Accepted Article Disability Syndrome(SMRXS) Durham NC Durham NC

6 5 4 3 2 1 Vandana Shashi The This article is protected by co protected is article This ofinterestNo conflicts Margaret N. Berry Margaret N. Email: [email protected] Fax: (919)668-0414 Tel: (919)681-2616 27710 Durham NC Sciences, Health Duke University Box 103857, Vandana Shashi,MD Corresponding author: Allen Division ofBrainSciences, College,London,UK Imperial UniversityDepartment ofBiostatistics, Sciences Duke Health GreenwoodSC GeneticCenter, Greenwood Wake Univ Department ofPediatrics, Forest Genome Variation,DukeCenter forHumanSchool University ofMedicine Department ofPediatrics,Division Medical of article as doi: 10.1111/cge.12511 lead todifferencesbetween thismay version been through the copyediting, typesetting, pagination and proofreading process, which This article hasbeen accepted for publication andundergone full peer review but has not 5 RBMX , Anna C.Need , Anna gene asaCandidate gene forth 1 , Pingxing Xie, Pingxing 3 , Charles E. Schwartz , Charles 6 pyright. reserved rights All 2 , Kelly Schoch , Kelly 4 , Kenneth Cronin ersity NC Health Sciences,Winston-Salem 1 Genetics, Duke University Medical Sciences, University Genetics, Duke e Shashi X-linked Intellectual e ShashiX-linked , David B.Goldstein David , and theofRecord. Pleasethis Version cite 2 , Samantha Sliwa 2 ,

Timothy D.Howard Timothy 2 , Andrew , Andrew 3 , Accepted Article with this distinctive syndrome. XLID andmayenablewith identificationthe lociassociated ofotherindividuals the affected RBMX ofmodeling studiesindicatelossoffunction that andanimal XLID genes. Priorexpression tolossintolerant offunctionvariants,being relatively adistinctivepatternseeninsubset a of ( 23 bpframeshift a identified deleti disorder,we interval.whole sequencing On exome inthela and distinguishingcraniofacial dysmorphism A novelX-linked intellectual disability (XLID) This article is protected by co protected is article This coding regions and thenon-coding of regions previouslycausal disease.We ofhuman males (n=2)andincontrol databases (7800exomes). The RBMX results in abnormal brain development. Our finding addsanovel to putatively braindevelopment. gene in results abnormal )

gene at Xq26 in the affected males (n=7), one carrier female, absent in unaffected female,absentinunaffected onecarrier atXq26ingene theaffectedmales (n=7), pyright. reserved rights All examined thegenicexamined intolerancethe scores for Abstract Abstract s beenpreviously had mapped totheXq26-q27 syndrome withmoderateintellectual disability RBMX rge family withthis originally reported on inon theRNABindingMotifProteinX-linked ; thefindingsindicative were of RBMX genehas notbeen RBMX

Accepted Article WES. identifyunderlying againthe genewith to family members RetardationSyndrome, SMRSX) remained unknown.Recently,we contacted theoriginal gene responsible for thisunique syndrome XLID (OMIM%300238, ShashiMental X-linked underlying the However, features and haplotyping. onclinical conditionthe samebased et al.,(8)Xq26-q27 (7).Subsequently,Castro believed had reported twobrotherswhothey mapped to thegenewas moderate intellectualdisability andcraniofacialdysmorphisms; alargefamilyinNorthCarolinaWe hadpreviously with reported form ofXLIDwith aunique intolerant to functional variants (6). genes haveMendelian diseases beengenerally associatedXLID, since with be foundto of thejudgementenable furtherrefinement of the coding (RVIS)non-coding regions (6)and advances suchasof genes theprioritization based variantson intolerance tofunctional in discovered as beingerroneous,enablingmore accurateRecent associations etiological (5). also in resulted thedetectionspurious of hasaccele(4). Wholeexomesequencing (WES) This article is protected by co protected is article This 100 genes beingidentified sofar(http://www.ggc.org/research/molecular-studies/xlid.html) neurotransmissionApproximately 200 XLID (3). XLID genesareusuallymutations in loss-of-fu with ahigher vulnerability recessiv toX-linked A concentration ofgenesintelligence associated with on males the X-chromosomeconfers pyright. reserved rights All Introduction gene associations, with approximately 10%being gene associations, whetheragenecouldassociated be with e intellectual disability (XLID) (1,2).Causal (XLID) disability intellectual e nction, impairing inhibitory andexcitatory nction, impairing (ncRVIS) (manuscript in preparation)can (manuscript (ncRVIS) disordershave beendescribed, over with rated thediscovery ofgenes has these and Accepted Article RVIS) and ncRVIS Scores: We used the RVIS Scores:We used (6)andncRVIS topredicthow likelyRVIS) andncRVIS affected reportedbyCastro etal males (8). thefamily.Sanger RBMXthe results to sequencing ofthe genewasperformed on the two laboratory (GeneDx,certified Gaithersburg, MD Analyzer (Foster inof thevariant CA),FurtherconfirmationCity, wasperformed aCLIA- onallSanger sequenced fromthefamilyDNA using participants Applied 3730 Biosystems insertion/deletionvariants the located inprotein-coding regions. Thevariant ofinterest was focusing on nonsynonymous variants, variants interval) were shared betweenIV-4that andIV-5, butwerenotcarriedmale controls, by any specialvariants attention totheXq26-q27 (with searched forhemizygous XWe chromosome rare geneticdisorders orintellectual disabilities. Noneofthe controls(http://evs.gs.washington.edu/EVS/). beenascertained had forsevere from (n=1300) and the NHLBI (ESP, GOExome Sequencing n=6503) Project using(9, 10).Cont previously methods described participants were utilized. WES was performed WES: Previously extractedperipheral bl and DukeUniversity Sciences. Health ForestHealthSciences Wake boardsof byThe study review approved theinstitutional was publication previousavailable inthe (7) subjects are 11) inthefamilywasalsoenrolled.Details ofclinical evaluationsofthe agesOnecarrier (IV- included. The oftheaffectedmalesfrom 13-65years. female ranged tothe (VI-2)in andisnow affected bornsubsequent original male report this family was SMRXS were reevaluated (7);affected is deceased(Figure1).Aseventh maleIII-2 now This article is protected by co protected is article This the mutations in Subjects: reported with in oftheseventhatwehad affectedmales Six theoriginal family RBMX gene are selected against in the healthy human population.gene areselectedagainstThe in the healthy human pyright. reserved rights All ood DNA samples and/or new DNA from the newDNAfromthe and/or DNA samples ood Methods in essential splice sites, and small in essentialsmall splice sites,and on twoaffected subjects (IV-4andIV-5), ) ononeaffected (IV-3)tocommunicate male rol cohorts consisted of subjects from Duke subjects fromDuke rol consistedof cohorts Accepted Article further. variants variant other missense in healthycontrolmales resultedin not being this pursued variants.functional Additionally, thenatureof mutation(missense) andthepresence of missense in variant controls wasasubjects. male in theNHLBImale and IV-5,absentThefirst internal and inall Threehemizygousvariantsregions respectively. coverage 91.8%and96.1%of forIV-4and57-foldIV-5,with5X targeted for was 44-fold sequencing of WES: Exome high quality;average datawas the Xcoverage ofchromosome reevaluated. noted thecharacteristic facial features andobesity. Duetoaggressiveness be hecould not during childhoodand early epilepsy. The PIhadexamined and him intellectual disability years-old, VI-2vismoderate 13 to agerelatedMale has his due complications. 80s, affected males live athomewiththeirguardians. inThe seventh affectedmale (III-2),died IV-6 werediagnosedwith bilateral sensorineural the hearinglossin early50s.All their lower earsand obesityprominent lip,large (Figure2)(7).Affected IV-4,IV-5and males IV-3, coarse faces, prominent supraorbital rid Subjects: thedistinctive sixrangefrom28 males to65years.Allhave The now affected startUTRs gene’ssite 250bpupstream transcription ofthe andthe isprotein coding regionRVIS score basedonvariants ncRVISscoreonthe5’ andthe and3’ This article is protected by co protected is article This percentile withthencRVIS scoreonthe37 UTP14A EVSbenign IntheNHLBI databasevariants byPolyPhen-2. 14othertypesmissense in of Xq26.1NP_006640.2), isin the interval as (chrX: alsopredicted 129,040,096-129,063,737), innot pursuedfurther.Theseconda missensemutation was as benignPolyPhen-2(11).The by were seen in males. The X-chromosome RVISscore seenmales. TheX-chromosome forUTP14Aisonthe80.3 were in ARSF located in theXp22.33 locatedin region predicted (p.V170I,NP_004033.2), pyright. reserved rights All ARSF ges, narrow palpebral ges, narrow fissures,bulbous nose, gene is outside theintervalis outside gene linkage and was thus Results Results th percentile,making itagenetolerant to on the X chromosome were shared byIV-4were shared ontheXchromosome UTP14A (p.R647C, (p.R647C, Accepted Article the ncRVIS scorethe ncRVIS for assesscoding thetolerancetoloss mutations inthe regions offunction of Thes any gene. within mutations of frameshift mutations in being 0.8, therewasinsufficient resolution ofnonsense toassessintolerance preferential was nonsense) andwiththeBroad institute Z-scoreforloss mutations offunctionin mutations: 16observednonsensevariants controls, across(none theESP6500 therewere tolerant of functional mutations. We then examined thepreferentialtolerant offunctionalintolerancemutations. of We then wide andon the74.33percentilethe forX-chromosome thatit genes be suggesting may damaging mutations in the 1300Dukeor6503NHLBIESPsubjects.We lookedcontrols forotherindels and and generatesastopafteranothercodon sevenanyamino acids.Itwasnotobserved in of 336positionchanges glutamicacid the deletessevenacids, followingamino toglycine, the variant was a23-bpdeletionThe third causing inexon 9a frameshift of This article is protected by co protected is article This RVIS and ncRVIS scores: The RVIS score TheRVIS for scores: RVIS andncRVIS (8)didnotshow23 bpdeletion orothervariants. etalreport the from theCastro IV-10).However, (IV-7, sequencing Sanger in twonormalmales onthetwoaffectedmales IV-4,males (IV-3, IV-5, IV-6, andwasabsent V-3,V-4andVI-2),onecarrier female(IV-11) database. Sangersequencing the demonstrated frameshiftinseven deletion all affected of isoform intolerant loss offunctionmutations. to 18.42 percentile indirectindeedX chromosome be providing it may forthe evidence that observed (chrX:135954483_135954485_DEL_ATA, located inexon 10,in only the3 RBMX. RBMX There was no experimental confirmation for isoform 3 based onUniProt isoform3based confirmation for was There noexperimental . Additionally,ofmethods assess islack there to preferential a depletion RBMX RBMX pyright. reserved rights All places it aroundthe places 15 in both control cohorts, and only one in-frame deletion was in controlandonly onein-frame deletion both cohorts, e factorslimited ouranalyses toaccurately RBMX th percentile the (genome-wide) andon was on the73 was on rd percentile genome- RBMX RBMX (Figure 3).It (Figure . However, . However, RBMX RBMX RBMX rd

to Accepted Article fish showed expressionfishshowed inthelater stages ofbraindevelopment; inknockouts of other general processes. forthehuman An orthologue developmental has a high RVIS score (80.2 percentile), at2.7 has ahighRVIS score ncRVISscore butan the 70.3 The absenceofdeleteriousvariants in causing mutations in lo themechanismofdiseaseis possibility that This article is protected by co protected is article This With an18 The widespread expression being predominantly loss offunction. follow apattern and ofhighRVISscores lowncRVIS with causingscores, disease mutations 0.4 retardatio genes anOMIMmental from “X-linked rank thetolerancevariants: In86syndromicXLID ofgenestofunctional RVISandncRVIS. rolecausal of To furtherrefinethepossible FragileX syndromehave beenreportedtoaccount for3-5%ofXLID conditions (2). gene,other alsosuitable candidate since a intervallinked inregion. theXq26 nature ofthis gene(12),thetypeof thelocation of mutationand evidence for validatedXLID be EVSFurther againstsuchas theNHLBI (5).supporting largedatabases thewere incorrect; authors thatalldeemed tocauseXLID recommended putative genes for XLID is highlightedreport thatfound by a thatat least the100 10%of genes thathadbeen ofcontrolsThe importance thatarerepresentat in areno mutations this gene protein disrupting ncRVIS scoreof17 th percentile ( rd percentile. Interestingly, th percentile ncRVIS score, percentile score, ncRVIS RBMX HUWE1 as a candidate gene for SRMXS is provided by the highlyis provided asbythe candidate forSRMXSconserved a gene th percentileover and 80% offunction. ofreportedmutationscause loss OPHN1 ) to95.7 ) pyright. reserved rights All of RBMX are loss of function mutations (14). Similarly, offunction are loss th percentile (ZNF81),with RBMX OPHN1 may be indicative ofits effects onthebrainaswell maybeindicative RBMX RBMX ’s function as makeit anRNAbinding proteinwould ’s function Discussion Discussion , causing XLID with cerebellar hypoplasia (13), causing cerebellarhypoplasia (13), , XLIDwith RBMX RNA binding proteins such as the FMRP in such astheFMRP RNA bindingproteins may be part of a subset of XLID genes that may bepartofasubsetXLID genes of in overin 7800control exomes suggests that ss of function.ss allthereporteddisease Indeed, t compatible with normal cognitive function.t compatiblewithnormal ive ofthe‘general instudies of population’ n’ key match, the RVIS scores ranged from match, theRVISscores ranged n’ key , we pursued twocutting-edgetools, wepursued that FMR1 RBMX (Fragile X on syndrome) th percentile, raising the RBMX within thepreviously FMR1 gene in zebra genein RBMX has alow in in Accepted Article suggest this that is areasonable candidategene for this XLIDsyndrome. unique and thefindings ofabnormal neurodevelopment inanimal diseasethe biological causing thisits genes, conservedstatus function (12) of gene, highly a beingconsistentncRVIS scores withpatternseen forRBMX ofX-linked inasubset mutationsdeleterious in other frameshiftvalidated yet. deletion Despite and theseweaknesses, theabsence ofthe andhasnot beenwidely new causal. ncRVIS scoringsystemis relatively is mutation The demonstratingdecreased thiswoul expression, pursuealso not did studies. functional However,sincemutation theframeshift cause would gene/intronthat thecausal maythatwasin another byWES. mutation be notdetected We We acknowledge thatthebe segregatingwith RBMXmutation could thelinkageinterval and these two brothersanddid notfindthe 23bpdeletionvariantsin orother We sequencinghaving yearsagoby Castro etal(8). on performedSanger several SMRSX The prevalence unclear. brotherswithXLIDwerereported ofSMRSXremains as Two further research. unstable proteincausing theabnormalneurodevelopment truncated bethetopic could of such altered as cellular localization ofthis support thepossibility that were unsuccessfullook in for DNA fromthesecohorts to obtaining SMRXSand thegenesmoderate phenotypicoverlapwith (7)butwe remain unmapped, havelikely Cl to anotherformofal is XLID. the thethe facialwere notevident family twobrothers.Thus, in gestalt reported by Castroet Additionally, in the salient ofSMRSX, features significantly sharedlarger,the intervalfromXq21.1-Xq27. by twoaffectedbrotherswas the a in neurogenesis,(15). Abnormalities neural andneural plate crestdevelopment wereseenin of berescued wildtypeby could forebrain injection smaller the zebra fishembryos This article is protected by co protected is article This RBMX knockdown modeloftheAfrican claw RBMX RBMX pyright. reserved rights All in a large numberofcontrol ina pattern ofRVISand the exomes, isin involved neurodevelopment. Possible mechanisms RNA binding protein,oratoxic RNAbinding effect duethe ark-Baraitser and Atkins type XLID andAtkins (17,18)haveark-Baraitser type cluding thefacialcephalometricand findings ed frog (16). Thus, these animal studiesed frog(16).Thus,theseanimal d not provide any further evidence that the not provideany furtherevidence that d RBMX knockout models all RBMX variants. RBMX. However, However, RBMX RBMX Accepted Article This article is protected by co protected is article This Baraitser M,Reardon W, Vijeratnam S.Nonspecific X-linked mental retardation with fa a further andobesity: macrocephaly 18. Atkin JF,Flaitzretardational.new X-linkedmentalet A K,Genet PatilMedsyndrome. Am J S 1985: 21: 697-705. 17. 1755-1766. 237: Dyn2008:development. Dev RNA- identifies in Xenopus cloning Expression RM. Harland RB, Fletcher DS, Dichmann embryogenesi of asregulators proteins binding 16. brain for is essential gene RBMX FS al. et Grutzner LA, O'Sullivan E, Tsend-Ayush in 682-688. development Dev zebrafish. Dyn 2005: 234: 15. 14. https://www.ncbi.nlm.nih.gov/clinvar/. Billuart P, Bienvenu T,Ronce Nal.et Oligophrenin 1encodes a rho-GAP proteininvolved in 678. 46: 1998: (Paris) Biol Pathol retardation. mental X-linked Clinvar. 13. processed of conservation and Expression S al. et Thomas ML, PA,Delbridge Lingenfelter copies of theRBMX gene.Mamm Genome 2001: 12:538-545. 12. damaging predicting for server and Amethod al. et L Peshkin S, Schmidt IA, Adzhubei 248-249. 7: 2010: Methods Nat mutations. missense 11. 6:80-92. (Austin) 2012: Fly iso-3. iso-2; w1118; Cingolani P, Platts A, Wangle Let al. A program forannotating and predicting the effects of single nucleotidepolymorphisms, SnpEff:in SNPs the genome of Drosophila melanogasterstrain 10. long-r accurate and Fast R. Durbin LiH, 589-595. 2010: 26: Bioinformatics 9. family. second ofa report syndrome: XLMR al. Shashi R et RC, Nelson Santos dos NH, Castro 49-51. 118A: 2003: Med GenetA Am J 8. Shashi V,Berry MN, Shoafal. Set Auniqueform of mental retardation with a distinctive maps toXq26-q27. Am phenotype 7. Allen, E.L., Heinzen, Q., Wang, S, Petrovski e1003709. 9, 2013: Genet PLoS . Personal Genomes. of the and Interpretation Variation Functional 6. in Challenged Genes Associated and Mutations XLID-Causing JL. C,Mandel A,Redin Piton Exome Large-Scale Human of DataFrom Light 5. sys A al. E et Pleasance R, Smith PS, Tarpey reta mental in exons coding chromosome 4. disability. intellectual X-linked of neurobiology The al. et L J,Gerosa S, Zapata Bassani 541-552. 19: 2013: Neuroscientist 3. Fragil CE. RE, Schwartz Stevenson HA, Lubs 579-590. 90: 2012: Genet J Hum discovery. Am decades of 2. Gecz M. J, Shoubridge C,Corbett The genetic 308-316. 25: Genet2009: Trends X. chromosome 1. pyright. reserved rights All J Hum Genet 2000: 66: 469-479. 469-479. 66: JHum2000: Genet mily. Am J Med Genet 1995: 57: 380-384. 380-384. 57: 1995: Genet AmJMed mily. rdation. Nat Genet 2009: 41: 535-543. 41: 535-543. 2009: Genet Nat rdation. Bibliography Bibliography Sequencing. Am J Hum Genet 2013: 93: 368-383. 368-383. 93: Genet2013: Am Hum J Sequencing. ead alignment with Burr alignment ead s and Rbmxas necessary for neural and muscle tematic, large-scaletematic, screenresequencing ofX- e X and X-linked intellectual disability: four four disability: intellectual X-linked and e X A.S., and Goldstein, D.B. . Genic Intolerance to to Intolerance . Genic D.B. Goldstein, and A.S., landscape of intellectual disability arising from from arising disability intellectual of landscape ows-Wheeler transform. Accepted Article in his80stoagerelatedcomplications. due andaffectedhas diedpublication anotheraffected identified male,III-2 hasbeen male (VI-2) pedigreeoflarge familywithSMRSX.Figure 1:Updated the time initial reported Since ofthe This article is protected by co protected is article This pyright. reserved rights All

Accepted Article This article is protected by co protected is article This pyright. reserved rights All

Figure 3: Illustration of the Sanger sequencing results of the frameshift deletionin frameshift results ofthe ofthe Illustration Sanger sequencing Accepted by co protected is article This Article IV-11(C),butnotin (D). IV-4(A),IV-5(B)andthecarrierfemale unaffected IV-10 in thetwomales male affected (chrX:135956417_135956439_DEL_CATAGAAGGGGGAAGCCCTCTTT pyright. reserved rights All RBMX ) in selected family members with SMRXS. The23bpdeletion) in familymembers is SMRXS. with seen selected

10 Unaffected Male IV- 11 IV- Female Carrier Affected IV-4 Male Affected IV-5 Male