thesis 2014 Submitted in partial fulfillment of the requirements for the Ph.D. degree from the Universitat Pompeu Fabra (UPF). This work has been carried out at the Group of Biology of Reproduction (GBR), at the Department of Renewable Marine Resources of the Institute of Marine Sciences (ICM-CSIC). Thesis supervisor: Dr. Francesc Piferrer Professor d’Investigació Institut de Ciències del Mar (ICM-CSIC) i ii A mis padres A Xavi iii iv Acknowledgements This thesis has been made possible by the support of many people who in one way or another, many times unknowingly, gave me the strength to overcome this "long and winding road". First of all, I would like to thank my supervisor, Dr. Francesc Piferrer, for his patience, guidance and wise advice throughout all this Ph.D. experience. But above all, for the trust he placed on me almost seven years ago when he offered me the opportunity to be part of his team. Thanks also for teaching me how to question always everything, for sharing with me your enthusiasm for science and for giving me the opportunity of learning from you by participating in many projects, collaborations and scientific meetings. I am also thankful to my colleagues (former and present Group of Biology of Reproduction members) for your support and encouragement throughout this journey. To the “exGBRs”, thanks for helping me with my first steps into this world. Working as an undergrad with you Dr.
    [Show full text]
  • OSTF1 (AT9G4): Sc-517418
    SAN TA C RUZ BI OTEC HNOL OG Y, INC . OSTF1 (AT9G4): sc-517418 BACKGROUND PRODUCT OSTF1 (osteoclast-stimulating factor 1) is a 214 amino acid cytoplasmic pro - Each vial contains 100 µg IgG 2a kappa light chain in 1.0 ml of PBS with tein that contains 3 ANK repeats and one SH3 domain. The SH3 domain < 0.1% sodium azide and 0.1% gelatin. mediates interaction of OSTF1 with SMN. In addition to SMN, OSTF1 inter - acts with Src and FAS-L. In osteoclasts, OSTF1 is thought to induce bone APPLICATIONS resorption most likely through a signaling cascade that results in the secre - OSTF1 (AT9G4) is recommended for detection of OSTF1 of mouse, rat and tion of factors that enhance osteoclast formation and activity. The gene that human origin by Western Blotting (starting dilution 1:200, dilution range encdoes OSTF1 consists of almost 59,000 bases and maps to human chro mo - 1:100-1:1000), immunoprecipitation [1-2 µg per 100-500 µg of total protein some 9q21.13. Housing over 900 genes, chromosome 9 comprises nearly 4% (1 ml of cell lysate)], immunofluorescence (starting dilution 1:50, dilution of the human genome. Hereditary hemorrhagic telangiectasia, which is char - range 1:50-1:500), flow cytometry (1 µg per 1 x 10 6 cells) and solid phase acterized by harmful vascular defects, and familial dysautonomia, are both ELISA (starting dilution 1:30, dilution range 1:30-1:3000). associated with chromosome 9. Notably, chromosome 9 encompasses the largest interferon family gene cluster. Suitable for use as control antibody for OSTF1 siRNA (h): sc-92800, OSTF1 siRNA (m): sc-151336, OSTF1 shRNA Plasmid (h): sc-92800-SH, OSTF1 REFERENCES shRNA Plasmid (m): sc-151336-SH, OSTF1 shRNA (h) Lentiviral Particles: sc-92800-V and OSTF1 shRNA (m) Lentiviral Particles: sc-151336-V.
    [Show full text]
  • Early Growth Response 1 Regulates Hematopoietic Support and Proliferation in Human Primary Bone Marrow Stromal Cells
    Hematopoiesis SUPPLEMENTARY APPENDIX Early growth response 1 regulates hematopoietic support and proliferation in human primary bone marrow stromal cells Hongzhe Li, 1,2 Hooi-Ching Lim, 1,2 Dimitra Zacharaki, 1,2 Xiaojie Xian, 2,3 Keane J.G. Kenswil, 4 Sandro Bräunig, 1,2 Marc H.G.P. Raaijmakers, 4 Niels-Bjarne Woods, 2,3 Jenny Hansson, 1,2 and Stefan Scheding 1,2,5 1Division of Molecular Hematology, Department of Laboratory Medicine, Lund University, Lund, Sweden; 2Lund Stem Cell Center, Depart - ment of Laboratory Medicine, Lund University, Lund, Sweden; 3Division of Molecular Medicine and Gene Therapy, Department of Labora - tory Medicine, Lund University, Lund, Sweden; 4Department of Hematology, Erasmus MC Cancer Institute, Rotterdam, the Netherlands and 5Department of Hematology, Skåne University Hospital Lund, Skåne, Sweden ©2020 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol. 2019.216648 Received: January 14, 2019. Accepted: July 19, 2019. Pre-published: August 1, 2019. Correspondence: STEFAN SCHEDING - [email protected] Li et al.: Supplemental data 1. Supplemental Materials and Methods BM-MNC isolation Bone marrow mononuclear cells (BM-MNC) from BM aspiration samples were isolated by density gradient centrifugation (LSM 1077 Lymphocyte, PAA, Pasching, Austria) either with or without prior incubation with RosetteSep Human Mesenchymal Stem Cell Enrichment Cocktail (STEMCELL Technologies, Vancouver, Canada) for lineage depletion (CD3, CD14, CD19, CD38, CD66b, glycophorin A). BM-MNCs from fetal long bones and adult hip bones were isolated as reported previously 1 by gently crushing bones (femora, tibiae, fibulae, humeri, radii and ulna) in PBS+0.5% FCS subsequent passing of the cell suspension through a 40-µm filter.
    [Show full text]
  • The Landscape of Human Mutually Exclusive Splicing
    bioRxiv preprint doi: https://doi.org/10.1101/133215; this version posted May 2, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. The landscape of human mutually exclusive splicing Klas Hatje1,2,#,*, Ramon O. Vidal2,*, Raza-Ur Rahman2, Dominic Simm1,3, Björn Hammesfahr1,$, Orr Shomroni2, Stefan Bonn2§ & Martin Kollmar1§ 1 Group of Systems Biology of Motor Proteins, Department of NMR-based Structural Biology, Max-Planck-Institute for Biophysical Chemistry, Göttingen, Germany 2 Group of Computational Systems Biology, German Center for Neurodegenerative Diseases, Göttingen, Germany 3 Theoretical Computer Science and Algorithmic Methods, Institute of Computer Science, Georg-August-University Göttingen, Germany § Corresponding authors # Current address: Roche Pharmaceutical Research and Early Development, Pharmaceutical Sciences, Roche Innovation Center Basel, F. Hoffmann-La Roche Ltd., Basel, Switzerland $ Current address: Research and Development - Data Management (RD-DM), KWS SAAT SE, Einbeck, Germany * These authors contributed equally E-mail addresses: KH: [email protected], RV: [email protected], RR: [email protected], DS: [email protected], BH: [email protected], OS: [email protected], SB: [email protected], MK: [email protected] - 1 - bioRxiv preprint doi: https://doi.org/10.1101/133215; this version posted May 2, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Role and Regulation of the P53-Homolog P73 in the Transformation of Normal Human Fibroblasts
    Role and regulation of the p53-homolog p73 in the transformation of normal human fibroblasts Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Bayerischen Julius-Maximilians-Universität Würzburg vorgelegt von Lars Hofmann aus Aschaffenburg Würzburg 2007 Eingereicht am Mitglieder der Promotionskommission: Vorsitzender: Prof. Dr. Dr. Martin J. Müller Gutachter: Prof. Dr. Michael P. Schön Gutachter : Prof. Dr. Georg Krohne Tag des Promotionskolloquiums: Doktorurkunde ausgehändigt am Erklärung Hiermit erkläre ich, dass ich die vorliegende Arbeit selbständig angefertigt und keine anderen als die angegebenen Hilfsmittel und Quellen verwendet habe. Diese Arbeit wurde weder in gleicher noch in ähnlicher Form in einem anderen Prüfungsverfahren vorgelegt. Ich habe früher, außer den mit dem Zulassungsgesuch urkundlichen Graden, keine weiteren akademischen Grade erworben und zu erwerben gesucht. Würzburg, Lars Hofmann Content SUMMARY ................................................................................................................ IV ZUSAMMENFASSUNG ............................................................................................. V 1. INTRODUCTION ................................................................................................. 1 1.1. Molecular basics of cancer .......................................................................................... 1 1.2. Early research on tumorigenesis ................................................................................. 3 1.3. Developing
    [Show full text]
  • WO 2012/174282 A2 20 December 2012 (20.12.2012) P O P C T
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2012/174282 A2 20 December 2012 (20.12.2012) P O P C T (51) International Patent Classification: David [US/US]; 13539 N . 95th Way, Scottsdale, AZ C12Q 1/68 (2006.01) 85260 (US). (21) International Application Number: (74) Agent: AKHAVAN, Ramin; Caris Science, Inc., 6655 N . PCT/US20 12/0425 19 Macarthur Blvd., Irving, TX 75039 (US). (22) International Filing Date: (81) Designated States (unless otherwise indicated, for every 14 June 2012 (14.06.2012) kind of national protection available): AE, AG, AL, AM, AO, AT, AU, AZ, BA, BB, BG, BH, BR, BW, BY, BZ, English (25) Filing Language: CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, DO, Publication Language: English DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, IN, IS, JP, KE, KG, KM, KN, KP, KR, (30) Priority Data: KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, ME, 61/497,895 16 June 201 1 (16.06.201 1) US MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, 61/499,138 20 June 201 1 (20.06.201 1) US OM, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SC, SD, 61/501,680 27 June 201 1 (27.06.201 1) u s SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, 61/506,019 8 July 201 1(08.07.201 1) u s TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW.
    [Show full text]
  • Based on Network Pharmacology and RNA Sequencing Techniques to Explore the Molecular Mechanism of Huatan Jiangzhuo Decoction for Treating Hyperlipidemia
    Hindawi Evidence-Based Complementary and Alternative Medicine Volume 2021, Article ID 9863714, 16 pages https://doi.org/10.1155/2021/9863714 Research Article Based on Network Pharmacology and RNA Sequencing Techniques to Explore the Molecular Mechanism of Huatan Jiangzhuo Decoction for Treating Hyperlipidemia XiaowenZhou ,1 ZhenqianYan ,1 YaxinWang ,1 QiRen ,1 XiaoqiLiu ,2 GeFang ,3 Bin Wang ,4 and Xiantao Li 1 1Laboratory of TCM Syndrome Essence and Objectification, School of Basic Medical Sciences, Guangzhou University of Chinese Medicine, Guangzhou 510006, China 2Guangzhou Sagene Tech Co., Ltd., Guangzhou 510006, China 3College of Traditional Chinese Medicine, Hunan University of Chinese Medicine, Changsha 410208, China 4Shenzhen Traditional Chinese Medicine Hospital, Shenzhen 518000, China Correspondence should be addressed to Xiantao Li; [email protected] Received 22 May 2020; Revised 12 March 2021; Accepted 18 March 2021; Published 12 April 2021 Academic Editor: Jianbo Wan Copyright © 2021 Xiaowen Zhou et al. +is is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Background. Hyperlipidemia, due to the practice of unhealthy lifestyles of modern people, has been a disturbance to a large portion of population worldwide. Recently, several scholars have turned their attention to Chinese medicine (CM) to seek out a lipid-lowering approach with high efficiency and low toxicity. +is study aimed to explore the mechanism of Huatan Jiangzhuo decoction (HTJZD, a prescription of CM) in the treatment of hyperlipidemia and to determine the major regulation pathways and potential key targets involved in the treatment process.
    [Show full text]
  • Supplementary Tables S1-S3
    Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse)
    [Show full text]
  • Prohibitin, STAT3 and SH2D4A Physically and Functionally Interact
    Prohibitin, STAT3 and SH2D4A physically and functionally interact in tumor cell mitochondria Carolin Ploeger, Thorben Huth, Raisatun Nisa Sugiyanto, Stefan Pusch, Benjamin Goeppert, Stephan Singer, Redouane Tabti, Ingrid Hausser, Peter Schirmacher, Laurent Désaubry, et al. To cite this version: Carolin Ploeger, Thorben Huth, Raisatun Nisa Sugiyanto, Stefan Pusch, Benjamin Goeppert, et al.. Prohibitin, STAT3 and SH2D4A physically and functionally interact in tumor cell mitochondria. Cell Death and Disease, Nature Publishing Group, 2020, 11 (11), 10.1038/s41419-020-03220-3. hal- 03032751 HAL Id: hal-03032751 https://hal.archives-ouvertes.fr/hal-03032751 Submitted on 1 Dec 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Ploeger et al. Cell Death and Disease (2020) 11:1023 https://doi.org/10.1038/s41419-020-03220-3 Cell Death & Disease ARTICLE Open Access Prohibitin, STAT3 and SH2D4A physically and functionally interact in tumor cell mitochondria Carolin Ploeger1, Thorben Huth1, Raisatun Nisa Sugiyanto1,StefanPusch2,3, Benjamin Goeppert 1, Stephan Singer1,4, Redouane Tabti5,IngridHausser1,PeterSchirmacher1, Laurent Désaubry 5,6 and Stephanie Roessler 1 Abstract Chromosome 8p is frequently deleted in various cancer entities and has been shown to correlate with poor patient survival.
    [Show full text]
  • The Potential Genetic Network of Human Brain SARS-Cov-2 Infection
    bioRxiv preprint doi: https://doi.org/10.1101/2020.04.06.027318; this version posted April 6, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. The potential genetic network of human brain SARS-CoV-2 infection. Colline Lapina 1,2,3, Mathieu Rodic 1, Denis Peschanski 4,5, and Salma Mesmoudi 1, 3, 4, 5 1 Prematuration Program: linkAllBrains. CNRS. Paris. France 2 Graduate School in Cognitive Engineering (ENSC). Talence. France 3 Complex Systems Institute Paris île-de-France. Paris. France 4 CNRS, Paris-1-Panthéon-Sorbonne University. CESSP-UMR8209. Paris. France 5 MATRICE Equipex. Paris. France Abstract The literature reports several symptoms of SARS-CoV-2 in humans such as fever, cough, fatigue, pneumonia, and headache. Furthermore, patients infected with similar strains (SARS-CoV and MERS-CoV) suffered testis, liver, or thyroid damage. Angiotensin-converting enzyme 2 (ACE2) serves as an entry point into cells for some strains of coronavirus (SARS-CoV, MERS-CoV, SARS-CoV-2). Our hypothesis was that as ACE2 is essential to the SARS-CoV-2 virus invasion, then brain regions where ACE2 is the most expressed are more likely to be disturbed by the infection. Thus, the expression of other genes which are also over-expressed in those damaged areas could be affected. We used mRNA expression levels data of genes provided by the Allen Human Brain Atlas (ABA), and computed spatial correlations with the LinkRbrain platform.
    [Show full text]
  • WO 2016/040794 Al 17 March 2016 (17.03.2016) P O P C T
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2016/040794 Al 17 March 2016 (17.03.2016) P O P C T (51) International Patent Classification: AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, C12N 1/19 (2006.01) C12Q 1/02 (2006.01) BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, C12N 15/81 (2006.01) C07K 14/47 (2006.01) DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, IN, IR, IS, JP, KE, KG, KN, KP, KR, (21) International Application Number: KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, MG, PCT/US20 15/049674 MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, (22) International Filing Date: PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, SC, 11 September 2015 ( 11.09.201 5) SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (25) Filing Language: English (84) Designated States (unless otherwise indicated, for every (26) Publication Language: English kind of regional protection available): ARIPO (BW, GH, (30) Priority Data: GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, 62/050,045 12 September 2014 (12.09.2014) US TZ, UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, (71) Applicant: WHITEHEAD INSTITUTE FOR BIOMED¬ DK, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, ICAL RESEARCH [US/US]; Nine Cambridge Center, LV, MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, Cambridge, Massachusetts 02142-1479 (US).
    [Show full text]