DOCSLIB.ORG

Shh/Gli Signaling in Anterior Pituitary

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Shh/Gli Signaling in Anterior Pituitary SHH/GLI SIGNALING IN ANTERIOR PITUITARY AND VENTRAL TELENCEPHALON DEVELOPMENT by YIWEI WANG Submitted in partial fulfillment of the requirements For the degree of Doctor of Philosophy Department of Genetics CASE WESTERN RESERVE UNIVERSITY January, 2011 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the thesis/dissertation of _____________________________________________________ candidate for the ______________________degree *. (signed)_______________________________________________ (chair of the committee) ________________________________________________ ________________________________________________ ________________________________________________ ________________________________________________ ________________________________________________ (date) _______________________ *We also certify that written approval has been obtained for any proprietary material contained therein. TABLE OF CONTENTS Table of Contents ••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• i List of Figures ••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• v List of Abbreviations •••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• vii Acknowledgements •••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• ix Abstract ••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• x Chapter 1 Background and Significance ••••••••••••••••••••••••••••••••••••••••••••••••• 1 1.1 Introduction to the pituitary gland ••••••••••••••••••••••••••••••••••••••••••••••••••••• 2 1.1.1 The pituitary gland and its function ••••••••••••••••••••••••••••••••••••••••••••• 3 1.1.2 The embryonic development of pituitary •••••••••••••••••••••••••••••••••••••• 6 1.2 Shh/Gli signaling in pituitary development •••••••••••••••••••••••••••••••••••••••• 13 1.2.1 The Sonic hedgehog signal transduction pathway •••••••••••••••••••••••• 13 1.2.2 The Gli transcription factors •••••••••••••••••••••••••••••••••••••••••••••••••••• 14 1.2.3 The role of Shh signaling in holoprosencephaly •••••••••••••••••••••••••••• 17 1.2.4 The role of Shh/Gli signaling in pituitary development ••••••••••••••••••••• 19 1.3 Other signals required in pituitary development •••••••••••••••••••••••••••••••••• 22 1.3.1 Bmps •••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• 22 1.3.2 Fgfs •••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• 25 1.3.3 Wnts ••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• 27 1.3.4 Signaling interactions in pituitary development ••••••••••••••••••••••••••••• 28 1.4 Shh/Gli signaling in ventral telencephalon development ••••••••••••••••••••••• 29 1.4.1 Introduction to the ventral telencephalon •••••••••••••••••••••••••••••••••••• 29 1.4.2 The embryonic development of the ventral telencephalon ••••••••••••••• 30 1.4.3 Shh signaling in telencephalon development ••••••••••••••••••••••••••••••• 33 i Chapter 2 Shh/Gli signaling is active in the pituitary primordium and pituitary cell progenitors •••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• 35 2.1 Abstract •••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• 36 2.2 Materials and methods •••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• 37 2.2.1 Mouse breeding and genotyping •••••••••••••••••••••••••••••••••••••••••••••• 37 2.2.2 Fate mapping •••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• 37 2.2.3 X-gal staining and Immunohistochemistry ••••••••••••••••••••••••••••••••••• 38 2.3 Results ••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• 40 2.3.1 Shh signaling is active in the pituitary primordium ••••••••••••••••••••••••• 40 2.3.2 Gli expression gradient in developing Rathke’s pouch •••••••••••••••••••• 45 2.3.3 Hh-responding cells contribute to ventral cell types in the anterior pituitary •••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• 47 2.4 Discussion ••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• 49 2.5 Acknowlegements •••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• 51 Chapter 3 Direct and indirect requirements for Shh/Gli signaling in early pituitary development •••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• 52 3.1 Abstract •••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• 53 3.2 Introduction •••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• 54 3.3 Materials and methods •••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• 57 3.4 Results ••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• 60 3.4.1 Loss of Gli2 leads to a selective loss of specific pituitary cell types •••• 60 3.4.2 Progenitor proliferation in the nascent pituitary requires cell autonomous expression of Gli2 ••••••••••••••••••••••••••••••••••••••••••••••••••••••• 63 3.4.3 Removal of Gli2 function before the closure of RP causes proliferation defects in some pituitary progenitors ••••••••••••••••••••••••••••••••••••••••••••••••• 68 ii 3.4.4 Overlapping roles of Gli genes in pituitary development •••••••••••••••••• 72 3.4.5 Activation of Hh signaling in RP increases pituitary proliferation without affecting patterning •••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• 75 3.4.6 Patterning of pituitary requires diencephalic function of Gli2 ••••••••••••• 76 3.5 Discussion ••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• 78 3.6 Acknowledgements •••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• 82 Chapter 4 Patterning of the ventral telencephalon requires positive function of Gli transcription factors •••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• 83 4.1 Abstract •••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• 84 4.2 Introduction •••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• 84 4.3 Materials and methods •••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• 87 4.4 Results ••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• 90 4.4.1 A subset of ventral telencephalic progenitors receives Hh signaling and expresses Gli1-lacZ •••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• 90 4.4.2 Hh-responding progenitors produce progressively superficial cortical interneurons ••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• 91 4.4.3 Gli activators are required for the specification of two progenitor groups in the telencephalic sulcus •••••••••••••••••••••••••••••••••••••••••••••••••••• 95 4.4.4 Removal of all Gli genes disrupts production and proliferation of ventral telencephalic neurons ••••••••••••••••••••••••••••••••••••••••••••••••••••••••• 98 4.4.5 Intermingling of different neuronal groups in Gli2/3 mutants ••••••••••• 104 4.5 Discussion ••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• 108 4.6 Acknowledgements •••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• 115 Chapter 5 Conclusions and Future Directions ••••••••••••••••••••••••••••••••••••••• 116 5.1 Summary ••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• 117 iii 5.2 Early Shh signaling in ANR may specify the pituitary primordium •••••••••• 118 5.3 Two different phases of Shh/Gli signaling in pituitary proliferation •••••••••• 119 5.4 Gli2 may be required for diencephalon-derived signals BMP4 and Fgf8 •• 124 5.5 Mouse Gli2 mutant phenotypes correlate with human HPE •••••••••••••••••• 125 5.6 Future directions •••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• 127 5.6.1 Shh/Gli signaling is required for early specification of the pituitary primordium ••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• 127 5.6.2 Shh/Gli singaling is required in the ventral diencephalon for pituitary cell proliferation ••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• 131 5.6.3 Shh/Gli singaling is required for cell type specification of the anterior pituitary ••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• 131 5.6.4 Interactions between Shh and other signaling pathways •••••••••••••••• 132 5.6.4 a Shh interacts with Bmp2 to regulate pituitary differentiation ••••• 133 5.6.4 b Gli2 regulate Bmp2 transcription by direct binding sites ••••••••• 135 5.6.5 Further study of Shh signaling in the pituitary gland •••••••••••••••••••••• 137 Appendix •••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• 140 References ••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••• 151 iv LIST OF FIGURES Chapter 1 Figure 1-1 Location and structure of the pituitary gland in the human brain •••••• 4 Figure 1-2 Embryonic development of the pituitary gland in the mouse ••••••••••• 7 Figure 1-3 Transcription factors in pituitary development ••••••••••••••••••••••••••• 10 Figure 1-4 The Shh/Gli signaling pathway ••••••••••••••••••••••••••••••••••••••••••••• 15 Figure 1-5 Multiple signaling pathways required for pituitary development •••••• 24 Figure 1-6 Telencephalon development •••••••••••••••••••••••••••••••••••••••••••••••• 31 Chapter 2 Figure 2-1 Fate mapping strategy •••••••••••••••••••••••••••••••••••••••••••••••••••••••
Load more

Recommended publications
  • Distribution of Immunoreactive ,&Neo
    0270-6474/84/0405-1248$02.00/O The Journal of Neuroscience Copyright 0 Society for Neuroscience Vol. 4, No. 5, pp. 1248-1252 Printed in U.S.A. May 1984 DISTRIBUTION OF IMMUNOREACTIVE ,&NEO-ENDORPHIN IN DISCRETE AREAS OF THE RAT BRAIN AND PITUITARY GLAND: COMPARISON WITH a-NEO-ENDORPHIN NADAV ZAMIR,’ MIKLOS PALKOVITS, AND MICHAEL J. BROWNSTEIN Laboratory of Cell Biology, National Institute of Mental Health, Bethesda, Maryland 20205 Received August 5, 1983; Revised December 2, 1983; Accepted December 2, 1983 Abstract The distribution of immunoreactive (ir)-P-neo-endorphin in 101 miscrodissected rat brain and spinal cord regions as well as in the neurointermediate lobe of pituitary gland was determined using a highly specific radioimmunoassay. The highest concentration of P-neo-endorphin in brain was found in the median eminence (341.4 fmol/mg of protein). High concentrations of ir-/3-neo- endorphin (>250 fmol/mg of protein) were found in 11 nuclei, including dorsomedial nucleus, substantia nigra, parabrachial nuclei, periaqueductal gray matter, anterior hypothalamic nucleus, and lateral preoptic areas. Moderate concentrations of the peptide (between 100 and 250 fmol/mg of protein) were found in 66 brain nuclei such as the amygdaloid and septal nuclei, most of the diencephalic structures (not including the hypothalamus), and the majority of the medulla oblongata nuclei and others. Low concentrations of ir-P-neo-endorphin (Cl00 fmol/mg of protein) were found in 21 nuclei, e.g., cortical structures (frontal., cingulate, piriform, parietal, entorhinal, occipital), olfactory tubercle, and cerebellum (nuclei and cortex). The olfactory bulb has the lowest /3-neo- endorphin concentration (21.3 fmol/mg of protein).
    [Show full text]
  • A Practical Handbook for Determining the Ages of Gulf of Mexico And
    A Practical Handbook for Determining the Ages of Gulf of Mexico and Atlantic Coast Fishes THIRD EDITION GSMFC No. 300 NOVEMBER 2020 i Gulf States Marine Fisheries Commission Commissioners and Proxies ALABAMA Senator R.L. “Bret” Allain, II Chris Blankenship, Commissioner State Senator District 21 Alabama Department of Conservation Franklin, Louisiana and Natural Resources John Roussel Montgomery, Alabama Zachary, Louisiana Representative Chris Pringle Mobile, Alabama MISSISSIPPI Chris Nelson Joe Spraggins, Executive Director Bon Secour Fisheries, Inc. Mississippi Department of Marine Bon Secour, Alabama Resources Biloxi, Mississippi FLORIDA Read Hendon Eric Sutton, Executive Director USM/Gulf Coast Research Laboratory Florida Fish and Wildlife Ocean Springs, Mississippi Conservation Commission Tallahassee, Florida TEXAS Representative Jay Trumbull Carter Smith, Executive Director Tallahassee, Florida Texas Parks and Wildlife Department Austin, Texas LOUISIANA Doug Boyd Jack Montoucet, Secretary Boerne, Texas Louisiana Department of Wildlife and Fisheries Baton Rouge, Louisiana GSMFC Staff ASMFC Staff Mr. David M. Donaldson Mr. Bob Beal Executive Director Executive Director Mr. Steven J. VanderKooy Mr. Jeffrey Kipp IJF Program Coordinator Stock Assessment Scientist Ms. Debora McIntyre Dr. Kristen Anstead IJF Staff Assistant Fisheries Scientist ii A Practical Handbook for Determining the Ages of Gulf of Mexico and Atlantic Coast Fishes Third Edition Edited by Steve VanderKooy Jessica Carroll Scott Elzey Jessica Gilmore Jeffrey Kipp Gulf States Marine Fisheries Commission 2404 Government St Ocean Springs, MS 39564 and Atlantic States Marine Fisheries Commission 1050 N. Highland Street Suite 200 A-N Arlington, VA 22201 Publication Number 300 November 2020 A publication of the Gulf States Marine Fisheries Commission pursuant to National Oceanic and Atmospheric Administration Award Number NA15NMF4070076 and NA15NMF4720399.
    [Show full text]
  • Formation of Primordia and Phyllotaxy Andrew J Fleming
    Formation of primordia and phyllotaxy Andrew J Fleming Leaves are made in an iterative pattern by the shoot apical Introduction meristem. The mechanism of this pattern formation has Immediately after germination, plants have an apparently fascinated biologists, mathematicians and poets for simple structure. During the subsequent lifetime of the centuries. Over the past year, fundamental insights into the plant, this structure can become exquisitely ornate. This molecular basis of this process have been gained. Patterns of is as a result of the ability of the plant to continually auxin polar transport dictate when and where new leaf generate organs from a specialised structure, the apical primordia are formed on the surface of the apical meristem. meristem. The most common organ formed is the leaf. Subsequent events are still obscure but appear to involve both These organs are not generated in a random fashion, alteration of cell wall characteristics (to facilitate a new vector of rather in a consistent pattern over space and time, produc- growth) and a cascade of spatially co-ordinated transcription ing the regular architecture of the plant. The meristem is, factor activity (to determine the fate of cells that are thus, a pattern-generating machine. Recent research, incorporated into new lateral organs). The co-ordinated described in this review, has provided key insights into signalling events involved in these processes are beginning the operation of this machine. to be elucidated. Meristems provide a field of cells from Addresses which leaves can be made Department of Animal and Plant Sciences, University of Sheffield, The shoot apical meristem consists of a population of cells Western Bank, Sheffield S10 2TN, UK that functions to maintain itself and, at periodic intervals, Corresponding author: Fleming, Andrew J (a.fleming@sheffield.ac.uk) to generate a new organ (a leaf primordium) from its lateral boundary (Figure 1).
    [Show full text]
  • The Bright Pituitary Gland-A Normal MR Appearance in Infancy
    The Bright Pituitary Gland-A Normal MR Appearance in Infancy Samuel M. Wolpert' Signal intensities of the pituitary gland were measured on T1 -weighted sagittal MR Mark Osborne2 images of 25 patients younger than 20 years old. We found that the signal intensities in Mary Anderson' the eight patients who were 8 weeks old or younger were higher (shorter T1) than those Val M. Runge2 in the 17 older patients. We also noted a difference in the signal intensities across the pituitary gland, the signal being higher in the posterior part of the gland than in the anterior part. We attribute the high signal intensities to the rapid intrauterine pituitary growth, so that at term pituitary protein synthetic activity is at a maximum. Possibly, an increase in the bound fraction of the water molecules of the gland may also be present in the neonatal pituitary as compared with the older gland, but this remains to be proved. The higher signal in the posterior pituitary gland may be due to lipid in the pituicyte cells of the posterior pituitary gland. The signal intensity of the contents of the sella turcica on T1-weighted MR images is not always uniform and homogeneous., Often , a high-intensity crescent­ shaped structure is seen oriented along the posterior-inferior margin of the sella turcica. Some believe this to be fat in the sella turcica but behind the gland [1]. Others think that the high intensity is derived from the posterior pituitary itself [2 , 3]. There are no published observations about the MR appearance of the pituitary gland in infants and children .
    [Show full text]
  • A Case of Acute Sheehan's Syndrome and Literature Review: a Rare but Life
    Matsuzaki et al. BMC Pregnancy and Childbirth (2017) 17:188 DOI 10.1186/s12884-017-1380-y CASEREPORT Open Access A case of acute Sheehan’s syndrome and literature review: a rare but life-threatening complication of postpartum hemorrhage Shinya Matsuzaki* , Masayuki Endo, Yutaka Ueda, Kazuya Mimura, Aiko Kakigano, Tomomi Egawa-Takata, Keiichi Kumasawa, Kiyoshi Yoshino and Tadashi Kimura Abstract Background: Sheehan’s syndrome occurs because of severe postpartum hemorrhage causing ischemic pituitary necrosis. Sheehan’s syndrome is a well-known condition that is generally diagnosed several years postpartum. However, acute Sheehan’s syndrome is rare, and clinicians have little exposure to it. It can be life-threatening. There have been no reviews of acute Sheehan’s syndrome and no reports of successful pregnancies after acute Sheehan’s syndrome. We present such a case, and to understand this rare condition, we have reviewed and discussed the literature pertaining to it. An electronic search for acute Sheehan’s syndrome in the literature from January 1990 and May 2014 was performed. Case presentation: A 27-year-old woman had massive postpartum hemorrhage (approximately 5000 mL) at her first delivery due to atonic bleeding. She was transfused and treated with uterine embolization, which successfully stopped the bleeding. The postpartum period was uncomplicated through day 7 following the hemorrhage. However, on day 8, the patient had sudden onset of seizures and subsequently became comatose. Laboratory results revealed hypothyroidism, hypoglycemia, hypoprolactinemia, and adrenal insufficiency. Thus, the patient was diagnosed with acute Sheehan’s syndrome. Following treatment with thyroxine and hydrocortisone, her condition improved, and she was discharged on day 24.
    [Show full text]
  • Section 2. Jack Pine (Pinus Banksiana)
    SECTION 2. JACK PINE - 57 Section 2. Jack pine (Pinus banksiana) 1. Taxonomy and use 1.1. Taxonomy The largest genus in the family Pinaceae, Pinus L., which consists of about 110 pine species, occurs naturally through much of the Northern Hemisphere, from the far north to the cooler montane tropics (Peterson, 1980; Richardson, 1998). Two subgenera are usually recognised: hard pines (generally with much resin, wood close-grained, sheath of a leaf fascicle persistent, two fibrovascular bundles per needle — the diploxylon pines); and soft, or white pines (generally little resin, wood coarse-grained, sheath sheds early, one fibrovascular bundle in a needle — the haploxylon pines). These subgenera are called respectively subg. Pinus and subg. Strobus (Little and Critchfield, 1969; Price et al., 1998). Occasionally, one to about half the species (20 spp.) in subg. Strobus are classified instead in a variable subg. Ducampopinus. Jack pine (Pinus banksiana Lamb.) and its close relative lodgepole pine (Pinus contorta Dougl. Ex Loud.) are in subg. Pinus, subsection Contortae, which is classified either in section Trifoliis or a larger section Pinus (Little and Critchfield, 1969; Price et al., 1998). Additionally, subsect. Contortae usually includes Virginia pine (P. virginiana) and sand pine (P. clausa), which are in southeastern USA. Jack pine has two quite short (2-5 cm) stiff needles per fascicle (cluster) and lopsided (asymmetric) cones that curve toward the branch tip, and the cone scales often have a tiny prickle at each tip (Kral, 1993). Non-taxonomic ecological or biological variants of jack pine have been described, including dwarf, pendulous, and prostrate forms, having variegated needle colouration, and with unusual branching habits (Rudolph and Yeatman, 1982).
    [Show full text]
  • Jcrpe-2018-0036.R1 Review Neonatal Hypopituitarism: Diagnosis and Treatment Approaches Running Short Title: Neonatal Hypopituita
    Jcrpe-2018-0036.R1 Review Neonatal Hypopituitarism: Diagnosis and Treatment Approaches Running short title: Neonatal Hypopituitarism Selim Kurtoğlu1,2, Ahmet Özdemir1, Nihal Hatipoğlu2 1Erciyes University, Faculty of Medicine, Department of Pediatrics, Division of Neonatalogy 2Erciyes University, Faculty of Medicine, Department of Pediatrics, Division of Pediatric Endocrinology Corresponding author: Ahmet Özdemir MD, Department of Pediatrics, Division of Neonatalogy, Erciyes University Medical Faculty, Kayseri, Turkey E-mail: [email protected] Tel: 00-90-3522076666 Fax: 00-90-3524375825 Received: 01.02.2018 Accepted: 08.05.2018 What is already known on this topic? The pituitary gland is the central regulator of growth, metabolism, reproduction and homeostasis. Hypopituitarism is defined as a decreased release of hypophysis hormones, which may be caused by pituitary gland disease or hypothalamus disease. Clinical findings for neonatal hypopituitarism dependproof on causes and hormonal deficiency type and degree. If early diagnosis is not made, it may cause pituitary hormone deficiencies. What this study adds? We aim to contribute to the literature through a review of etiological factors, clinical findings, diagnoses and treatment approaches for neonatal hypopituitarism. We also aim to increase awareness of neonatal hypopituitarism. We also want to emphasize the importance of early recognition. Abstract Hypopituitarism is defined as a decreased release of hypophysis hormones, which may be caused by pituitary gland disease or hypothalamus disease. Clinical findings for neonatal hypopituitarism depend on causes and hormonal deficiency type and degree. Patients may be asymptomatic or may demonstrate non-specific symptoms, but may still be under risk for development of hypophysis hormone deficiency with time. Anamnesis, physical examination, endocrinological, radiological and genetic evaluations are all important for early diagnosis and treatment.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • A Case of Congenital Central Hypothyroidism Caused by a Novel Variant (Gln1255ter) in IGSF1 Gene
    Türkkahraman D et al. A Novel Variant in IGSF1 Gene CASE REPORT DO I: 10.4274/jcrpe.galenos.2020.2020.0149 J Clin Res Pediatr Endocrinol 2021;13(3):353-357 A Case of Congenital Central Hypothyroidism Caused by a Novel Variant (Gln1255Ter) in IGSF1 Gene Doğa Türkkahraman1, Nimet Karataş Torun2, Nadide Cemre Randa3 1University of Health Sciences Turkey, Antalya Training and Research Hospital, Clinic of Pediatric Endocrinology, Antalya, Turkey 2University of Healty Sciences Turkey, Antalya Training and Research Hospital, Clinic of Pediatrics, Antalya, Turkey 3University of Healty Sciences Turkey, Antalya Training and Research Hospital, Clinic of Medical Genetics, Antalya, Turkey What is already known on this topic? Mutations in the immunoglobulin superfamily, member 1 (IGSF1) gene that mainly regulates pituitary thyrotrope function lead to X-linked hypothyroidism characterized by congenital hypothyroidism of central origin and testicular enlargement. The clinical features associated with IGSF1 mutations are variable, but prolactin and/or growth hormone deficiency, and discordance between timing of testicular growth and rise of serum testosterone levels could be seen. What this study adds? Genetic analysis revealed a novel c.3763C>T variant in the IGSF1 gene. To our knowledge, this is the first reported case of IGSF1 deficiency from Turkey. Additionally, as in our case, early testicular enlargement but delayed testosterone rise should be evaluated in all boys with central hypothyroidism, as macro-orchidism is usually seen in adulthood. Abstract Loss-of-function mutations in the immunoglobulin superfamily, member 1 (IGSF1) gene cause X-linked central hypothyroidism, and therefore its mutation affects mainly males. Central hypothyroidism in males is the hallmark of the disorder, however some patients additionally present with hypoprolactinemia, transient and partial growth hormone deficiency, early/normal timing of testicular enlargement but delayed testosterone rise in puberty, and adult macro-orchidism.
    [Show full text]
  • Shape Matters: Hofmeister's Rule, Primordium Shape, and Flower Orientation
    Int. J. Plant Sci. 164(4):505–517. 2003. ᭧ 2003 by The University of Chicago. All rights reserved. 1058-5893/2003/16404-0003$15.00 SHAPE MATTERS: HOFMEISTER’S RULE, PRIMORDIUM SHAPE, AND FLOWER ORIENTATION Bruce K. Kirchoff1 Department of Biology, P.O. Box 26170, University of North Carolina at Greensboro, Greensboro, North Carolina 27402-6170, U.S.A. Hofmeister’s rule is an empirical heuristic derived from the observation that new leaf primordia are formed in the largest space between the existing flanks of the older primordia. These observations have been repeatedly validated in studies of leaf arrangement, but there has been little attempt to extend them to inflorescence and floral organs. This investigation demonstrates the validity of Hofmeister’s observations to cincinnus and early flower development in Phenakospermum guyannense (Strelitziaceae) and Heliconia latispatha (Heliconiaceae) and relates these results to Paul Green’s work on the biophysics of organ formation. The cincinni of Phen- akospermum and Heliconia arise in the axils of primary bracts and produce a prophyll, continuation apex, and flower in regular succession. The shapes and orientations of the apical regions of the cincinni are correlated with the placement of these organs, which in turn effect the positions of the sepals and their sequence of formation. The result is two rows of mirror-image flowers. The mirror-image symmetry of the flowers is a direct result of Hofmeister’s rule in connection with the shape of the apical region. These two factors create a self-sustaining developmental system that produces prophylls, continuation apices, flowers, and sepals in regular succession.
    [Show full text]
  • Hypothalamus - Wikipedia
    Hypothalamus - Wikipedia https://en.wikipedia.org/wiki/Hypothalamus The hypothalamus is a portion of the brain that contains a number of Hypothalamus small nuclei with a variety of functions. One of the most important functions of the hypothalamus is to link the nervous system to the endocrine system via the pituitary gland. The hypothalamus is located below the thalamus and is part of the limbic system.[1] In the terminology of neuroanatomy, it forms the ventral part of the diencephalon. All vertebrate brains contain a hypothalamus. In humans, it is the size of an almond. The hypothalamus is responsible for the regulation of certain metabolic processes and other activities of the autonomic nervous system. It synthesizes and secretes certain neurohormones, called releasing hormones or hypothalamic hormones, Location of the human hypothalamus and these in turn stimulate or inhibit the secretion of hormones from the pituitary gland. The hypothalamus controls body temperature, hunger, important aspects of parenting and attachment behaviours, thirst,[2] fatigue, sleep, and circadian rhythms. The hypothalamus derives its name from Greek ὑπό, under and θάλαμος, chamber. Location of the hypothalamus (blue) in relation to the pituitary and to the rest of Structure the brain Nuclei Connections Details Sexual dimorphism Part of Brain Responsiveness to ovarian steroids Identifiers Development Latin hypothalamus Function Hormone release MeSH D007031 (https://meshb.nl Stimulation m.nih.gov/record/ui?ui=D00 Olfactory stimuli 7031) Blood-borne stimuli
    [Show full text]
  • Blueprint of Pediatric Endocrinology Book
    See discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/317428263 blueprint of pediatric endocrinology book Book · January 2014 CITATIONS READS 0 27 1 author: Abdulmoein Eid Al - Agha King Abdulaziz University 148 PUBLICATIONS 123 CITATIONS SEE PROFILE Some of the authors of this publication are also working on these related projects: HYPOPHOSPHATEMIC RICKETS, EPIDERMAL NEVUS SYNDROME WITH... View project HYPERTRIGLYCERIDAEMIA-INDUCED ACUTE PANCREATITIS IN AN INFANT: A CASE REPORT View project All content following this page was uploaded by Abdulmoein Eid Al - Agha on 09 June 2017. The user has requested enhancement of the downloaded file. IN THE NAME OF ALLAH, THE MERCIFUL, THE MERCY-GIVING iii Blueprint in Pediatric Endocrinology Abdulmoein Eid Al-Agha, MBBS, DCH, FRCPCH Pediatric Endocrinologist King AbdulAziz University Faculty of Medicine Jeddah, Saudi Arabia © King Abdulaziz University: 1435 A.H. (2014 AD.) All rights reserved. 1st Edition: 1435 A.H. (2014 A.D.) Table of Contents Chapter 1: Basic Endocrinology Introduction…………………………………………………………………….. 3 Effects of hormones…………………………………………………………….. 3 Types of hormones……………………………………………………………… 4 Types of Hormone Receptors………………...………………………………... 5 Loss – of – function mutations………………………………………………….. 7 Gain – of – function mutations……………………………...………………….. 9 Fetal Brain Programming ………………………………………………………. 10 The endocrine system ……………………………...…………………………... 10 Hypothalamic-Pituitary Relationships………………………………………….. 10 Hypothalamic Controls………………………………………………………….
    [Show full text]