TP53INP1 Downregulation Activates a P73- Dependent DUSP10/ERK

Published OnlineFirst July 3, 2017; DOI: 10.1158/0008-5472.CAN-16-3456

Cancer Tumor and Stem Cell Biology Research

TP53INP1 Downregulation Activates a p73- Dependent DUSP10/ERK Signaling Pathway to Promote Metastasis of Hepatocellular Carcinoma Kai-Yu Ng1, Lok-Hei Chan1, Stella Chai1, Man Tong1, Xin-Yuan Guan2,3, Nikki P Lee4, Yunfei Yuan5, Dan Xie5, Terence K Lee6, Nelson J Dusetti7, Alice Carrier7, and Stephanie Ma1,3

Abstract

Identifying critical factors involved in the metastatic progres- phosphatase-mediated activation of the ERK pathway. The sion of hepatocellular carcinoma (HCC) may offer important DUSP10 promoter included putative binding sites for p73 therapeutic opportunities. Here, we report that the proapoptotic directly implicated in modulation by TP53INP1. Overall, our stress response factor TP53INP1 is often selectively downregu- ﬁndings show how TP53INP1 plays a critical role in limiting lated in advanced stage IV and metastatic human HCC tumors. the progression of early-stage HCC, with implications for Mechanistic investigations revealed that TP53INP1 downregula- developing new therapeutic strategies to attack metastatic HCC. tion in early-stage HCC cells promoted metastasis via DUSP10 Cancer Res; 77(17); 4602–12. 2017 AACR.

Introduction Extracellular signal-regulated kinases (ERK) have been shown to play critical roles in malignant transformation and cancer Liver cancer remains one of the most prevalent and deadliest metastasis (3). Oncogenic activation of ERKs can be induced by cancer types worldwide. Hepatocellular carcinoma (HCC) various mechanisms including transcriptional overexpression, accounts for over 75% of all liver cancer cases. Metastasis and mutations in upstream components of the MAP kinase pathway, postsurgical recurrence are common and represent major obsta- such as RAS and BRAF, and downregulation of negative regulator cles to the improvement of patient survival. HCC patients are dual-specificity MAP kinase phosphatases (DUSP; ref. 4). ERK often diagnosed at an advanced stage when curative therapy is no plays a major role in invasion by inducing proteases that degrade longer available and even after surgery, the prognosis of HCC the basement membrane, enhances cell migration, and increases remains unsatisfactory, with a 5-year postrecurrence rate at >70%. cell survival. Activated ERK pathway has been shown to correlate Metastasis is a complex multistep process involving alterations in with the expression of epithelial–mesenchymal transition (EMT) the dissemination, invasion, survival, and growth of new cancer markers, a hallmark of metastasis. These findings collectively cell colonies, which are regulated by a complex network of intra- suggest that ERK plays a major role in tumor progression and and intercellular signal transduction cascades (1). However, metastasis. However, our knowledge of endogenous regulators of metastasis remains the most poorly understood component of DUSP/ERK remains limited and how they work to promote HCC cancer pathogenesis (2). Elucidation of the mechanisms under- metastasis is also not known. lying metastasis is fundamental for the development of new TP53INP1 is a stress-induced tumor suppressor gene with therapeutic treatments for advanced metastatic HCC. antiproliferative and proapoptotic activities (5, 6). It is an alter- natively spliced gene encoding two protein isoforms (a and b), and when overexpressed, both isoforms exert a tumor suppressor 1 School of Biomedical Sciences, The University of Hong Kong, Hong Kong. function, mainly by inducing the transcription of target genes 2Department of Clinical Oncology, The University of Hong Kong, Hong Kong. 3State Key Laboratory for Liver Research, Li Ka Shing Faculty of Medicine, The involved in cell-cycle arrest and p53-mediated apoptosis as part of fi University of Hong Kong, Hong Kong. 4Department of Surgery, The University of the cell responses to genotoxic stress. Signi cant reduction or loss Hong Kong, Hong Kong. 5State Key Laboratory of Oncology in Southern China, of TP53INP1 expression has been shown in a number of cancer Sun Yat-Sen University Cancer Center, Guangzhou, China. 6Department of types, including those of the stomach (7), breast (8), pancreas (9), Applied Biology and Chemical Technology, The Hong Kong Polytechnic Uni- esophagus (10), lung (11), melanocyte (12), colon (13), and 7 versity, Hong Kong. Aix Marseille University, CNRS, INSERM, Institut Paoli- blood (14). In relation to metastasis, TP53INP1 has only been Calmettes, CRCM, Marseille, France. implicated in a handful of studies including one report where they Note: Supplementary data for this article are available at Cancer Research found transcriptional levels of TP53INP1 to be downregulated in Online (http://cancerres.aacrjournals.org/). metastatic lung of brain cancers (15). A more recent study led by Corresponding Author: Stephanie Ma, The University of Hong Kong, Room 47, 1/F, our collaborator Dusetti and colleagues found TP53INP1 to Laboratory Block, Faculty of Medicine Building, 21 Sassoon Road, Pok Fu Lam, reduce pancreatic cancer cell migration by regulating SPARC Hong Kong. Phone: 852-3917-9238; Fax: 852-2817-0857; E-mail: [email protected] expression (16). TP53INP1 is a target gene of the transcription doi: 10.1158/0008-5472.CAN-16-3456 factor p53. Conversely, TP53INP1 has also been shown to play 2017 American Association for Cancer Research. a role in cellular homeostasis through p53-dependent and

4602 Cancer Res; 77(17) September 1, 2017

TP53INP1 in HCC Metastasis

p53-independent manners (5, 6). In addition to p53, TP53INP1, Phospho-kinase array profiling which is also a p73 target gene, can enhance transcriptional Proteome Profiler Human Phospho-Kinase Array Kit was pur- activity of p73 to induce cell-cycle arrest and cell death (17). chased from R&D Systems (ARY003B). Thus, TP53INP1 can exert its tumor suppressor function by inducing the transcription of both p53 and p73 target genes. Quantitative real-time PCR In our previous studies, we found that the initiation, growth Total RNA was extracted using RNAisoPlus (Takara). For quan- þ fi and self-renewal of CD133 liver tumors to be ne-tuned by a titative (q)RT-PCR of mRNA targets, cDNA was synthesized by balance of miR-130b overexpression and TP53INP1 downre- PrimeScript RT Master Mix (Takara) and amplified with EvaGreen gulation (18). This result suggests that TP53INP1 is a critical qPCR MasterMix-R (Applied Biological Materials) and primers effector driving hepatocarcinogenesis. Nevertheless, to date, no listed in Supplementary Table S1. b-Actin was amplified as an studies have determined the function of TP53INP1 in HCC internal control. Reactions were performed on an ABI Prism 7900 metastasis or the molecular mechanism by which TP53INP1 System (Applied Biosystems) with data analyzed using the ABI regulates invasion and metastasis in HCC. Here, we demon- SDS v2.3 software (Applied Biosystems). Relative expression DD strate that TP53INP1 is frequently downregulated in advanced- differences were calculated using the 2 Ct method. stage and metastatic human HCC tumors and that downregulation of TP53INP1 in HCC functionally promotes metastasis through ERK activation via a p73-dependent DUSP10 regula- Western blot analysis fi tion. Findings from our study not only provide new insights Protein lysates were quanti ed and resolved on a SDS-PAGE into how HCC metastasis is regulated but also provide a new gel, transferred onto PVDF membrane (Millipore), and immuno- layer of mechanism by which DUSP10/ERK signaling is regu- blotted with a primary antibody, followed by incubation with a lated by p73/TP53INP1 and also identify DUSP10 as a new secondary antibody. Antibody signal was detected using an transcriptional effector of p73. enhanced chemiluminescence system (GE Healthcare). The following antibodies were used: TP53INP1 (1:250, Genway Biotech, GWB-61D856), p-ERK1/2 (1:1,000, Cell Signaling Technology, Materials and Methods 9101), total ERK (1:1,000, Cell Signaling Technology, 9102), Gene expression profiling and patient samples DUSP10 (1:500, Cell Signaling Technology, 3483), p73 Gene expression profiling studies involving multiple clinical (1:1,000, Novus Biologicals, NB100-56674), BAX (1:1,000, Cell samples were performed analyzing the expression of specific Signaling Technology, 2772), MDM2 (1:500, Santa Cruz Biotech- transcripts in two datasets available through Gene Expression nology, sc-965), and b-actin (1:5,000, Sigma-Aldrich, A5316). Omnibus (GSE25097 and GSE40367; refs. 19, 20). In addition, human primary and matched metastatic HCC tissue samples were Expression plasmids and lentiviral transduction obtained from 37 patients undergoing hepatectomy at the Sun Expression plasmids for shRNAs were made in a pLKO.1-puro Yat-Sen University Cancer Centre in Guangzhou, China. Tissue vector (Sigma-Aldrich). The targeted sequences were: human samples were collected from patients who had not received any TP53INP1 (464, 50-CCGGCATAGATACTTGCACTGGTTTCTC- previous local or systemic treatment prior to operation. Use of GAGAAACCAGTGCAAGTATCTATGTTTTTTG-30) and (3834, 50- human samples was approved by the committee for ethical review CCGGGCGCCATGTTTCTCAAAGTTTCTCGAGAAACTTTGAGAA- of research involving human subjects at the Sun Yat-Sen Univer- ACATGGCGCTTTTTTG-30); human p73 (753, 50- CCGGATCC- sity Cancer Centre. GCGTGGAAGGCAATAATCTCGAGATTATTGCCTTCCACGCGG- ATTTTTTG-30) and (1643, 50- CCGGCCAAGGGTTACAGAGCAT- Cell lines TTACTCGAGTAAATGCTCTGTAACCCTTGGTTTTTG-30); human Human HCC cell lines Hep3B, SNU182, SK-Hep-1, and ERK1 (50- CCGGCTATACCAAGTCCATCGACATCTCGAGATGT- human hepatoblastoma cell line HepG2 were purchased from CGATGGACTTGGTATAGTTTTTG-30) and ERK2 (50- CCGGGA- American Type Culture Collection. Human liver cell line LO2 CATTATTCGAGCACCAACCCTCGAGGGTTGGTGCTCGAATAA- and HCC cell lines PLC8024, QSG-7701, and QGY-7703 were TGTCTTTTTG-30) and scrambled shRNA nontarget control (NTC; obtained from the Institute of Virology, Chinese Academy of 50-CCGGCAACAAGATGAAGAGCACAACTCGAGTTGGTGCTCT- Medical Sciences, Beijing, China. Human HCC cell line HLE TCATCTTGTTGTTTTT-30). Sequences were transfected into 293FT was obtained from Japanese Collection of Research Biore- cells, packaged using MISSION lentiviral packaging mix (Sigma- sources Cell Bank. Immortalized normal liver cell line, MIHA, Aldrich). The full-length complementary DNA of human DUSP10 was provided by Dr. J. R. Chowdhury, Albert Einstein College was amplified in cDNA of human adult normal liver tissue RNA of Medicine, New York, New York (21). MHCC97L cells were (BioChain) as a template using the following primers (forward 50- obtained from Liver Cancer Institute, Fudan University, China GGGGACAAGTTTGTACAAAAAAGCAGGCTGCCACCATGCCT- (22). 293FT cells were purchased from Invitrogen. All cell lines CCGTCTCCTTTAGAC-30; reverse 50-GGGGACCACTTTGTAC- used in this study were obtained between 2013 and 2016, AAGAAAGCTGGGTCACACAACCGTCTCCACG-30); and then regularly authenticated by morphologic observation and cloned into the Gateway entry vector pDONR201. DUSP10 AuthentiFiler STR (Invitrogen) and tested for absence of myco- was then shuttled into the Gateway destination vector pEZ- plasma contamination (MycoAlert, Lonza). Cells were used Lv199 (GeneCopoeia). Sequences were transfected into 293FN within 20 passages after thawing. cells, packaged using Lenti-Pac HIV Expression Packaging Mix (GeneCopoeia). Stable clones were selected with puromycin. Reagents The full-length complementary DNA of human TP53INP1 was U0126 was purchased from Cell Signaling Technologies. Mito- amplified in cDNA of human adult normal liver tissue RNA mycin C was purchased from Calbiochem. (BioChain) as a template using the following primers (forward

www.aacrjournals.org Cancer Res; 77(17) September 1, 2017 4603

Ng et al.

50- GGGGACAAGTTTGTACAAAAAAGCAGGCTGCCACCATGT- Animal studies TCCAGAGGCTGAATAAAATGT -30;reverse50-GGGGACCACT- The study protocol was approved by and performed in accor- TTGTACAAGAAAGCTGGGTTAGTAATTGTACTGACGCGGG -30); dance with the Committee of the Use of Live Animals in Teaching and then cloned into the Gateway entry vector pDONR201. and Research at The University of Hong Kong. Metastasis was TP53INP1 was then shuttled into the Gateway destination vector assessed by orthotopically injecting into the liver to observe for pLenti CMV Blast DEST (706-1; Addgene plasmid #17451). extrahepatic metastasis to the lung. Luciferase-labeled cells were Sequences were transfected into 293FN cells, packaged using injected into the left lobes of the livers of 6-week-old BALB/c nude LentiPac HIV expression packaging mix (GeneCopoeia). Stable mice (n ¼ 6–10/group). Six to eight weeks after implantation, clones were selected with blasticidin. mice were administered with 100 mg/kg D-luciferin (Gold Bio- technology) via peritoneal injection 5 minutes before biolumi- Cell motility and invasion assays nescent imaging (IVIS 100 Imaging System, Xenogen). Livers and Migration and invasion assays were conducted in 24well Milli- lungs were harvested for ex vivo imaging and histologic analysis. cell hanging inserts (Millipore) and 24well BioCoat Matrigel Metastatic nodules in the lungs were counted. Invasion Chambers (BD Biosciences), respectively. Cells resus- pended in serum-free DMEM were added to the top chamber and Statistical analysis the medium supplemented with 10% FBS was added to the Data were analyzed by SPSS 21.0 or GraphPad Prism 6.0 and bottom chamber as a chemoattractant. After 48 hours of incuba- fi shown as mean standard deviations, unless otherwise speci ed. tion at 37 C, cells that migrated or invaded through the mem- Differences between groups were analyzed by an unpaired Stu- fi brane (migration) or Matrigel (invasion) were xed and stained dent t test for continuous variables. Correlation between expres- with crystal violet (SigmaAldrich). The number of cells was sions was analyzed by the c-square test. Statistical significance was fi counted in 3 random elds under 20 objective lens and imaged defined as P 0.05. using SPOT imaging software (Nikon).

Immunohistochemistry Results Immunohistochemical staining of paraffin sections was carried TP53INP1 is downregulated in advanced-stage and metastatic out using a two-step protocol. After antigen retrieval, sections HCC tumors were incubated with the following antibodies against anti-human As an initial attempt to explore whether TP53INP1 expression is TP53INP1 (clone A25-E12; 6 mg/mL; ref. 9), anti-human associated with metastasis, we evaluated the expression of p73 (1:500, Novus Biologicals, NB100-56674), anti-human TP53INP1 transcripts in two public gene expression databases. DUSP10 (1:50, Cell Signaling Technology, 3483) and anti-human We found that in advanced-stage HCC samples (stage IV of AJCC p-ERK1/2 (1:500, abcam; ab50011). Anti-mouse, -rabbit and -rat and TNM) that are more likely associated with recurrence and HRP–labeled polymer (DAKO) was used as secondary antibodies. metastasis, the expression of TP53INP1 was significantly lower Color detection was performed by liquid DABþ substrate chro- than that in early-stage samples (stages I, II, and III; GSE25097; mogen system (DAKO). Slides were counterstained with Mayer's ref. 19; Fig. 1A). In a second, independent data set (GSE40367; hematoxylin. According to the intensity and total area of the ref. 20) that compares metastatic free HCCs and HCCs with staining, the expression of TP53INP1 was scored as either low extrahepatic metastases, we also observed significantly lower (<30%), medium (30 to 60%), or high (>60%) expression. expression of TP53INP1 in HCC samples with extrahepatic metastases (Fig. 1B). To confirm these observations experimentally, we Luciferase reporter assay carried out immunohistochemical analyses in 37 pairs of matched Both fragments of the DUSP10 promoter regions S1 (4,400 to primary and metastatic HCC tissue samples. Consistently, 2,201 bp, carrying predicted site sequences ATTAAGTTTCAA- TP53INP1 was found to be downregulated in metastatic HCC. CATGTA and ATCATGTTACAACATCCA) and S2 (2,200 to 1 Only 28 of the 37 metastatic HCC samples were strong or bp, carrying predicted site sequences GGTATGTGCCTGCATGTA moderately positive for TP53INP1 and 9 were weak or negative. and GGCAAGGGGCGGCTTGCC) were amplified and cloned In contrast, moderate or strong immune positivity for TP53INP1 into the XhoI and HindIII sites of a pGL3 basic vector (Promega) was present in all 37 out of 37 primary HCC cases, suggesting that for luciferase reporter assay. All PCR products cloned into the a downregulation of TP53INP1 expression is involved in HCC plasmid were verified by DNA sequencing to ensure that they were metastasis (Fig. 1C). We then carried out Western blotting anal- free of mutations and in the correct cloning direction. Primer yses in a panel of immortalized normal liver (MIHA and LO2), sequences used listed in Supplementary Table S2. hepatoblastoma (HepG2) and HCC cell lines (SK-Hep1, HLE, SNU182, PLC8024, MHCC97L, Hep3B, QSG-7701, and QGY- Chromatin immunoprecipitation assay 7703). The expression of TP53INP1 was high in the immortalized Chromatin immunoprecipitation (ChIP) assay was performed normal liver and hepatoblastoma cells, while 7 of the 8 HCC cell using the MagnaChIP A Kit (Millipore). Briefly, cells were soni- lines examined displayed significantly lower or undetectable cated and lysed after cross-link treatment by 1% formaldehyde for levels of TP53INP1 expression (Fig. 2A). 10 minutes. The crosslinked protein/DNA complex was immunoprecipitated by anti-p73 antibody or normal IgG bound to TP53INP1 knockdown promotes HCC metastasis protein A magnetic beads. After overnight incubation at 4C, the To assess the functional role of TP53INP1 in cancer cells, we complex was eluted and DNA was purified. The immunopreci- knocked down expression of TP53INP1 in immortalized normal pitated DNA was quantified by qPCR using primer sequences liver cells MIHA and HCC cells MHCC97L using two TP53INP1- designed to detect specific regulatory regions listed in Supple- specific shRNA lentiviruses (sh-TP53INP1 464 and 3834). As mentary Table S3. controls, we used lentiviruses expressing nonspecific shRNA

4604 Cancer Res; 77(17) September 1, 2017 Cancer Research

TP53INP1 in HCC Metastasis

Figure 1. TP53INP1 is downregulated in advanced-stage and metastatic HCC tumors. A, Gene expression levels of human TP53INP1 mRNA (NM_033285) in HCC tumors categorized by both AJCC (stages I, II, IIIA, IIIB, and IV; n ¼ 219) and TNM (stages I, II, III, IVA, and IVB; n ¼ 229) staging systems (GSE25097). Open circles represent outliers. B, Box and whisker plot analysis of TP53INP1 mRNA levels in metastasis-free HCCs (n ¼ 10) and HCCs with extrahepatic metastasis (n ¼ 20; GSE40367). The horizontal lines indicate data within median 1.5 interquartile range. Closed circles, outliers. C, TP53INP1 immunostaining of tissue microarray comprising of 37 paired human primary and metastatic HCC tissue samples. Shown are representative images of the immunostaining. Scale bar, 50 mm. P ¼ 0.0007. Graph indicates the percentage of cases displaying low, medium, and high staining intensity of TP53INP1.

(nontarget control, NTC). Efficient TP53INP1 knockdown was sion to be preferentially expressed in the livers and lungs of the confirmed by Western blotting (Fig. 2B). We found that TP53INP1 nontarget control xenografts (Fig. 2F). In addition, to rule out any shRNA-expressing cells had a significantly enhanced ability to potential off-target effects of our knockdown shRNAs, we per- migrate and invade compared with control cells (Fig. 2C and D). formed experiments to rescue the effects of TP53INP1 shRNAs on Similar results were also obtained when the same experiment was migration and invasion by overexpressing TP53INP1 in the same performed in the presence of mitomycin C, where cells were cells. Overexpression of TP53INP1 in MHCC97L cells with inhibited to proliferate, suggesting that TP53INP1-mediated TP53INP1 stably repressed rescued the ability of the cells to migration and invasion are not a misinterpretation of the cells' attenuate migration and invasion in both knockdown clones, altered ability to proliferate (Supplementary Fig. S1). To confirm further demonstrating the importance of TP53INP1 in regulating these findings, we further examined the effects of TP53INP1 metastasis in HCC (Supplementary Fig. S2). expression in an in vivo experimental metastasis model where cells were orthotopically injected into the liver for observation of Phopsho-kinase array profiling analysis identifies activation of metastasis to the lung. TP53INP1 suppression induced a potent ERK to be involved in TP53INP1-mediated HCC metastasis increase in the ability of MHCC97L cells to not only form tumors To elucidate the molecular mechanism of TP53INP1 in regu- in the liver, but also metastasize to the lung (sh-464: 7 of 10 lating HCC metastasis, a Proteome Profiler Human Phospho- tumors formed in the liver with 6 developing extrahepatic metas- Kinase Array Kit was utilized to compare the relative levels of tasis in the lung; sh-3834: 8 of 10 tumors formed in the liver with 4 43 human protein kinase phosphorylation between HCC cells developing extrahepatic metastasis in the lung). In contrast, with or without TP53INP1 knocked down. Intensity of the spots on MHCC97L control cells only resulted in tumor growth in the the array was quantified by ImageJ analyses and those spots that liver in 6 of 10 mice injected, with only 2 mice going on to develop displayed >1.5-fold change between control and TP53INP1 lung metastasis (Fig. 2E; only 4 representative mice shown). Mice knocked down cells were selected for further validation by Western were sacrificed after 8 weeks and both livers and lungs were blotting analyses. Altogether, 6 phospho-kinases were found removed for histologic analyses. Hematoxylin and eosin (H&E) altered, including pERK1/2 (T202/Y204 and T185/Y187), pGSK3b staining of the tumors confirmed the bioluminescence signals (S21/S9), pAMPK1a (T183), pAMPK2a (T172), p-p53 (S15), and observed to indeed represent tumor cells and that there is altered p-WNK1 (T60; Fig. 3A), of which only p-ERK1/2 could be validated ability of the cells to metastasize to the lung as evident by to be commonly increased in both MIHA and MHCC97L cells (Fig. increased number of tumor nodules present there (Fig. 2E and 3B). To further validate the role of pERK1/2 signaling in TP53INP1- F). Immunohistochemical analysis also found TP53INP1 expres- regulated metastasis, we analyzed the impact of introducing an

www.aacrjournals.org Cancer Res; 77(17) September 1, 2017 4605

Ng et al.

Figure 2. TP53INP1 knockdown promotes HCC metastasis. A, Western blotting analysis of TP53INP1 expression in a panel of immortalized normal liver (MIHA and LO2), hepatoblastoma (HepG2), and HCC (SK-Hep1, HLE, SNU182, PLC8024, MHCC97L, Hep3B, QSG-7701, and QGY-7703) cell lines. B, Validation of TP53INP1 knockdown in MIHA and MHCC97L cells by Western blotting. NTC, nontarget control. sh-TP53INP1 clones 464 and 3834. Representative images and quantiﬁcation of number of cells that migrated (C) or invaded (D) in MIHA and MHCC97L cells with or without TP53INP1 suppressed. Scale bar, 50 mm. , P < 0.05; , P < 0.01; and , P < 0.001 compared with NTC control. E, Bioluminescence imaging of four representative nude mice injected intrahepatically with luciferase-labeled MHCC97L cells with or without TP53INP1 suppressed. Ex vivo imaging of the livers and lungs harvested from nude mice that received orthotopic liver injections. n ¼ 10 mice per group. Bar chart summary of number of metastatic foci observed in lung. , P < 0.05 and , P < 0.001 compared with NTC control. F, Representative H&E and immunohistochemistry staining of TP53INP1 images of liver and lung tissues harvested. Scale bar, 50 mm. n ¼ 10. NTC, nontarget control. sh-TP53INP1 clones, 464 and 3834.

ERK inhibitor (U0126) or stable shRNA against ERK1/2 into enzymes within the larger family of DUSPs, which all share a HCC cells with TP53INP1 stably repressed on these altered conserved cluster of basic amino acid residues involved in MAPK metastatic phenotype. Introduction of U0126 or sh-ERK1/2 in recognition (23–25). A screen of these DUSP members at the TP53INP1-suppressed HCC cells attenuated in vitro cell migra- genomic level by qRT-PCR in HCC cells with or without tion and invasion abilities (Figs. 3C and D, 4A; Supplementary TP53INP1 suppressed identified DUSP10/MKP-5 to be consis- Fig. S3), as well as lung metastasis in vivo (Fig. 4B–D), suggest- tently downregulated in both MIHA and MHCC97L cells following that ERK signaling is needed to drive metastasis in ing TP53INP1 knockdown (Fig. 5A). This observation was further TP53INP1-deficient HCC. Immunohistochemical analysis also validated at the proteomic level by Western blotting where found p-ERK expression to be preferentially expressed in the DUSP10 was found to be significantly downregulated (Fig. livers and lungs of the nontarget control of sh-TP53INP1 5B), concomitant with p-ERK1/2 activation in TP53INP1 xenografts (Fig. 4D). Note that 1 mmol/L and 10 mmol/L of shRNA-expressing cells as compared with control cells (Fig. ERK inhibitor U0126 was initially used to test which concen- 3B). To further validate the role of DUSP10-mediated pERK1/2 tration was most appropriate for experimental use. At the end, signaling in TP53INP1 regulated metastasis, rescue experiments 10 mmol/L concentration was chosen as it resulted in complete where DUSP10 was reintroduced into HCC cells with TP53INP1 abolishment of ERK expression as evident by Western blotting stably repressed was carried out (Fig. 5C). Introduction of analysis, with no sign of toxicity to the cells (data not shown). DUSP10 in TP53INP1-suppressed HCC cells resulted in a marked decrease in phosphorylated ERK (Fig. 5C) concomitant with TP53INP1 inhibits HCC metastasis through DUSP10- attenuated abilities of HCC cells to migrate and invade in vitro dependent modulation of ERK (Fig. 5D and E), suggesting that DUSP10-mediated alteration of p- Dual-specificity MAP kinase (MAPK) phosphatases (MKPs or ERK in TP53INP1 low/absent HCC cells can indeed promote DUSPs) are well-established negative regulators of MAPK/ERK metastasis. Consistently, we also observed a significantly lower signaling in mammalian cells and tissues. By virtue of their expression of DUSP10 in human HCC samples with extrahepatic differential subcellular localization and ability to specifically metastases as compared with metastatic free HCC samples in the recognize, dephosphorylate and inactivate different MAPK iso- GSE40367 dataset (20). A positive correlation between TP53INP1 forms, they are key spatiotemporal regulators of pathway activity. and DUSP10 expression was also found in the same sample The MKPs constitute a distinct subgroup of 11 catalytically active cohort (R ¼ 0.4152; P ¼ 0.0001; Fig. 5F).

4606 Cancer Res; 77(17) September 1, 2017 Cancer Research

TP53INP1 in HCC Metastasis

Figure 3. Phopsho-kinase array profiling analysis identifies activation of ERK to be involved in TP53INP1-mediated HCC metastasis. A, Western blotting images of deregulated phospho-kinases spotted on the Proteome Profiler Human Phospho-Kinase Array, comparing MIHA cells transduced with NTC or sh-TP53INP1 clone 464. B, Western blotting analysis for levels of phosphorylated and total ERK1/2 in HCC cells expressing NTC or sh-TP53INP1 clones (464 and 3834). Representative images and quantification of number of cells that migrated (C) or invaded (D) in MIHA and MHCC97L cells expressing NTC or sh-TP53INP1 clones (464 and 3834) that were treated with DMSO vehicle control (V) or ERK inhibitor U0126 (10 mm). Scale bar, 50 mm. , P < 0.01 and , P < 0.001 compared with NTC/vehicle control. #, P < 0.05; ##, P < 0.01; and ###, P < 0.001 compared with vehicle.

p73, which transcriptional activity is known to be modulated by (17). Notably, both MIHA liver and MHCC97L HCC cell lines TP53INP1, binds and regulates DUSP10 via promoter binding that were used for functional experiments in our current study are and cooperatively drives ERK activation in HCC either p53 absent (MIHA) or mutant (MHCC97L). Both cell types To determine the link between TP53INP1- and DUSP10-medi- are, however, p73 wild-type. Luciferase reporter assays showed ated ERK signaling in regulating HCC metastasis, the upstream high transcriptional activity of endogenous p73 to DUSP10 in region of DUSP10 (1to4,400) was analyzed using JASPAR MHCC97L cells in both sites 1 and 2, as knockdown of p73 would (http://jaspar.genereg.net). Four predicted binding sites of p73, decrease the activation of DUSP10 promoter by two folds (Fig. which activity is known to be modified by TP53INP1 (17), was 6C). Stable knockdown of p73 in MHCC97L cells led to a marked found in the upstream region of DUSP10 [two sites in S1 (A and decrease in DUSP10 and concomitant increase in pERK1/2 expres- B); and two sites in S2 (C and D)], with a high relative score of sion; while overexpression of DUSP10 in cells with p73 stably >0.75 (Fig. 6A). ChIP assays showed high physical binding affinity suppressed can cancel this effect (Fig. 6D). Further, we found of endogenous p73 to DUSP10 in MHCC97L cells in two of the stable TP53INP1 knockdown in MHCC97L cell to also result in a four predicted sites, namely site B (at 3716 to 3699) and site D similar decrease in DUSP10 promoter activation (Fig. 6E). Immu- (at 1337 to 1320; Fig. 6B, left). To delineate the involvement of nohistochemical staining of xenograft tumors generated from TP53INP1 in the regulation of p73 activity and its subsequent HCC cells with and without TP53INP1 knockdown further val- binding to the promoter of DUSP10, we knocked down idated these observations as TP53INP1 repressed tumors dis- TP53INP1 in MHCC97L and repeated the ChIP assay again. played elevated pERK1/2 concomitant with a decrease in DUSP10 Silencing of TP53INP1 attenuated binding of p73 to DUSP10 (Supplementary Fig. S4). Note p73 expression levels remain promoter in the same two binding sites (B and D; Fig. 6B, right), unchanged in TP53INP1-repressed HCC cells, as evidenced by suggesting that TP53INP1 does indeed play a role in modulating both Western blotting and IHC analyses (Fig. 6F and Supplemen- the binding affinity of p73 to the DUSP10 promoter. Note that it tary Fig. S4). In addition, we also noted that in addition to has previously been reported that TP53INP1 can also alter the DUSP10, knockdown of TP53INP1 would similarly lead to a transactivation capacity of p73 on a number of genes, demon- marked downregulation of other known p73 targets, including strating a functional association between p73 and TP53INP1 MDM2 and BAX2 (Fig. 6F; ref. 17). Taken together, TP53INP1 can

www.aacrjournals.org Cancer Res; 77(17) September 1, 2017 4607

Ng et al.

Figure 4. TP53IN1 inhibits HCC metastasis via modulation of ERK signaling. A, Western blotting analysis for levels of total ERK1/2 in MHCC97L cells coexpressing sh-TP53INP1 clones and NTC or sh-ERK1/2. B, Bioluminescence imaging of nude mice injected intrahepatically with luciferase-labeled MHCC97L cells coexpressing sh-TP53INP1 clones and NTC or sh-ERK1/2. Ex vivo imaging of the livers and lungs harvested from nude mice that received orthotopic liver injections. C, Bar chart summary of number of metastatic foci observed in lung. , P < 0.05 compared with NTC control. D, Representative H&E and immunohistochemistry staining of p-ERK images of liver and lung tissues harvested.

enhance p73 ability to drive DUSP10 transcription, thereby, findings, such that we must ensure that the metastasis effect is altering downstream ERK signaling to drive HCC metastasis. In not a by-product of the cells' altered proliferation potential. To HCC tumors where p73 mutations are rarely observed, TP53INP1 address this, we repeated our migration and invasion assays again, downregulation promotes HCC metastasis through DUSP10 in the presence of mitomycin C, a drug used to inhibit cell inactivation via p73-dependent DUSP10 promoter binding and proliferation. regulation, resulting in activation of the ERK signaling pathway TP53INP1 is a stress-induced p53-target gene whose expression (Fig. 6G). is modulated by transcription factors such as p53, p73, and E2F1 (6, 17, 26). It encodes two protein isoforms, TP53INP1a and TP53INP1b (5), which have similar functions and can induce cell- Discussion cycle arrest and apoptosis when overexpressed (6). In association Metastasis is a major hallmark of cancer and yet remains the with homeodomain-interacting protein kinase-2 (HIPK2), most poorly understood component of cancer pathogenesis (2). It TP53INP1 phosphorylates p53 protein at serine 46, thereby is a complex multistep process involving alterations in the dis- enhancing p53 protein stability and its transcriptional activity, semination, invasion, survival, and growth of new cancer cell leading to transcriptional activation of p53-target genes, cell colonies, which are regulated by a complex network of intra- and growth arrest and apoptosis upon DNA damage stress (27). The intercellular signal transduction cascades (1). In this study, we antiproliferative and proapoptotic activities of TP53INP1 indicate demonstrate that TP53INP1 is frequently downregulated in that TP53INP1 has an important role in cellular homeostasis and advanced-stage and metastatic human HCC tumors and that DNA damage response. TP53INP1 can be subcellularly localized downregulation of TP53INP1 in HCC promotes metastasis in the nucleus or cytoplasm depending on the context. In addition through DUSP10 inactivation via p73-dependent DUSP10 pro- to its role in the nucleus where it stimulates the transcriptional moter binding and regulation, resulting in activation of the ERK activity of p53 and p73 (17, 27), it also contributes to autophagy signaling pathway. Findings from our study not only provide new and regulation of energetic metabolism and reactive oxygen insight into how HCC metastasis is regulated but also provide a species (28–31). new layer of mechanism by which DUSP10/ERK signaling is Deficiency in TP53INP1 expression results in increased tumor- regulated by p73/TP53INP1. Note that because TP53INP1-medi- igenesis. A number of studies have demonstrated a significant ated ERK1/2 activation can also lead to increased cell prolifera- reduction of TP53INP1 expression during cancer formation of the tion, we must take caution when we interpret our metastasis stomach (7), breast (8), pancreas (9), esophagus (10), lung (11),

4608 Cancer Res; 77(17) September 1, 2017 Cancer Research

TP53INP1 in HCC Metastasis

Figure 5. TP53INP1 inhibits HCC metastasis through DUSP10-dependent modulation of ERK. A, Left, relative expression of selected DUSP/MKP family members and TP53INP1 in MIHA and MHCC97L cells expressing NTC or sh-TP53INP1 clones (464 and 3834) by qRT-PCR. Right, validation of downregulated DUSP10 expression following TP53INP1 knockdown in MIHA and MHCC97L cells by qRT-PCR. B, Western blotting analysis for levels of DUSP10 in HCC cells expressing NTC or sh-TP53INP1 clones (464 and 3834). C, Western blotting analysis for levels of DUSP10, phosphorylated and total ERK1/2 in HCC cells coexpressing NTC or sh-TP53INP1 clones and empty vector or DUSP10 overexpression. Representative images and quantiﬁcation of number of cells that migrated (D) or invaded (E)in MIHA and MHCC97L cells coexpressing NTC or sh-TP53INP1 clones and empty vector or DUSP10 overexpression. Scale bar, 50 mm. , P < 0.05; , P < 0.01; and , P < 0.001 compared with NTC/EV control. ##, P < 0.01 and ###, P < 0.001 compared with EV control. F, Left box and whisker plot analysis of DUSP10 mRNA levels in metastasis-free HCCs (n ¼ 10) and HCCs with extrahepatic metastasis (n ¼ 20; GSE40367). The horizontal lines indicate data within median 1.5 interquartile range. Right, Pearson correlation analysis of TP53INP1 and DUSP10 mRNA levels in human HCC samples (n ¼ 30; GSE40367).

melanocyte (12), colon (13), and T-cell leukemia (14); and that TP53INP1 downregulation in cancers is regulated at multiple downregulation of TP53INP1 correlated with more aggressive levels by DNA methylation (10), the transcription factors c-myc clinicopathologic behaviors in several human cancer types (7–9, (10) and n-myc (36), histone deacetylase 2 (36) as well as a 11). TP53INP1-deﬁcient mice exhibited exacerbated colitis-asso- plethora of miRNAs including miR-569 (37), miR-155 (9, 38– ciated carcinogenesis (32), while TP53INP1 expression was found 40), miR-182 (41), miR-93, miR-130b (14, 18), miR-30a, miR- to be lost in rat preneoplastic liver lesions (33). In contrast to this, 205 (42–43), and miR-125b (11). Studies have not only dem- two recent studies published by the same group in 2012 have onstrated a functional tumor suppressive role of TP53INP1 but found TP53INP1 to be frequently overexpressed in prostate cancer also a role in modulating cancer stem cell phenotypes (38), and castration-resistant prostate cancer, and that its overexpres- cisplatin and gemcitabine resistance (41, 44), as well as oxidative sion correlated with poor prognostic factors and is predictive of stress (45). In our previous studies, we found that the initiation, þ tumor relapse (34, 35), suggesting that TP53INP1 appears to play growth, and self-renewal of CD133 liver tumors are regulated by a dual role as both a tumor-suppressing and tumor-promoting a balance of miR-130b overexpression and TP53INP1 down- gene and that its expression trend is cancer type speciﬁc. regulation (18), yet to date, the role of TP53INP1 in HCC

www.aacrjournals.org Cancer Res; 77(17) September 1, 2017 4609

Ng et al.

Figure 6. p73, which transcriptional activity is modulated by TP53INP1, binds and regulates DUSP10 via promoter binding and cooperatively drives ERK activation in HCC. A, Computational prediction of p73 binding sites (S1 at 4,400 to 2,201 bp and S2 at 2,200 to 1 bp) on DUSP10 promoter region by JASPAR matrix model. B, Conﬁrmation of p73 binding to candidate DUSP10 sites by ChIP-qPCR analysis in MHCC97L cells with or without TP53INP1 suppressed. Chromatins were immunoprecipitated by anti-p73 antibody, and the enrichment of predicted p73 binding sites on DUSP10 (sites A, B, C,andD) relative to IgG control was conﬁrmed by qPCR. C, Luciferase reporter assays in MHCC97L cells expressing NTC or sh-p73 clones (753 and 1643) to validate the interaction between p73 and DUSP10 at both predicted regions. pRL-TK Renilla luciferase plasmid cotransfected for normalization. , P < 0.01 and , P < 0.001 compared with NTC control. D, Western blotting analysis for levels of p73, DUSP10, phosphorylated and total ERK1/2 in HCC cells expressing NTC or sh-p73 clones (753 and 1643), with empty vector (EV) or DUSP10 overexpressed. E, Luciferase reporter assays in MIHA and MHCC97L cells expressing NTC or sh-TP53INP1 clones (464 and 3834) to validate the interaction between p73 and DUSP10 at both predicted regions. pRL-TK Renilla luciferase plasmid cotransfected for normalization. , P < 0.01 and , P < 0.001 compared with NTC control. F, Western blotting analysis for levels of p73, MDM2, and BAX in HCC cells expressing NTC or sh-TP53INP1 clones (464 and 3834). G, Proposed model illustrates how TP53INP1 downregulation promotes HCC metastasis through a p73-dependent DUSP10/ERK signaling pathway. Dotted box with question mark indicates how TP53INP1 interacts with p73 is still unknown.

metastasis or the molecular mechanism by which TP53INP1 which according to our previous experience and studies would regulates migration and invasion in HCC has not been explored. represent the a isoform. We did observe a much weaker band at Prior to findings presented in this study, only three reports have 55-kDa band, which in our experience would correspond to the b linked TP53INP1 to metastasis where they found TP53INP1 to isoform of TP53INP1. However, this band was only detected reduce pancreatic cancer cell migration by regulating SPARC upon extensive exposure. RT-PCR analysis on HCC cell lines, expression (16); that TP53INP1 is downregulated in distant lung clinical samples and sh-TP53INP1 HCC cells using primers spe- metastasis of brain cancer (15); and TP53INP1 30UTR to function cific to just a isoform, b isoform or both a and b isoforms, as a competitive endogenous RNA (ceRNA) in repressing the revealed that expression levels were similarly expressed or unex- metastasis of glioma cells by regulating miRNA activity (46). pressed (data not shown). Whether the two isoforms are differ- Specifically, using a mouse model of skin wound healing in entially expressed at the mRNA and protein level or would exert TP53INP1 wild-type and deficient mice, our collaborators ele- different functional roles in HCC would need to be further gantly showed TP53INP1 to suppress cell migration in vivo. studied. Similar observations were also noted in vitro in TP53INP1 wild- There is ample evidence to show that TP53INP1 can alter the type and deficient mouse embryonic fibroblasts (MEF). Above transactivation capacity of a number of genes through both p53- studies collectively support a role of TP53INP1 in regulating and p73-dependent manners (17). P53 is mutated in approxi- metastasis. mately 30% of all liver cancers (47). But unlike p53, mutation of As mentioned above, TP53INP1 encodes two protein isoforms p73 is not a common event in HCC nor other human tumors. P73 (a and b; ref. 5). This current study did not examine these two was also not found to be differentially expressed in nontumor isoforms separately, but just looked at the role of both isoforms versus HCC (GSE25097) nor metastatic-free HCC versus HCC collectively in HCC. The antibody used for Western blotting with extrahepatic metastasis (GSE40367; data not shown). Here, analysis binds to the N-terminus of TP53INP1, which detects we have uncovered a novel mechanism by which TP53INP1 both protein isoforms. However, it should be noted that a downregulation contributes to HCC metastasis, through a p73- predominant 36-kDa band was observed in the Western blotting, dependent DUSP10/ERK signaling pathway. The immortalized

4610 Cancer Res; 77(17) September 1, 2017 Cancer Research

TP53INP1 in HCC Metastasis

normal liver and HCC cell lines that were used in this current metastasis-free HCCs. Samples of these are rare and of particular study, namely MIHA and MHCC97L, respectively, were either p53 importance to studies like this that focuses specifically on HCC deleted or mutated, but were both p73 intact. Whether down- metastasis. regulation of TP53INP1 promotes HCC metastasis through a similar DUSP10/ERK mechanism in a p53-dependent manner Disclosure of Potential Conflicts of Interest needs to be further studied using appropriate cell lines that harbor No potential conflicts of interest were disclosed. wild-type p53. It is interesting to note that we were also able to fi predict ve p53 putative binding sites on the DUSP10 promoter Authors' Contributions with a relative score higher than 0.75 (which is the same setting Conception and design: K.-Y. Ng, T.K. Lee, S. Ma used for prediction of p73 binding sites on DUSP10), suggesting Development of methodology: S. Chai that TP53INP1 may also indeed control DUSP10/ERK pathway Acquisition of data (provided animals, acquired and managed patients, via a p53-dependent manner. If experimentally proven, provided facilities, etc.): K.-Y. Ng, L.-H. Chan, S. Chai, M. Tong, N.P. Lee, TP53INP1 downregulation would be able to regulate DUSP10/ Y. Yuan, D. Xie, N.J. Dusetti, A. Carrier, S. Ma ERK via both p53 and p73 means, uncovering a new mechanism Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): K.-Y. Ng, M. Tong, S. Ma for all p53 wild-type, mutated/deleted HCC tumors. fi Writing, review, and/or revision of the manuscript: K.-Y. Ng, N.J. Dusetti, S. Ma p63 also exhibits signi cant structural homology to p53 and Administrative, technical, or material support (i.e., reporting or organizing p73, has been reported to bind to the same responsive element as data, constructing databases): S. Chai, X.-Y. Guan, D. Xie, S. Ma p73 and plays a role in cancer metastasis (48). It would also be Study supervision: S. Ma intriguing to study the possible involvement of p63 and TP53INP1-mediated suppression of metastasis. Toward this end, Acknowledgments we went back to examine the p63 status in HCC tissues and found We thank the Faculty Core Facility at the LKS Faculty of Medicine, The that p63 expression is largely absent in HCC (49, 50). With this, University of Hong Kong for providing and maintaining the equipment needed we cannot conclude that p63 has no role in TP53INP1-mediated for animal imaging. DUSP10/ERK signaling, but at least in the context of HCC, where p63 expression is absent, chances are low. Grant Support Our study benefitted from the fast growing publicly available This work was supported in part by grants from Research Grants Council– transcriptome datasets deposited in NCBI Gene Expression General Research Fund (HKU_773412M), Collaborative Research Fund Omnibus. The two datasets used, namely GSE40367 (20) and (C7027-14G), and the Croucher Foundation Innovation Award to S. Ma. The costs of publication of this article were defrayed in part by the payment of GSE25097 (19), were chosen in particular as the clinical samples advertisement fi page charges. This article must therefore be hereby marked in pro led are all representative of Asian ethnicity and are thus more accordance with 18 U.S.C. Section 1734 solely to indicate this fact. relevant to the disease in our locality. In particular, the GSE40367 dataset was sampled from laser capture microdissected tissue of Received December 19, 2016; revised May 26, 2017; accepted June 27, 2017; pure tumor cells of HCCs with extrahepatic metastases and published OnlineFirst July 3, 2017.

References 1. Chaffer CL, Weinberg RA. A perspective on cancer cell metastasis. Science 11. Li Q, Han Y, Wang C, Shan S, Wang Y, Zhang J, et al. MicroRNA-125b 2011;331:1559–64. promotes tumor metastasis through targeting tumor protein 53-induced 2. Nguyen DX, Bos PD, Massague J. Metastasis: from dissemination to organ- nuclear protein 1 in patients with non-small-cell lung cancer. Cancer Cell specific colonization. Nat Rev Cancer 2009;9:274–84. Int 2015;15:84. 3. Reddy KB, Nabha SM, Atanaskova N. Role of MAP kinase in tumor 12. Bonazzi VF, Irwin D, Hayward NK. Identification of candidate tumor progression and invasion. Cancer Metastasis Rev 2003;22:395–403. suppressor genes inactivated by promoter methylation in melanoma. 4. Caunt CJ, Keyse SM. Dual-specificity MAP kinase phosphatases (MKPs): Genes Chromosomes Cancer 2009;48:10–21. shaping the outcome of MAP kinase signalling. FEBS J 2013;280:489–504. 13. Shibuya H, Iinuma H, Shimada R, Horiuchi A, Watanabe T. Clinicopatho- 5. Tomasini R, Samir AA, Vaccaro MI, Pebusque MJ, Dagorn JC, Iovanna JL, et al. logical and prognostic value of microRNA-21 and microRNA-155 in Molecular and functional characterization of the stress-induced protein (SIP) colorectal cancer. Oncology 2010;79:313–20. gene and its two transcripts generated by alternative splicing. SIP induced by 14. Yeung ML, Yasunaga J, Bennasser Y, Dusetti N, Harris D, Ahmad N, et al. stress and promotes cell death. J Biol Chem 2001;276:44185–92. Roles for microRNAs, miR-93 and miR-130b, and tumor protein 53- 6. Okamura S, Arakawa H, Tanaka T, Nakanishi H, Ng CC, Taya Y, et al. induced nuclear protein 1 tumor suppressor in cell growth dysregulation p53DINP1, a p53-inducible gene, regulates p53-dependent apoptosis. Mol by human T-cell lymphotrophic virus 1. Cancer Res 2008;68:8976–85. Cell 2001;8:85–94. 15. Zohrabian VM, Nandu H, Gulati N, Khitrov G, Zhao C, Mohan A, et al. 7. Jiang PH, Motoo Y, Garcia S, Iovanna JL, Pebusque MJ, Sawabu N. Down- Gene expression profiling of metastatic brain cancer. Oncol Rep 2007; expression of tumor protein 53-induced nuclear protein 1 in human gastric 18:321–8. cancer. World J Gastroenterol 2006;12:691–6. 16. Seux M, Peuget S, Montero MP, Siret C, Rigot V, Clerc P, et al. TP53INP1 8. Ito Y, Motoo Y, Yoshida H, Iovanna JL, Takamura Y, Miya A, et al. Decreased decreases pancreatic cancer cell migration by regulating SPARC expression. expression of tumor protein p53-induced nuclear protein 1 (TP53INP1) in Oncogene 2011;30:3049–61. breast carcinoma. Anticancer Res 2006;26:4391–5. 17. Tomasini R, Seux M, Nowak J, Bontemps C, Carrier A, Dagorn JC, et al. 9. Gironella M, Seux M, Xie MJ, Cano C, Tomasini R, Gommeaux J, et al. TP53INP1 is a novel p73 target gene that induces cell cycle arrest and cell Tumor protein 53-induced nuclear protein 1 expression is repressed by death by modulating p73 transcriptional activity. Oncogene 2005; miR-155, and its restoration inhibits pancreatic tumor development. Proc 24:8093–104. Natl Acad Sci U S A 2007;104:16170–5. 18. Ma S, Tang KH, Chan YP, Lee TK, Kwan PS, Castilho A, et al. miR-130b 10. Weng W, Yang Q, Huang M, Qiao Y, Xie Y, Yu Y, et al. c-Myc inhibits promotes CD133(þ) liver tumor-initiating cell growth and self-renewal TP53INP1 expression via promoter methylation in esophageal carcinoma. via tumor protein 53-induced nuclear protein 1. Cell Stem Cell 2010; Biochem Biophys Res Commun 2011;405:278–84. 7:694–707.

www.aacrjournals.org Cancer Res; 77(17) September 1, 2017 4611

Ng et al.

19. Lamb JR, Zhang C, Xie T, Wang K, Zhang B, Hao K, et al. Predictive genes in nostic factors and is predictive of biological cancer relapse. Prostate adjacent normal tissue are preferentially altered by sCNV during tumor- 2012;72:117–28. igenesis in liver cancer and may rate limiting. PLoS One 2011;6:e20090. 36. Shahbazi J, Scarlett CJ, Norris MD, Liu B, Haber M, Tee AE, et al. Histone 20. Ye QH, Zhu WW, Zhang JB, Qin Y, Lu M, Lin GL, et al. GOLM1 modulates deacetylase 2 and N-Myc reduce p53 protein phosphorylation at serine 46 EGFR/RTK cell-surface recycling to drive hepatocellular carcinoma metas- by repressing gene transcription of tumor protein 53-induced nuclear tasis. Cancer Cell 2016;30:444–58. protein 1. Oncotarget 2014;5:4257–68. 21. Brown JJ, Parashar B, Moshage H, Tanaka KE, Engelhardt D, Rabbani E, 37. Chaluvally-Raghavan P, Zhang F, Pradeep S, Hamilton MP, Zhao X, et al. A long-term hepatitis B viremia model generated by transplanting Rupaimoole R, et al. Copy number gain of hsa-miR-569 at 3q26.2 leads nontumorigenic immortalized human hepatocytes in Rag-2-deficient to loss of TP53INP1 and aggressiveness of epithelial cells. Cancer Cell mice. Hepatology 2000;31:173–81. 2014;26:863–79. 22. Li Y, Tang ZY, Ye SL, Liu Y, Chen J, Xue Q, et al. Establishment of cell clones 38. Liu F, Kong X, Lv L, Gao J. TGF-b1 acts through miR-155 to down-regulate with different metastatic potential from the metastatic hepatocellular TP53INP1 in promoting epithelial-mesenchymal transition and cancer carcinoma cell line MHCC97. World J Gastroenterol 2001;6:630–6. stem cell phenotypes. Cancer Lett 2015;359:288–98 23. Kidger AM, Keyse SM. The regulation of oncogenic Ras/ERK signalling by 39. Zhang J, Cheng C, Yuan X, He JT, Pan QH, Sun FY. microRNA-155 acts as an dual-specificity mitogen activated protein kinase phosphatases (MKPs). oncogene by targeting the tumor protein 53-induced nuclear protein 1 in Semin Cell Dev Biol 2016;50:125–32. esophageal squamous cell carcinoma. Int J Clin Exp Pathol 2014;7: 24. Keyse SM. Dual-specificity MAP kinase phosphatases (MKPs) and cancer. 602–10. Cancer Metastasis Rev 2008;27:253–61. 40. Zhang CM, Zhao J, Deng HY. MiR-155 promotes proliferation of human 25. Nomura M, Shiba K, Katagiri C, Kasugai I, Masuda K, Sato I, et al. Novel breast cancer MCF-7 cells through targeting tumor protein 53-induced function of MKP-5/DUSP10, a phosphatase of stress-activated kinases, on nuclear protein 1. J Biomed Sci 2013;20:79. ERK-dependent gene expression, and upregulation of its gene expression in 41. Qin J, Luo M, Qian H, Chen W. Upregulated miR-182 increases drug colon carcinomas. Oncol Rep 2012;28:931–6. resistance in cisplatin-treated HCC cell by regulating TP53INP1. Gene 26. Tomasini R, Samir AA, Pebusque MJ, Calvo EJ, Totaro S, Dagorn JC, et al. 2014;538:342–7. P53-dependent expression of the stress-induced protein (SIP). Eur J Cell 42. Xu CG, Yang MF, Fan JX, Wang W. MiR-30a and miR-205 are down- Biol 2002;81:294–301. regulated in hypoxia and modulate radiosensitivity of prostate cancer cells 27. Tomasini R, Samir AA, Carrier A, Isnardon D, Cecchinelli B, Soddu S, et al. by inhibiting autophagy via TP53INP1. Eur Rev Med Pharmacol Sci TP53INP1s and homeodomain-interacting protein kinase-2 (HIPK2) are 2016;20:1501–8. partners in regulating p53 activity. J Biol Chem 2003;278:37722–9. 43. Nie G, Duan H, Li X, Yu Z, Luo L, Lu R, et al. MicroRNA-205 promotes 28. Seillier M, Pouyet L, N'Guessan P, Nollet M, Capo F, Guillaumond F, et al. the tumorigenesis of nasopharyngeal carcinoma through targeting Defects in mitophagy promotes redox-driven metabolic syndrome in the tumor protein p53-inducible nuclear protein 1. Mol Med Rep 2015; absence of TP53INP1. EMBO Mol Med 2015;7:802–18. 12:5715–22. 29. Cano CE, Gommeaux J, Pietri S, Culcasi M, Garcia S, Seux M, et al. Tumor 44. Nakaya N, Ishigaki Y, Nakajima H, Murakami M, Shimasaki T, Takata T, protein 53-induced nuclear protein 1 is a major mediator of p53 antiox- et al. Meaning of tumor protein 53-induced nuclear protein 1 in the idant function. Cancer Res 2009;69:219–26. molecular mechanism of gemcitabine sensitivity. Mol Clin Oncol 2013; 30. Seillier M, Peuget S, Gayet O, Gauthier C, N'Guessan P, Monte M, et al. 1:100–4. TP53INP1, a tumor suppressor, interacts with LC3 and ATG8-family 45. Al Saati T, Clerc P, Hanoun N, Peuget S, Lulka H, Gigous V, et al. Oxidative proteins through the LC3-interacting region (LIR) and promotes autop- stress induced by inactivation of TP53INP1 cooperates with KrasG12D to hagy-dependent cell death. Cell Death Differ 2012;19:1525–35. initiate and promote pancreatic carcinogenesis in the murine pancreas. Am 31. Saadi H, Seillier M, Carrier A. The stress protein TP53INP1 plays a tumor J Pathol 2013;182:1996–2004. suppressive role by regulating metabolic homeostasis. Biochimie 2015; 46. Wang Y, Lin G. TP53INP1 30-UTR functions as a ceRNA in repressing the 118:44–50. metastasis of glioma cells by regulating miRNA activity. Biotechnol Lett 32. Gommeaux J, Cano C, Garcia S, Gironella M, Pietri S, Culcasi M, et al. Colitis 2016;38:1699–707. and colitis-associated cancer are exacerbated in mice deficient for tumor 47. Olivier M, Hollstein M, Hainaut P. TP53 mutations in human cancers: protein 53-induced nuclear protein 1. Mol Cell Biol 2007;27:2215–28. origins, consequences, and clinical use. Cold Spring Harb Perspect Biol 33. Ogawa K, Asamoto M, Suzuki S, Tsujimura K, Shirai T. Downregulation of 2010;2:a001008. apoptosis revealed by laser microdissection and cDNA microarray analysis 48. DeYoung MP, Ellisen LW. p63 and p73 in human cancer: defining the of related genes in rat liver preneoplastic lesions. Med Mol Morphol 2005; network. Oncogene 2007;26:5169–83. 38:23–9. 49. Ramalho FS, Ramalho LN, Della Porta L, Zucoloto S. Comparative immu- 34. Giusiano S, Baylot V, Andrieu C, Fazli L, Gleave M, Iovanna JL, et al. nohistochemical expression of p63 in human cholangiocarcinoma and TP53INP1 as new therapeutic target in castration-resistant prostate cancer. hepatocellular carcinoma. J Gastroenterol Hepatol 2006;21:1276–80. Prostate 2012;72:1286–94. 50. Tannapfel A, Wittekind C. Genes involved in hepatocellular carcinoma: 35. Giusiano S, Garcia S, Andrieu C, Dusetti NJ, Bastide C, Gleave M, et al. deregulation in cell cycling and apoptosis. Virchows Arch 2002;440: TP53INP1 overexpression in prostate cancer correlates with poor prog- 345–52.

4612 Cancer Res; 77(17) September 1, 2017 Cancer Research

TP53INP1 Downregulation Activates a p73-Dependent DUSP10/ERK Signaling Pathway to Promote Metastasis of Hepatocellular Carcinoma

Kai-Yu Ng, Lok-Hei Chan, Stella Chai, et al.

Cancer Res 2017;77:4602-4612. Published OnlineFirst July 3, 2017.

Updated version Access the most recent version of this article at: doi:10.1158/0008-5472.CAN-16-3456

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2017/07/01/0008-5472.CAN-16-3456.DC1

Cited articles This article cites 50 articles, 10 of which you can access for free at: http://cancerres.aacrjournals.org/content/77/17/4602.full#ref-list-1

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at Subscriptions [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/77/17/4602. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.