DOCSLIB.ORG

ONCOGENOMICS a Genome-Wide Study of the Repressive Effects of Estrogen Receptor Beta on Estrogen Receptor Alpha Signaling in Breast Cancer Cells

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
ONCOGENOMICS a Genome-Wide Study of the Repressive Effects of Estrogen Receptor Beta on Estrogen Receptor Alpha Signaling in Breast Cancer Cells Oncogene (2008) 27, 1019–1032 & 2008 Nature Publishing Group All rights reserved 0950-9232/08 $30.00 www.nature.com/onc ONCOGENOMICS A genome-wide study of the repressive effects of estrogen receptor beta on estrogen receptor alpha signaling in breast cancer cells C Williams, K Edvardsson, SA Lewandowski, A Stro¨ m and J-A˚ Gustafsson Department of Biosciences and Nutrition at Novum, Karolinska Institutet, Huddinge, Sweden Transcriptional effects of estrogen result from its activa- mediated via two estrogen receptor (ER) isoforms, that tion of two estrogen receptor (ER) isoforms; ERa that is, ER alpha (ERa) and ER beta (ERb) (Hanstein et al., drives proliferation and ERb that is antiproliferative. 2004). The second ER isoform, ERb, was discovered Expression of ERb in xenograft tumors from the T47D some 10years ago (Kuiper et al., 1996). ERa and ERb breast cancer cell line reduces tumor growth and are homologous, especially in their DNA-binding angiogenesis. If ERb can halt tumor growth, its introduc- domains (97%), but they differ in their ligand-binding tion into cancers may be a novel therapeutic approach to domains (59% identity) and in their transcriptional the treatment of estrogen-responsive cancers. To assess activating function-1 (AF-1) domains. Estrogen is non- the complete impact of ERb on transcription, we have selective for the two receptors and the binding of made a full transcriptome analysis of ERa- and ERb- estrogen results in a receptor–ligand complex that binds mediated gene regulation in T47D cell line with Tet-Off with high affinity to estrogen responsive elements regulated ERb expression. Of the 35 000 genes and (EREs) on DNA. Transcriptional regulation by the transcripts analysed, 4.1% (1434) were altered by ERa ERs may occur through a direct interaction of ERs with activation. Tet withdrawal and subsequent ERb expres- EREs or through an interaction of ER with other sion inhibited the ERa regulation of 998 genes and, in transcription factors (Sp1, AP-1 and NF-kB; McDon- addition, altered expression of 152 non-ERa-regulated nell and Norris, 2002). The two receptors can hetero- genes. ERa-induced and ERb-repressed genes were dimerize, and they may modulate each other’s effects involved in proliferation, steroid/xenobiotic metabolism (Gustafsson, 2006). ERb often behaves as an antagonist and ion transport. The ERb repressive effect was further to ERa (Nilsson et al., 2001). The basis of this confirmed by proliferation assays, where ERb was shown antagonism has been shown to be due to the reduction to completely oppose the ERa–E2 induced proliferation. in ERa protein level and reduced recruitment of the Additional analysis of ERb with a mutated DNA-binding activating protein-1 complex (Matthews et al., 2006). domain revealed that this mutant, at least for a quantity of Detection of ERa protein in a breast tumor helps to genes, antagonizes ERa even more strongly than ERb wt. identify those breast cancer patients who may respond From an examination of the genes regulated by ERa and to hormonal intervention, and measurement of ERa has ERb, we suggest that introduction of ERb may be an become standard in the clinical management of breast alternative therapeutic approach to the treatment of cancer. However, only about 50% of ERa-expressing certain cancers. tumors respond well to hormonal therapy. ERb is Oncogene (2008) 27, 1019–1032; doi:10.1038/sj.onc.1210712; expressed at high concentration in normal human published online 13 August 2007 mammary gland tissue and expression is lost or decreased in breast cancer (Palmieri et al., 2002; Keywords: estrogen receptor; microarray; breast cancer; Esslimani-Sahla et al., 2005). When it is reintroduced gene regulation into breast cancer cells, ERb is antiproliferative (Paruthiyil et al., 2004; Strom et al., 2004; Murphy et al., 2005; Hartman et al., 2006). Several investigators have used the breast cancer cell ONCOGENOMICS Introduction line MCF-7 to evaluate the transcriptional effect of ERa in response to estrogen (Frasor et al., 2003, 2004; Estrogen is involved in the regulation of the reproduc- Buterin et al., 2006), and shown that many genes tive, immune, cardiovascular, musculo/skeletal and associated with the control of cell cycle, proliferation central nervous systems. The effects of estrogens are and apoptosis are regulated by ERa. Few reports have focused on ERb, in terms of global transcriptional effects, and no direct transcriptional targets of ERb Correspondence: C Williams, Department of Biosciences and Nutrition have been convincingly described. In an effort to at Novum, Karolinska Institutet, Ha¨ lsova¨ gen 7-9, 14157 Huddinge, elucidate the gene regulatory function of ERb and the Sweden. E-mail: [email protected] mechanisms behind its suggested anti-tumorigenic role, Received 16 January 2007; revised 19 June 2007; accepted 5 July 2007; we performed a full transcriptome analysis of the cell published online 13 August 2007 line used in our recently reported experimental model of Role of ERb in breast cancer cells C Williams et al 1020 ERb-dependent reduction of breast tumors (Strom Gene expression changes caused by ERa and ERb et al., 2004; Hartman et al., 2006). We identify clear We found that the activation of ERa alone by E2 differences between gene regulation by ERa and ERb, (Comparison I, referred to as the ‘ERa profile’) resulted respectively, and report previously unknown targets of in the differential expression of 1 434 out of the analysed estrogen regulation. Our data provide further insight 35 000 transcripts. Correlations of M-values (2 log of into the interplay between the two receptors and the FC) between the replicated arrays are shown in antiproliferative actions of ERb. Figure 1d, where the arrow in Comparison (I) indicates the maximally ERa-regulated gene TFF1/pS2, FC 34.8 (confirmed with real-time PCR as upregulated 301 times). Of the 50strongest regulated genes, 40(80%) Results and discussions were upregulated. Overall the proportion of upregulated genes was 63% (897 out of 1 434 genes). When the cells We have recently reported on the use of the breast expressed both ERa and ERb (TetÀ culture), E2 cancer cell line T47D with a tetracyclin (Tet) responsive treatment affected 588 genes (Comparison IV). The element regulating ERb expression to study the role of pS2 gene was now upregulated only 4.4-fold (confirmed ERb in tumors formed from T47D cells. In the absence with real-time PCR as upregulated 53 times). The ERb- of Tet, ERb was induced in these tumors resulting in the mediated negative effect on this gene is in line with reduction of tumor size and inhibition of angiogenesis previously published data (Matthews et al., 2006). Venn (Hartman et al., 2006). To investigate the mechanisms diagram in Figure 2a further shows that Tet withdrawal by which ERb opposes the growth of ERa-positive and the subsequent ERb expression more or less tumors, we analysed the genome-wide transcriptional inhibited ERa regulation of 998 genes and, in addition, effects of ERb induction in T47D breast cancer cells. We altered expression of 152 genes not regulated when ERa examined the response of the cells to estrogen in the was the only ER expressed. The remaining 436 ERa- presence of ERa alone or ERa and ERb together, and regulated genes were still differentially expressed when the effects of induction of ERb. In the presence of Tet, ERb was present at high levels. Selective induction of ERa is the predominant receptor expressed and follow- ERb (Comparison II), excluding gene regulation possi- ing Tet withdrawal, ERb is induced to ERa at a ratio of bly inherent to the Tet-Off system as determined by approximately 4:1 (Strom et al., 2004). A mock T47D control analysis, strongly affected the expression of 196 Tet-Off PBI control was analysed to define non-ERb- genes as a result of ERb expression. Among the 50most related gene expression inherent in the Tet-Off model affected genes, 37 (74%) were downregulated following used. A 240-fold increase in ERb transcript levels was ERb expression. Thus, ERa induces and ERb negatively observed after Tet withdrawal in 17b-estradiol (E2) modulates a majority of their regulated genes. Tables 1 treated cultures; the relative ERb mRNA levels as and 2 show the top regulated genes of the ‘ERa profile’ analysed by real-time PCR are shown in Figure 1a. and ‘ERb profile’, respectively. Observation of ERb protein co-expressed with green We used the Gene Ontology classification and the fluorescent protein (GFP) confirms that there was a EASE package for a two-step functional analysis to corresponding increase from undetectable to clearly identify biological themes that were overrepresented visible levels of induced protein in the cells (Figure 1b). among the differentially expressed genes (a Gene To estimate ERa-induced gene expression, E2-treated Ontology annotation was assigned to approximately cells without the expression of ERb were compared to an 50% of the regulated genes). The most overrepresented equivalent cell line treated with the antiestrogen ICI gene group of the ‘ERa profile’ was the upregulated 182780(ICI) (Comparison I: E2 T47D Tet þ compared to genes within the ‘cell cycle’ (EASE score 4.2 e–034). ICI T47D Tet þ ). To obtain ERb-induced alterations, Here, 101 genes were significantly upregulated upon E2 three separate studies were performed comparing genes stimulation; of these 53 belonged to the subgroup altered upon the introduction of ‘active’ ERb (Compar- ‘regulation of cell cycle’ and 11 to the subgroup of ‘cell ison II: E2 T47D TetÀ compared to E2 T47D Tet þ ); cycle checkpoint’ (BRCA2, TP53, BUB1, BUB1B, genes altered upon the introduction of ‘inactive’ ERb BUB3, CCNA2, CHEK1, MAD2L1, RBBP8, TTK (Comparison III: ICI T47D TetÀ compared to ICI T47D and GTSE1).
Load more

Recommended publications
  • Identification of the Causative Gene for Simmental Arachnomelia Syndrome Using a Network-Based Disease Gene Prioritization Approach
    Identification of the Causative Gene for Simmental Arachnomelia Syndrome Using a Network-Based Disease Gene Prioritization Approach Shihui Jiao1., Qin Chu2., Yachun Wang1*, Zhenquan Xie3, Shiyu Hou3, Airong Liu5, Hongjun Wu4, Lin Liu6, Fanjun Geng7, Congyong Wang7, Chunhua Qin8, Rui Tan9, Xixia Huang10, Shixin Tan11, Meng Wu12, Xianzhou Xu12, Xuan Liu1, Ying Yu1, Yuan Zhang1 1 Key Laboratory of Agricultural Animal and Breeding, National Engineering Laboratory for Animal Breeding, College of Animal Science and Technology, China Agricultural University, Beijing, China, 2 Institute of Animal Husbandry and Veterinary Medicine, Beijing Academy of Agriculture and Forestry Sciences, Beijing, China, 3 Anshan Hengli Dairy Farm, Anshan, Liaoning, China, 4 Xiertala Breeding Farm, Hailaer Farm Buro, Hailaer, Inner Mongolia, China, 5 Hailaer Farm Buro, Hailaer, Inner Mongolia, China, 6 Beijing Dairy Cattle Centre, Beijing, China, 7 Dingyuan Seedstock Bulls Breeding Ltd. Company, Zhengzhou, Henan, China, 8 Ningxia Sygen BioEngineering Research Center, Yinchuan, Ningxia, China, 9 Xinjiang General Livestock Service, Urumqi, Xinjiang, China, 10 College of Animal Science, Xinjiang Agriculture University, Urumqi, Xinjiang, China, 11 Xinjiang Tianshan Animal Husbandry Bio-engineering Co. Ltd, Urumqi, Xinjiang, China, 12 Dalian Xuelong Industry Limited Group, Dalian, Liaoning, China Abstract Arachnomelia syndrome (AS), mainly found in Brown Swiss and Simmental cattle, is a congenital lethal genetic malformation of the skeletal system. In this study, a network-based disease gene prioritization approach was implemented to rank genes in the previously reported ,7 Mb region on chromosome 23 associated with AS in Simmental cattle. The top 6 ranked candidate genes were sequenced in four German Simmental bulls, one known AS-carrier ROMEL and a pooled sample of three known non-carriers (BOSSAG, RIFURT and HIRMER).
    [Show full text]
  • Bioinformatics Approach for the Identification of Fragile Regions On
    UNIVERSITÉ DU QUÉBEC À MONTRÉAL BIOINFORMATICS APPROACH FOR THE IDENTIFICATION OF FRAGILE REGIONS ON THE HUMAN GENOME THESIS PRESENTED AS PARTIAL REQUIREMENT OF THE MASTERS OF BIOLOGY BY GOLROKH KIANI SEPTEMBER 2015 UNIVERSITÉ DU QUÉBEC À MONTRÉAL Service des bibliothèques Avertissement La diffusion de ce mémoire se fait dans le respect des droits de son auteur, qui a signé le formulaire Autorisation de reproduire et de diffuser un travail de recherche de cycles supérieurs (SDU-522 - Rév.01-2006). Cette autorisation stipule que «conformément à l'article 11 du Règlement no 8 des études de cycles supérieurs, [l'auteur] concède à l'Université du Québec à Montréal une licence non exclusive d'utilisation et de publication de la totalité ou d'une partie importante de [son] travail de recherche pour des fins pédagogiques et non commerciales. Plus précisément, [l 'auteur] autorise l'Université du Québec à Montréal à reproduire, diffuser, prêter, distribuer ou vendre des copies de [son] travail de recherche à des fins non commerciales sur quelque support que ce soit, y compris l'Internet. Cette licence et cette autorisation n'entraînent pas une renonciation de [la] part [de l'auteur] à [ses] droits moraux ni à [ses] droits de propriété intellectuelle. Sauf entente contraire, [l 'auteur] conserve la liberté de diffuser et de commercialiser ou non ce travail dont [il] possède un exemplaire.» UNIVERSITÉ DU QUÉBEC À MONTRÉAL APPROCHE BIOINFORMATIQUE POUR L'IDENTIFICATION DES RÉGIONS FRAGILES SUR LE GÉNOME HUMAIN MÉMOIRE PRÉSENTÉ COMME EXIGENCE PARTIELLE DE LA MAÎTRISE EN BIOLOGIE PAR GOLROKH KIANI SEPTEMBRE 2015 DEDICATION AND ACK OWLEDGEMENTS No research could be performed without the assistance and intellectual comrade­ ship of many individuals.
    [Show full text]
  • Profiling of Cell Cycle Genes of Breast Cells Exposed to Etodolac
    1383-1391.qxd 29/3/2010 11:48 Ì ™ÂÏ›‰·1383 ONCOLOGY REPORTS 23: 1383-1391, 2010 Profiling of cell cycle genes of breast cells exposed to etodolac D. ROY1,2*, G.A. ARASON2*, B. CHOWDHURY3,4, A. MITRA5 and G.M. CALAF6,7 1Department of Natural Sciences, Hostos College of the City University of New York, Bronx, NY; 2Graduate Biotechnology Program, Manhattan College, Riverdale, NY; 3Human Retrovirus Section, Vaccine Branch, National Cancer Institute, National Institutes of Health, Frederick, MD; 4Department of Cellular Injury, Military Casualty Research, Walter Reed Army Institute of Research, Silver Spring, MD; 5Department of Chemistry, The College of Mount Saint Vincent, Riverdale, NY; 6Center for Radiological Research, Columbia University Medical Center, New York, NY, USA; 7Instituto de Alta Investigación, Universidad de Tarapaca, Arica, Chile Received September 29, 2009; Accepted November 6, 2009 DOI: 10.3892/or_00000775 Abstract. Breast cancer represents the second leading cause Introduction of cancer-related deaths in the world. There is increasing evidence that perturbation of cell cycle regulation is an Breast cancer represents the second leading cause of cancer- important contributing factor to various cancer progression related deaths in the United States and other Western countries; stages. There are key checkpoints in the cell cycle involving accounting for about 30-40% of all newly diagnosed cancers various regulatory proteins. The relationship between these (1,2). Hereditary breast cancer accounts for just 5-10% of cell cycle regulatory proteins and cell cycle arrest by cyclo- cases. It is generally believed that a family history of breast oxygenase (COX) inhibitors during neoplastic progression cancer and hormonal imbalances also contributes to the remains largely unknown.
    [Show full text]
  • Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-Like Mouse Models: Tracking the Role of the Hairless Gene
    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Doctoral Dissertations Graduate School 5-2006 Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-like Mouse Models: Tracking the Role of the Hairless Gene Yutao Liu University of Tennessee - Knoxville Follow this and additional works at: https://trace.tennessee.edu/utk_graddiss Part of the Life Sciences Commons Recommended Citation Liu, Yutao, "Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino- like Mouse Models: Tracking the Role of the Hairless Gene. " PhD diss., University of Tennessee, 2006. https://trace.tennessee.edu/utk_graddiss/1824 This Dissertation is brought to you for free and open access by the Graduate School at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. To the Graduate Council: I am submitting herewith a dissertation written by Yutao Liu entitled "Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-like Mouse Models: Tracking the Role of the Hairless Gene." I have examined the final electronic copy of this dissertation for form and content and recommend that it be accepted in partial fulfillment of the requirements for the degree of Doctor of Philosophy, with a major in Life Sciences. Brynn H. Voy, Major Professor We have read this dissertation and recommend its acceptance: Naima Moustaid-Moussa, Yisong Wang, Rogert Hettich Accepted for the Council: Carolyn R.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name protein kinase (cAMP-dependent, catalytic) inhibitor beta Gene Symbol PKIB Organism Human Gene Summary The protein encoded by this gene is a member of the cAMP-dependent protein kinase inhibitor family. Studies of a similar protein in rat suggest that this protein may interact with the catalytic subunit of cAMP-dependent protein kinase and act as a competitive inhibitor. At least three alternatively spliced transcript variants encoding the same protein have been reported. Gene Aliases FLJ23817, PRKACN2 RefSeq Accession No. NC_000006.11, NT_025741.15 UniGene ID Hs.486354 Ensembl Gene ID ENSG00000135549 Entrez Gene ID 5570 Assay Information Unique Assay ID qHsaCED0044612 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000368452, ENST00000368448, ENST00000258014, ENST00000354275, ENST00000368446, ENST00000392491, ENST00000392490 Amplicon Context Sequence GGCTCATAATCTATCAAGAGTGCTGAATTTCTGCATGTTGAAAGACTTAGTGGTT CTGTTTTCTTGAGACATTTAATCTGGTGGTAACTGTGGTAACATTGCAGCC Amplicon Length (bp) 76 Chromosome Location 6:123046342-123046447 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 95 R2 0.9996 cDNA Cq 22.83 cDNA Tm (Celsius) 76.5 gDNA Cq 24.52 Page 1/5 PrimePCR™Assay Validation Report Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report PKIB, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve
    [Show full text]
  • RNA Epigenetics: Fine-Tuning Chromatin Plasticity and Transcriptional Regulation, and the Implications in Human Diseases
    G C A T T A C G G C A T genes Review RNA Epigenetics: Fine-Tuning Chromatin Plasticity and Transcriptional Regulation, and the Implications in Human Diseases Amber Willbanks, Shaun Wood and Jason X. Cheng * Department of Pathology, Hematopathology Section, University of Chicago, Chicago, IL 60637, USA; [email protected] (A.W.); [email protected] (S.W.) * Correspondence: [email protected] Abstract: Chromatin structure plays an essential role in eukaryotic gene expression and cell identity. Traditionally, DNA and histone modifications have been the focus of chromatin regulation; however, recent molecular and imaging studies have revealed an intimate connection between RNA epigenetics and chromatin structure. Accumulating evidence suggests that RNA serves as the interplay between chromatin and the transcription and splicing machineries within the cell. Additionally, epigenetic modifications of nascent RNAs fine-tune these interactions to regulate gene expression at the co- and post-transcriptional levels in normal cell development and human diseases. This review will provide an overview of recent advances in the emerging field of RNA epigenetics, specifically the role of RNA modifications and RNA modifying proteins in chromatin remodeling, transcription activation and RNA processing, as well as translational implications in human diseases. Keywords: 5’ cap (5’ cap); 7-methylguanosine (m7G); R-loops; N6-methyladenosine (m6A); RNA editing; A-to-I; C-to-U; 2’-O-methylation (Nm); 5-methylcytosine (m5C); NOL1/NOP2/sun domain Citation: Willbanks, A.; Wood, S.; (NSUN); MYC Cheng, J.X. RNA Epigenetics: Fine-Tuning Chromatin Plasticity and Transcriptional Regulation, and the Implications in Human Diseases. Genes 2021, 12, 627.
    [Show full text]
  • Location Analysis of Estrogen Receptor Target Promoters Reveals That
    Location analysis of estrogen receptor ␣ target promoters reveals that FOXA1 defines a domain of the estrogen response Jose´ e Laganie` re*†, Genevie` ve Deblois*, Ce´ line Lefebvre*, Alain R. Bataille‡, Franc¸ois Robert‡, and Vincent Gigue` re*†§ *Molecular Oncology Group, Departments of Medicine and Oncology, McGill University Health Centre, Montreal, QC, Canada H3A 1A1; †Department of Biochemistry, McGill University, Montreal, QC, Canada H3G 1Y6; and ‡Laboratory of Chromatin and Genomic Expression, Institut de Recherches Cliniques de Montre´al, Montreal, QC, Canada H2W 1R7 Communicated by Ronald M. Evans, The Salk Institute for Biological Studies, La Jolla, CA, July 1, 2005 (received for review June 3, 2005) Nuclear receptors can activate diverse biological pathways within general absence of large scale functional data linking these putative a target cell in response to their cognate ligands, but how this binding sites with gene expression in specific cell types. compartmentalization is achieved at the level of gene regulation is Recently, chromatin immunoprecipitation (ChIP) has been used poorly understood. We used a genome-wide analysis of promoter in combination with promoter or genomic DNA microarrays to occupancy by the estrogen receptor ␣ (ER␣) in MCF-7 cells to identify loci recognized by transcription factors in a genome-wide investigate the molecular mechanisms underlying the action of manner in mammalian cells (20–24). This technology, termed 17␤-estradiol (E2) in controlling the growth of breast cancer cells. ChIP-on-chip or location analysis, can therefore be used to deter- We identified 153 promoters bound by ER␣ in the presence of E2. mine the global gene expression program that characterize the Motif-finding algorithms demonstrated that the estrogen re- action of a nuclear receptor in response to its natural ligand.
    [Show full text]
  • Supplementary Table 3 Complete List of RNA-Sequencing Analysis of Gene Expression Changed by ≥ Tenfold Between Xenograft and Cells Cultured in 10%O2
    Supplementary Table 3 Complete list of RNA-Sequencing analysis of gene expression changed by ≥ tenfold between xenograft and cells cultured in 10%O2 Expr Log2 Ratio Symbol Entrez Gene Name (culture/xenograft) -7.182 PGM5 phosphoglucomutase 5 -6.883 GPBAR1 G protein-coupled bile acid receptor 1 -6.683 CPVL carboxypeptidase, vitellogenic like -6.398 MTMR9LP myotubularin related protein 9-like, pseudogene -6.131 SCN7A sodium voltage-gated channel alpha subunit 7 -6.115 POPDC2 popeye domain containing 2 -6.014 LGI1 leucine rich glioma inactivated 1 -5.86 SCN1A sodium voltage-gated channel alpha subunit 1 -5.713 C6 complement C6 -5.365 ANGPTL1 angiopoietin like 1 -5.327 TNN tenascin N -5.228 DHRS2 dehydrogenase/reductase 2 leucine rich repeat and fibronectin type III domain -5.115 LRFN2 containing 2 -5.076 FOXO6 forkhead box O6 -5.035 ETNPPL ethanolamine-phosphate phospho-lyase -4.993 MYO15A myosin XVA -4.972 IGF1 insulin like growth factor 1 -4.956 DLG2 discs large MAGUK scaffold protein 2 -4.86 SCML4 sex comb on midleg like 4 (Drosophila) Src homology 2 domain containing transforming -4.816 SHD protein D -4.764 PLP1 proteolipid protein 1 -4.764 TSPAN32 tetraspanin 32 -4.713 N4BP3 NEDD4 binding protein 3 -4.705 MYOC myocilin -4.646 CLEC3B C-type lectin domain family 3 member B -4.646 C7 complement C7 -4.62 TGM2 transglutaminase 2 -4.562 COL9A1 collagen type IX alpha 1 chain -4.55 SOSTDC1 sclerostin domain containing 1 -4.55 OGN osteoglycin -4.505 DAPL1 death associated protein like 1 -4.491 C10orf105 chromosome 10 open reading frame 105 -4.491
    [Show full text]
  • Steroid-Dependent Regulation of the Oviduct: a Cross-Species Transcriptomal Analysis
    University of Kentucky UKnowledge Theses and Dissertations--Animal and Food Sciences Animal and Food Sciences 2015 Steroid-dependent regulation of the oviduct: A cross-species transcriptomal analysis Katheryn L. Cerny University of Kentucky, [email protected] Right click to open a feedback form in a new tab to let us know how this document benefits ou.y Recommended Citation Cerny, Katheryn L., "Steroid-dependent regulation of the oviduct: A cross-species transcriptomal analysis" (2015). Theses and Dissertations--Animal and Food Sciences. 49. https://uknowledge.uky.edu/animalsci_etds/49 This Doctoral Dissertation is brought to you for free and open access by the Animal and Food Sciences at UKnowledge. It has been accepted for inclusion in Theses and Dissertations--Animal and Food Sciences by an authorized administrator of UKnowledge. For more information, please contact [email protected]. STUDENT AGREEMENT: I represent that my thesis or dissertation and abstract are my original work. Proper attribution has been given to all outside sources. I understand that I am solely responsible for obtaining any needed copyright permissions. I have obtained needed written permission statement(s) from the owner(s) of each third-party copyrighted matter to be included in my work, allowing electronic distribution (if such use is not permitted by the fair use doctrine) which will be submitted to UKnowledge as Additional File. I hereby grant to The University of Kentucky and its agents the irrevocable, non-exclusive, and royalty-free license to archive and make accessible my work in whole or in part in all forms of media, now or hereafter known.
    [Show full text]
  • The Mitotic Checkpoint Protein MAD2 Delivers Monoamine Transporters to Endocytosis
    bioRxiv preprint doi: https://doi.org/10.1101/2021.06.09.447721; this version posted June 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 The mitotic checkpoint protein MAD2 delivers monoamine transporters to endocytosis. Florian Koban1*, Michael Freissmuth1 https://orcid.org/0000-0003-0912-3114, https://orcid.org/0000-0001-9398-1765 1Institute of Pharmacology and the Gaston H. Glock Research Laboratories for Exploratory Drug Development, Center of Physiology and Pharmacology, Medical University of Vienna, Vienna, Austria. *Corresponding Author: Florian Koban, PhD Institute of Pharmacology and the Gaston H. Glock Research Laboratories for Exploratory Drug Development, Center of Physiology and Pharmacology, Medical University of Vienna. Waehringer Strasse 13A, 1090 Vienna, Austria E-mail: [email protected] Tel.: +43 1 40160 31328 Author contributions: F. K. conceptualized the study; F. K. conducted research; F. K. and M. F. analyzed data; F.K. and M.F. wrote the paper. bioRxiv preprint doi: https://doi.org/10.1101/2021.06.09.447721; this version posted June 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 2 ABSTRACT Monoamine transporters retrieve serotonin (SERT), dopamine (DAT) and norepinephrine (NET) from the synaptic cleft. Surface levels of transporters are also regulated by internalization. Clathrin-mediated endocytosis of cargo proteins requires adaptor protein 2 (AP2), which recruits cargo to the nascent clathrin- cage. The transporter C-terminus is required for internalization but lacks an AP2- binding site.
    [Show full text]
  • Patient-Based Cross-Platform Comparison of Oligonucleotide Microarray Expression Profiles
    Laboratory Investigation (2005) 85, 1024–1039 & 2005 USCAP, Inc All rights reserved 0023-6837/05 $30.00 www.laboratoryinvestigation.org Patient-based cross-platform comparison of oligonucleotide microarray expression profiles Joerg Schlingemann1,*, Negusse Habtemichael2,*, Carina Ittrich3, Grischa Toedt1, Heidi Kramer1, Markus Hambek4, Rainald Knecht4, Peter Lichter1, Roland Stauber2 and Meinhard Hahn1 1Division of Molecular Genetics, Deutsches Krebsforschungszentrum, Heidelberg, Germany; 2Chemotherapeutisches Forschungsinstitut Georg-Speyer-Haus, Frankfurt am Main, Germany; 3Central Unit Biostatistics, Deutsches Krebsforschungszentrum, Heidelberg, Germany and 4Department of Otorhinolaryngology, Universita¨tsklinik, Johann-Wolfgang-Goethe-Universita¨t Frankfurt, Frankfurt, Germany The comparison of gene expression measurements obtained with different technical approaches is of substantial interest in order to clarify whether interplatform differences may conceal biologically significant information. To address this concern, we analyzed gene expression in a set of head and neck squamous cell carcinoma patients, using both spotted oligonucleotide microarrays made from a large collection of 70-mer probes and commercial arrays produced by in situ synthesis of sets of multiple 25-mer oligonucleotides per gene. Expression measurements were compared for 4425 genes represented on both platforms, which revealed strong correlations between the corresponding data sets. Of note, a global tendency towards smaller absolute ratios was observed when
    [Show full text]
  • CYB5R3 Gene Cytochrome B5 Reductase 3
    CYB5R3 gene cytochrome b5 reductase 3 Normal Function The CYB5R3 gene provides instruction for making an enzyme called cytochrome b5 reductase 3. This enzyme is involved in transferring negatively charged particles called electrons from one molecule to another. Two versions (isoforms) of this enzyme are produced from the CYB5R3 gene. The soluble isoform is present only in red blood cells, and the membrane-bound isoform is found in all other cell types. Normal red blood cells contain molecules of iron-containing hemoglobin, which deliver oxygen to the body's tissues. The iron in hemoglobin is ferrous (Fe2+), but it can spontaneously become ferric (Fe3+). Hemoglobin that contains ferric iron is called methemoglobin, and it cannot deliver oxygen. The soluble isoform of cytochrome b5 reductase 3 changes ferric iron back to ferrous iron so hemoglobin can function. Normally, red blood cells contain less than 2 percent methemoglobin. The membrane-bound isoform is embedded in the membranes of various cellular compartments and is widely used in the body. This isoform is necessary for many chemical reactions, including the breakdown and formation of fatty acids, the formation of cholesterol, and the breakdown of various molecules and drugs. Health Conditions Related to Genetic Changes Autosomal recessive congenital methemoglobinemia More than 65 mutations in the CYB5R3 gene have been found to cause autosomal recessive congenital methemoglobinemia types I and II. Most of these CYB5R3 gene mutations cause autosomal recessive congenital methemoglobinemia type I, which is characterized by a lack of oxygen in the body's tissues and bluish appearance of the skin, lips, and nails (cyanosis).
    [Show full text]