DOCSLIB.ORG

Implication of Globin Gene Expression, Hemoglobin F and Hemoglobin E Levels on Β-Thalassemia/Hb E Disease Severity

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Implication of Globin Gene Expression, Hemoglobin F and Hemoglobin E Levels on Β-Thalassemia/Hb E Disease Severity Available online at www.aNNclinlabsci.org Annals of Clinical & Laboratory Science, vol. 44, no. 4, 2014 437 Implication of Globin Gene Expression, Hemoglobin F and Hemoglobin E Levels on β-Thalassemia/Hb E Disease Severity Suwimol Siriworadechkul1, Sumalee Jindadamrongwech1, SuporN Chuncharunee2, and Saranya Aupparakkitanon1 1Department of Pathology and 2Department of Medicine, Faculty of Medicine Ramathibodi Hospital, Mahidol University, Bangkok, Thailand Abstract. One of the factors affecting the degree of severity in β-thalassemia disease is the presence of un- matched α-hemoglobin chains. Thus, the expression levels of globin genes in reticulocytes of β-thalassemia subjects were measured using quantitative RT-PCR, demonstrating that α/β globin mRNA ratio, as well as levels of γ-globin mRNA and Hb F, increased with progressing degree of β globin synthesis defect. The levels of γ-globin mRNA and Hb F could not be directly correlated with severity of β-thalassemia/Hb E disease due to a low statistical power of this analysis. Higher levels of Hb E were present, however, in clini- cally mild patients, as compared to moderately severe β-thalassemia/Hb E subjects. This suggests that in β-thalassemia/Hb E disease, elevation of Hb E level through enhancing correctly spliced βE-globin mRNA offers another approach in ameliorating disease severity. In addition, co-inheritance of α-thalassemia 2 trait in β-thalassemia/Hb E subjects was associated with milder outcome compared with those with the same β-thalassemia genotypes, confirming the notion of the beneficial effect of a more balanced α:β-globin chain ratio. Key words: Globin gene expression, Hemoglobin E, Hemoglobin F, β-thalassemia, modifying factor. Introduction Pathogenesis of thalassemia is mainly due to an im- balance of α-and β- globin chain synthesis. With β-Thalassemia is an important autosomal recessive β-thalassemia, the presence of unpaired inherited disease in regions where malaria is or has α-hemoglobin chains results in their precipitation been endemic, causing anemia of variable degrees onto red blood cell membranes, causing oxidative of severity [1,2,3]. Most defects are due to point damage leading to ineffective erythropoiesis and re- mutations or small deletions leading to reduction duced lifespan of circulating effete red cells [11-13]. in or absence of β-globin chain synthesis [4,5]. Heterogeneity in disease severity of β-thal/Hb E Heterozygotes have only a few numbers of micro- disease has been attributed to the types of β- thalas- cytic hypochromic red blood cells but no clinical semia mutations, co-inheritance α-thalassemia, symptoms. The homozygous state causes and persistence of Hb F production [14-17]. In the β-thalassemia major, and compound heterozygosi- expected severe β0-thal/Hb E genotypes, milder ty of β-thalassemia and Hb E (β26 Glu>Lys)(β-thal/ forms have been reported to be associated with Hb E) can result in mild to severe anemia. The lat- more elevated levels of Hb E [15]. However, a sig- ter of which is often comparable to that of nificant negative correlation of age of onset with β-thalassemia major [6-8]. This type of Hb E was determined, but no correlation with Hb β-thalassemia is a major health problem in regions F was found [14]. Although a wide range in α/non where both genotypes are prevalent, such as certain α-globin mRNA ratios was found in β-thal/Hb E regions of Southeast Asia, including Thailand patients, there is no difference between mild and [9,10]. severe phenotypes, but interestingly, elevated cor- rectly spliced βE mRNA was detected in one-third Address correspondence to Assist. Prof. Dr. Sumalee Jindadamrongwech, Department of Pathology, Faculty of Medicine, of mild patients, suggesting that proper splicing of Ramathibodi Hospital, Bangkok 10400, Thailand; phone: +662 E 2011076; fax: +662 2011445; e mail: [email protected] β mRNA may contribute to disease outcome [18]. 0091-7370/14/0400-437. © 2014 by the Association of Clinical Scientists, Inc. 438 Annals of Clinical & Laboratory Science, vol. 44, no. 4, 2014 Table 1. Primers and probes used in qRT-PCR. Gene Primera Sequence (5’-3’)b α-globin HBA1:F GGAGGCCCTGGAGAGGAT HBA1:R CGTGGCTCAGGTCGAAGTG HBA1:P FAM-TGTCCTTCCCCACCACCAAGACCT-BBQ β-globin HBB:F CTGACACAACTGTGTTCACTAGC HBB:R GGTAGACCACCAGCAGCCT HBB:P YAK-CCCACAGGGCAGTAACGGCAGACT-BBQ βE-globin HBE:R AGCCTGCCCAGGGCCTT γ-globin HBG:F GACTTCCTTGGGAGATGCCAC HBG:R ATTTCCCAGGAGCTTGAAGTTCT HBG:P LC610-AGCTTGTCACAGTGCAGTTCACTCAGC-BBQ GAPD GAPD:F GAAGGTGAAGGTCGGAGTC GAPD:R GAAGATGGTGATGGGATTTC GAPD:P LC670-CAAGCTTCCCGTTCTCAGCCT-BBQ aF: forward primer, R: reverse primer, P: probe. bBBQ: Black Berry quencher, FAM: 6-carboxy-fluorescein, YAK: Yakima yellow, LC610: Light Cycler-Red 610, LC670: Light Cycler-Red 670. GAPD, glyceraldehydes-3-phosphate dehydrogenase. The involvements of β-thalassemia genotypes, Human Rights Related to Research Involving Human α-thalassemia co-inheritance, imbalance of globin Subjects of Ramathibodi Hospital, and written informed chains synthesis, and Hb F and Hb E levels in consents were obtained from subjects prior to collecting β-thalassemia trait (β-thal trait) and β-thal/Hb E specimens. disease were explored in this study. The α/β ratio, γ α- and β- thalassemia genotyping. DNA was extracted (both Aγ and Gγ), and correctly spliced βE globin from blood leukocytes. β-thalassemia mutations were mRNA levels were determined by quantitative re- identified using multiplex ARMS-PCR as previously de- verse-transcriptase PCR (qRT-PCR). scribed [19]. α-Thalassemias (– – SEA,––THAI,––FIL, –α3.7,–α4.2 deletions and non deletions Hb Constant Materials and Methods Spring and Hb Pakse) were detected using multiplex Gap-PCR and multiplex ARMS-PCR as described pre- Subjects and measurement of hematological parame- viously [20-22]. ters. EDTA-whole blood samples were obtained from the Department of Medicine and Department of Globin mRNA quantitation. Total RNA was extracted Pathology, Faculty of Medicine Ramathibodi Hospital, from reticulocyte fraction separated from blood samples Mahidol University, Bangkok, Thailand. A total of 48 using TRIzol® Reagent (Invitrogen, California, U.S.A.) thalassemia subjects, comprising 28 β-thal/Hb E disease [23]. Contaminating DNA was removed by treatment and 20 β-thal trait, and 10 normal controls were en- with RNase-free DNase (Promega, Madison, WI, USA). rolled. Blood samples were investigated for hematologi- Quantity and purity of RNA were measured spectropho- cal parameters and hemoglobin typing using Sysmex XS- tometrically (WPA Biowave DNA-Isogen Life Science 1000i blood cell counter (Kobe, Japan) and capillary instrument). Expression of α-, β-, βE-, and γ-globin electrophoresis (Sebia, Lisses, France) respectively. mRNAs were measured using a one-step qRT–PCR Hemoglobin typings obtained in addition to hemato- method with TaqMan™ probe system [24,25]. Each re- logical parameters were compatible with their diagnostic action of 20 µl contained 40 ng of total RNA, 0.30-0.38 phenotypes: namely, normal (A2A), β-thalassemia trait µM each primer, 0.1-0.125 µM each probe, and (A2A with Hb A2>3.5%), and β-thalassemia disease (EF, LightCycler® 480 RNA Master Hydrolysis Probes EFA, A2F, or A2FA). The percentage of Hb F or HbE (Roche, Berlin, Germany). The primers and probes used from the Hb typing result was calculated with total he- are shown in Table 1. qRT-PCR was performed in a moglobin to yield the absolute amount in g/dl. The LightCycler® 480 Real-Time PCR System (Roche, study protocol was approved by the Committee on Berlin, Germany) using the following thermocycling Role of Globin Gene Expression, Hb F and E on β-Thalassemia Severity 439 Table 2. Hb typing and β-thalassemia mutations of 48 β-thalassemia subjects. Subject (n) Hb typing β-thalassemia mutation β0-thal/Hb E (19)* EF cd41/42 (-TTCT) (n=4), cd17 (A>T ) (n=13), IVSI-1 (G>T ) (n=2) β+(severe)-thal/Hb E (6) EF(A) IVSII-654 (C>T ) β+-thal/Hb E (3) EFA nt-28 (A>G) β-thalassemia trait (20) A2A cd41/42 (-TTCT) (n=8), cd17 (A>T ) (n=2), IVSI-1 (G>T ) (n=1), (high A2) cd27/28 (+C) (n=1), IVSII-654 (C>T ) (n=4), IVSI-5 (G>C) (n=1), nt-28 (A>G) (n=3) *Four cases (3 with cd17 and 1 IVSI-1) co-inherited α-thalassemia 2 trait (3.7-kb deletion). cd, codon. conditions: 3 min at 63°C for reverse transcription, and genotypes of β-thal/Hb E subjects. A remarkably 40 cycles of 15 s at 95°C, 1 min at 60°C, 1 s at 72°C. All higher γ-globin mRNA expression was observed in samples were determined in triplicate, and mRNA levels β+(severe)- (median 119.2, range 39.5-144.9) com- -∆∆CT were quantitated by 2 method relative to glyceral- pared to β+-thalassemia (median 8.9, range 7.0- dehyde-3-phosphate dehydrogenase (GAPD) mRNA 27.1) (p=0.025). However, in β0-thal/Hb E sub- [26,27]. jects the lower median γ-globin mRNA level Statistical analysis. Kruskal-Wallis and Mann-Whitney (median=68.6, with a wide range=3.2-404.6) may U tests were used to evaluate the differences among account for the overall lack of significant differ- groups. Correlations among variables were analyzed by ences among the β-thal/Hb E genotypes. These val- Spearman's correlation analysis, with a p-value <0.05 ues correlated with Hb F amounts (median 4.9, considered statistically significant. range 2.7-5.7 g/dl and median 1.2, range 1.0-1.5 g/dl) for β+(severe)- and β+-thalassemia respectively Results (p<0.01) (Figure 1C). β-Thalassemia genotypes identified by PCR-based Expression of βE mRNAs (relative to GAPD methods were as follows: β0-thal/Hb E (19 sub- mRNA) showed no significant differences among jects), β+(severe)-thal/Hb E (6), β+-thal/Hb E (3), β0-, β+(severe)- and β+-thal/Hb E groups (Figure andβ-thalassemiatrait(20)(Table2).
Load more

Recommended publications
  • Impact of Heterozygous Hemoglobin E on Six Commercial Methods for Hemoglobin A1c Measurement
    Impact of heterozygous hemoglobin E on six commercial methods for hemoglobin A1c measurement Sharon Yong1, Hong Liu1, Cindy Lye Teng Lum2, Qian Liu2, Sin Ye Sim3, Felicia Fu Mun Chay3, Wan Ling Cheng4, Siew Fong Neo4, Suru Chew4, Lizhen Ong4, Tze Ping Loh4, Qinde Liu1, Tang Lin Teo1 and Sunil Kumar Sethi4 1 Chemical Metrology Division, Health Sciences Authority, Singapore, Singapore 2 Department of Pathology, Sengkang General Hospital, Singapore, Singapore 3 Department of Laboratory Medicine, Alexandra Hospital, Singapore, Singapore 4 Department of Laboratory Medicine, National University Hospital, Singapore, Singapore ABSTRACT Background: This study examined the impact of heterozygous HbE on HbA1c measurements by six commonly used commercial methods. The results were compared with those from a modified isotope-dilution mass spectrometry (IDMS) reference laboratory method on a liquid chromatograph coupled with tandem mass spectrometer (LC-MS/MS). Methods: Twenty-three leftover samples of patients with heterozygous HbE (HbA1c range: 5.4–11.6%), and nineteen samples with normal hemoglobin (HbA1c range: 5.0–13.7%) were included. The selected commercial methods included the Tina-quant HbA1c Gen. 3 (Roche Diagnostics, Basel, Switzerland), Cobas B 101 (Roche Diagnostics, Basel, Switzerland), D100 (Bio-Rad Laboratories, Hercules, CA, USA), Variant II Turbo HbA1c 2.0 (Bio-Rad Laboratories, Hercules, CA, USA), DCA Vantage (Siemens Healthcare, Erlangen, Germany) and HbA1c Advanced (Beckman Coulter Inc., Brea, CA, USA). Results: With the exception of Cobas B 101 and the Variant II Turbo 2.0, the 95% confidence intervals of the Passing–Bablok regression lines between the results Submitted 25 September 2020 from the six commercial methods and the IDMS method overlapped.
    [Show full text]
  • Physiology & Biophysics
    DEPARTMENTAL RESOURCES The Department of Physiology & Biophysics plays a unique role in biological research. It is in effect a conduit through which the powerful techniques and tools of the physical sciences are brought to bear on significant problems of biological importance. The range of problems being addressed in the Department runs the gamut from understanding functionally important atomic scale motions of proteins to characterizing complex behavior on the cellular through organelle level. The tools being used to pursue these cutting edge problems include state of the art instrumentation for magnetic resonance, laser and synchrotron radiation spectroscopies as well as extensive computer modeling. The strength of the Department stems not only from the significant problems that are being aggressively addressed by the departmental faculty, but also from the resources and the collaborative spirit with the department. The Department houses several world class spectroscopy facilities: Biomolecular Laser Research Center (BLRC) The BLRC is composed of three interrelated laser oriented facilities. The laser spectroscopy facility (LSF) contains an extensive array of state-of-the-art laser spectroscopic tools devoted to studying structure, function and dynamics in isolated biomolecules. The laser imaging and microscopy facility (L1MF) focuses on interfacing laser spectroscopy with microscopy to study complex systems at the molecular level. The third facility, devoted to laser based diagnostic tools for clinical applications, is still in the development stage. Pulsed EPR Facility The EPR facility consists of a number of state-of-the-art spectrometers that have been constructed at Einstein. Both theoretical work and experiments are being carried out to define the structure of metal binding sites in metalloproteins and to determine the orientation and distance of substrates to metal centers at active sites of metalloenzymes.
    [Show full text]
  • Your Baby Has Hemoglobin E Or Hemoglobin O Trait for Parents
    NEW HAMPSHIRE NEWBORN SCREENING PROGRAM Your Baby Has Hemoglobin E or Hemoglobin O Trait For Parents All infants born in New Hampshire are screened for a panel of conditions at birth. A small amount of blood was collected from your baby’s heel and sent to the laboratory for testing. One of the tests looked at the hemoglobin in your baby’s blood. Your baby’s test found that your baby has either hemoglobin E trait or hemoglobin O trait. The newborn screen- ing test cannot tell the difference between hemoglobin E and hemoglobin O so we do not know which one your baby has. Both hemoglobin E trait and hemoglobin O trait are common and do not cause health problems. Hemoglobin E trait and hemoglobin O trait will never develop to disease. What is hemoglobin? Hemoglobin is the part of the blood that carries oxygen to all parts of the body. There are different types of hemoglobin. The type of hemoglobin we have is determined from genes that we inherit from our parents. Genes are the instructions for how our body develops and functions. We have two copies of each gene; one copy is inherited from our mother in the egg and one copy is inherited from our father in the sperm. What are hemoglobin E trait and hemoglobin O trait? The normal, and most common, type of hemoglobin is called hemoglobin A. Hemoglobin E trait is when a baby inherited one gene for hemoglobin A from one parent and one gene for hemoglobin E from the other parent.
    [Show full text]
  • Methemoglobinemia and Ascorbate Deficiency in Hemoglobin E Β Thalassemia: Metabolic and Clinical Implications
    From www.bloodjournal.org by guest on April 2, 2015. For personal use only. Plenary paper Methemoglobinemia and ascorbate deficiency in hemoglobin E ␤ thalassemia: metabolic and clinical implications Angela Allen,1,2 Christopher Fisher,1 Anuja Premawardhena,3 Dayananda Bandara,4 Ashok Perera,4 Stephen Allen,2 Timothy St Pierre,5 Nancy Olivieri,6 and David Weatherall1 1MRC Molecular Haematology Unit, Weatherall Institute of Molecular Medicine, University of Oxford, John Radcliffe Hospital, Oxford, United Kingdom; 2College of Medicine, Swansea University, Swansea, United Kingdom; 3University of Kelaniya, Colombo, Sri Lanka; 4National Thalassaemia Centre, District Hospital, Kurunegala, Sri Lanka; 5School of Physics, University of Western Australia, Crawley, Australia; and 6Hemoglobinopathy Research, University Health Network, Toronto, ON During investigations of the phenotypic man hypoxia induction factor pathway is There was, in addition, a highly signifi- diversity of hemoglobin (Hb) E ␤ thalasse- not totally dependent on ascorbate lev- cant correlation between methemoglobin mia, a patient was encountered with per- els. A follow-up study of 45 patients with levels, splenectomy, and factors that sistently high levels of methemoglobin HbE ␤ thalassemia showed that methemo- modify the degree of globin-chain imbal- associated with a left-shift in the oxygen globin levels were significantly increased ance. Because methemoglobin levels are dissociation curve, profound ascorbate and that there was also a significant re- modified by several mechanisms and may deficiency, and clinical features of scurvy; duction in plasma ascorbate levels. Hap- play a role in both adaptation to anemia these abnormalities were corrected by toglobin levels were significantly re- and vascular damage, there is a strong treatment with vitamin C.
    [Show full text]
  • Pathological Conditions Involving Extracellular Hemoglobin
    Pathological Conditions Involving Extracellular Hemoglobin: Molecular Mechanisms, Clinical Significance, and Novel Therapeutic Opportunities for alpha(1)-Microglobulin Gram, Magnus; Allhorn, Maria; Bülow, Leif; Hansson, Stefan; Ley, David; Olsson, Martin L; Schmidtchen, Artur; Åkerström, Bo Published in: Antioxidants & Redox Signaling DOI: 10.1089/ars.2011.4282 2012 Link to publication Citation for published version (APA): Gram, M., Allhorn, M., Bülow, L., Hansson, S., Ley, D., Olsson, M. L., Schmidtchen, A., & Åkerström, B. (2012). Pathological Conditions Involving Extracellular Hemoglobin: Molecular Mechanisms, Clinical Significance, and Novel Therapeutic Opportunities for alpha(1)-Microglobulin. Antioxidants & Redox Signaling, 17(5), 813-846. https://doi.org/10.1089/ars.2011.4282 Total number of authors: 8 General rights Unless other specific re-use rights are stated the following general rights apply: Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. • Users may download and print one copy of any publication from the public portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain • You may freely distribute the URL identifying the publication in the public portal Read more about Creative commons licenses: https://creativecommons.org/licenses/ Take down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim.
    [Show full text]
  • 2004400 October 2004, Change Report and NCD Coding Policy
    Medicare National Coverage Determinations (NCD) Coding Policy Manual and Change Report April 2012 Clinical Diagnostic Laboratory Services Health & Human Services Department Centers for Medicare & Medicaid Services 7500 Security Boulevard Baltimore, MD 21244 CMS Email Point of Contact: [email protected] TDD 410.786.0727 Fu Associates, Ltd. Medicare National Coverage Determinations (NCD) Coding Policy Manual and Change Report This is CMS Logo. NCD Manual Changes Date Reason Release Change Edit The following section represents NCD Manual updates for April 2012. *04/01/12 *ICD-9-cm code range *2012200 *376.21-376.22 *(190.15) Blood Counts and descriptors Endocrine exophthalmos revised 376.21-376.9 Disorders of the orbit, *376.40-376.47 except 376.3 Other Deformity of orbit exophthalmic conditions (underlining *376.50-376.52 in original) Enophthalmos *376.6 Retained (old) foreign body following penetrating wound of orbit *376.81-376.82 Orbital cysts; myopathy of extraocular muscles *376.89 Other orbital disorders *376.9 Unspecified disorder of orbit The following section represents NCD Manual updates for January 2012. 01/01/12 Per CR 7621 add ICD-9- 2012100 786.50 Chest pain, (190.17) Prothrombin Time CM codes 786.50 and unspecified (PT) 786.51 to the list of ICD- 9-CM codes that are 786.51 Precordial pain covered by Medicare for the Prothrombin Time (PT) (190.17) NCD. Transmittal # 2344 01/01/12 Per CR 7621 delete ICD- 2012100 425.11 Hypertrophic (190.25) Alpha-fetoprotein 9-CM codes 425.11 and obstructive cardiomyopathy 425.18 from the list of ICD-9-CM codes that are 425.18 Other hypertrophic covered by Medicare for cardiomyopathy the Alpha-fetoprotein (190.25) NCD.
    [Show full text]
  • Observations on the Minor Basic Hemoglobin Component in the Blood of Normal Individuals and Patients with Thalassemia
    Observations on the Minor Basic Hemoglobin Component in the Blood of Normal Individuals and Patients with Thalassemia H. G. Kunkel, … , U. Müller-Eberhard, J. Wolf J Clin Invest. 1957;36(11):1615-1625. https://doi.org/10.1172/JCI103561. Research Article Find the latest version: https://jci.me/103561/pdf OBSERVATIONS ON THE MINOR BASIC HEMOGLOBIN COMPONENT IN THE BLOOD OF NORMAL INDIVIDUALS AND PATIENTS WITH THALASSEMIA BY H. G. KUNKEL, R. CEPPELLINI, U. MULLER-EBERHARD, AND J. WOLF (From the Rockefeller Institute for Medical Research, and Institute for the Study of Human Variation, and the Departmet of Pediatrics, Colunma Uniewsity, N. Y.) (Submitted for publication March 6, 1957; accepted April 11, 1957) In a previous report (1) a second hemoglobin was collected from a number of New York hospitals. was described which was found at a concentration The specimens from patients with thalassemia were ob- of tained from Italian and Greek individuals in the hema- approximately 3 per cent in the blood of normal tology clinic at the Babies Hospital, Columbia-Presby- adult individuals. It was found to resemble he- terian Medical Center, New York. Five individuals with moglobin E in electrophoretic properties, but iden- thalassemia in two families were obtained from index tity with this abnormal hemoglobin was not estab- cases at Bellevue Hospital. The great majority of lished. This same component probably had been thalassemia trait cases were parents of children with observed severe Cooley's anemia. In all instances the diagnosis of by previous investigators employing the thalassemia was based on the hematological picture. classical Tiselius procedure in occasional speci- Several individuals who were suspected of having thalas- mens of blood from normal persons (2, 3) and semia were excluded from the study because of un- thalassemia patients (4), but had not been defined certain hematological findings.
    [Show full text]
  • Chapter 03- Diseases of the Blood and Certain Disorders Involving The
    Chapter 3 Diseases of the blood and blood-forming organs and certain disorders involving the immune mechanism (D50- D89) Excludes2: autoimmune disease (systemic) NOS (M35.9) certain conditions originating in the perinatal period (P00-P96) complications of pregnancy, childbirth and the puerperium (O00-O9A) congenital malformations, deformations and chromosomal abnormalities (Q00-Q99) endocrine, nutritional and metabolic diseases (E00-E88) human immunodeficiency virus [HIV] disease (B20) injury, poisoning and certain other consequences of external causes (S00-T88) neoplasms (C00-D49) symptoms, signs and abnormal clinical and laboratory findings, not elsewhere classified (R00-R94) This chapter contains the following blocks: D50-D53 Nutritional anemias D55-D59 Hemolytic anemias D60-D64 Aplastic and other anemias and other bone marrow failure syndromes D65-D69 Coagulation defects, purpura and other hemorrhagic conditions D70-D77 Other disorders of blood and blood-forming organs D78 Intraoperative and postprocedural complications of the spleen D80-D89 Certain disorders involving the immune mechanism Nutritional anemias (D50-D53) D50 Iron deficiency anemia Includes: asiderotic anemia hypochromic anemia D50.0 Iron deficiency anemia secondary to blood loss (chronic) Posthemorrhagic anemia (chronic) Excludes1: acute posthemorrhagic anemia (D62) congenital anemia from fetal blood loss (P61.3) D50.1 Sideropenic dysphagia Kelly-Paterson syndrome Plummer-Vinson syndrome D50.8 Other iron deficiency anemias Iron deficiency anemia due to inadequate dietary
    [Show full text]
  • Sickle Cell Disease
    Sickle cell disease Description Sickle cell disease is a group of disorders that affects hemoglobin, the molecule in red blood cells that delivers oxygen to cells throughout the body. People with this disease have atypical hemoglobin molecules called hemoglobin S, which can distort red blood cells into a sickle, or crescent, shape. Signs and symptoms of sickle cell disease usually begin in early childhood. Characteristic features of this disorder include a low number of red blood cells (anemia), repeated infections, and periodic episodes of pain. The severity of symptoms varies from person to person. Some people have mild symptoms, while others are frequently hospitalized for more serious complications. The signs and symptoms of sickle cell disease are caused by the sickling of red blood cells. When red blood cells sickle, they break down prematurely, which can lead to anemia. Anemia can cause shortness of breath, fatigue, and delayed growth and development in children. The rapid breakdown of red blood cells may also cause yellowing of the eyes and skin, which are signs of jaundice. Painful episodes can occur when sickled red blood cells, which are stiff and inflexible, get stuck in small blood vessels. These episodes deprive tissues and organs, such as the lungs, kidneys, spleen, and brain, of oxygen-rich blood and can lead to organ damage. A particularly serious complication of sickle cell disease is high blood pressure in the blood vessels that supply the lungs (pulmonary hypertension), which can lead to heart failure. Pulmonary hypertension occurs in about 10 percent of adults with sickle cell disease. Frequency Sickle cell disease affects millions of people worldwide.
    [Show full text]
  • Journal of Medical - Clinical Research & Reviews
    Research Article ISSN 2639-944X Journal of Medical - Clinical Research & Reviews Renal Function Changes Between Anemic and Clinical Silent Hemoglobin E Disorder, Diabetic Patients in Surin Hospital, Thailand Sueyanyongsiri P*, Tangbundit P, Sueyanyongsiri S, Bunmee S and Khansri P *Correspondence: Dr. Sueyanyongsiri P, Surin Hospital, Affiliated Institutes of Surin hospital, Affiliated Institutes of Suranaree University of Suranaree University of Technology, Thailand. Technology, Thailand. Received: 03 March 2019; Accepted: 26 March 2019 Citation: Sueyanyongsiri P, Tangbundit P, Sueyanyongsiri S, et al. Renal Function Changes Between Anemic and Clinical Silent Hemoglobin E Disorder, Diabetic Patients in Surin Hospital, Thailand. J Med - Clin Res & Rev. 2019; 3(2): 1-5. ABSTRACT Background: Diabetes is now the common cause of end-stage renal disease (ESRD). This research aims to study the rate of decline in estimated glomerular filtration rate (eGFR) in hemoglobin E disorder diabetic patients in Surin hospital. Methods: This case control cohort study was conducted from 2009 to 2018. Patient’s general clinical information, fasting plasma glucose (FPG), HbA1c levels, hematocrit (Hct) and eGFR were collected and divided into two groups, anemic hemoglobin E homozygote group (anemic group) and clinical silent hemoglobin E homozygote group (control group).Subjects were confirmed diabetics who already had been treated either with insulin, oral hypoglycemic drugs or a physician-prescribed diet. Target of diabetic control follow standard treatment, not try to intensive control. The endpoint was rate of decline of eGFR per year. The hypothesis was that the cumulative average duration of disease was equally, the renal complication between two groups was not different. Results: From 2009 to 2018, 195 diabetic patients with hemoglobin E homozygote, 72 anemic hemoglobin E homozygote group (anemic group) and 123 clinical silent hemoglobin E homozygote group (control group).
    [Show full text]
  • Fact Sheet: Hemoglobin E Trait
    hemoglobin E trait. trait. E hemoglobin region. It is possible for a person of any nationality to have have to nationality any of person a for possible is It region. came from Africa, India, the Middle East, or the Mediterranean Mediterranean the or East, Middle the India, Africa, from came Hematology came from Asia. It can also be found in people whose ancestors ancestors whose people in found be also can It Asia. from came Hemoglobin E trait is very common in people whose ancestors ancestors whose people in common very is trait E Hemoglobin Who can have hemoglobin E trait? E hemoglobin have can Who hemoglobin. People with hemoglobin E trait usually do not have enough enough have not do usually trait E hemoglobin with People Trait E in their red blood cells. Hemoglobin E is not normal. normal. not is E Hemoglobin cells. blood red their in E People with hemoglobin E trait have hemoglobin A and hemoglobin hemoglobin and A hemoglobin have trait E hemoglobin with People Hemoglobin E E Hemoglobin A. hemoglobin type, (1) one only have the lungs to all parts of your body. People with normal hemoglobin hemoglobin normal with People body. your of parts all to lungs the Your red blood cells contain hemoglobin, which carries oxygen from from oxygen carries which hemoglobin, contain cells blood red Your FACT SHEET SHEET FACT Hemoglobin E trait is a condition that affects the red blood cells. blood red the affects that condition a is trait E Hemoglobin What is hemoglobin E trait? E hemoglobin is What BMC–05/19 (BK76000) BMC–05/19 What if one (1) parent has hemoglobin E trait and the other parent has beta thalassemia trait? If one (1) parent has hemoglobin E trait Hemoglobin E Beta Thalassemia and the other parent has beta Trait Trait thalassemia trait, there is a 25 percent (1 (AE) (Aβ) in 4) chance with each pregnancy of having a child with hemoglobin E/beta thalassemia disease.
    [Show full text]
  • Neonatal Anemia: Recognizing Thalassemia and Hemoglobin Variants
    Neonatal Anemia: Recognizing Thalassemia and Hemoglobin Variants James H. Nichols, PhD, DABCC, FACB Professor of Pathology, Microbiology, and Immunology Medical Director, Clinical Chemistry Associate Medical Director of Clinical Operations Vanderbilt University School of Medicine Nashville, TN 37232‐5310 [email protected] Objectives • Describe hemoglobin genetics • Interpret hemoglobin chromatograms and IEF • Recognize common hemoglobin variants Case • 4 mo male, African American, abnormal newborn screen, seen for follow‐up testing • Newborn screen shows hemoglobin FS at birth HbF = 33.8% HbA = <1% HbA2 = 2.7% HbS = 62.5% SickleDex = Positive C S F A NB Audience Poll • What do these results indicate? A. Normal profile B. Abnormal amounts of hemoglobin F C. Sickle cell disease D. Sickle cell trait Hemoglobin Tetramer Chromosomal Organization of Globin Genes Normal Hemoglobins in Adults Hemoglobin Concentration Structure Hb A ~90% 2 2 Hb F ~1.0% 2 2 Hb A2 ~2.5% 2 2 Hb A1 ~7.0% Mixture of post- translational variants of Hb A Globin Chain Expression Reasons for Requesting Hemoglobin Variant Analysis • Follow‐up to abnormal newborn screen • Adoption • Prenatal screening –patients of ethnic origin • Anemia of unknown origin in ethnic patient • Athletic exam for competitive sports Hemoglobinopathies 1. Structural – substitution, addition or deletion of one or more AAs in the globin chain i.e HbS, HbC, HbE, HbD, HbO, etc… 2. Thalassemia‐ quantitative defect in globin chain production i.e. alpha and Beta Thalassemia 3. Combination
    [Show full text]