Supporting Information Scully et al. 10.1073/pnas.1614970113 SI Materials and Methods Histology and Immunofluorescence Assays. For immunohistochem- Generation of Conditional Deletions of the Itgb1 and VEGF-A Genes. istry with anti-PECAM/CD31 and anti–PV-1 antibodies, fresh- All mice were housed in strict accordance with the principles and frozen tissue sections were mounted on slides, fixed at room procedures outlined in the NIH GuidefortheCareandUseof temperature in acetone for 2 min, and dried before staining. For all Laboratory Animals (40). All procedures were approved by the other histological analyses, including H&E staining, and indirect University of California, San Diego Institutional Animal Care and immunofluorescence assays, tissues were fixed with 10% (vol/vol) Use Committee. The mouse strain B6;129-Itgb1tm1Efu/J (common phosphate-buffered formalin or 4% (wt/vol) paraformaldehyde by name Itgb1flox), donated to The Jackson Laboratory by Elaine transcardial perfusion and/or immersion. Primary antibodies di- Fuchs, harbors loxP sitesoneithersideofexon3oftheItgb1 gene. rected against pituitary hormones were provided by A. F. Parlow – Deletion of exon 3 by Cre-recombinase results in frame shift and (Harbor UCLA Medical Center) and the National Hormone and premature termination of translation (17). Itgb1f/f mice were bred Pituitary Program (National Institute of Diabetes and Digestive to transgenic mice harboring cre-recombinase under the control of and Kidney Diseases). They included rabbit anti-human ACTH 8 kb of mouse pitx-1 5′ sequence (16) or 2 kb of mouse prop-1 5′ (adrenocorticotropic hormone) (1:500, AFP-39032082); rabbit β sequence, including exon 1 (18). Itgb1f/f; Pitx1-cre knockout pups anti-rat TSH- (1:1,000, AFP-1274789); monkey anti-rat GH β die soon after birth with palate defects that preclude suckling. (1:1,000, AFP 411S); guinea pig anti-rat LH- (1:1,000, AFP- α To generate littermate Itgb1f/f; Pitx1-cre knockout and Itgb1f/f con- 2223879OGPOLHB); and rabbit anti-rat GSU (1:500, AFP- + trols, heterozygous Itgb1f/ ;Pitx1-creanimals were crossed to Itgb1f/f 66P9986). Other primary antibodies used were rabbit anti-human animals. Primers used to genotype these animals were CRE5′ PRL (1:250, DAKO A0569); rabbit anti-rat Pit-1 [1:250, Simmons ′ et al. (41)]; mouse antiphosphohistone H3 serine 10 (pH 3) (1:200, GGAAATGGTTTCCCGCAGAAC and CRE3 ACCCTGATC- β CTGGCAATTTCG, which amplify an ∼400-bp product, and β1- Cell Signaling Technology 9706S); rat anti-mouse integrin 1 clone integrin oIMR1906 CGGCTCAAAGCAGAGTGTCAGTC-3′ MB1.2 (1:100, MAB1997; Chemicon/Millipore); rat anti-mouse CD31/PECAM-1 clone MEC13.3 (1:20, 550274; BD Pharmingen); and oIMR1907 CCACAACTTTCCCAGTTAGCTCTC, which – amplify ∼160 bp of the wild-type Itgb1 allele and ∼280 bp of rabbit anti-mouse EHS laminin (1:200, L9393; Sigma Aldrich); f/f rabbit anti-rat NG2 (1:200, AB5320; Chemicon/Millipore); rat the Itgb1 allele (genotyping by The Jackson Laboratory). f/f f/f anti-mouse CD140b/PDGFRβ clone APB5 (1:500, 14-1402-82; Itgb1 ; Prop1-cre animals were viable and fertile. Itgb1 ; Prop1-cre eBioscience); rat anti-mouse PV-1 IgG2a mAb (1:500), which knockouts and Itgb1f/f littermate controls were generated by breeding was affinity-purified by FPLC on an anti-rat IgG column (GE Itgb1f/f; Prop1-cre to Itgb1f/f animals. VEGF loxP mice (herein referred Healthcare) from the supernatant of the clone MECA-32 hy- to as VEGF-Af/f) were generously provided by Genentech. These bridoma (Developmental Studies Hybridoma Bank, University mice harbor loxP sites on either side of exon 3, which is common to of Iowa) grown in serum-free hybridoma medium (Invitrogen), all isoforms of VEGF-A. Primers used to genotype these animals and then labeled with Alexa-647 fluorophore (Molecular Probes/ were muVEGF419.F CCTGGCCCTCAAGTACACCTT and mu- Invitrogen), as per the manufacturer’s instructions (19). Sec- VEGF567.R TCCGTACGACGCATTTCTAG. They amplify ondary antibodies were labeled with Alexa fluorphores-488, -594, loxP ∼ 148 bp of alleles and 108 bp of wild-type alleles (29). or -647 (1:500; Molecular Probes/Invitrogen). Images were ob- VEGF-Af/f; Pitx1-cre animals were viable and fertile. VEGF-Af/f; f/f tained using a Zeiss Axioplan 2 microscope and a Leica SP5 Pitx1-cre knockouts and VEGF-A littermate controls were confocal microscope. generated by breeding VEGF-Af/f; Pitx1-cre to VEGF-Af/f ani- β−/− mals. PDGFR and littermate control embryos were gener- Pericyte Recruitment. Sixteen-micrometer serial sagittal sections ously provided by Lorin Olson, Oklahoma Medical Research beginning at the midline and progressing through the lateral an- Foundation, Oklahoma City (24). terior lobes were collected and immunostained with VEGFR2 (endothelial cells) and PDGFRβ (pericytes). Four pairs of e13.5 Quantitative Real-Time PCR. Quantitative real-time (RT) PCR was Itgb1f/f; Pitx1-cre and control Itgb1f/f littermate embryos were carried out with RNA extracted using TRIzol (Life Technologies) examined in this manner. Each pair was from an independent litter. from control and Itgb1 gene-deleted pituitaries from stages as indicated in the figures. RNA samples were DNase I-treated, and Quantification of EC Clusters, Presence of Lumens, and Lumen Diameter. all RT-PCR reactions were accompanied by RT(−) controls. Ex- Four Itgb1f/f and four Itgb1f/f; Prop1-cre were analyzed at e14.5. Each periments were performed with three biological replicates and pair was from an independent litter. Coronal sections were im- three technical replicates. The data were normalized to GAPDH. munostained with integrin β1 and CD31 antibodies and imaged on a Zeiss Axioplan 2 MOT Microscope System and a Leica SP5 Computed Tomography, Data Processing, and Image Generation. All confocal microscope. CD31(+) EC clusters were counted in three samples were processed using a Numira Biosciences proprietary equivalently sized sections from each animal. The fraction of EC staining technique. The samples were scanned on a high-resolution, clusters with lumens was established on the same sections. Lumen μ volumetric microCT scanner ( CT40; ScanCo Medical). The image diameters were measured using the straight-line tool in ImageJ. The μ data were acquired with the following parameters: 6- m isotropic shortest distance across each lumen was recorded to eliminate error voxel resolution at 200-ms exposure time, 2,000 views, and 10 based on the angle at which each vessel was cut. Statistical analysis frames per view. The microC-generated DICOM (Digital Imaging was performed with Prism 7 software (GraphPad Software). and Communication) files were used to create images of the samples. The raw data files were viewed using Microview (GE RNA-Sequencing. Embryonic mouse pituitaries were dissected at Healthcare). Using Numira’s software, the files were converted e12.5 and frozen individually. Following genotyping, total RNA into frames for planar movies and used to generate rotating 3D from separate biological replicates of three control and two movies. The movie frames were then converted into QuickTime knockout pituitaries was isolated using TRIzol (Life Technologies), (Apple, Inc.) movies for viewing and screen capture. chloroform extraction, and isopropanol precipitation. Ribosomal Scully et al. www.pnas.org/cgi/content/short/1614970113 1of10 RNA was removed using a Ribo-Zero Magnetic Kit (Epicentre), a erate correlation plots that identified genes with a consistent strand-specific library was constructed with ScriptSeq v2 RNA-Seq pattern of differential expression in control vs. knockout pituitaries. Library Preparation Kit (Epicentre), and deep sequencing was carried out on an Illumina HiSeq 2000. The RNA-seq reads were Microarray Analysis. RNA was prepared from individual micro- aligned to the mouse genome mm9 using Bowtie2 with ultrasensitive dissected e12.5 pituitaries from Prop1 knockout and mutant animals. parameters. Because the number of assignable reads in the samples RNA quality was assessed using the Agilent Bioanalyzer 6000 Pico 6 6 ranged from 11 × 10 to 38 × 10 ,Homer(homer.salk.edu)was LabChip. One hundred nanograms of total RNA was labeled with used to select an equal number of reads randomly from each Cy-3 or Cy-5 using the Agilent Low RNA Input Fluorescent Linear sample. RNA-seq reads were counted over gene exons and reads Amplification Kit. Labeled cDNA was hybridized to the Agilent 44K for the same exons were combined allowing only two exact dupli- Whole-Mouse Genome Array. Data were collected using the Agilent cate tags in any one position. Genes with less than eight tags per kilobase were filtered out. edgeR software (www.bioconductor.org/ Microarray Scanner and Feature Extraction Software, using a Lowess packages/release/bioc/vignettes/edgeR/inst/doc/edgeRUsersGuide. option with spatial detrend. Normalized data were imported into pdf) was used for statistical analysis, set with a P value ≤0.01 and a Focus to extract genes of interest with more confidence than through minimum fold change of 1.5 either up or down. Pairwise compar- the use of fold-change only (42). Experiments were performed in isons of each control to each knockout sample were used to gen- triplicate, with litter-matched wild-type and mutant samples. Scully et al. www.pnas.org/cgi/content/short/1614970113 2of10 Fig. S1. Integrin β1 is expressed in pituitary gland epithelial cells throughout embryonic development and is inactivated at e10.5 with Pitx1-cre and at e14.5 with Prop1-cre.(A) Embryonic development of the glandular anterior and intermediate lobes (yellow) beginning with invagination of the oral ectoderm at e10.5. Tandem outgrowth of the third ventricle gives rise to the neural posterior lobe (gray). At e13.5, the first evidence appears of nascent microvessels (M) in red. (B) Immunohistochemical staining of integrin β1 and laminin in sections of control embryonic pituitaries. (Top Left) e10.5 is the same image shown in Fig. 1A, Left. Laminin marks the basement membranes of the organ primordium and the developing vasculature.