DOCSLIB.ORG

Supporting Information

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supporting Information Supporting Information Scully et al. 10.1073/pnas.1614970113 SI Materials and Methods Histology and Immunofluorescence Assays. For immunohistochem- Generation of Conditional Deletions of the Itgb1 and VEGF-A Genes. istry with anti-PECAM/CD31 and anti–PV-1 antibodies, fresh- All mice were housed in strict accordance with the principles and frozen tissue sections were mounted on slides, fixed at room procedures outlined in the NIH GuidefortheCareandUseof temperature in acetone for 2 min, and dried before staining. For all Laboratory Animals (40). All procedures were approved by the other histological analyses, including H&E staining, and indirect University of California, San Diego Institutional Animal Care and immunofluorescence assays, tissues were fixed with 10% (vol/vol) Use Committee. The mouse strain B6;129-Itgb1tm1Efu/J (common phosphate-buffered formalin or 4% (wt/vol) paraformaldehyde by name Itgb1flox), donated to The Jackson Laboratory by Elaine transcardial perfusion and/or immersion. Primary antibodies di- Fuchs, harbors loxP sitesoneithersideofexon3oftheItgb1 gene. rected against pituitary hormones were provided by A. F. Parlow – Deletion of exon 3 by Cre-recombinase results in frame shift and (Harbor UCLA Medical Center) and the National Hormone and premature termination of translation (17). Itgb1f/f mice were bred Pituitary Program (National Institute of Diabetes and Digestive to transgenic mice harboring cre-recombinase under the control of and Kidney Diseases). They included rabbit anti-human ACTH 8 kb of mouse pitx-1 5′ sequence (16) or 2 kb of mouse prop-1 5′ (adrenocorticotropic hormone) (1:500, AFP-39032082); rabbit β sequence, including exon 1 (18). Itgb1f/f; Pitx1-cre knockout pups anti-rat TSH- (1:1,000, AFP-1274789); monkey anti-rat GH β die soon after birth with palate defects that preclude suckling. (1:1,000, AFP 411S); guinea pig anti-rat LH- (1:1,000, AFP- α To generate littermate Itgb1f/f; Pitx1-cre knockout and Itgb1f/f con- 2223879OGPOLHB); and rabbit anti-rat GSU (1:500, AFP- + trols, heterozygous Itgb1f/ ;Pitx1-creanimals were crossed to Itgb1f/f 66P9986). Other primary antibodies used were rabbit anti-human animals. Primers used to genotype these animals were CRE5′ PRL (1:250, DAKO A0569); rabbit anti-rat Pit-1 [1:250, Simmons ′ et al. (41)]; mouse antiphosphohistone H3 serine 10 (pH 3) (1:200, GGAAATGGTTTCCCGCAGAAC and CRE3 ACCCTGATC- β CTGGCAATTTCG, which amplify an ∼400-bp product, and β1- Cell Signaling Technology 9706S); rat anti-mouse integrin 1 clone integrin oIMR1906 CGGCTCAAAGCAGAGTGTCAGTC-3′ MB1.2 (1:100, MAB1997; Chemicon/Millipore); rat anti-mouse CD31/PECAM-1 clone MEC13.3 (1:20, 550274; BD Pharmingen); and oIMR1907 CCACAACTTTCCCAGTTAGCTCTC, which – amplify ∼160 bp of the wild-type Itgb1 allele and ∼280 bp of rabbit anti-mouse EHS laminin (1:200, L9393; Sigma Aldrich); f/f rabbit anti-rat NG2 (1:200, AB5320; Chemicon/Millipore); rat the Itgb1 allele (genotyping by The Jackson Laboratory). f/f f/f anti-mouse CD140b/PDGFRβ clone APB5 (1:500, 14-1402-82; Itgb1 ; Prop1-cre animals were viable and fertile. Itgb1 ; Prop1-cre eBioscience); rat anti-mouse PV-1 IgG2a mAb (1:500), which knockouts and Itgb1f/f littermate controls were generated by breeding was affinity-purified by FPLC on an anti-rat IgG column (GE Itgb1f/f; Prop1-cre to Itgb1f/f animals. VEGF loxP mice (herein referred Healthcare) from the supernatant of the clone MECA-32 hy- to as VEGF-Af/f) were generously provided by Genentech. These bridoma (Developmental Studies Hybridoma Bank, University mice harbor loxP sites on either side of exon 3, which is common to of Iowa) grown in serum-free hybridoma medium (Invitrogen), all isoforms of VEGF-A. Primers used to genotype these animals and then labeled with Alexa-647 fluorophore (Molecular Probes/ were muVEGF419.F CCTGGCCCTCAAGTACACCTT and mu- Invitrogen), as per the manufacturer’s instructions (19). Sec- VEGF567.R TCCGTACGACGCATTTCTAG. They amplify ondary antibodies were labeled with Alexa fluorphores-488, -594, loxP ∼ 148 bp of alleles and 108 bp of wild-type alleles (29). or -647 (1:500; Molecular Probes/Invitrogen). Images were ob- VEGF-Af/f; Pitx1-cre animals were viable and fertile. VEGF-Af/f; f/f tained using a Zeiss Axioplan 2 microscope and a Leica SP5 Pitx1-cre knockouts and VEGF-A littermate controls were confocal microscope. generated by breeding VEGF-Af/f; Pitx1-cre to VEGF-Af/f ani- β−/− mals. PDGFR and littermate control embryos were gener- Pericyte Recruitment. Sixteen-micrometer serial sagittal sections ously provided by Lorin Olson, Oklahoma Medical Research beginning at the midline and progressing through the lateral an- Foundation, Oklahoma City (24). terior lobes were collected and immunostained with VEGFR2 (endothelial cells) and PDGFRβ (pericytes). Four pairs of e13.5 Quantitative Real-Time PCR. Quantitative real-time (RT) PCR was Itgb1f/f; Pitx1-cre and control Itgb1f/f littermate embryos were carried out with RNA extracted using TRIzol (Life Technologies) examined in this manner. Each pair was from an independent litter. from control and Itgb1 gene-deleted pituitaries from stages as indicated in the figures. RNA samples were DNase I-treated, and Quantification of EC Clusters, Presence of Lumens, and Lumen Diameter. all RT-PCR reactions were accompanied by RT(−) controls. Ex- Four Itgb1f/f and four Itgb1f/f; Prop1-cre were analyzed at e14.5. Each periments were performed with three biological replicates and pair was from an independent litter. Coronal sections were im- three technical replicates. The data were normalized to GAPDH. munostained with integrin β1 and CD31 antibodies and imaged on a Zeiss Axioplan 2 MOT Microscope System and a Leica SP5 Computed Tomography, Data Processing, and Image Generation. All confocal microscope. CD31(+) EC clusters were counted in three samples were processed using a Numira Biosciences proprietary equivalently sized sections from each animal. The fraction of EC staining technique. The samples were scanned on a high-resolution, clusters with lumens was established on the same sections. Lumen μ volumetric microCT scanner ( CT40; ScanCo Medical). The image diameters were measured using the straight-line tool in ImageJ. The μ data were acquired with the following parameters: 6- m isotropic shortest distance across each lumen was recorded to eliminate error voxel resolution at 200-ms exposure time, 2,000 views, and 10 based on the angle at which each vessel was cut. Statistical analysis frames per view. The microC-generated DICOM (Digital Imaging was performed with Prism 7 software (GraphPad Software). and Communication) files were used to create images of the samples. The raw data files were viewed using Microview (GE RNA-Sequencing. Embryonic mouse pituitaries were dissected at Healthcare). Using Numira’s software, the files were converted e12.5 and frozen individually. Following genotyping, total RNA into frames for planar movies and used to generate rotating 3D from separate biological replicates of three control and two movies. The movie frames were then converted into QuickTime knockout pituitaries was isolated using TRIzol (Life Technologies), (Apple, Inc.) movies for viewing and screen capture. chloroform extraction, and isopropanol precipitation. Ribosomal Scully et al. www.pnas.org/cgi/content/short/1614970113 1of10 RNA was removed using a Ribo-Zero Magnetic Kit (Epicentre), a erate correlation plots that identified genes with a consistent strand-specific library was constructed with ScriptSeq v2 RNA-Seq pattern of differential expression in control vs. knockout pituitaries. Library Preparation Kit (Epicentre), and deep sequencing was carried out on an Illumina HiSeq 2000. The RNA-seq reads were Microarray Analysis. RNA was prepared from individual micro- aligned to the mouse genome mm9 using Bowtie2 with ultrasensitive dissected e12.5 pituitaries from Prop1 knockout and mutant animals. parameters. Because the number of assignable reads in the samples RNA quality was assessed using the Agilent Bioanalyzer 6000 Pico 6 6 ranged from 11 × 10 to 38 × 10 ,Homer(homer.salk.edu)was LabChip. One hundred nanograms of total RNA was labeled with used to select an equal number of reads randomly from each Cy-3 or Cy-5 using the Agilent Low RNA Input Fluorescent Linear sample. RNA-seq reads were counted over gene exons and reads Amplification Kit. Labeled cDNA was hybridized to the Agilent 44K for the same exons were combined allowing only two exact dupli- Whole-Mouse Genome Array. Data were collected using the Agilent cate tags in any one position. Genes with less than eight tags per kilobase were filtered out. edgeR software (www.bioconductor.org/ Microarray Scanner and Feature Extraction Software, using a Lowess packages/release/bioc/vignettes/edgeR/inst/doc/edgeRUsersGuide. option with spatial detrend. Normalized data were imported into pdf) was used for statistical analysis, set with a P value ≤0.01 and a Focus to extract genes of interest with more confidence than through minimum fold change of 1.5 either up or down. Pairwise compar- the use of fold-change only (42). Experiments were performed in isons of each control to each knockout sample were used to gen- triplicate, with litter-matched wild-type and mutant samples. Scully et al. www.pnas.org/cgi/content/short/1614970113 2of10 Fig. S1. Integrin β1 is expressed in pituitary gland epithelial cells throughout embryonic development and is inactivated at e10.5 with Pitx1-cre and at e14.5 with Prop1-cre.(A) Embryonic development of the glandular anterior and intermediate lobes (yellow) beginning with invagination of the oral ectoderm at e10.5. Tandem outgrowth of the third ventricle gives rise to the neural posterior lobe (gray). At e13.5, the first evidence appears of nascent microvessels (M) in red. (B) Immunohistochemical staining of integrin β1 and laminin in sections of control embryonic pituitaries. (Top Left) e10.5 is the same image shown in Fig. 1A, Left. Laminin marks the basement membranes of the organ primordium and the developing vasculature.
Load more

Recommended publications
  • Shh/Gli Signaling in Anterior Pituitary
    SHH/GLI SIGNALING IN ANTERIOR PITUITARY AND VENTRAL TELENCEPHALON DEVELOPMENT by YIWEI WANG Submitted in partial fulfillment of the requirements For the degree of Doctor of Philosophy Department of Genetics CASE WESTERN RESERVE UNIVERSITY January, 2011 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the thesis/dissertation of _____________________________________________________ candidate for the ______________________degree *. (signed)_______________________________________________ (chair of the committee) ________________________________________________ ________________________________________________ ________________________________________________ ________________________________________________ ________________________________________________ (date) _______________________ *We also certify that written approval has been obtained for any proprietary material contained therein. TABLE OF CONTENTS Table of Contents ••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• i List of Figures ••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• v List of Abbreviations •••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• vii Acknowledgements •••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• ix Abstract ••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• x Chapter 1 Background and Significance ••••••••••••••••••••••••••••••••••••••••••••••••• 1 1.1 Introduction to the pituitary gland
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • The Viral Oncoproteins Tax and HBZ Reprogram the Cellular Mrna Splicing Landscape
    bioRxiv preprint doi: https://doi.org/10.1101/2021.01.18.427104; this version posted January 18, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The viral oncoproteins Tax and HBZ reprogram the cellular mRNA splicing landscape Charlotte Vandermeulen1,2,3, Tina O’Grady3, Bartimee Galvan3, Majid Cherkaoui1, Alice Desbuleux1,2,4,5, Georges Coppin1,2,4,5, Julien Olivet1,2,4,5, Lamya Ben Ameur6, Keisuke Kataoka7, Seishi Ogawa7, Marc Thiry8, Franck Mortreux6, Michael A. Calderwood2,4,5, David E. Hill2,4,5, Johan Van Weyenbergh9, Benoit Charloteaux2,4,5,10, Marc Vidal2,4*, Franck Dequiedt3*, and Jean-Claude Twizere1,2,11* 1Laboratory of Viral Interactomes, GIGA Institute, University of Liege, Liege, Belgium.2Center for Cancer Systems Biology (CCSB), Dana-Farber Cancer Institute, Boston, MA, USA.3Laboratory of Gene Expression and Cancer, GIGA Institute, University of Liege, Liege, Belgium.4Department of Genetics, Blavatnik Institute, Harvard Medical School, Boston, MA, USA. 5Department of Cancer Biology, Dana-Farber Cancer Institute, Boston, MA, USA.6Laboratory of Biology and Modeling of the Cell, CNRS UMR 5239, INSERM U1210, University of Lyon, Lyon, France.7Department of Pathology and Tumor Biology, Kyoto University, Japan.8Unit of Cell and Tissue Biology, GIGA Institute, University of Liege, Liege, Belgium.9Laboratory of Clinical and Epidemiological Virology, Rega Institute for Medical Research, Department of Microbiology, Immunology and Transplantation, Catholic University of Leuven, Leuven, Belgium.10Department of Human Genetics, CHU of Liege, University of Liege, Liege, Belgium.11Lead Contact. *Correspondence: [email protected]; [email protected]; [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2021.01.18.427104; this version posted January 18, 2021.
    [Show full text]
  • Prenatal Testing Requisition Form
    BAYLOR MIRACA GENETICS LABORATORIES SHIP TO: Baylor Miraca Genetics Laboratories 2450 Holcombe, Grand Blvd. -Receiving Dock PHONE: 800-411-GENE | FAX: 713-798-2787 | www.bmgl.com Houston, TX 77021-2024 Phone: 713-798-6555 PRENATAL COMPREHENSIVE REQUISITION FORM PATIENT INFORMATION NAME (LAST,FIRST, MI): DATE OF BIRTH (MM/DD/YY): HOSPITAL#: ACCESSION#: REPORTING INFORMATION ADDITIONAL PROFESSIONAL REPORT RECIPIENTS PHYSICIAN: NAME: INSTITUTION: PHONE: FAX: PHONE: FAX: NAME: EMAIL (INTERNATIONAL CLIENT REQUIREMENT): PHONE: FAX: SAMPLE INFORMATION CLINICAL INDICATION FETAL SPECIMEN TYPE Pregnancy at risk for specific genetic disorder DATE OF COLLECTION: (Complete FAMILIAL MUTATION information below) Amniotic Fluid: cc AMA PERFORMING PHYSICIAN: CVS: mg TA TC Abnormal Maternal Screen: Fetal Blood: cc GESTATIONAL AGE (GA) Calculation for AF-AFP* NTD TRI 21 TRI 18 Other: SELECT ONLY ONE: Abnormal NIPT (attach report): POC/Fetal Tissue, Type: TRI 21 TRI 13 TRI 18 Other: Cultured Amniocytes U/S DATE (MM/DD/YY): Abnormal U/S (SPECIFY): Cultured CVS GA ON U/S DATE: WKS DAYS PARENTAL BLOODS - REQUIRED FOR CMA -OR- Maternal Blood Date of Collection: Multiple Pregnancy Losses LMP DATE (MM/DD/YY): Parental Concern Paternal Blood Date of Collection: Other Indication (DETAIL AND ATTACH REPORT): *Important: U/S dating will be used if no selection is made. Name: Note: Results will differ depending on method checked. Last Name First Name U/S dating increases overall screening performance. Date of Birth: KNOWN FAMILIAL MUTATION/DISORDER SPECIFIC PRENATAL TESTING Notice: Prior to ordering testing for any of the disorders listed, you must call the lab and discuss the clinical history and sample requirements with a genetic counselor.
    [Show full text]
  • PDF Download
    Review Xatzipsalti Maria et al. Congenital Hypopituitarism: Various Genes, … Horm Metab Res 2018; 00: 00–00 Congenital Hypopituitarism: Various Genes, Various Phenotypes Authors Maria Xatzipsalti1, 2, Antonis Voutetakis1, Lela Stamoyannou2, George P. Chrousos1, Christina Kanaka-Gantenbein1 Affiliations ABSTRacT 1 Division of Endocrinology, Diabetes and Metabolism, The ontogenesis and development of the pituitary gland is a First Department of Pediatrics, Medical School, National highly complex process that depends on a cascade of transcrip- and Kapodistrian University of Athens, “Aghia Sofia” tion factors and signaling molecules. Spontaneous mutations Children's Hospital, Athens, Greece and transgenic murine models have demonstrated a role for 2 First Department of Pediatrics, “Aglaia Kyriakou” many of these factors, including HESX1, PROP1, PIT1, LHX3, Children's Hospital, Athens, Greece LHX4, SOX2, SOX3, OTX2, PAX6, FGFR1, SHH, GLI2, and FGF8 in the etiology of congenital hypopituitarism. Genetic muta- Key words tions in any of these factors can lead to congenital hypopitui- pituitary, combined pituitary hormone deficiency, congenital tarism, which is characterized by the deficiency in one or more hypopituitarism, transcription factors, syndromic hypopitui- pituitary hormones. The phenotype can be highly variable, tarism, non-syndromic hypopituitarism consisting of isolated hypopituitarism or more complex disor- ders. The same phenotype can be attributed to different gene received 27.03.2018 mutations; while a given gene mutation can
    [Show full text]
  • Rapid Evolution of Mammalian X-Linked Testis-Expressed Homeobox Genes
    Copyright 2004 by the Genetics Society of America DOI: 10.1534/genetics.103.025072 Rapid Evolution of Mammalian X-Linked Testis-Expressed Homeobox Genes Xiaoxia Wang and Jianzhi Zhang1 Department of Ecology and Evolutionary Biology, University of Michigan, Ann Arbor, Michigan 48109 Manuscript received November 26, 2003 Accepted for publication February 11, 2004 ABSTRACT Homeobox genes encode transcription factors that function in various developmental processes and are usually evolutionarily conserved in their sequences. However, two X-chromosome-linked testis-expressed homeobox genes, one from rodents and the other from fruit flies, are known to evolve rapidly under positive Darwinian selection. Here we report yet another case, from primates. TGIFLX is an X-linked homeobox gene that originated by retroposition of the autosomal gene TGIF2, most likely in a common ancestor of rodents and primates. While TGIF2 is ubiquitously expressed, TGIFLX is exclusively expressed in adult testis. A comparison of the TGIFLX sequences among 16 anthropoid primates revealed a signifi- cantly higher rate of nonsynonymous nucleotide substitution (dN) than synonymous substitution (dS), strongly suggesting the action of positive selection. Although the high dN/dS ratio is most evident outside ف the homeobox, the homeobox has a dN/dS of 0.89 and includes two codons that are likely under selection. Furthermore, the rate of radical amino acid substitutions that alter amino acid charge is significantly greater than that of conservative substitutions, suggesting that the selection promotes diversity of the protein charge profile. More interestingly, an analysis of 64 orthologous homeobox genes from humans and mice shows substantially higher rates of amino acid substitution in X-linked testis-expressed genes than in other genes.
    [Show full text]
  • Comparative Genomics Reveals Functional Transcriptional Control Sequences in the Prop1 Gene
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by UNL | Libraries University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln U.S. Department of Agriculture: Agricultural Publications from USDA-ARS / UNL Faculty Research Service, Lincoln, Nebraska August 2007 Comparative genomics reveals functional transcriptional control sequences in the Prop1 gene Robert D. Ward University of Michigan MinChul Cho University of Michigan S. A. Camper University of Michigan Shannon W. Davis University of Michigan Lori T. Raetzman University of Michigan See next page for additional authors Follow this and additional works at: https://digitalcommons.unl.edu/usdaarsfacpub Part of the Agricultural Science Commons Ward, Robert D.; Cho, MinChul; Camper, S. A.; Davis, Shannon W.; Raetzman, Lori T.; Smith, Timothy P.L.; Esposito, Constance; Lyons, Robert H.; Cheng, Jan-Fang; Rubin, Edward M.; and Rhodes, Simon J., "Comparative genomics reveals functional transcriptional control sequences in the Prop1 gene" (2007). Publications from USDA-ARS / UNL Faculty. 222. https://digitalcommons.unl.edu/usdaarsfacpub/222 This Article is brought to you for free and open access by the U.S. Department of Agriculture: Agricultural Research Service, Lincoln, Nebraska at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Publications from USDA-ARS / UNL Faculty by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. Authors Robert D. Ward, MinChul Cho, S. A. Camper, Shannon W. Davis, Lori T. Raetzman, Timothy P.L. Smith, Constance Esposito, Robert H. Lyons, Jan-Fang Cheng, Edward M. Rubin, and Simon J. Rhodes This article is available at DigitalCommons@University of Nebraska - Lincoln: https://digitalcommons.unl.edu/ usdaarsfacpub/222 Mamm Genome (2007) 18:521–537 DOI 10.1007/s00335-007-9008-6 Comparative genomics reveals functional transcriptional control sequences in the Prop1 gene Robert D.
    [Show full text]
  • Genomics 93 (2009) 449–460
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Genomics 93 (2009) 449–460 Contents lists available at ScienceDirect Genomics journal homepage: www.elsevier.com/locate/ygeno Discovery of transcriptional regulators and signaling pathways in the developing pituitary gland by bioinformatic and genomic approaches Michelle L. Brinkmeier a, Shannon W. Davis a, Piero Carninci b, James W. MacDonald c, Jun Kawai b, Debashis Ghosh e,1, Yoshihide Hayashizaki b, Robert H. Lyons d, Sally A. Camper a,⁎ a Department of Human Genetics, University of Michigan Medical School, Ann Arbor, MI, 48109-5618, USA b Omics Science Center, RIKEN Yokohama Institute, Suehiro-cho, Tsurumi-ku, Yokohama, Kanagawa 230-0045, Japan c Affymetrix and cDNA Microarray Core Facility, University of Michigan Cancer Center, Ann Arbor, MI 48109-0946, USA d Department of Biological Chemistry, University of Michigan Medical School, Ann Arbor, MI, 48109-5638, USA e Department of Biostatistics, School of Public Health, University of Michigan, 48109-2029, USA article info abstract Article history: We report a catalog of the mouse embryonic pituitary gland transcriptome consisting of five cDNA libraries Received 13 December 2007 including wild type tissue from E12.5 and E14.5, Prop1df/df mutant at E14.5, and two cDNA subtractions: E14.5 Accepted 24 November 2008 WT–E14.5 Prop1df/df and E14.5 WT–E12.5 WT. DNA sequence information is assembled into a searchable Available online 11 February 2009 database with gene ontology terms representing 12,009 expressed genes. We validated coverage of the libraries by detecting most known homeobox gene transcription factor cDNAs.
    [Show full text]
  • Comprehensive Physiology Development of the Pituitary Gland
    Comprehensive Physiology Article type: Overview Article Development of the pituitary gland Authors Kyriaki S. Alatzoglou, Louise C. Gregory, Mehul T. Dattani Author Affiliations Genetics and Genomic Medicine Programme UCL Great Ormond Street Institute of Child Health 30 Guilford Street London WC1N 1EH Running Head Pituitary development Abstract The development of the anterior pituitary gland occurs in distinct sequential developmental steps, leading to the formation of a complex organ containing five different cell types secreting six different hormones. During this process the temporal and spatial expression of a cascade of signalling molecules and transcription factors plays a crucial role in organ commitment, cell proliferation, patterning and terminal differentiation. The morphogenesis of the gland and the emergence of distinct cell types from a common primordium are governed by complex regulatory networks involving transcription factors and signalling molecules that may be either intrinsic to the developing pituitary or extrinsic, originating from the ventral diencephalon, the oral ectoderm and the surrounding mesenchyme. Endocrine cells of the pituitary gland are organized into structural and functional networks that contribute to the coordinated response of endocrine cells to stimuli; these cellular networks are formed during embryonic development and are maintained or may be modified in adulthood, contributing to the plasticity of the gland. Abnormalities in any of the steps of pituitary development may lead to congenital hypopituitarism that includes a spectrum of disorders from isolated to combined hormone deficiencies including syndromic disorders such as septo-optic dysplasia. Over the last decade, the acceleration of next generation sequencing has allowed for rapid analysis of the patient genome to identify novel mutations and novel candidate genes associated with hypothalmo-pituitary development.
    [Show full text]
  • Lamprecht Et Al, Supplementary Data 1 Suppl. Figure S1. Specificity
    Lamprecht et al, Supplementary Data Suppl. Figure S1. Specificity of PBX3 protein detection. (A) Representative immunohistochemistry of PBX3 in normal colonic mucosa. Scale bar, 100 µm. (B) Immunoblotting for indicated proteins in lysates of normal colonic mucosa and colon cancer tissue, derived from the same patient. (C) Immunoblotting for indicated proteins on whole cell lysates of SW480 and LoVo colon cancer cells after PBX3 or control (siCtrl) knockdown by siRNA for 72 h. (D) Amino acid sequences of PBX3 isoforms obtained from UniProt (www.uniprot.org) and immunogen sequence (epitope) for PBX3 monoclonal antibody (M01), clone 1A9 (Abnova). UniProt identifiers are P40426-1 (PBX3A), P40426-2 (PBX3B), P40426-3 (PBX3C), P40426-4 (PBX3D) and P40426-5 (PBX3-5). 1 Lamprecht et al, Supplementary Data Suppl. Figure S2. Effects of WNT repression on PBX3 in colon cancer cells. Immunoblotting for indicated proteins on whole cell lysates of indicated cell lines 72 h after transfection with two different siRNAs targeting β-catenin or with control siRNA (siCtrl). Numbers below immunoblots indicate normalized fold change by densitometry. n ≥ 3. 2 Lamprecht et al, Supplementary Data Suppl. Figure S3. Lack of transcriptional regulation of PBX3 expression by WNT. (A) Illustration of putative TCF/LEF binding elements (TBEs) within 2.5 kb of the PBX3 transcriptional start site (upper panel), and sequences of wild-type (WT) and mutated (MUT) TBEs used for luciferase assays (lower panel). (B) Dual luciferase assays with empty pBV-Luc vector or vector containing 2.5 kb of the PBX3 promoter region with wild-type (WT) or mutated (MUT) TBEs 24 h after stimulation of HEK293T cells with WNT3a or without stimulation (Ctrl).
    [Show full text]
  • Congenital Hypopituitarism: How to Select the Patients for Genetic
    Crisafulli et al. Italian Journal of Pediatrics (2018) 44:47 https://doi.org/10.1186/s13052-018-0484-y COMMENTARY Open Access Congenital hypopituitarism: how to select the patients for genetic analyses Giuseppe Crisafulli, Tommaso Aversa, Giuseppina Zirilli, Filippo De Luca*, Romina Gallizzi and Malgorzata Wasniewska Abstract Aim of this commentary is to analyze the relationships between genotypic bases and phenotypic expression of congenital “multiple pituitary hormone deficiency” (MPHD) syndrome and to indicate some reliable criteria for selecting the patients who should undergo genetic analyses in order to clarify the etiology of their disorder. On the basis of the most recent reports on this topic, it is possible to infer that: 1) in only few patients with congenital MPHD it is possible to detect a causative gene mutation; 2) therefore, it is fundamental to define some criteria for selecting the patients who should undergo genetic analyses; 3) such inclusion criteria should be based on the overall evaluation of hormonal clinical and neuroradiological phenotype; 4) it is crucial to consider whether the cases are sporadic or familial, since the probability of finding a causative gene mutation is distinctly higher in familial cases; 5) for PROP1 gene it is also important to consider the geographical origin of the patients, because this mutation is much more frequent in some ethnic groups. Keywords: Causative gene mutations, Combined pituitary hormone deficiency, HESX1 gene, LHX3 and LHX4 genes, Multiple pituitary hormone deficiency, POU1F1 gene, PROP1 gene Background familial or sporadic hypopituitarism and those with iso- GH deficiency (GHD) is a relatively uncommon patho- lated GHD or multiple pituitary hormone deficiency logical condition, which should always be considered in (MPHD) [2].
    [Show full text]
  • Pituitary Stem Cell Regulation: Who Is Pulling the Strings?
    234 3 B COX, H ROOSE and others Pathways regulating pituitary 234:3 R135–R158 Review stem cells Pituitary stem cell regulation: who is pulling the strings? Correspondence Benoit Cox*, Heleen Roose*, Annelies Vennekens and Hugo Vankelecom should be addressed Department of Development and Regeneration, Cluster of Stem Cell and Developmental Biology, to H Vankelecom Unit of Stem Cell Research, University of Leuven (KU Leuven), Leuven, Belgium Email *(B Cox and H Roose contributed equally to this work) Hugo.Vankelecom@ kuleuven.be Abstract The pituitary gland plays a pivotal role in the endocrine system, steering fundamental Key Words processes of growth, metabolism, reproduction and coping with stress. The adult f pituitary pituitary contains resident stem cells, which are highly quiescent in homeostatic f stem cells conditions. However, the cells show marked signs of activation during processes f regulation of increased cell remodeling in the gland, including maturation at neonatal age, f homeostasis adaptation to physiological demands, regeneration upon injury and growth of local f regeneration tumors. Although functions of pituitary stem cells are slowly but gradually uncovered, f tumor their regulation largely remains virgin territory. Since postnatal stem cells in general f NOTCH reiterate embryonic developmental pathways, attention is first being given to f WNT Endocrinology of regulatory networks involved in pituitary embryogenesis. Here, we give an overview of f Hedgehog the current knowledge on the NOTCH, WNT, epithelial–mesenchymal transition, SHH f epithelial–mesenchymal and Hippo pathways in the pituitary stem/progenitor cell compartment during various transition Journal (activation) conditions from embryonic over neonatal to adult age. Most information f Hippo comes from expression analyses of molecular components belonging to these networks, f SOX2 whereas functional extrapolation is still very limited.
    [Show full text]