Ubiquitin Ligase COP1 Controls Hepatic Fat Metabolism by Targeting ATGL for Degradation
Total Page：16
File Type：pdf, Size：1020Kb
Diabetes Volume 65, December 2016 3561 Mainak Ghosh,1 Sougata Niyogi,1 Madhumita Bhattacharyya,2 Moumita Adak,1 Dipak K. Nayak,3 Saikat Chakrabarti,2 and Partha Chakrabarti1 Ubiquitin Ligase COP1 Controls Hepatic Fat Metabolism by Targeting ATGL for Degradation Diabetes 2016;65:3561–3572 | DOI: 10.2337/db16-0506 Optimal control of hepatic lipid metabolism is critical for accumulation of triacylglycerol (TAG) in the liver (4), organismal metabolic fitness. In liver, adipose triglycer- which is caused by defects in lipid accumulation and mo- ide lipase (ATGL) serves as a major triacylglycerol (TAG) bilization (5,6). lipase and controls the bulk of intracellular lipid turnover. Adipose triglyceride lipase (ATGL) is the first and However, regulation of ATGL expression and its functional rate-limiting enzyme for the breakdown of cellular TAG implications in hepatic lipid metabolism, particularly in the (7–10). Mutation in the ATGL gene causes neutral lipid context of fatty liver disease, is unclear. We show that E3 storage disease and myopathy in humans (11). ATGL ex- ubiquitin ligase COP1 (also known as RFWD2) binds to the pression in adipose tissue is transcriptionally regulated by METABOLISM consensus VP motif of ATGL and targets it for proteasomal insulin through FoxO1 and EGR1, directly by peroxisome degradation by K-48 linked polyubiquitination, predom- proliferator–activated receptor-g (12–14), and posttran- inantly at the lysine 100 residue. COP1 thus serves as a scriptionally by G0S2 and CGI-58 (15). The importance critical regulator of hepatocyte TAG content, fatty acid of ATGL was evidenced by ectopic lipid accumulation in mobilization, and oxidation. Moreover, COP1-mediated regulation of hepatic lipid metabolism requires opti- many tissues of ATGL-null mice, including cardiac muscle, mum ATGL expression for its metabolic outcome. In vivo, skeletal muscle, and the liver (7,10). ATGL serves as the fi adenovirus-mediated depletion of COP1 ameliorates high- major TAG lipase in the liver (16), and liver-speci c ATGL fat diet–induced steatosis in mouse liver and improves liver knockdown or deletion in mice reveals progressive hepatic fl function. Our study thus provides new insights into the steatosis and in ammation (17) as well as changes in the regulation of hepatic lipid metabolism by the ubiquitin- lipid droplet (LD) lipidome (18) with uncoupling of glu- proteasome system and suggests COP1 as a potential cose tolerance from liver TAG accumulation (19). Lowered therapeutic target for nonalcoholic fatty liver disease. ATGL expression has also been found in patients with NAFLD (6). Molecular regulation of hepatic ATGL remained elusive, however. Nonalcoholic fatty liver disease (NAFLD) is the most Regulated cellular protein turnover via the ubiquitin- common chronic liver disease and is strongly associated proteasome system underlies a wide variety of signaling with obesity and type 2 diabetes (1). NAFLD describes a pathways, from cell-cycle control and metabolic homeo- spectrum of conditions characterized mainly by the his- stasis to development (20). Stepwise ubiquitination of a tological finding of macrovesicular hepatic steatosis (2) target protein is achieved through three enzyme classes: and now considered to be the hepatic component of the E1-ubiquitin–activating enzymes, E2-ubiquitin–conjugating metabolic syndrome (3). The hallmark feature of NAFLD enzymes, and E3 ubiquitin ligases (21,22). COP1 is an evo- pathogenesis, both histologically and metabolically, is the lutionarily conserved E3 ubiquitin ligase (23) essential for 1Division of Cell Biology and Physiology, Council of Scientific and Industrial This article contains Supplementary Data online at http://diabetes Research–Indian Institute of Chemical Biology, Kolkata, India .diabetesjournals.org/lookup/suppl/doi:10.2337/db16-0506/-/DC1. 2 fi Division of Structural Biology and Bioinformatics, Council of Scienti cand M.G., S.N., and M.B. contributed equally to this work. Industrial Research–Indian Institute of Chemical Biology, Kolkata, India © 2016 by the American Diabetes Association. Readers may use this article as 3Nuclear Medicine Division, Council of Scientific and Industrial Research–Indian long as the work is properly cited, the use is educational and not for profit, and the Institute of Chemical Biology, Kolkata, India work is not altered. More information is available at http://www.diabetesjournals Corresponding author: Partha Chakrabarti, [email protected] or partha.iicb@ .org/content/license. gmail.com. Received 25 April 2016 and accepted 14 September 2016. 3562 COP1 Ubiquitinates ATGL Diabetes Volume 65, December 2016 mouse development, because COP1-knockout mice were acquisition was done over 30 min using 180 time frames embryonically lethal (24). COP1 regulates the stabilities of 10 s each. of p53 (25), c-Jun (26), and acetyl-CoA carboxylase 1 (27), Cell Culture and Transfection each through different mechanisms. Recent discoveries Human hepatoma cell line HepG2, HUH7, and human have documented important roles of COP1 in the regula- embryonic kidney cell line HEK293A were cultured in high- tion of intermediary metabolism, including glucose (23,28) glucose DMEM supplemented with 10% FBS containing and lipid metabolism (27). The importance of COP1 in 1% penicillin/streptomycin. Transient transfections with mediating insulin secretion from pancreatic b-cells appre- plasmids and small interfering (si)RNA were done using ciates the role of COP1 as a master regulator of whole-body Lipofectamine 2000 reagent (Life Technologies) according glucose homeostasis (29). to the manufacturer’s instruction. For stable expression fi Inthisstudywehaveidenti edhepaticATGLasanovel and knockdown of ATGL, cells were transfected with target of COP1, and their interaction controls hepatic TAG pcDNA3.1-b myc-his vector and infected with lentivirus turnover. Moreover, depletion of COP1 in the liver abrogated generated from pooled shATGL plasmids (Santa Cruz Bio- hepatic steatosis, thereby suggesting that COP1 could be a technology), respectively. siRNA for human RFWD2 against novel target for ameliorating lipid accumulation in NAFLD. the GCUGUGGUCUACCAAUCUA sequence was from Euro- RESEARCH DESIGN AND METHODS gentec, Liège, Belgium. Antibodies Adenovirus Production Antibodies to ATGL, HA-tag, myc-tag, and GAPDH were Recombinant adenoviruses containing shCOP1 construct from Cell Signaling Technology (Boston, MA); the COP1 were generated by the BLOCK-iT Adenoviral Expression antibody was from Bethyl Laboratories Inc.; anti-Ub anti- System (Invitrogen) using the sequence CACCGAGTCCA body was from Santa Cruz Biotechnology; and anti-FLAG ATGTGCTGATTGC (28). Recombinant adenoviruses were M2 and b-actin antibody were from Sigma-Aldrich. purified and concentrated using the FAST-TRAP adenovi- rus purification and concentration kit (Millipore). Plasmids and Vectors Histology Human ubiquitin-HA and COP1-myc-FLAG clones were For histological analysis, tissues were fixed in 10% formal- from Addgene and OriGene, respectively. ATGL was cloned dehyde in PBS, embedded in paraffin, sectioned at 10 mm, in pcDNA 3.1(-) b myc-his vector using the forward primer and stained with hematoxylin and eosin (H&E) following 59 TCACCTCGAGATGTTCCCGAGGGAGACCAAGTGG 39 and standard staining protocol. reverse primer 59 TAGAAGCTTGGGCAAGGCGGGAGGC CAGGTGGATC 39 containing Xho1 and HindIII restric- Immunoprecipitation and Ubiquitination Assay tion sites, respectively. Mutagenesis of the ATGL clone Cells were harvested in radioimmunoprecipitation assay was done using the QuickChange II Site-Directed Muta- buffer (10 mmol/L Tris-HCl [pH 8.0], 1 mmol/L EDTA, genesis Kit (Agilent). Details of primers for mutagenesis 0.5 mmol/L EGTA, 1% Triton X-100, 0.1% SDS, 140 mmol/L are in Supplementary Table 1. NaCl with protease, and phosphatase-inhibitor cocktail; Roche). Then, 200 mg of protein was incubated overnight Animal Experiments with 2 mg primary antibody and 30 mLofProteinAmag- – C57BL/6 male mice 8 10 weeks of age were divided in two netic beads at 4°C. Immune complexes were separated by groups for normal chow and high-fat diet (HFD) containing Magnetic GrIP RAC (Millipore) and washed thrice. For af- 45% fat and 5.81 kcal/g diet energy content (# 960192; finity purification of COOH-terminal hexahistidine contain- MP Biomedicals). Animals were fed the HFD for 4 weeks, ing ATGL, cells were harvested in radioimmunoprecipitation 3 9 and 8 10 plaque-forming units short hairpin (sh)COP1 assay buffer and incubated overnight with 30 mLofNi adenovirus was injected retro-orbitally. Animals were sac- Sepharose beads (Roche). Beads were then warmed at fi ri ced after 1 week. All data are representative of two 60°C for 10 min in 23 sample buffer and centrifuged. independent experiments with four to seven animals per b-Marcaptoethanol was added to the supernatant to make group. The experimental protocols were approved by the In- the final concentration 5%. For immunoprecipitation, cells stitutional Animal Ethics Committee (approved by CPCSEA, were harvested in cell lysis buffer containing 20 mmol/L Ministry of Environment & Forest, Government of India). Tris-HCl (pH 7.4), 100 mmol/L NaCl, 2.5 mmol/L MgCl2, Technetium-99m–Mebrofenin Liver Activity Imaging and 0.05% Nonidet P-40 for 5 h on ice. Immunoprecipita- 99m 2 tion was performed as described previously and analyzed by Technetium-99m ( Tc)O4 was obtained by 2-butanone 99 2 Western blotting. extraction of a 5N NaOH solution of MoO4 , procured from Bhabha Atomic Research Centre (Mumbai, India).