View of Insect Taxonomy, Behavior, and Physiology

MOLECULAR AND BIOCHEMICAL GENETIC STUDIES ON SOME LEAFHOPPER TRANSMITTED PLANT PATHOGENS

DISSERTATION

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University

Sawsan Youssef Youness Mohamed Elateek

Graduate Program in Plant Pathology

The Ohio State University

2010

Dissertation Committee:

Dr. Sally A. Miller, “Advisor”

Dr. Margaret G. Redinbaugh

Dr. Anne E. Dorrance

Dr. Pierce A. Paul

Dr. Andrew P. Michel

Sawsan Youssef Youness Mohamed Elateek

2010

Abstract

Aster yellows is a disease that sporadically damages leafy green vegetables, especially lettuce. The disease is caused by a phytoplasma and vectored by phloem- feeding aster leafhoppers. Aster yellows induces various symptoms in lettuce including yellowing and witches‟-broom of the leaves, and phyllody and virescence of the flowers, which can lead to severe economic losses. Previously, four aster yellows phytoplasma strains were identified and characterized based on their symptoms in lettuce fields in

Ohio. In our study, a thorough assessment of the role that these different strains play in aster yellows epidemics in Ohio was made over time during two growing seasons (2008 and 2009). In addition, new aster yellows isolates that may contribute to the aster yellows phytoplasma strain complex were identified based on their 16SrRNA sequences.

The role of herbaceous plants such as cilantro and parsley, which are commonly produced in lettuce production areas, was studied as well. Surveys of aster leafhoppers and host plants (lettuce, cilantro and parsley) were conducted to assess the distribution of these known strains (AY-WB, AY-S, AY-DB2 and AY-BW) of aster yellows phytoplasma in two major vegetable production areas (Celeryville and Hartville) in northern Ohio. Strains in two 16SrRNA group I subgroups (16SrI-A and 16SrI-B) were detected in both locations and years. Strain AY-WB belonged to subgroup 16SrI-A while strains AY-S, AY-BD2 and AY-BW belonged to 16SrI-B. Multiplex PCR assays for aster yellows phytoplasma were developed and used to screen leafhopper and plant

ii samples to detect known phytoplasma strains. In both locations during both years, populations of aster leafhoppers collected were higher in romaine lettuce during the month of August. There was a noticeable increase in the proportion of infected/inoculative aster leafhoppers collected early in the season compared to that observed 3-8 years previously. Aster yellows infection of surveyed leafhoppers and plants was the highest early in the growing season, declining late in the season, in both years.

All lettuce types (romaine, red leaf and green leaf), cilantro and parsley plants were infected with both 16SrI-A and 16SrI-B strains. Aster yellows phytoplasma strains were distributed evenly across hosts (red, green and romaine lettuce, cilantro and parsley) and there was no association between aster yellows phytoplasma strain and plant host. Strain

AY-S (16SrI-B) appeared to be relatively rare (2.2-3.2%) in leafhoppers and plants in both years at both locations; however, there were no significant differences in strain distribution in either location. Other strains in subgroup 16SrI-B (AY-BD2 and AY-BW) were numerically more abundant in leafhoppers and plants in this study.

Phylogenetic analysis of 16S rRNA gene sequences of sixteen aster yellows isolates that were detected amongst host plants and aster leafhoppers associated with these plants indicated that these isolates belonged to aster yellows subgroup 16SrI-A and subgroup

16SrI-B.

iii

In the last five years, cilantro and parsley production increased dramatically in intensive lettuce production areas in Ohio. While these plants remained symptomless in the field, the proportions of aster yellows-infected plants were no different than the proportions of aster yellows-infected lettuce plants. Therefore, it is very likely that parsley and cilantro play an important role in aster yellows epidemiology, providing a natural reservoir of aster yellows phytoplasmas.

Dedication

To my mom

and

My children Yassmine and Seif

Acknowledgments

I would like to thank my advisor Dr. Sally A. Miller for giving me the opportunity to pursue my doctoral studies under her advisement. Also I would like to extend my thanks to my committee members for helping me through my lab work and data analysis; especially Dr. Andrew Michel for his help with setting up field experiments, Dr. Pierce

Paul for his guidance with statistical analyses, and Dr. Redinbaugh for her help with the phylogenetic analysis. My committee members along with Dr. Miller taught me many valuable lessons through my research including organization, coherent thinking, writing skills and most of all patience.

Special thanks to Mrs. Melanie L. Lewis Ivey for her help with my research project and Mr. Bruce Roger for his guidance in writing. Also I would like to express thanks to

Mr. Bob James, Mr. Bill Bardall, Mr. Richard Callendar, and Mr. Cecile Keene for their help in greenhouse and field work.

In addition, I would like to thank my extended family from Egypt, Dr. Ammar and

Tawehida for their advice and moral support, also Kristie and Hady Yassine, and Eman and Tarek Jaboor for their friendship and support. Furthermore, I would like to show my appreciation to my friends in the USA who made me feel that I am part of their family

vi and supported me through the whole process of my studies, Steve and Joy Yoder, Bill and Allison Seymour, Ryan and Katie Immel and Stacie Steigg. Also, my friends in

Orrville, Bev, Dawn and Rebekah, thank you for supporting me through my research. As well, I extend my thanks to my friends in Wooster Katelyn, Alissa, Dan, Xiulan, Maria,

Soledad, Rosa, Fulya, Maggie, David, Valdir, Kristin, Laura, Laurel and Loren.

Last but not least, I would like to thank the Egyptian government and my university,

Ain Shams University, for funding my Ph.D. research at The Ohio State University. My experience in the Plant Pathology Department of OSU was unforgettable and I appreciate the support received from former chair Dr. Mike Boehm and its faculty members.

vii

Vita

December 1974 ...... Born-Cairo, Egypt

1996 ...... B.S. Genetics, Ain Shams University

2002 ...... M.A. Genetics, Ain Shams University

2002-2006 ...... Assistant Lecturer, Department of Genetics,

Ain Shams University

2006-present ...... Graduate research Associate, The Ohio State

University

Publications

Elateek, S., Lewis Ivey, M. L. and Miler, S. A. 2008. Identification of phytoplasmas affecting greenhouse tomatoes in North America. Phytopathology.98:S50. Elateek, S., Lewis Ivey, M. L. and Miler, S. A. 2009. Characterization of aster yellows phytoplasma strains in leafy green vegetable crops in Ohio. Phytopathology.99:S31. Elateek, S., Lewis Ivey, M. L., Michel, A. P., Paul, P. A. and Miler, S. A. 2010. Influence of time, host plant and location on diversity of aster yellows phytoplasma strains. Phytopathology 100:S33.

Fields of Study

Major Field: Plant Pathology

viii

Table of Contents

Abstract ...... ii Dedication ...... v Acknowledgments ...... vi Vita ...... viii List of Tables……………………………………………………………………………...x List of Figures……………………………………………………………………………xii

CHAPTER 1 ...... 1 Background on Phytoplasmas Diseases, Distribution, Detection and Classification Aster Yellows Phytoplasmas Disease of Lettuce in Ohio ...... 1 Introduction ...... 1

CHAPTER 2 ...... 16 Development of a Multiplex PCR Assay for the Detection and Identification of Aster Yellows Phytoplasma Strains ...... 16 Introduction ...... 16 Materials and Methods ...... 19 Results ...... 24 Discussion...... 27

CHAPTER 3 ...... 44 Diversity of Aster Yellows Phytoplasma Strains in Intensive Lettuce Production Areas in Ohio ...... 44 Introduction ...... 44 Materials and Methods ...... 49 Results ...... 57 Discussion...... 64

Bibliography ...... 88 ix

List of Tables

Table 1. Aster yellows phytoplasma strains collected from lettuce in Ohio and maintained in China aster plants...... 30

Table 3. Specificity of aster yellows strain-specific primer sets (Zhang et al. 2004); expected amplicons sizes and primer combinations used in multiplex PCR for detection and differentiation of aster yellows strains...... 32

Table 5. Primers, primer sequences and number and size of amplicons produced in two multiplex PCR assays to differentiate strains of aster yellows phytoplasma...... 34

Table 6. Universal primer sets used to identify phytoplasma in aster leafhoppers, lettuce, cilantro and parsley...... 73

Table 7. Sampling date and GPS coordinates of fields in OH from which leafhopper and plant samples were collected in 2008 and 2009...... 74

Table 8. Aster yellows phytoplasma detected in leafhoppers collected from lettuce, cilantro, and parsley fields (2008-2009) and in lettuce, cilantro and parsley plants (2009) in Celeryville, Ohio, by nested and multiplex PCR assays using universal and strain- specific primer sets...... 77

Table 9. Aster yellows phytoplasma detected in leafhoppers collected from lettuce, cilantro, and parsley fields (2008-2009) and in lettuce, cilantro and parsley plants (2009) in Hartville, Ohio, by nested and multiplex PCR assays using universal and strain- specific primer sets...... 78

Table 10. P-value of the effect of host and sampling time over the growing seasons on the distribution of aster yellows phytoplasma strains in infected aster leafhoppers and infected lettuce, cilantro and parsley plants...... 81 Table 11. Mean estimates of the effect of sampling time over the growing seasons on the percentage of aster yellows phytoplasma-infected leafhoppers collected in Ohio lettuce, x cilantro and parsley fields and on the percentage of phytoplasmas belonging to 16SrI subgroup A and B, and identified as strain AY-BD2 (also 16SrI-B)...... 82

Table 12. Mean estimates of the effect of sampling time over the growing season on the percentage of phytoplasma-infected lettuce, cilantro and parsley crops collected in Ohio lettuce, cilantro and parsley fields and on the percentage of aster yellows phytoplasma strains belonging to phytoplasma 16SrI-B subgroup...... 82

Table 13. Percentages of the aster yellows phytoplasma isolates detected in leafhoppers and lettuce, cilantro and parsley crops in Ohio...... 83

Table 14. Number of unidentified phytoplasma isolates collected from leafhoppers and plants samples in Celeryville and Hartville over the growing season in 2008 and 2009. . 84

Table 15. Classification of the unidentified phytoplasma isolates present in lettuce, cilantro and parsley plants and aster leafhoppers collected from Celeryville and Hartville, Ohio...... 85

Table 16. Phytoplasma reference strains used in the phylogenetic analysis based on their 16SrRNA sequence retrieved from the GenBank database...... 86

List of Figures

Figure 1. China aster plant showing vein clearing and yellowing symptoms caused by aster yellows phytoplasma strain AY-WB...... 35

Figure 2. China aster plant showing witches'-broom symptom caused by aster yellows phytoplasma strain AY-WB...... 35

Figure 3. China aster plant showing chlorotic (A) turning to dark green leaves (B) caused by aster yellows phytoplasma strain AY-S...... 36

Figure 4. China aster plant showing the flower phyllody symptom caused by aster yellows phytoplasma strain AY-S...... 36

Figure 5. Infected China aster plant showing vein clearing (A) and chlorosis (B) symptoms caused by aster yellows phytoplasma strain AY-BD2...... 37

Figure 6. China aster showing vein clearing and yellowing symptoms caused by aster yellows phytoplasma strain AY-BD3...... 38

Figure 7. Gradient polymerase chain reaction (PCR) amplification of aster yellows phytoplasma strain AY-WB using primer pairs: (A) BF/BR; and (B) S1/S2...... 39

Figure 8. Gradient polymerase chain reaction (PCR) amplification of aster yellows phytoplasma strain AY-BD2 using primer pairs: (A) 15F/15R; and (B) 21F/21R...... 40

Figure 9. Polymerase chain reaction (PCR) amplification of aster yellows phytoplasma strains (AY-WB, AY-S, AY-BD2 and AY-BD3) with (A): BF/BR primer pair; (B): S1/S2 primer pair; and (C): multiplex PCR using primer pairs BF/BR and S1/S2 (CPA1)...... 41 Figure 10. Multiplex PCR amplification of aster yellows phytoplasma strains using primer pairs: (A): BF/BR, S1/S2 (CPA1); and (B): BF/BR, 15F/15R (CPA2) ...... 42

Figure 11. Flow chart of development of two multiplex PCR assays, A: CPA1 (differentiates AY-S and AY-WB); and B: CPA2 (differentiates AY-BD2/BD3 and AY- WB)...... 43

xii

Figure 13. Numbers of leafhoppers collected from lettuce, cilantro and parsley fields in Celeryville and Hartville, Ohio during summer 2008 and 2009...... 76

Figure 14. Healthy (left) and aster yellows-infected (right) romaine lettuce in Hartville, Ohio...... 79

Figure 15. Healthy (left, right) and aster yellows-infected (center) green leaf lettuce, Celeryville, Ohio...... 80

Figure 16. Phylogenetic tree of aster yellows unidentified isolates constructed by neighbor-joining analysis of partial length of 16SrRNA sequences collected from vegetable crops: lettuce (vars. red, green and romaine), cilantro and parsley; aster leafhoppers collected from lettuce, cilantro and parsley plants from Celeryville and Hartville in 2008 and 2009; and reference strains: AY-S (16SrI-B), SAY (16SrI-B), AY- BW (16SrI-B), AY-BD2 (16SrI-B), ParsD1 (16SrI-B), 99UW111 (16SrI-A), ca2006/1 (16SrI-A), AY-WB (16SrI-A), ParsD3 (16SrI-A); employing tomato stolbur phytoplasma as the outgroup...... 87

xiii

CHAPTER 1

Background on Phytoplasmas Diseases, Distribution, Detection and Classification

Aster Yellows Phytoplasmas Disease of Lettuce in Ohio

Introduction

Phytoplasmas cause more than 400 plant diseases worldwide, causing significant losses globally (McCoy et al. 1989; Lee et al. 2000 and Bertaccini 2007). Many of these diseases, affecting cultivated and wild plants, are economically important, including aster yellows in vegetable crops like lettuce, carrot, onion and celery (Errampalli and Fletcher

1991; Lee et al. 1993b; Zhang et al. 2004; Oshima et al. 2004; Beanland et al. 2005;

Chung et al. 2007 and Duduk et al. 2006; 2008). Other diseases associated with phytoplasmas include tomato big bud (Shaw et al. 1993 and Streten and Gibb 2003), tomato and pepper little leaf (Santos-Cervantes et al. 2008), potato witches‟-broom (Doi et al. 1967 and Khadhair et al. 2003), sweet potato little leaf (Streten and Gibb 2003 and

Saqib et al. 2006), rice yellow dwarf (Nakashima et al. 1993), maize bushy stunt

(Harrison 1996 and Bedendo et al. 2000) and maize redness (Duduk et al. 2006 and Jovic et al. 2009). Phytoplasmas also contribute to major fruit crop diseases including coconut lethal yellowing (Harrison and Richardson 1994 and Mpunami et al. 1999), peach X- disease (Lee et al. 1992; Ahrens et al. 1993 and Zhu et al. 1996); strawberry yellows 1

(Valiunas et al. 2006), pear decline (Davies et al. 1992), grapevine yellows (Daire et al.

1993; Chen et al. 1994 and Bertaccini and Stefani 1995), and apple proliferation (Lee et al. 1995 and Seemüller and Schneider 2007). Ornamental plants such as gladiola, hydrangea, China aster, and purple coneflower are also affected (Stanosz et al. 1997;

Sawayanagi et al. 1999; Zhang et al. 2004 and Lee et al. 2008). Herbaceous plants such as parsley (Khadhair et al. 1998) and cilantro (Zhou et al. 2003 and Lebsky and

Poghosyan 2007) can also be hosts of phytoplasma diseases. Furthermore, phytoplasma diseases like elm and ash yellows have destroyed historical and new plantations of forest trees (Sinclair et al. 1996; Griffith et al. 1999 and Lee et al. 2004b).

Phytoplasma diseases were originally thought to be caused by viruses because they shared similar symptoms, are insect-transmitted, and could not be cultured (Kunkel 1926,

1957). Kunkel (1926) was the first to describe a phytoplasma disease as aster yellows, which caused a yellowing of the China aster leaves. In 1967, a group of Japanese scientists discovered that the plant pathogen that caused yellowing symptoms in plants was similar to the animal pathogen „mycoplasmas‟: both were pleiomophic, 80×800 nm in size, and sensitive to the antibiotic tetracycline. Subsequently, the term mycoplasmalike organism (MLO) was coined to describe these plant pathogens (Doi et al. 1967). In

1980, Woese and others suggested that MLOs originated from a single lineage diverged from species of Acholeplasma, namely Bacillus /Clostridium ancestors (Gundersen et al.

1996). Moreover, Lim and Sears (1989) compared the 16SrRNA gene sequence from an

MLO (Oenothera virescence phytoplasma) from the aster yellows group with those of

2 mycoplasmas, which indicated that MLOs are members of the class Mollicutes and are evolutionarily distinct from animal mycoplasmas. Phylogenetic analyses based on conserved genes followed the lateral comparison to confirm that MLOs represent a clearly distinct, monophyletic clade within the class Mollicutes (Lim and Sears 1991 and

1992; Kuske and Kirkpatrick 1992; Namba et al. 1993; Seemüller et al. 1994; Toth et al.

1994; Gundersen et al. 1994 and Jomantiene et al. 1998). In 1994, the 10th Congress of the International Organization of Mycoplasmology announced that the name

„phytoplasmas‟ would replace „MLOs‟. Subsequently, with the development of new techniques for identification and characterization of phytoplasmas such as polymerase chain reaction (PCR), restriction fragment length polymorphism (RFLP) and phylogenetic analyses, the International Research Program on Comparative

Mycoplasmology (IRPCM) suggested in 2004 that phytoplasmas be placed within the genus „Candidatus‟ (IRPCM 2004). Thus far, 27 Ca. phytoplasma species have been described and for any strain to be described as a novel „Ca. Phytoplasma‟ species, its

16SrRNA gene sequence has to have < 97.5% similarity to any previously described „Ca.

Phytoplasma‟ species (Zreik et al. 1995; Davis et al. 1997; Griffiths et al. 1999;

Sawayanagi et al. 1999; Montano et al. 2001; Jung et al. 2002, 2003; Verdin et al. 2003;

Lee et al. 2004a, b; Marcone et al. 2004; Hiruki and Wang 2004; IRPCM 2004;

Seemüller and Schneider 2004; Schneider et al. 2005; Firrao et al. 2005; Valiunas et al.

2006; Arocha et al. 2007; Al-Saady et al. 2008; Hogenhout et al. 2008 and Zhao et al.

2009).

Phytoplasmas indeed have unique characteristics amongst microorganisms, including repeat-rich genomes, which promote rapid adaptation of these plant pathogens to new environments (Bai et al. 2006). Furthermore, phytoplasmas have many copies of transporter genes that encode proteins to facilitate importation of different types of sugars from plant and insect hosts, such as maltose from plant sieve tubes and trehalose from insect haemolymph. Phytoplasmas lack some cell metabolism and division genes, which explain the dependence of phytoplasmas on their hosts (plants and insect vectors) for survival (Oshima et al. 2004; 2007; Bai et al. 2006 and Kube et al. 2008).

In the plant host, phytoplasmas reside mainly in the phloem sieve tubes and spread from the leaves to the roots by moving through the pores of the sieve plates that divide the phloem sieve tubes (Doi et al. 1967; Whitcomb and Tully 1989 and Olivier et al.

2007). Once phytoplasmas have infected a plant it can take from 1 week up to 24 months, depending on the phytoplasma and plant species, for symptoms to develop. For example, aster yellows symptoms take 3 weeks to develop on lettuce (Lee et al. 2000).

Although phytoplasmas can be spread by vegetative propagation such as grafting, rhizomes, or bulbs (Lee et al. 1992) they are not transmitted through seeds. There has been no evidence that the phloem sieve tubes that harbor phytoplasmas have a direct connection to the seed.

Insect vectors are the means of phytoplasma dispersal in nature (Bosco et al. 1997;

Sforza et al. 1998; Carraro et al. 1998; Marzachì et al. 1998; Maixner and Reinert 1999;

Gatineau et al. 2001; Blomquist and Kirkpatrick 2002; Palermo et al. 2004 and

Bertaccini 2007). Insect vectors are phloem-feeders, mainly from the Order Hemiptera, including leafhoppers (Cicadellidae) (Maramorosch and Harris 1979; Grylls 1979;

McClure 1982 and Kawakita et al. 2000), psyllids (Psyllidae), (Weintraub and Beanland

2006) and planthoppers (Fulgoromorpha, Delphacidae and Derbidae) (Khan and Saxena

1984). Insect vectors acquire phytoplasmas through their stylets during feeding in the phloem of infected plants (Lherminier et al. 1990 and Nakashima and Hayashi 1995).

This feeding period, which allows the insect vector to acquire sufficient titer of phytoplasmas, is called acquisition access period (AAP). The AAP can range from a few minutes to a few hours (Purcell 1987). Phytoplasmas then pass through the foregut and penetrate the midgut, passing through the epithelial cells to the haemolymph where they replicate (Purcell 1987; Nault 1997; Lett et al. 2001 and Ammar and Hogenhout 2006).

In order for the insect vector to transmit phytoplasmas, they must pass through the three salivary gland barriers (the basal lamina, the basal plasmalemma, and the apical plasmalemma), where they accumulate in high titers and are injected as the insect feeds on new plants. This period between initial acquisition of phytoplasmas and the ability of the insect vector to transmit the phytoplasma is called the latent period (LP). The latent period ranges from 7 to 80 days, which can increase with low temperature (Nagaich et al.

1974; Murral et al. 1996 and Moya-Raygoza and Nault 1998). Once the insect vector becomes infectious, it is able to transmit phytoplasmas for life. However, if the phytoplasmas fail to penetrate any of the three insect salivary gland barriers, the insect vector becomes a dead-end host and is unable to transmit the phytoplasmas to new host

5 plants (Vega et al. 1993, 1994; Lefol et al. 1993; Wayadande et al. 1997 and Fletcher et al. 1998). Some plant hosts such as cilantro and parsley may become infected with phytoplasmas by feeding insects without showing any symptoms, but still serve as reservoirs for the phytoplasmas (Khadhair et al. 1998 and Lee et al. 2003).

Generally, phytoplasmas do not affect their insect vector negatively, in fact, the insect vector can benefit from its association with phytoplasmas by showing improved overwintering ability and increased fecundity and longevity (Beanland et al. 2000 and

Hogenhout et al. 2008). Aster yellows phytoplasma-infected aster leafhoppers lay nearly double the amount of eggs on host plants than non-infected leafhoppers do (Beanland et al. 2000). In 2009, Bai et al. demonstrated that phytoplasmas produce effector proteins that target the plant nuclei, changing plant gene expression to increase the attractiveness of the young shoots and leaves to leafhoppers, and making it more accessible for insect vector feeding and oviposition compared to healthy plants (Peterson 1973 and Schultz

1973).

Insects that vector phytoplasmas can be monophagous, oligophagous or polyphagous

(Backus et al. 2005). For example, North American aster yellows phytoplasma strains are transmitted by the polyphagous aster leafhopper to at least 250 plant species

(Swenson 1971; McCoy et al. 1989 and Weintraub and Beanland 2006). On the other hand, the American elm yellows phytoplasma is transmitted by the monophagous vector

Scaphoideus luteolus, and causes disease in only a few plant species in the genus Ulmus

(Lee et al. 1992, 1994).

Phytoplasmas have been difficult to detect due to their low and often variable titre in hosts, their variable distribution in the sieve tubes of infected plants (Doi et al. 1967;

Martinez et al. 2000 and Firrao et al. 2007), and the inability to culture them. Prior to the development of molecular techniques, the characterization of phytoplasmas relied on biological properties such as symptoms, host range, and the relationship between the phytoplasma and its leafhopper vector (Davis et al. 1990; Chen et al. 1992; Daire et al.

1992; Davis and Lee 1993 and Davies et al. 1995). Transmission (Jones et al. 1974;

Parthasarathy 1974; Schneider 1977; Braun and Sinclair 1979; Bertaccini and Marani

1982; Cousin et al. 1986; Singh 1991; Ahrens and Seemüller 1994 and Tanaka et al.

2000) and scanning (Haggis and Sinha 1978; Marcone and Ragozzino 1996 and

Poghosyan et al. 2004) electron microscopy are the principal diagnostic techniques that allow in situ observation of phytoplasmas in plants and leafhoppers. A method to stain the DNA with the fluorescent dye 4', 6-diamidino-2-phenylindole (DAPI) was developed for light microscopy (Schaper and Converse 1985 and Hiruki and Rocha 1986) and used with success for the diagnosis of phytoplasmas even in woody hosts such as coconut palm (Schuiling and Forstel 1992), ash (Sinclair et al. 1989 and 1992) and pear

(Malinowski et al. 1996). However microscopic methods are time-consuming, not widely accessible and limited in capacity for phytoplasma identification beyond the genus (Candidatus Phytoplasma) level.

Polyclonal and monoclonal antibodies were amongst the earliest tools of biotechnology used for detection of phytoplasmas affecting host plants (Davis et al.

1988; Clark et al. 1989; Chen et al. 1992a, b; Lee and Davis 1992; Chang et al. 1995;

Srinivasulu and Narayanasamy 1995; Lin and Chen 1996; Seddas et al. 1996; Gomez et al. 1996; Guo et al. 1998; Thomas and Balasundaran 2001; Loi et al. 2002; Bertaccini

2007 and Firrao et al. 2007). Polyclonal antibodies against phytoplasmas belonging to different taxonomic groups were developed for use in immunosorbent electron microscopy (IEM) (Sinha et al. 1983), fluorescence microscopy (Lin and Chen 1986;

Clark et al. 1989 and Chen et al. 1993), western blots (Clark et al. 1989 and Seemüller and Schneider 2004) and ELISA (Hobbs et al. 1987; Davies and Clark 1992; Sarindu and

Clark 1993 and Canik and Ertunc 2007). However, some of the polyclonal antibodies have a high level of cross-reactivity with other phytoplasmas, and therefore are not useful for differentiation between phytoplasma groups (Sinha et al. 1983; Clark et al. 1989 and

Schneider et al. 1997). The development of monoclonal antibodies against some phytoplasmas such as aster yellows (Lin and Chen 1985; 1996), apple proliferation (Loi et al. 2002), maize bushy stunt (Chen and Jiang 1988) and grapevine yellows (Chen et al.

1993) permitted some differentiation between different groups of phytoplasmas.

Monoclonal antibodies have been used successfully to detect different phytoplasmas in potential vectors by immunofluorescence (Boudon-Padieu et al. 1986; Boudon-Padieu et al. 1989; Lherminier et al. 1989; Scheltinga et al. 1989 and Liefting and Kirkpatrick

2003), immunosorbent electron microscopy (Sinha and Chiykowski 1986; Lherminier et

8 al. 1990 and Vera and Milne 1994), dot blot (Boudon-Padieu et al. 1989) and ELISA

(Boudon-Padieu et al. 1989; Fos et al. 1992 and Lherminier et al. 1994).

More recently, another approach for phytoplasma detection and classification based on nucleic acid-based techniques was developed, which mainly depends on high quality phytoplasma DNA. Different protocols for phytoplasma DNA isolation have been reported for use in detection of phytoplasmas in their hosts in the laboratory and in the field (Ahrens and Seemüller 1992; Gibb and Padovan 1994; Levy et al. 1994; Daire et al.

1997; Zhang et al. 1998; Green et al. 1999; Prince et al. 1999; Guo et al. 2003; Goto et al. 2009; and Tomlinsona et al. 2010). The development of nucleic acid-based techniques has facilitated routine detection and identification of phytoplasmas and indication of their distribution in plants and leafhopper vectors (Kirkpatrick et al. 1987;

Lee et al. 1993; Webb et al. 1999; Christensen et al. 2004 Wei et al. 2004; Bertolini et al.

2007; Hren et al. 2007 and Martini et al. 2007). Of all the nucleic acid-based techniques,

PCR is used most extensively for this purpose since it is rapid, specific and highly sensitive for the detection of phytoplasmas both from symptomatic and asymptomatic plants and from insect vectors. Universal primers prime the amplification of common sequences and can be used to detect phytoplasmas 7 days before symptoms appear in the plants (Lee et al. 1991; 1992; 1994; Deng and Hiruki 1991; Firrao et al. 1993 and Smart et al. 1996). Specific primers that distinguish between phytoplasma groups (Griffiths et al. 1994 and Weintraub and Beanland 2006) have been developed from different positions on the ribosomal RNA operon, such as the 16SrRNA gene and the variable

16S-23S intergenic region (Deng and Hiruki 1991; Davis and Lee 1993; Namba et al.

1993; Rhode et al. 1993; Schneider et al. 1993; Ahrens et al. 1994; Kirkpatrick et al.

1994; Lorenz et al. 1995; Maixner et al. 1995; Gundersen et al. 1996; Malisano et al.

1996; Smart et al. 1996; Schneider et al. 1997; White et al. 1998; Zhang et al. 1998;

Griffiths et al. 1999; Guo et al. 2000; Montano et al. 2001; Wang et al. 2003; Lee et al.

2005; 2006; Wei et al. 2007 and Firrao et al. 2007). Phytoplasmas may be detected by direct PCR assays but in some cases can be present in low titers, so nested PCR assays are commonly used. In nested PCR, two sets of primers are used in two consecutive runs of PCR; the second set of the primers amplify DNA within the first PCR product, which increases the assay detection sensitivity. Furthermore, for the complete identification of detected phytoplasmas to the strain level it may be necessary to perform multiplex PCR and/or RFLP analysis or sequencing of 16SrRNA amplicons (Lee et al. 1992; Daire et al.

1997 and Zhang et al. 2004). In a multiplex PCR assay, multiple phytoplasma strain- specific primer sets are used within a single PCR mixture to produce amplicons of varying sizes, which results in „fingerprints‟ unique to specific phytoplasma strains.

Assays utilizing strain-specific primer sets in a multiplex mixture can distinguish between different phytoplasma strains within specific phytoplasma groups precisely with less time and less cost than multiple independent assays (Oliveira et al. 2007 and Gomes et al. 2004).

In addition to the PCR assays, RFLP analysis has been used to identify and classify different groups and subgroups of phytoplasmas from different plant and leafhopper

10 sources based on the size of the DNA fragments produced after using restriction enzymes

(Lee et al. 1993; Schneider et al. 1993; Langer et al. 2003 and Zhang et al. 2004 and

Bertaccini 2007). In 1993, Lee et al. proposed a classification scheme that included ten major phytoplasma groups and 15 subgroups based on their RFLP profiles. This scheme was later expanded to 28 groups and 57 subgroups, and new groups are continually being added (Lee et al. 1993 and 1994; Gundersen et al. 1994; Seemüller et al. 1998; Lee et al.

1998 and 2000; Marcone et al. 2000; Lee et al. 2004a, b; Al-Saady et al. 2008).

DNA sequencing is considered the most appropriate nucleic-acid based technique for phytoplasma classification because it provides the most information and helps define the evolutionary relationships between different groups and subgroups. Also, this technique may be used to compare between different phytoplasma strains within the same subgroup/group based on the sequence of specific genes such as the16SrRNA gene

(Bertaccini 2007). Based on these distinctive sequences in the 16SrRNA gene, several phytoplasma-specific PCR assays have been developed and more than 350 different, nearly full length sequences of phytoplasma 16SrRNA genes have been obtained to date

(Ahrens and Seemüller 1992; Firrao et al. 1993; Lee et al. 1993; Namba et al. 1993; Gibb et al. 1995; Lorenz et al. 1995; Padovan et al. 1995; Smart et al. 1996; Seemüller et al.,

1998b; Lee et al., 2000; IRPCM 2004 and Zhao et al. 2009).

One of the first phytoplasma groups to be classified was the aster yellows group (Group

I), which is the main focus in this study. In Ohio, aster yellows significantly damages leafy

11 green vegetables, especially lettuce, although the incidence of the disease varies from year to year (Murral et al. 1996). The disease is caused by „Ca. Phytoplasma asteris‟ which induces various symptoms in lettuce including yellowing of the leaves, witches‟-broom

(excessive proliferation of shoots), phyllody (the development of leafy structures instead of floral parts), and virescence (the development of chloroplasts in flower parts) (Lee and

Davis 1992; Lee et al. 2000; Firrao et al. 2007 and Hogenhout et al. 2008). Aster yellows disease is transmitted by the aster leafhopper (Macrosteles quadrilineatus) (Kunkel 1957), which feeds and reproduces on over 400 plant species. Preferred hosts include small grain crops (wheat, oats, barley, and rye), vegetable crops (lettuce, carrot, onion, tomato, and pepper), and various herbs (parsley, cilantro, and dill) (Kunkel 1957; Lee et al. 2003, 2004a and Hollingsworth et al. 2008). The movement of these leafhoppers can be influenced by the dispersion of their host plants over the growing season and can have a significant impact on aster yellows epidemics. During spring, phytoplasma-infected aster leafhopper populations migrate from grain growing areas in Texas, Louisiana, Oklahoma and

Arkansas, acquire the phytoplasma before or during migration, start feeding on winter wheat and oats, and then emerge in the vegetable growing areas of midwestern states of the

United States and the Great Lakes area of Canada in winds originating from the Gulf Coast region and the northern Plains (Wallis 1962; Meade and Peterson 1964; Drake and

Chapman 1965; Chiykowski and Chapman 1965; Nichiporick 1965 and Hoy et al. 1992).

Infected migratory aster leafhoppers are considered to be the main source of aster yellows in many vegetable crops in the midwestern United States. However, there were some observations that aster leafhoppers overwinter in the egg stage in Minnesota (Meade and

Peterson 1964) and Wisconsin (Chiykowski and Chapman 1965). No evidence of transovarial transmission has been reported for aster yellows phytoplasma in M. quadrilineatus (Ammar and Hogenhout 2006).

Once aster yellows-infected aster leafhoppers migrate into lettuce fields, they begin feeding on and infecting early plantings of lettuce. As the growing season progresses, leafhoppers originating from earlier plantings or from other migrant infected leafhoppers begin feeding on the later plantings of lettuce, which explains the clustered pattern of aster yellows-infected lettuce plants caused by different strains observed in Oklahoma and Ohio (Errampalli et al. 1991; Madden et al. 1995; Murral et al. 1996 and Beanland et al. 2005). Aster yellows phytoplasma strains distribute differently within and between host plants in the field (Madden et al. 1995). The diversity of aster yellows symptoms in lettuce fields depends on the type of aster yellows phytoplasma strains present

(Errampalli and Fletcher 1991 and Murral et al. 1996). For example, Beanland et al.

(2000) observed that aster leafhoppers infected with aster yellows phytoplasma strain

AY-WB laid more eggs than those infected with AY-S, which suggests that the AY-WB strain could become more common in the lettuce fields than the AY-S strain.

In Ohio, five different strains of aster yellows phytoplasma were identified previously in lettuce fields: aster yellows witches‟-Broom (AY-WB) (16SrI-A), aster yellows severe

(AY-S) (16SrI-B) (D‟Arcy and Nault 1982; Hoy et al. 1992 and Murral et al. 1994), aster yellows bolt white (AY-BW) (16SrI-B), aster yellows bolt distortion no. 2 (AY-BD2)

(16SrI-B), and aster yellows bolt distortion no. 3 (AY-BD3) (16SrI-B) (Zhang et al.

2004). Initially, the five aster yellows phytoplasma strains were identified and characterized based on their symptoms in both lettuce and China aster plants (Zhang et al. 2004). Distinguishing symptoms included chlorosis, wilting and witches‟-broom

(AY-WB); stunting, chlorosis, phyllody and virescence (AY-S) (Murral et al. 1996); chlorosis of newly emerging leaves (AY-BW) and leaf and stem distortion (AY-

BD2/AY-BD3) (Zhang et al. 2004). Zhang et al. (2004) used the universal primer sets

P1/P7 (Deng and Hiruki 1991 and Smart et al. 1996) and F2n/R2 (Lee et al. 1992) to identify these aster yellows phytoplasma strains by direct and nested PCR. They also developed strain-specific primers to distinguish between these strains; i.e. AY-WB can be distinguished from the other strains by using the primer pair BF/BR. AY-WB and AY-S can be distinguished from the other strains by using the primer pair S1/S2. AY-WB, AY-

S, AY-BD2, AY-BD3 and AY-BW have been detected and characterized successfully using multiple single reaction PCR assays but not using multiplex PCR assays.

Epidemics of aster yellows disease in Ohio depend on several factors, including 1) host plant susceptibility to phytoplasma infection; 2) phytoplasma strains, which are distributed between and within the host plants and 3) the infected insect vector feeding behavior and its preference for particular host plants throughout the growing season (Hoy et al. 1992 and Zhou et al. 2003). While leafhopper feeding behavior and phytoplasma distribution between and within lettuce plants have been described extensively in the past two decades (Hoy et al. 1992; Madden et al. 1995; Murral et al. 1996; Beanland et al.

2000 and Zhang et al. 2004), a thorough assessment of the role of different aster yellows strains and other herbaceous crops in lettuce aster yellows epidemiology has not been done. Therefore the aims of this study were: 1) to document the distribution of known strains of aster yellows phytoplasma in lettuce intensive production areas, 2) to determine if the composition of the aster yellows strain complex varies over time in different vegetable crops, 3) to determine the role of the herbaceous plants such as cilantro and parsley as reservoirs for the aster yellows phytoplasma within the lettuce-intensive production areas and 4) to identify any new aster yellows isolates that may contribute to the aster yellows phytoplasma strain complex.

CHAPTER 2

Development of a Multiplex PCR Assay for the Detection and Identification of Aster

Yellows Phytoplasma Strains

Introduction

Effective prevention techniques for aster yellows disease in lettuce and other crops rely mainly on early detection and accurate diagnosis of phytoplasmas in their plant and leafhopper hosts. Since phytoplasmas cannot be cultured in vitro and have low titers and/or variable distribution in their host plants, identification and differentiation of phytoplasmas has been traditionally based on the symptoms they produce in plants and microscopic observation of their cells (Lee and Davis 1992). Diagnosis based on symptoms can be unreliable since symptoms such as leaf distortion, chlorosis and vein clearing are similar to those caused by viruses or nutritional deficiencies. Microscopy, while useful in confirming the actual presence of the phytoplasma, is time-consuming and can be limited by the distribution or titer of the phytoplasma within the host (plant and/or insect vector). In addition, neither microscopy nor plant symptoms can distinguish between phytoplasma groups sub-groups or strains causing the disease. The development of molecular techniques such as PCR and DNA sequencing has increased the specificity

16 and sensitivity of phytoplasma detection from symptomatic and asymptomatic plants and insect vectors, as well as the detection time (Kirkpatrick et al. 1987; Lee et al. 1993;

Webb et al. 1999; Christensen et al. 2004; Bertolini et al. 2007; Hren et al. 2007 and

Martini et al. 2007). Phytoplasma-specific PCR assays generally utilize primers specific to conserved regions of the 16SrRNA gene and to the variable 16S-23S intergenic region

(Deng and Hiruki 1991; Ahrens et al. 1992 and 1993; Schneider et al. 1993; Rhode et al.

1993; Davis and Lee 1993; Kirkpatrick et al. 1994; Lee et al. 1994 and 1995; Lorenz et al. 1995; Maixner et al. 1995; Gundersen et al. 1996; Smart et al. 1996; White et al.

1998; Zhang et al. 1998; Griffiths et al. 1999; Montano et al. 2001; Wang et al. 2003 and

Firrao et al. 2007). Both universal (P1/P6, P1/P7 and F2n/R2; Lee et al. 1991; 1992;

Deng and Hiruki 1991; Firrao et al. 1993 and Smart et al. 1996) and group-specific

(F4/R1 for aster yellows group; fPD/rPDS for pear decline; fB1/rULWS1 for elm yellows group; fB1/rASHYS for ash yellows and P1/PYLRint for apple proliferation group;

Griffiths et al. 1994; Smart et al. 1996 and Weintraub and Beanland 2006) primers have been developed and are used routinely to detect and identify phytoplasma infections in host plants and insect vectors. In addition, the use of PCR assays with universal or group-specific primers has been especially practical for the early detection of aster yellows-infected leafhoppers in leafy green vegetables such as lettuce. Early detection before the symptoms develop is critical to prevent the disease from spreading, minimize inoculum within lettuce fields and avoid major loss of yield by developing preventative insecticide spray programs to manage disease onset (Errampalli and Fletcher 1991 and

Zhang et al. 2004).

Although PCR assays including strain-specific PCR (Lorenz et al. 1995; Smart et al.

1996; Lee et al. 1998 and Zhang et al. 2004), nested multiplex PCR (Daire et al. 1997), real-time multiplex PCR (Christensen et al. 2004) and RFLP analysis (Lee et al. 1993; and Schneider et al. 1993; Langer et al. 2003; Zhang et al. 2004 and Bertaccini 2007) have been developed over the last ten years, they still require multiple steps and have not always been reproducible. However, these techniques have been used as tools for the detection and identification of many plant pathogens including viruses (Ali et al. 2009), bacteria (Soustrade et al. 2010), and fungi (Lievens and Thomma 2005). Even though there are few publications on multiplex PCR assays, they are favored over RFLP assays

(Chamberlain et al. 1994; Edwards et al. 1994 and Henegariu et al. 1997) because they are less time-consuming and require fewer steps to completion. Although developing multiplex PCR assays to identify phytoplasma group and subgroup can be tedious, once all conditions are optimized, they require very little sample material, are sensitive and can be used to quickly identify multiple strains of aster yellows.

In this study, two multiplex PCR assays were developed to facilitate the differentiation of four strains of phytoplasmas (AY-WB, AY-S, AY-BD2 and AY-BD3) within the 16SrI group of phytoplasmas (aster yellows phytoplasma group) using primers previously described by Zhang et al. (2004).

Materials and Methods

Rearing of aster leafhoppers.

Laboratory colonies of aster leafhoppers were the progeny of leafhoppers originally collected in 1992 from vegetable crops grown in Celeryville, OH (41.00°N, 82.45°W)

(Murral et al. 1996). Leafhoppers were reared by placing ~200 nymphs on four-six 7- day-old oat seedlings (Avena sativa L. var. Armor) contained within rearing cages (20 cm x 40 cm x 40 cm) covered with Dacron organdy netting. The rearing cages were constructed using an aluminum frame with a solid floor and two hinged plexiglass doors

(Figure 1; D‟Arcy and Nault 1982). Leafhoppers were maintained in an insectary under fluorescent lights (16/8 hrs) at 27°C. Every 3 months, 50 leafhoppers were randomly selected and tested using universal primers P1/P7 (Deng and Hiruki 1991) and F2n/R2

(Smart et al. 1996 and Lee et al. 1992) to confirm the colonies remained phytoplasma- free.

Maintenance of leafhoppers infected with aster yellows phytoplasma reference strains.

Leafhoppers collected from plants in commercial, symptomatic lettuce fields in

Celeryville, OH previously were purified into four colonies, each infected with a different strain of aster yellows phytoplasma (Zhang et al. 2004; Table 1). Colonies were maintained on China aster (Callistephus chinensis) cv. Matsumoto Red (Stokes Seeds

Ltd., Buffalo, NY) (D‟Arcy and Nault, 1982; Hoy et al. 1992; Murral et al. 1996 and

Zhang et al. 2004) as described below. Pure colonies of each strain were generated by 19 placing non-infected aster leafhoppers nymphs (2nd and 3rd instars) into leafhopper rearing cages containing symptomatic lettuce and/or China aster (one symptom type per cage) for an acquisition access period (AAP) of 21 days. The leafhoppers were maintained in the insectary as described for the non-infected colonies. After the AAP, the infected leafhoppers were transferred to new cages containing 3-wk-old healthy, leafhopper-free China aster seedlings for a variable inoculation access period (IAP).

After the IAP, the aster plants were removed from the rearing cages, sprayed with 1100

Pyrethrum aerosol insecticide (0.5% pyrethroid, 2.0% piperonyl butoxide; Whitmire

Micro-Gen Research Laboratories Inc. St. Louis, MO) and left in a greenhouse for a day to assure no live nymphs or leafhoppers were still harbored by the plants. Plants were subsequently transferred to a greenhouse containing 400 W high-pressure sodium lights.

The plants were maintained at a daytime temperature of 25±2°C and a nighttime temperature of 20±2°C. Plants were monitored daily for any hatched eggs or feeding nymphs and for symptom development. Once the symptoms were observed, within 20-

45 days after the initiation of IAP, the infected plants were placed into clean rearing cages containing non-infected nymphs and maintained in the insectary for the AAP described above. The transmission cycle of phytoplasmas from infected China aster plants to the non-infected ones by the leafhoppers was repeated for each aster yellows phytoplasma strain.

Evaluation of aster yellows phytoplasma symptom types.

The aster yellows phytoplasma-infected China aster plants were maintained in a special greenhouse, after the successful transmission of different aster yellows phytoplasma strains (four plants for each cage contain one aster yellows phytoplasma strain type), at a daytime temperature of 25±2°C and a nighttime temperature of 20±2°C.

China aster plants were monitored daily for strain-specific symptom development within

3-5 wks (after the initiation of IAP). Once the symptoms developed, another serial transmission cycle was initiated.

Total genomic DNA extraction from aster yellows infected and non-infected leafhoppers and plant tissues.

Total genomic DNA from ten individual laboratory-reared leafhoppers infected with each aster yellows phytoplasma strains (AY-WB, AY-S, AY-BD2 and AY-BD3), a total of 40 leafhoppers, was extracted using the Wizard SV96 DNA extraction kit (Promega

Corp., Madison, WI). Total genomic DNA from ten individual laboratory-reared non- infected leafhoppers was extracted to serve as negative control. For the plant samples, total genomic DNA from 0.5 g leaf tissue of five individual China aster plants infected switch one of the aster yellows phytoplasma strains (AY-WB, AY-S, AY-BD2 and AY-

BD3), a total of 20 plants, was extracted using DNeasy plant mini kit (Qiagen, Valencia,

CA). In addition, total genomic DNA from 0.5 g leaf tissue from five non-infected China aster plants was extracted to serve as negative control. For both extraction protocols the manufacturer‟s instructions were followed. DNA from leafhoppers and plant tissues was 21 diluted in TE buffer (TE; pH 7.4, 10mM Tris-HCl pH 7.4, 1mM EDTA) to 50 ng/µl and used as template for the uniplex and multiplex PCR assays.

Development of aster yellows phytoplasma-strain specific multiplex PCR assays.

Aster yellows-strain specific multiplex PCR assays were developed using DNA from the aster yellows phytoplasma reference strains AY-WB, AY-S, AY-BD2 and AY-BD3 isolated from leafhoppers and China aster plants, and with strain specific primer sets

BF/BR, S1/S2, 15F/15R and 21F/21R (Table 2; Zhang et al. 2004). An optimal annealing temperature was established for each strain-specific primer pair using a temperature gradient-PCR protocol. A PCR master mix (1.25 μl of each primer (10 μM),

12.5 μl of GoTaq Green Master Mix (Go-Taq DNA polymerase at 100 units/ml, 400 μM dNTP and 3 mM MgCl2 per reaction; Promega Corporation, Madison, WI), and 10 μl of sterile DNAase-free water) was prepared for each reference strain and each mixture was identical except for the primer pair used. Twenty-four microliters of the master mix was combined with 1 μl of the corresponding reference strain DNA (50 ng/μl) and the following program was used to amplify the specific gene sequence: 2 min at 95°C, 30 cycles of 30 sec at 94°C, 30 sec at a temperature range of 47-57°C (0.83°C intervals), 1 min at 72°C, and a 10 min final extension at 72°C. PCR products (10 μl) were separated by horizontal gel electrophoresis in 1.5% agarose in 1X TTE buffer (Tris-Triton-EDTA;

1M Tris-HCl (pH 8.0), 0.25M EDTA, Triton X-100) for 20 min at 130 V. Gels were stained in dilute GelRed™ (6X in water), and DNA was visualized under UV light and photographed using the Kodak Electrophoresis Documentation and Analysis System 22

(EDAS) 290 (Eastman Kodak Company, New Haven, CT). PCR assays were carried out in a PTC-200 thermocycler with a gradient alpha block (MJ Research Inc., Waltham,

MA). The intensity of the amplicons for each temperature and PCR assay was observed and the optimal annealing temperature most common for all assays (55.2°C) was selected and used for the uniplex and multiplex PCR assays. Aster yellows phytoplasma strain- specific primer sets BF/BR, S1/S2, 15F/15R and 21F/21R were used in independent uniplex PCR reactions with aster yellows phytoplasma strain AY-WB-, AY-S-, AY-BD2- and AY-BD3-infected leafhoppers and aster plants (Table 2). A PCR master mix (as described above) was prepared for each leafhoppers and aster sample infected with each reference strain and each mixture was identical except for the primer pair used. Twenty- four microliters of the master mix was combined with 1 μl of the corresponding DNA samples from each leafhopper and aster infected with aster yellows strains (50 ng/μl) and the following program was used: 2 min at 95°C, 30 cycles of 30 sec at 94°C, 30 sec at a temperature range of 55.2°C, 1 min at 72°C, and a 10 min final extension at 72°C. PCR products (10 μl) were separated as described above and DNA was visualized and photographed. Aster yellows phytoplasma strain-specific primer sets were used in three combinations of primer sets: CPA1 (BF/BR and S1/S2); CPA2 (BF/BR and 15F/15R) and CPA3 (BF/BR, S1/S2, 15F/15R, 21F/21R); Table 3) for testing with aster yellows phytoplasma-infected leafhoppers and aster plants to ensure no multiplex assay produced two amplicons of the same size. Each PCR mixture contained each primer at 10μM and

GoTaq Green Master Mix as described above. The volume of water for each assay was adjusted so that the final volume of reaction mixture was 25 μl. The following

23 amplification program was used for each assay: 2 min at 95°C, 30 cycles of 30 sec at

94°C, 30 sec at 55.2°C, 1 min at 72°C, and a 10 min final extension at 72°C in a PTC-

100 thermocycler (MJ Research Inc., Waltham, MA) to find the minimal number of reactions that could distinguish all four strains of aster yellows phytoplasma. PCR products (10 μl) were separated by horizontal gel electrophoresis, stained and DNA visualized as described above. All the above experiments were repeated once.

Results

Symptoms of aster yellows phytoplasma on China aster plants infected with strains of aster yellow phytoplasma.

AY-WB. China aster plants began to show symptoms 2-3 weeks after inoculation with AY-WB-infected aster leafhoppers. Newly emerged leaves showed vein clearing, chlorosis (Figure 1), stunting, wilting and necrosis. At the late stage of infection, leaves start showing witches-broom symptoms (Figure 2) and the flowers became virescent.

AY-S. China aster plants began to show symptoms 7 days post-inoculation with AY-S- infected aster leafhoppers and were stunted during all growth stages. Newly emerged leaves were chlorotic and smaller than healthy leaves, and within 14 days leaves turned dark green (Figure 3). In the late stage of infection, the flowers were green and had a leaf-like morphology (phyllody) (Figure 4).

AY-BD2. China aster plants began to show symptoms 7-14 days post-inoculation with

AY-BD2-infected aster leafhoppers and developed symptoms similar to plants infected

24 with AY-WB. Newly emerged leaves and stems were distorted and showed vein clearing and chlorosis. After 21 days of infection, the leaves were clustered and chlorotic (Figure

5).

AY-BD3. AY-BD3 symptoms were difficult to distinguish from AY-BD2 symptoms.

Twenty-one days post-inoculation with AY-BD3, newly emerged leaves showed vein clearing and chlorosis (Figure 6) and in the late stages of infection, the aster plants were stunted.

Development of aster yellows phytoplasma-strain specific multiplex PCR assay.

Temperature gradient-PCR using aster yellows phytoplasma-strain specific primers

BF/BR, S1/S2, 15F/15R and 21F/21R (Table 2) and DNA from the corresponding strains

(AY-WB, AY-S, AY-BD2 and AY-BD3) produced the expected size amplicon for each annealing temperature in the assay (Figure 7B and 8A, B), with the exception of the assay using BF/BR primers at the 47.9°C annealing temperature (Figure 7A). However, a PCR product was amplified at all the other temperatures above and below 47.9°C. Although bands were visible at every annealing temperature up to the 57°C threshold, sensitivity decreased once the temperature exceeded 55.5°C for PCR assays with primer pairs

BF/BR (Figure 7B) and 21F/21R (Figure 8B). Therefore, an annealing temperature of

55.5°C was selected and subsequently used in the multiplex PCR assays.

In the uniplex PCR reaction (Table 4) with primer set BF/BR, only one 900-bp amplicon was generated with strain AY-WB, and none with the other aster yellows 25 strains. Primer set S1/S2 generated one 490-bp amplicon with AY-WB and AY-S strains and no amplicons were generated from AY-BD2 and AY-BD3 (Figure 9A, 9B). PCR with primer set 15F/15R generated one 390-bp amplicon, whereas with 21F/21R one

700-bp amplicon was amplified when tested with AY-BD2 (Figure 8) and AY-BD3 (data not shown). No amplicons were generated from AY-WB or AY-S using these primers

(data not shown).

The multiplex PCR reaction (Table 4) CPA1 (BF/BR and S1/S2) generated 490-bp and 900-bp amplicons from AY-WB and one 490-bp amplicon from AY-S, but none from AY-BD2 or AY-BD3 (Figures 9 and 10). CPA2 (BF/Br and 15F/15R) generated

390-bp and 900-bp amplicons from AY-WB and one 390-bp amplicon from AY-BD2 and AY-BD3 (Table 5). No amplicons were generated from AY-S.

When CPA1 and CPA2 were run in conjunction, three of the four strains were distinguished (AY-WB, AY-S and AY-BD2) (Figure 11). AY-BD2 and AY-BD3 could not be distinguished from one another by any PCR assay in this study. CPA3 multiplex

PCR, which utilized four primer sets, did not amplify any PCR products under the conditions used in this study (data not shown). No amplicons were generated in any of these assays when DNA from non-infected leafhoppers and non-infected China aster plants was used as template.

Discussion

The four strains of aster yellows phytoplasma (AY-WB, AY-S, AY-BD2, and AY-

BD3) used in this study were isolated from lettuce fields in Celeryville, Ohio. Since these aster yellows phytoplasma strains are closely related, they produce similar symptoms. Using these symptoms as tools to differentiate between different aster yellows phytoplasma strains requires comparing the infected plants at the same stage of infection and then comparing several stages of infection in each plant to monitor the development of aster yellows disease. Further, mixed infections of two or more phytoplasma strains have been reported in different vegetables, fruits and trees

(Errampalli et al. 1986; Errampalli and Fletcher 1991; Lee et al. 1993, 1994 and 1995), which make it very difficult to differentiate between strains based on host symptoms.

PCR assays are now the method of choice for phytoplasma detection and diagnosis, but using PCR assays with universal primers can only confirm the presence of the phytoplasma, not classify it within any group or subgroup. Thus, Zhang et al. (2004) developed strain-specific primers including the primer set BF/BR, which was developed from an aster yellows phytoplasma strain AY-WB genomic DNA clone. Primer sets

S1/S2, 15F/15R and 21F/21R were developed based on the sequence variation between

PCR products of aster yellows phytoplasma strains amplified by primer pair AY19p and

AY19m (Schaff et al. 1992). These strain-specific primer sets were used in the development of the multiplex PCR assays in this study. Multiplex PCR assays developed in this study made it possible to detect and differentiate three of the four aster yellows

27 phytoplasma strains previously observed in Ohio lettuce fields, without the need to wait for symptom development or to run multiple uniplex PCR assays.

Initially, the individual primer sets were amplified in uniplex reactions by gradient

PCR to optimize their annealing temperature in order to have strong amplification of

PCR amplicon(s) and reduce any non-specific amplification. Although DNA of aster yellows phytoplasma strains was amplified using strain-specific primers at 57°C in a previous study (Zhang et al. 2004), our experiment showed that lowering the annealing temperature to 55.5°C was critical for these strains to be re-amplified in multiplex mixtures and to produce highly reliable amplification products.

Developing reliable multiplex PCR assays that target sequences of more than one aster yellows phytoplasma reference strain can be challenging, but we utilized previously developed primers (Zhang et al. 2004) that distinguish between those strains in multiple uniplex reactions. When BF/BR (detects AY-WB) and S1/S2 (detects AY-WB and AY-

S) primer sets were pooled in the multiplex PCR assay CPA1, they generated two amplicons from AY-WB (490 and 900-bp), one amplicon from AY-S (490-bp) and none for AY-BD2 and AY-BD3. When 15F/15R (detects AY-BD2 and AY-BD3) was combined with BF/BR in the multiplex PCR assay CPA2, two amplicons from AY-WB

(390 and 900-bp) and one amplicon from AY-BD2 and AY-BD3 (390-bp) were generated. The CPA2 multiplex assay detected AY-BD2 and AY-BD3 but did not distinguish them from one another. Strains AY-BD2 and AY-BD3 are very similar,

28 causing nearly identical symptoms in lettuce and China aster, and could not be distinguished with the primers used in this study. However, Zhang et al. (2004) differentiated these two strains by PCR with primers (S10F/S10R) developed from AY-S genomic DNA with high sequence identity to an AL1-like protein gene. However, this primer set reacted with AY-S and other strains in this study and therefore was not selected for use in multiplex PCR development. Quadriplex PCR assays, which utilized

S1/S2, BF/BR, 15F/15R and 21F/21R primers, failed to generate any amplicons of the band sizes observed in the uniplex reactions for the same DNA extracts from aster yellows phytoplasma strains. Failure to generate visible amplicons from the quadriplex

PCR assays could be the result of the limited size range of PCR amplicons (Chen et al.

2005) or due to several compatible primers (primer-primer interactions) (Clair et al. 2003 and Lopez et al. 2009).

These multiplex PCR assays can be convenient in the diagnostic lab to distinguish between different aster yellows phytoplasma strains during routine diagnosis of leafy green samples. Both CPA1 and CPA2 assays were used to test for the presence of aster yellows phytoplasma strains in individual aster leafhoppers, captured flying in Ohio fields of lettuce, cilantro and parsley and from leaves and roots of these crops (Chapter

3).

Strain and Subgroup affiliation Symptoms on Symptoms on Year of Lettuce Aster collection Aster yellows witches‟-Broom Vein clearing Vein clearing 1996 (AY-WB)1 Yellowing Yellowing 16SrI-A Stunting Stunting Wilting Witches‟-broom Necrosis Necrosis Bolting Flower sterility Aster yellows severe Yellowing Yellowing 1996 (AY-S)1 Stunting Stunting 16SrI-B Phyllody Virescence Aster yellows bolt distortion Bolting Vein clearing 2003 No.2 (AY-BD2)2 Distortion of Yellowing 16SrI-B stem and leaves Flower sterility Aster yellows bolt distortion Bolting Vein clearing 2003 No.3 (AY-BD3)2 Chlorosis Chlorosis 16SrI-B Stunting Flower sterility 1, 2 Aster yellows phytoplasma strains were described previously by 1Murral et al. 1996 and 2Zhang et al. 2003.

Table 1. Aster yellows phytoplasma strains collected from lettuce in Ohio and maintained in China aster plants.

Primer Sequence (5‟-3‟) Tm (°C) G+C % Amplicon size (bp) Strain specificity

BF AGGATGGAACCCTTCAATGTC 52.4 47.6 BR GGAAGTCGCCTACAAAAATCC 52.4 47.6 900 AY-WB S1 CGCTAACAAATGTAAAGGCAAG 51.1 40.9 S2 CTTTAATAGGACTATGAGGG 47.7 40 490 AY-WB, AY-S 15F CCCTCAAACCCACGAAGTT 51.1 52.6

15R TACTGTGTTCCCTTACTCC 48.9 47.4 390 AY-BD2, AY-BD3 31 21F CCAATCATTTAGATAAAATTGATACC 50.1 26.9

21R TGTAGTTGAGTTCTATGTAGC 48.5 38.1 700 AY-BD2, AY-BD3

Table 2. Sequences of the oligonucleotide primer sets developed from rRNA operon of aster yellows phytoplasma reference strains by Zhang et al. (2004) for detection of aster yellows phytoplasma (AY) strains in uniplex PCR assays. AY-WB = aster yellows witches‟- broom; AY-S = Aster yellows severe; AY-BD2 and AY-BD3 = aster yellows bolt-distortion; AY-BW = aster yellows bolt white.

Primer combination Strains to be Amplicon size Multiplex PCR identified assay AY-WB 490 and 900 bp BF/BR+S1/S2 AY-S 490 bp CPA1 AY-BD2, AY-BD3 No amplicon AY-WB 390 and 900 bp BF/BR+15F/15R AY-S No amplicon CPA2

AY-BD2, AY-BD3 390 bp AY-WB 390, 490 and 900 bp BF/BR+S1/S2+ AY-S 490 bp CPA3 15F/15R+21F/21R AY-BD2, AY-BD3 390 and 519 bp

Aster yellows phytoplasma strain-specific primer sets

Samples tested BF/BR S1/S2 15F/15R 21F/21R BR/BR+S1/S2 BF/BR+15F/15R BF/BR+S1/S2+ (CPA1) (CPA2) 15F/15R+21F/21R (CPA3) AY-WB-infected leafhoppers + + - - + + - AY-S-infected leafhoppers - + - - + + -

AY-BD2-infected leafhoppers - - + + - + - AY-BD3-infected leafhoppers - - + + - + -

Non-infected leafhoppers ------

AY-WB-infected aster plants + + - - + + -

AY-S-infected aster plants - + - - + + -

AY-BD2-infected aster plants - - + + - + -

AY-BD3-infected aster plants - - + + - + -

Non-infected aster plants ------

Table 4. Differentiation of aster yellows phytoplasma strains by uniplex and multiplex PCR. Template DNA was from leafhoppers infected with one of four phytoplasma strains. DNA isolated from non-infected leafhoppers was used as a negative control. AY-WB = aster yellows witches‟-broom; AY-S = Aster yellows severe; AY-BD2 and AY-BD3 = aster yellows bolt-distortion; AY-BW = aster yellows bolt white.

Number of amplicons Multiplex PCR assay Primer Idenitifcation1 Primer sequence (5´ to 3`) produced PCR amplicon sizes (bp) BF AGG ATG GAA CCC TTC AAT GTC BR GGA AGT CGC CTA CAA AAA TCC CPA1 2 490 and 900 S1 CGC TAA CAA ATG TAA AGG CAA G S2 CTT TAA TAG GAC TAT GAG GG BF AGG ATG GAA CCC TTC AAT GTC BR GGA AGT CGC CTA CAA AAA TCC CPA2 2 390 and 900

34 15F CCC TCA AAC CCA CGA AGT T

15R TAC TGT GTT CCC TTA CTC C

1 Primers previously described by Zhang et al. (2004).

Table 5. Primers, primer sequences and number and size of amplicons produced in two multiplex PCR assays to differentiate strains of aster yellows phytoplasma.

Figure 1. China aster plant showing vein clearing and yellowing symptoms caused by aster yellows phytoplasma strain AY-WB.

Figure 2. China aster plant showing witches'-broom symptom caused by aster yellows phytoplasma strain AY-WB.

Figure 3. China aster plant showing chlorotic (A) turning to dark green leaves (B) caused by aster yellows phytoplasma strain AY-S.

Figure 4. China aster plant showing the flower phyllody symptom caused by aster yellows phytoplasma strain AY-S.

Figure 5. Infected China aster plant showing vein clearing (A) and chlorosis (B) symptoms caused by aster yellows phytoplasma strain AY-BD2.

Figure 6. China aster showing vein clearing and yellowing symptoms caused by aster yellows phytoplasma strain AY-BD3.

Figure 7. Gradient polymerase chain reaction (PCR) amplification of aster yellows phytoplasma strain AY-WB using primer pairs: (A) BF/BR; and (B) S1/S2. Lane M, 1-Kb plus ladder; Lane 1, 47°C; 2, 47.3°C; 3, 47.9°C; 4, 48.7°C; 5, 49.8°C; 6, 51.3°C; 7, 53°C; 8, 54.4°C; 9, 55.5°C; 10, 56.3°C; 11, 56.8°C; 12, 57°C.

Figure 8. Gradient polymerase chain reaction (PCR) amplification of aster yellows phytoplasma strain AY-BD2 using primer pairs: (A) 15F/15R; and (B) 21F/21R. Lane M, 1Kb plus ladder; Lane 1, 47°C; 2, 47.3°C; 3, 47.9°C; 4, 48.7°C; 5, 49.8°C; 6, 51.3°C; 7, 53°C; 8

Figure 9. Polymerase chain reaction (PCR) amplification of aster yellows phytoplasma strains (AY-WB, AY-S, AY-BD2 and AY- BD3) with (A): BF/BR primer pair; (B): S1/S2 primer pair; and (C): multiplex PCR using primer pairs BF/BR and S1/S2 (CPA1). Lane M, 1-Kb plus ladder (Invitrogen Crop., Carlsbad, CA); lane 1, AY-S; lane 2, AY-WB; lane 3, AY-BD2; lane 4, AY-BD3; lane 5, AY-S + AY-WB; and lane 6, non-infected leafhopper as a negative control.

Figure 10. Multiplex PCR amplification of aster yellows phytoplasma strains using primer pairs: (A): BF/BR, S1/S2 (CPA1); and (B): BF/BR, 15F/15R (CPA2). Lane M, 1-Kb plus ladder (Invitrogen Corp., Carlsbad, CA); lane 1, AY-S; lane 2, AY-WB; lane 3, AY-BD2; lane 4, AY- BD3; and lane 5, non-infected leafhopper.

Figure 11. Flow chart of development of two multiplex PCR assays, A: CPA1 (differentiates AY-S and AY-WB); and B: CPA2 (differentiates AY-BD2/BD3 and AY-WB).

CHAPTER 3

Diversity of Aster Yellows Phytoplasma Strains in Intensive Lettuce Production

Areas in Ohio

Introduction

Lettuce fields in Ohio can be significantly affected by aster yellows disease, but disease incidence varies from year to year. In some years, disease incidence can reach

100% in individual fields and cause major economic losses (Hoy et al. 1992). The cause of aster yellows disease is a phytoplasma (Ca. Phytoplasma asteris) that affects more than

400 host plant species. Aster yellows phytoplasmas induce symptoms in their plant hosts, including yellowing of leaves, witches‟-broom (excessive proliferation of shoots), stunting, and phyllody, among others (Lee and Davis 1992; Lee et al. 2000; Zhang et al.

2004; and Hogenhout et al. 2008). They are dependent on phloem-feeding aster leafhoppers (Macrosteles quadrilineatus, Forbes) as the main vector for disease transmission. Once the leafhoppers transmit phytoplasmas to a host plant, aster yellows symptoms may appear within 2-3 weeks. Some host plants may become infected with phytoplasmas and remain asymptomatic, and serve as reservoirs for the phytoplasma

(Blomquist and Kirkpatrick 2002; Gatineau et al. 2001; Marzachì et al. 1998; Bertaccini

2007; Maramorosch and Harris 1979; McClure 1982 and Kawakita et al. 2000). 44

The distribution of aster yellows phytoplasma in Ohio depends on many factors, including host plant range, which is determined in large part by aster leafhopper feeding behavior. The aster leafhopper is a polyphagous vector, which can transmit aster yellows phytoplasma to different vegetable crops including but not limited to lettuce, carrot, onion, celery, tomato, potato, spinach, cauliflower, broccoli, cabbage and dill (Swenson

1971; McCoy et al. 1989 and Weintraub and Beanland 2006). In a recent study, Bai et al. (2009) showed that aster yellows phytoplasma produced effector proteins in infected host plants that changed the plant‟s gene expression to increase the attractiveness of young shoots and leaves to the aster leafhopper compared to the non-infected plants, contributing to increased leafhopper feeding and oviposition (Peterson 1973 and Schultz

1973). Furthermore, aster yellows phytoplasma-infected leafhoppers showed improvement in overwintering ability and an increase in fecundity and longevity.

Beanland et al. (2000) observed that aster yellows phytoplasma-infected leafhoppers laid twice the amount of eggs on host plants as non-infected leafhoppers.

Infected leafhoppers migrating from southern states are considered to be the main source of aster yellows in vegetables in the Midwestern United States (Hoy et al. 1992).

However, there were some reports that aster leafhoppers overwinter in the egg stage in

Minnesota (Meade and Peterson 1964) and Wisconsin (Chiykowski and Chapman 1965).

However, there was no evidence of aster leafhoppers overwintering as adults or eggs in

Ohio (Teraguchi 1986).

Once they arrive in lettuce fields, leafhopper movement depends on the distribution of lettuce and other host crops over the growing season. For example, infected leafhoppers move to a lettuce field, and feed on and inoculate the lettuce plants. They eventually fly to another nearby lettuce field and continue the cycle of inoculation

(Wallis 1962; Meade and Peterson 1964; Drake and Chapman 1965; Chiykowski and

Chapman 1965; Nichiporick 1965 and Hoy et al. 1992). A clustered pattern of aster yellows-infected lettuce plants caused by different aster yellows phytoplasma strains transmitted by aster leafhoppers has been documented (Errampalli et al. 1991; Madden et al. 1995; Murral et al. 1996 and Beanland et al. 2005). Aster yellows phytoplasma strains carried by infected leafhoppers distribute differently within and between lettuce plants in the field, which affects their transmission (Madden et al. 1995) and the diversity of the symptoms they express (Murral et al. 1996 and Errampalli and Fletcher 1991). For example, Beanland et al. (2000) showed that leafhoppers infected with aster yellows phytoplasma strain AY-WB produced significantly more nymphs and had more fitness than those infected with strain AY-S. Leafhoppers infected with AY-WB were better adapted to the aster yellows pathogen as documented by higher fecundity and longevity, suggesting that the strain AY-WB could become more common in the lettuce fields than the AY-S strain.

In the past, aster yellows phytoplasma detection relied on biological properties such as symptoms, host range, and the relationship between the phytoplasma and its leafhopper vector (Davis et al. 1990; Chen et al. 1992; Daire et al. 1992; Davies et al.

1995 and Davis and Lee 1993). Currently, aster yellows phytoplasma detection and classification rely on molecular techniques. Direct and nested PCR, using universal primers P1/P7 and F2n/R2, are used extensively for the detection of the aster yellows phytoplasmas both from symptomatic and asymptomatic plants and from aster leafhoppers. Also, specific primers that distinguish among aster yellows phytoplasma strains have been developed from different positions on the ribosomal RNA operon, such as the 16SrRNA gene and the variable 16S-23S intergenic region (Smart et al. 1996;

Schneider et al. 1993; Gundersen et al. 1996; Lorenz et al. 1995; Rhode et al. 1993;

Davis and Lee 1993; Deng and Hiruki 1991; Ahrens et al. 1994; Kirkpatrick et al. 1994;

Lee et al. 1994; 1995; 2005; 2006; Griffiths et al. 1999; Zhang et al. 1998; Schneider et al. 1997 and Zhang et al. 2004). Sequences of the aster yellows phytoplasma 16SrRNA gene provide sufficient information for aster yellows phytoplasma classification to the strain level. There are at least 14 subgroups with different strains distributed worldwide in the aster yellows phytoplasma group. Although these different strains have high similarity in 16SrRNA sequences between them, they represent the genetic diversity of the aster yellows group in different ecological niches (Gundersen et al. 1994; Seemüller et al. 1994, 1998b; Vibio et al. 1996; Lee et al. 1998, 2000, 2002; Marcone et al. 2000 and Jomantiene et al. 2002).

In Ohio, five different strains of aster yellows phytoplasma were identified previously in lettuce fields, based on their symptoms and RFLP patterns: aster yellows Witches‟-

Broom (AY-WB) (16SrI-A) and aster yellows Severe (AY-S) (16SrI-B) (D‟Arcy and

Nault 1982; Hoy et al. 1992 and Murral et al. 1994), aster yellows Bolt White (AY-BW)

(16SrI-B), aster yellows Bolt Distortion no. 2 (AY-BD2) (16SrI-B), and aster yellows

Bolt Distortion no. 3 (AY-BD3) (16SrI-B) (Zhang et al. 2004). Initially, the five aster yellows phytoplasma strains were identified and characterized based on their symptoms in both lettuce and China aster plants (Zhang et al. 2004). Direct and nested PCR using universal primer sets P1/P7 and F2n/R2 were used to identify these isolates as phytoplasmas. Next, strain-specific primers were developed to distinguish among these strains; i.e. AY-WB can be distinguished from the other strains by using the primer pair

BF/BR. AY-WB and AY-S can be distinguished from the other strains by using the primer pair S1/S2. AY-WB, AY-S, AY-BD2, AY-BD3 and AY-BW were detected successfully using multiple single reaction PCR assays. In Chapter 2 of this study, multiplex PCR assays were developed to distinguish between the aster yellows phytoplasma reference strains using previously developed primers. These rapid assays allowed us to screen a large number of leafhopper and plant samples at different times from multiple locations and identify aster yellows strains quickly and economically.

Other factors that may affect the distribution of aster yellows phytoplasma strains in

Ohio vegetable fields throughout the growing season may include host plant preference by the leafhoppers, time of sampling and variation in transmission rate of different aster yellows phytoplasma strains. Herbaceous crops including cilantro and parsley, which are widely grown in the lettuce production areas included in this study, do not commonly exhibit aster yellows disease symptoms, but may serve as alternative host plants

(Khadhair et al. 1998; Zhou et al. 2003 and Lebsky and Poghosyan 2007). However, their role in the distribution of aster yellows strains in lettuce and other economically important vegetable crops is unknown. While several aster yellows phytoplasma strains have been identified in lettuce, it is likely that others are present in leafhoppers and vegetable crops. The aims of this study were to document the geographic and temporal distribution of known strains of aster yellows phytoplasma in lettuce, cilantro and parsley, and identify new isolates that may contribute to the aster yellows phytoplasma strain complex.

Materials and Methods

Rearing of healthy aster leafhoppers.

The rearing of healthy aster leafhoppers was as described in Chapter 2. Fifty leafhoppers were randomly selected from each rearing cage and tested in groups of five by nested PCR using aster yellows phytoplasma universal primers P1/P7 (Deng and

Hiruki 1991 and Smart et al. 1996) followed by F2n/R2 (Lee et al. 1992) every 3 months to insure they were not contaminated with phytoplasmas (Table 6).

Maintenance of aster yellows reference strains.

The maintenance of the aster yellows phytoplasma strains was as previously described in Chapter 2.

Leafhopper and plant sample collection.

From June to September 2008 and 2009, aster leafhoppers were collected in lettuce production areas near Celeryville and Hartville, OH from commercial fields planted to red leaf lettuce, green leaf lettuce, romaine lettuce, cilantro or parsley. At least 50 leafhoppers were sampled from the fields within each crop (depending on availability) following a zigzag pattern with a vacuum leafhopper net comprised of a model BG 72 leaf blower with a fine-mesh leafhopper net bag taped to the end of the intake nozzle to capture the leafhoppers (Stihl Inc., Virginia Beach, VA) (Zhou et al. 2003). Geographic coordinates of each field were recorded (Table 7) using a hand-held global positioning system (GPS). Leafhoppers trapped in the nets from each sampling unit were transferred to individual 3.78L double locked plastic bag (Ziploc® Brand freezer bags with smart zip™ seal, S.C. Johnson and Son, Inc., Racine, WI) and stored on ice up to 7 hrs prior to processing. Sampled leafhoppers were frozen and aster leafhoppers were identified and separated from other leafhopper species and packed individually (1 leafhopper per tube) into 8-well tube strips (Fisher Scientific, Pittsburgh, PA) labeled with the location, date of collection, and the host plant. Individual leafhoppers were stored at -20°C prior to DNA extraction.

Samples of lettuce, cilantro and parsley plants were collected in 2009. Plant samples were from the same commercial fields where leafhopper samples were collected, with a total of eight collections beginning in June and continuing through September 2009. Five plants were selected from each field along a zigzag pattern and removed from the soil by 50 hand. Plants with aster yellows symptoms were preferentially selected when present. If no symptomatic plants were observed, samples were selected at random. Samples were placed in individual 3.78L double locked plastic bags and stored on ice during the collection. The collection date, host plant type, and transect point GPS coordinates were recorded. Roots and leaves from each sample were selected, rinsed with water to remove residual soil, placed into clean plastic bags, and stored at -20°C prior to DNA extraction.

Total genomic DNA extraction from leafhopper and plant tissue.

Total genomic DNA from individual field-collected and laboratory-reared leafhoppers (infected and non-infected) was extracted using the Wizard SV96 DNA extraction kit (Promega Corp., Madison, WI). For the plant samples, five upper leaves

(8-10 cm in length) and five lateral roots (~2-3 cm in length) from lettuce and five upper leaves (4-6 cm in length) and five lateral roots (~2-3 cm in length) from cilantro and parsley were frozen in liquid nitrogen and ground in a sterilized mortar and pestle. DNA was extracted from a 200 mg sample of this tissue using DNeasy plant mini kit (Qiagen,

Valencia, CA). For both extraction protocols the manufacturer‟s instructions were followed. DNA from leafhopper and plant tissue was diluted in Tris-EDTA (TE; pH 7.4,

10 mM) to 50 ng/µl and used as template for PCR.

Optimization of the sample size required for initial screening of leafhopper and plant samples.

DNA extracts from individual AY-WB-infected leafhoppers were previously pooled in groups of five and used as template for PCR (Zhou et al. 2003). The feasibility of 51 increasing the leafhopper pool to eight individuals was tested to accommodate the design of the Wizard SV96DNA and DNeasy plant mini extraction kits. DNA from eight individual AY-WB-infected leafhoppers and eight individual non-infected leafhoppers reared in the laboratory was extracted. One µl of DNA from each AY-WB-infected leafhopper extract was pooled to be used as positive control (8AY) for the experiment (a total of 8 µl) and 1 µl of DNA from each non-infected leafhoppers were pooled to be used as negative control (8N) for the experiment (a total of 8 µl). Also, 1 µl of DNA from seven AY-WB-infected leafhoppers were pooled (7AY) with 1 µl of DNA from a non-infected leafhopper (1N). Different ratios of DNA from AY-WB-infected leafhoppers and non-infected leafhoppers were pooled (6AY:2N; 5AY:3N; 4AY:4N;

3AY:5N; 2AY:6N; 1AY:7N) to be tested for the optimum sample size. One µl aliquot of

DNA extract from each pooled sample was used in PCR for each combination tested

(Figure 12).

For plant samples, DNA from 200 mg root tissue from eight individual AY-WB- infected aster plants and eight individual non-infected aster plants was extracted. One µl of DNA from each AY-WB-infected aster plant was pooled to be used as positive control

(8AY) for the experiment (a total of 8 µl) and 1 µl of DNA from each non-infected aster plants was pooled to be used as negative control (8N) for the experiment (a total of 8 µl).

Also, 1 µl of DNA from seven AY-WB-infected aster plants were pooled together (7AY) with 1 µl of DNA from non-infected aster plants (1N). Different ratios of DNA from

AY-WB-infected aster plants and non-infected aster plants were pooled together

(6AY:2N; 5AY:3N; 4AY:4N; 3AY:5N; 2AY:6N; 1AY:7N) to be tested for the optimum sample size. A 1µl aliquot of DNA extract from each pooled sample was used in PCR for each combination tested. DNA samples were tested by nested PCR assay; the PCR mixture and program are described below. This experiment was repeated one time.

For both leafhoppers (Figure 12) and plant extracts (data not shown), the PCR assay was sufficiently sensitive to detect one aster yellows phytoplasma-infected leafhopper or plant sample extract in a total of eight pooled extracts. Therefore pools of eight DNA extracts from individual leafhoppers or plants were used to identify positive samples.

The individual samples that comprised the phytoplasma-positive pooled samples were then tested individually as described below.

Detection of phytoplasmas in leafhopper and plant samples.

Phytoplasma direct PCR.

PCR was performed using the universal phytoplasma primer pair P1/P7 (Deng and

Hiruki 1991 and Smart et al. 1996) (Table 6). Each PCR reaction mixture contained 1 μl of the pooled DNA diluted to 50 ng/μl, and 24 μl of master mix (1.25 μl of each 10 μM primer, 12.5 μl of GoTaq Green Master Mix (Go-Taq DNA polymerase at 100 units/ml,

400 μM dNTP, and 3 mM MgCl2; Promega Corporation, Madison, WI) and 10 μl sterile distilled water. The following program was used to amplify the DNA: 1 min at 94°C, 30 cycles of 2 min at 94°C, 1 min at 55°C, 2 min at 72°C, and a 10-min final extension at

72°C. All PCR assays described in this study were carried out in a PTC-100

53 thermocycler (MJ Research Inc., Waltham, MA). The PCR product was stored at -20°C and used as template for the nested PCR.

Phytoplasma nested PCR.

Nested PCR was performed on the PCR products obtained above using the universal

PCR primer pair F2n/R2 (Lee et al. 1992) (Table 6). PCR reactions were prepared as described above except 1 μl of the PCR product from the direct PCR was used as a template, the annealing temperature was 50°C for 2 min and the extension time was 3 min. PCR products (10 μl) were separated by horizontal gel electrophoresis in 1.5% agarose in 1X Tris-Triton-EDTA (TTE, 1M Tris-HCl (pH 8.0), 0.25 M EDTA, Triton X-

TM 100) buffer for 20 min at 130 V. Gels were stained in dilute GelRed (3X in H2O), and

PCR products were visualized under UV light and photographed using the Kodak

Electrophoresis Documentation and Analysis System (EDAS) 290 (Eastman Kodak

Company, New Haven, CT). From each pooled sample that tested positive with phytoplasma universal primer sets, the eight individual samples that comprised each pooled sample were recovered from storage and tested by nested PCR using the phytoplasma universal primer pairs as described above.

Detection and identification of aster yellows phytoplasma strains using multiplex PCR.

Individual leafhopper and plant samples that tested positive for aster yellows were further evaluated for strain identity using multiplex PCR with CPA1 and CPA2 primer

54 complexes (Chapter 2). Leafhopper and plant samples that tested negative with CPA1 and CPA2 were re-tested using AY-BW specific PCR primers BWF/BWR (Zhang et al.

2004). The reaction mixture was as described above for the aster yellows phytoplasma- specific PCR and the program was as follows: 2 min at 94°C, 30 cycles of 30 s at 94°C,

40 s at 55°C, and 1 min at 72°C, and then a 10-min final extension at 72°C. PCR products were separated and visualized as described above.

Statistical analyses.

Statistical analyses were performed using linear mixed models in SAS software (SAS

Institute, Cary, NC) to determine the effect of year, location, host and sampling time on the distribution of the aster yellows phytoplasma strains found in vegetable production areas in Ohio. Because the number of infected samples (from host plants and leafhoppers) was not always the same, the proportion of the infected samples was calculated as follows: number of the infected samples for each strain/total number of the infected samples tested. All factors including host plant (red leaf, green leaf, romaine lettuce, cilantro and parsley) and sampling time (June, July, August and September) were considered fixed effects in the analysis. Preliminary analysis showed that there were no significant differences between the two locations and the two years, so year and location were combined and treated as a blocking factor (Loc_Year) and considered random effects in the analysis. For the host plant and the sampling time, mean comparisons were performed using Proc mixed and mean separation by letters was performed using the macro PDMIX800.sas (Saxton 1998).

Phylogenetic analysis of unidentified phytoplasma isolates.

DNA extracts from individual plant and leafhopper samples that were phytoplasma- positive by nested PCR but negative with the aster yellows phytoplasma strain-specific primers were amplified by PCR using the universal primers P1/P7. P1/P7 PCR products were purified using the Wizard SV gel and PCR purification system (Promega, Madison,

WI). The purified PCR products (40 ng/μl) and the corresponding primers P1/P7 (2 pmol/μl) were sent to the Plant-Microbe Genomic Facility (The Ohio State University,

Columbus, OH) for sequencing using an automated 3730 DNA Analyzer (Applied

Biosystems, Inc.). Each amplicon was sequenced from both directions. The raw sequence chromatograms were trimmed and edited, and consensus sequences were generated using Sequencher (Sequencher 3.0; Gene Codes Corporation, Ann Arbor,

Michigan). The trim criteria for both ends of the sequences were set to remove no more than 25% until the last 15 bases contained less than three bases with a confidence level less than 20. Based on the trim criteria, the unreliable sequences were excluded from the analyses. Partial sequences of 16SrRNA (1136 bp) from aster yellows phytoplasma isolates detected in plants and aster leafhoppers were aligned using ClustalW algorithm

(Higgins et al. 1994) in Mac Vector (Mac vector 6.1; Oxford Molecular Ltd., Beaverton,

OR). The aligned sequences were compared with representative aster yellows phytoplasma strains selected from the Genbank database. Phylogenetic analyses were conducted by MEGA version 4 (Tamura et al. 2007) using the neighbor-joining method with 1000 replicates for bootstrap analysis. Reference aster yellows phytoplasma strains 56 from subgroup 16SrI-A: 99UW11 (Lee et al. 2002), ca2006/1 (Duduk et al. 2009), AY-

WB (Zhang et al. 2004) and ParsD3 (Lee et al. 2003) and from subgroup 16SrI-B: AY-S,

AY-BW, AY-BD2 (Zhang et al. 2004), SAY (Kuske and Kirkpatrick 1992), and ParsD1

(Lee et al. 2003) were included in the phylogenetic analysis (Table 16). The corresponding sequence of tomato stolbur phytoplasma (Martini et al. 2007) was used to root the phylogenetic tree.

Results

Leafhopper populations during the 2008-2009 growing seasons.

During the summer of 2008, 1326 and 1174 aster leafhoppers were collected from red leaf, green leaf and romaine lettuce, cilantro and parsley in Celeryville and Hartville, OH respectively. In 2009, 1688 and 1638 aster leafhoppers were collected from the same crops at the two locations. In 2008, at both locations, more than 75% of the leafhoppers obtained were collected during the months of July and August. Similar results were observed in 2009, with more than 80% of the leafhoppers collected during the months of

July and August at both locations (Figure 13 and Tables 8 and 9).

There were significant differences in both locations during 2008 and 2009 in the total number of leafhoppers collected among plant hosts (p = 0.0006) and between the sampling dates (p < 0.0001). In addition, there was a significant effect of plant host and the sampling time (p = 0.0057) on the number of leafhoppers collected. The highest

57 number of the leafhoppers was found in romaine lettuce during the month of August

(Table 10).

Symptoms of aster yellows in plants.

In 2009, 818 and 948 plants (lettuce, cilantro and parsley) samples were collected from fields in Celeryville and Hartville, respectively. Cilantro and parsley plant samples were asymptomatic for aster yellows. Early symptoms of aster yellows disease on lettuce included small, yellow, narrow, distorted leaves. By the end of the growing period, all the leaves of infected lettuce plants were yellow and the plants were wilted and stunted

(Figure 14 and 15).

Aster yellows phytoplasma infection in aster leafhoppers.

In 2008, 735 and 525 leafhoppers from Celeryville and Hartville, respectively, were tested for phytoplasma detection by nested PCR. In 2009, 1688 and 1638 leafhoppers from Celeryville and Hartville respectively, were tested. In total, 65.9% and 75.2% of the leafhoppers from Celeryville and Hartville, respectively, were infected with phytoplasma in 2008, and 63.9% and 41.3% were positive from Celeryville and Hartville, respectively, in 2009. There were no significant differences in the proportion of phytoplasma-infected leafhoppers collected among the crops tested (p ≥ 0.59). However, the proportion was significantly higher in June and July than in August and September (p

= 0.0006) (Tables 10 and 11).

Aster yellows phytoplasma infection in lettuce, parsley and cilantro plants.

In 2009, 818 and 948 plants, from Celeryville and Hartville respectively, were tested for phytoplasma infection by nested PCR. Twenty one percent of the tested plants from

Celeryville were infected with phytoplasma and the number was twice that in plants from

Hartville. Although there were no significant differences in the proportion of infected plants between the three lettuce types, cilantro or parsley (p ≥ 0.76), infected plants were more abundant in June, July and August than in September (p ≤ 0.01) (Tables 10 and 12).

Aster yellows phytoplasma strain distribution in leafhoppers and plants.

In 2008, the percentage of the leafhoppers infected with aster yellows phytoplasma strain AY-WB (16SrI-A) was similar to the percentage infected with strain AY-BD2

(16SrI-B) at both locations (approx. 22%; Table 13). Very few leafhoppers infected with strain AY-S (16SrI-B) were found in Celeryville, and none were detected in Hartville

(Table 13). Strain AY-BW (16SrI-B) was regularly found in leafhoppers at both locations (39.7-46.6%), as was strain AY-BD2 (16SrI-B) (23.8-25.3%) (Table 13). In

2009, strain AY-WB was abundant in Celeryville (47.1%) but not in Hartville (17.6%), while the percentage of leafhoppers infected with strain AY-BW (14.4-32.4%) was lower than observed in 2008. The percentage of leafhoppers infected with aster yellows phytoplasma strain AY-S was numerically low at both locations (2.9-3.2%), as in 2008.

Strains AY-BD2 and AY-BW were present in similar percentages at both locations. The percentage of plants infected with strain AY-WB was similar to the percentage of plants infected with strain AY-BW at both locations, while the percentage of plants infected 59 with strain AY-BD2 in Celeryville was twice the percentage infected at Hartville. The percentages of plants infected with strain AY-S were low (2.2-2.6%) and similar at both locations (Table 13).

In 2009, at both locations, the percentage of leafhoppers infected with strain AY-WB

(64.7%) was twice the percentage of plants infected with strain AY-WB (39.1%), while the percentage of leafhoppers infected with strain AY-S (6.1%) was similar to that of plants infected with the same strain (4.8%). However, the percentage of plants infected with strain AY-BD2 (63.1%) was higher than that of leafhoppers infected with this strain

(47.4%). The percentage of plants infected with strain AY-BW (49.7%) was similar to the percentage to the leafhoppers infected with strain AY-BW (46.8%) (Table 13).

The percentage of leafhoppers infected with subgroup 16SrI-A strain AY-WB differed significantly over time during the growing season (p = 0.0187) but did not differ among the crops (p = 0.51; Table 10). The percentage of AY-WB-infected leafhoppers collected was significantly higher in July than in September (p = 0.01) (Table 11). The proportion of leafhoppers infected with subgroup 16SrI-B strains AY-S, AY-BD2 and

AY-BW did not differ by crop from which they were collected, but the proportion of leafhoppers infected with AY-BD2 differed over time (Table 10). The percentage of leafhoppers infected with AY-BD2 was significantly lower in September than in June,

July or August (Table 11). There was a significant interaction between crops tested and time of sampling for the percentage of leafhoppers infected with AY-BD2 (p = 0.0012)

(Table 10). The percentage of leafhoppers infected with AY-BD2 was higher in romaine lettuce (p ≤ 0001) throughout the growing season except September.

There were no significant differences in the percentage of any of the aster yellows phytoplasma strains detected among the host plants tested (lettuce, cilantro and parsley).

On average, the percentage of aster yellows strains belong to subgroup 16SrI-B detected in the host plants tested differed over time, with the lowest proportion in September

(Table 12). However, there were no significant differences in the percentages of individual 16SrI-B strains detected in these crops over time. There was no significant interaction between host plants and time of sampling for the proportion of strains detected.

Unidentified phytoplasma isolates in infected leafhoppers and plants.

Samples that tested positive with P1/P7 and F2n/R2 primers in the nested PCR analysis indicate phytoplasma presence in their DNA but when tested with strain-specific primers in the multiplex PCR analysis, they tested negative, which defined them as unidentified phytoplasma isolates. Of the phytoplasma-infected leafhoppers collected from Celeryville and Hartville, 23.9% (35/146) and 10.4% (11/105), respectively, were infected with previously unidentified phytoplasma isolates in 2008. In 2009, 14.2%

(77/540) and 19.4% (66/339) of the phytoplasma-infected leafhoppers from Celeryville and Hartville, respectively, were infected with unidentified phytoplasma isolates (Table

14). Amongst the phytoplasma-infected plant samples collected in 2009, 14.7% (13/88) from Celeryville were infected with unidentified phytoplasma isolates. In Hartville, 61

28.1% (54/192) were infected with previously unidentified aster yellows phytoplasma isolates (Table 14).

Nucleotide sequence analysis of unidentified phytoplasmas isolates.

The 16SrRNA sequences of unidentified isolates from ten leafhoppers and five plants collected from Celeryville, and nine leafhoppers and five plants from Hartville were determined. After the pairwise distance was calculated between the different isolates, the

29 isolates from both locations were divided into 16 sequence types (Table 15). Eight sequence types originated in Celeryville. Sequence type (3) contained eight identical isolates (SE9, SE12, SE39, SE20, SE7 SE33, SE16, and SE37). Sequence type 5, 6, 7, 8,

9, 10, 11 each included one unique isolate (SE11, SE21, SE29, SE10, SE38, SE18 and

SE27, respectively). Eight sequence types were also identified amongst leafhoppers and plants collected in Hartville. Sequence type (1) contained two identical isolates (SE5 and

SE26), sequence type (2) consisted of four identical isolates (SE13, SE14, SE22 and

SE36), sequence type (4) consisted of three identical isolates (SE4, SE31 and SE35), and sequence types 12, 13, 14, 15, 16 each contained one unique isolate (SE6, SE19, SE30,

SE3 and SE8, respectively). One isolate from each sequence type (SE26, SE36, SE20,

SE4, SE11, SE21, SE29, SE10, SE38, SE18, SE27, SE6, SE19, SE30, SE3 and SE8) was selected to represent its type in the phylogenetic analysis.

Phylogenetic analysis of unidentified phytoplasmas isolates.

A BLAST search using partial sequences from the 16SrRNA gene of these sixteen isolates showed they shared 99.3% sequence identity with phytoplasma reference strains from aster yellows phytoplasmas group 16Sr-I, and closely aligned to phytoplasma strains from subgroups 16SrI-A and 16SrI-B. Nucleotide sequences from positions 206 to 1342 (1136 bp) within the 16SrRNA gene of the sixteen isolates were aligned with the

GenBank sequences of 10 representative aster yellows phytoplasma strains from various crops (Table 16). Six isolates (SE3, SE6, SE8 from Hartville; SE21, SE27, SE38 from

Celeryville) belonged to subgroup 16SrI-A and ten isolates (SE4, SE19, SE26, SE30,

SE36 from Hartville; SE10, SE11, SE18, SE20, SE29 from Celeryville) belonged to subgroup 16SrI-B. Some of the subgroup 16SrI-B isolates were found in both leafhoppers and plants, but this was not observed for subgroup 16SrI-A isolates (Table

15).

The sequence identity between the isolates belonging to subgroups 16SrI-A and the isolates belonging to subgroup 16SrI-B was 99.7% and 99.4%, respectively. The sequence identity between the six 16SrI-A isolates was 99.1%, while between the ten

16SrI-B isolates it was 99.3%. In a pairwise comparison between the six 16SrI-A isolates

(SE3, SE6, SE8, SE21, SE27 and SE38) and the 16Sr-I group reference strains, these six isolates shared 99.0-99.8% nucleotide sequence identity with the reference strains that included carrot phytoplasma ca2006/1 (EU215424), aster yellows phytoplasma

99UW111 (AF268408), aster yellows phytoplasma ParsD3 (AY180940) and aster

63 yellows witch‟s-broom (AY389828). In a pairwise comparison between the ten 16SrI-B isolates (SE4, SE10, SE11, SE18, SE19, SE20, SE26, SE29, SE30 and SE36) and the

16Sr-I group reference strains, these ten isolates shared 99.1-99.6% nucleotide sequence identity with reference strains that included severe aster yellows SAY (AF222063), aster yellows phytoplasma bolt white (AY389820), aster yellows severe (AY389824), aster yellows bolt distortion no. 2 (AY389826) and aster yellows phytoplasma ParsD1

(AY180954). Phylogenetic analysis of these sixteen aster yellows phytoplasma isolates generated one neighbor-joining tree based on their 16SrDNA gene sequence. The phylogenetic tree resolved two distinct subclades, which corresponding to subgroup

16SrI-A and 16SrI-B (Figure 16). The phylogenetic tree showed that six isolates (SE3,

SE6, SE8, SE21, SE27 and SE38) were clustered with reference strains from 16SrI-A subgroup while ten isolates (SE4, SE10, SE11, SE18, SE19, SE20, SE26, SE29, SE30 and SE36) were clustered with reference strains from the 16SrI-B subgroup (Figure 16).

Discussion

Aster yellows phytoplasma disease causes problems sporadically in vegetable production areas in Ohio. In some years, major damage to vegetable crops, primarily lettuce, occurs and losses can reach 100% in individual fields. In other years, infection rates may be as low as 2-3% (Hoy et al. 1992 and Madden et al. 1995). Vegetable growers control this disease differently, in that some spray insecticide once they notice the aster leafhoppers in their fields, while others spray insecticide on a regular basis regardless of leafhopper presence (Hoy et al. 1992 and Beanland et al. 2000). 64

Alternative approaches to disease management include controlling the leafhopper population only when they are known to be infected with aster yellows (Hoy et al. 1992;

Mahr et al. 1993 and Murral 1994) and cultural practices such as timing and arrangement of lettuce crop plantings throughout the season to reduce the spread of the disease from one planting to the next (Hoy et al. 1999; Zhou et al. 2003).

Different symptoms of aster yellows disease have been observed in lettuce fields, depending mainly on the aster yellows phytoplasma strains present (Errampalli and

Fletcher 1991 and Murral et al. 1996). To date, four different strains of aster yellows phytoplasma have been detected, isolated and identified in Ohio based on different symptoms they cause in lettuce: aster yellows Witches‟-Broom (AY-WB) (16SrI-A), which causes chlorosis, wilting and witches‟-broom, and aster yellows severe (AY-S)

(16SrI-B), which causes stunting, chlorosis, phyllody and virescence (D‟Arcy and Nault

1982; Hoy et al. 1992 and Murral et al. 1994). Moreover, aster yellows bolt white (AY-

BW) (16SrI-B) induces chlorosis of newly emerging leaves, and aster yellows bolt distortion no. 2 (AY-BD2) (16SrI-B) causes leaf and stem distortion (Zhang et al. 2004).

Molecular markers for these four aster yellows phytoplasma strains have been developed

(Zhang et al. 2004).

In order to better describe aster yellows phytoplasma strain distribution in lettuce production areas, we developed a multiplex assay optimized from previously existing strain-specific primers to identify aster yellows phytoplasma strains in samples collected

65 from leafhopper and lettuce plants. Initially, we assessed strain distribution temporally, geographically and by host (from which leafhoppers were collected) only in aster leafhoppers. In the second year, in addition to the aster leafhoppers, three lettuce types

(red leaf, green leaf and romaine) highly susceptible to aster yellows, cilantro and parsley were sampled randomly and tested for the presence of different strains of aster yellows phytoplasma. In the last 5 years, cilantro and parsley plantings in Ohio lettuce production areas have increased. We proposed that these herbaceous crops might serve as an additional host for the aster yellows phytoplasma and as sources of inoculum (reservoir) for the disease, which has not been considered in the model of aster yellows epidemiology (Zhou et al. 2003).

While all types of lettuce plants showed typical aster yellows phytoplasma disease symptoms, cilantro and parsley were asymptomatic. There has been only one report of wild cilantro exhibiting witches‟-broom symptoms (Lebsky and Poghosyan 2007) and another that showed that parsley exhibits virescense and phyllody in the flowering stage

(Lee et al. 2003). In both studies, the cilantro and parsley were not intended for human consumption (treated as weeds), and allowed to flower, at which point aster yellows symptoms appeared. Cultivated cilantro and parsley are not allowed to flower in our sampled area, which can explain the lack of observation of disease symptoms. However, while these crops were asymptomatic, the proportion of plants infected with aster yellows phytoplasma was not significantly different from that observed in the lettuce. Further, the total number of leafhoppers detected in cilantro and parsley was not significantly

66 different from the number detected in red leaf and green leaf lettuce. Therefore, it is very likely that parsley and cilantro play an important and previously unrecognized role as inoculum reservoirs for aster yellows phytoplasmas within the lettuce fields in this region. Weeds that surround vegetable production areas and survive inside irrigation ditches may also serve as reservoirs for phytoplasmas (Iranoff et al. 1944, Lee et al.

1998, Lee et al. 2003, Weintraub and Beanland 2006). Langer et al. (2003) stated that the weed composition around lettuce fields not only affects the levels of aster leafhopper infection with phytoplasmas but also affects the incidence and spread of the disease.

Over both years and in both locations, there was a significant increase in the total number of aster leafhoppers collected as the growing season progressed, especially in the month of August. Further, leafhopper populations were higher in romaine lettuce than in the other types of lettuce, cilantro and parsley. During the growing season of 1989 and

1990, Hoy et al. (1992) surveyed both locations (Celeryville and Hartville, Ohio), planted with vegetable crops lettuce, carrot and celery, for the presence of immigrant aster leafhoppers. Hoy documented that populations of leafhoppers were higher in July than

June and varied in the month of August. The proportion of phytoplasma-infected individuals was low within the immigrant leafhopper population early in the season, although some were also inoculative upon arrival in Ohio. During the growing season of

2008 and 2009, the proportion of leafhoppers infected with aster yellows phytoplasma was high in June and July and declined by the end (September) of the growing season.

This agrees with a previous survey conducted during 2001 and 2002, in which the

67 percentage of leafhoppers migrating from the southern United States to southern

Manitoba, Canada and captured in carrot fields was high in June and July and declined by the end of the growing season (Wally et al. 2004). Further, the proportion of immigrant aster yellows-infected leafhoppers detected was higher early in the season than at the end.

These results suggest that host plant infection with aster yellows phytoplasma from inoculative leafhoppers peaked early in the growing season, rather than middle or late season, because of the high proportion of phytoplasma-infected immigrant leafhoppers.

Therefore, management may require spraying insecticides to significantly reduce leafhopper populations in the early part of the growing season (May, June). However, this approach should be based on early testing of immigrant leafhoppers to determine their phytoplasma infection levels.

It is possible that changes in environmental conditions such as earlier onset of warming temperatures in the spring observed recently (Baldocchi et al. 2005 and Kelaine et al. 2007) have increased the ability of leafhoppers to acquire the phytoplasma from host plants along the route of migration. In Ohio, Murral et al. (1996) found that more than 60% of aster leafhoppers acquired different strains of aster yellows phytoplasmas when the temperature was between 25-32°C, decreasing to less than 30% when the temperature was under 20°C. These results suggest a positive correlation between local temperature and the efficiency of acquisition of the aster yellows phytoplasma. The increase of acquisition efficiency by leafhoppers enhances its ability to transmit the phytoplasma at higher rates, which increases the spread of the disease. Bale et al. (2002)

68 stated that the main effect of climate change on insects is the increase in temperature, which directly affects their feeding behavior, their fecundity and longevity. In Europe,

Flavescence dorée disease of grapevines, caused by phytoplasmas from elm yellows group and vectored by leafhoppers (Scaphoideus titanus Ball), was reported in epidemic proportions in France, Spain and Portugal (Bertin et al. 2007). There was a noticeable increase of its vector activity and population density when winters were mild in these regions. Further, the leafhopper S. titanus populations increased within its geographical distribution and successfully established new habitats out of its range. The authors theorized that the increase in temperature enhanced migration activity of the vector

(Parmesan, 2006). Bois noir disease of grapevines, which is caused by phytoplasmas from the stolbur group (Daire et al. 1993), is transmitted solely from wild herbaceous plants (bindweed) to grapevine by planthoppers (Hyalesthes obsoletus Signoret)

(Maixner et al. 1995). In German wine-growing areas, H. obsoletus acquire phytoplasmas exclusively from bindweed (Convolvulus arvensis) and transmit them to grapevines (Langer and Maixner 2004). But with a mild winter in 2003, the population of planthoppers increased in the following summer and started to harbor stinging nettle

(Urtica dioica) as a new host plant with a prolonged feeding period (Boudon-Padieu et al. 2007). Usually, the stinging nettle population is delayed 2-3 weeks compared to bindweed population, but with the increase of the yearly mean temperature (Lüers 2003) the nettle population had a prolonged growth period, which explains the recent exploitation of it as an additional host plant for Bois noir disease (Menzel et al. 2003 and

Boudon-Padieu et al. 2007).

There were no significant differences in the distribution of aster yellows phytoplasma strains from subgroup 16SrI-A or 16SrI-B in aster leafhoppers in either location. A previous study showed that leafhoppers infected with aster yellows strain AY-WB

(subgroup 16SrI-A) produced more nymphs than those infected with strain AY-S

(subgroup 16SrI-B) (Beanland et al. 2000). We found that strain AY-S was rare in leafhoppers and plants in both years and both locations, supporting the previous work.

However, other strains in subgroup 16SrI-B were abundant in leafhoppers and plants in this study and other studies have shown a predominance of strains in subgroup 16SrI-B

(Marcone et al. 2000 and Lee et al. 2000, 2003). Therefore, it is possible that the differences observed by Beanland et al. (2000) were unrelated to current taxonomic grouping.

Unidentified phytoplasma isolates (a total of 207) were collected from plants and aster leafhoppers associated with these plants and were sequenced based on their

16SrRNA gene. Sixteen strain types from a total of 29 isolates with 4 nt differences were identified and typed to subgroup 16SrI-A and 16SrI-B. Half of these isolates were collected from cilantro and parsley plants and leafhoppers from fields that were infected with subgroup 16SrI-A and 16SrI-B strains as well. These previously unreported isolates of aster yellows might play an important role in the aster yellows epidemic in lettuce crops in this region.

In addition, some of these isolates belonging to subgroup 16SrI-B were detected in both infected leafhoppers and plants, but none of the isolates belonging to subgroup

16SrI-A was detected in both. These results suggest that these newly detected phytoplasma isolates belonging to subgroup 16SrI-B might also be more widespread in the lettuce fields than subgroup 16SrI-A isolates. While Marcone et al. (2000) observed that subgroup 16SrI-B was the most dispersed and widespread subgroup of aster yellows phytoplasmas in America, Europe and Asia, Wally et al. (2008) found that subgroup

16SrI-A was more common than subgroup 16SrI-B in Canada. Additional studies are needed to clarify the biological relevance of 16SrI subgroup classification for aster yellows phytoplasma strains.

Primer Sequence (5‟-3‟) Reference Amplicon Size (bp) Specificity

P1 AAGAGTTTGATCCTGGCTCAGGATT Deng and Hiruki (1991) 1784 Phytoplasma

P7 CGTCCTTCATCGGCTCTT Smart et al. 1996 F2n GAAACGACTGCTAAGACTGG

Lee et al. 1992 1239 Phytoplasma R2 TGACGGGCGGTGTGTACAAACCCCG

Table 6. Universal primer sets used to identify phytoplasma in aster leafhoppers, lettuce, cilantro and parsley.

Location GPS Coordinates Sampling Date Crop Type1 41°00'N, 82°45'W June 24, 2008; August 20, 2008; July 17, 2009 RL, GL, R, C, P 41°00'N, 82°44'W July 18, 2008; August 8, 2008; July 9, 2009 RL, GL, R, C, P

41°00'N, 82°43'W June 24, 2008; August 24, 2009 RL, R, C 41°01'N, 82°44'W August 20, 2008; July 7, 2009 RL, GL, R., C, P Celeryville, OH 41°00'N, 82°44'W September 25, 2008; July 17, 2009 RL, GL, R, C, P 41°01'N, 82°43'W August 20, 2008; June 18, 2009; RL, GL, R., C., P 41°00'N, 82°45'W June 24, 2008; July 7 and 14, 2009 RL, GL, C, P

41°01'N, 82°45'W June 24, 2008; July 25, 2009 RL, GL, R, C, P 41°01'N, 82°42'W July 18, 2008; August 10, 2009 RL, GL, C, P 41°00'N, 82°41'W July 18, 2008; August 27, 2009; September 17, 2009 RL, R, C, P 41°01'N, 82°41'W June 24, 2008; September 10, 2009 GL, R, C, P

7 40°58N, 81°17'W June 26, 2008; July 9, 2009 RL, GL, R, C, P 3 40°57'N, 81°17'W July 10, 2008; July 17, 2009 RL, GL, R., C, P 72 41°57'N, 81°16'W August 1, 2008; August 24, 2009 RL, GL, R, C, P 40°58'N, 81°16'W August 15, 2008; July 9, 2009 RL, GL, R, C 40°59'N, 81°17'W July 10, 2008; September 3, 2008; August 17, 2009 RL, R, C, P Hartville, OH 40°58'N, 81°15'W August 1, 2008; June 25, 2009 RL, GL, R, C, P

40°57'N, 81°15'W August 1, 2008; July 9, and 17, 2009 RL, GL, R, C, P 41°59'N, 81°16'W July 10, 2008; August 12, 2009 RL, GL, C, P 40°58'N, 81°18'W July 10, 2008; August 24, 2009 RL,GL, R, P 41°57'N, 81°18'W August 1, 2008; September 3, 2009 GL, R,C, P 40°58'N, 81°17'W July 10, 2008; September 18, 2009 RL, C, P

1 RL: Red leaf lettuce; GL: Green leaf lettuce; R: Romaine; C: Cilantro; P: Parsley.

Table 7. Sampling date and GPS coordinates of fields in OH from which leafhopper and plant samples were collected in 2008 and 2009.

Figure 12. Sensitivity of PCR detection of aster yellows phytoplasma strain AY-WB- infected leafhoppers in pooled samples. Samples were assayed by nested PCR using the universal phytoplasma primers P1/P7 followed by universal primers F2n/R2. Lane M, 1-Kb plus ladder; Lane 1, AY-WB (positive control); Lanes 2-10, samples with different ratios of DNA extracts from AY-WB-infected (AY) and non-infected (N) leafhoppers: 2, 8N; 3, 1AY:7N; 4, 2AY:6N; 5, 3AY:5N; 6, 4AY:4N; 7, 5AY:3N; 8, 6AY:2N; 9, 7AY:1N; 10, 8AY; 11, non-infected leafhoppers (negative control).

200 180 160 140 120 100 Red leaf 80 Green leaf 60 40 Romaine 20 Cilantro 0

Parsley

July July July July

June June June June

August August August August

September September September September

Celeryville 2008 Celeryville 2009 Hartville 2008 Hartville 2009

Figure 13. Numbers of leafhoppers collected from lettuce, cilantro and parsley fields in Celeryville and Hartville, Ohio during summer 2008 and 2009.

Location Year Vector / Plant Host Samples Collected Nested PCR Multiplex PCR Tested +Phytoplasma -Phytoplasma Tested 16SrI-A16SrI2 -B2 -Aster yellows3 ALH RL1 360 275 184 91 82 4 40 38 2008 ALH GL 329 135 69 66 36 4 20 12 ALH R 330 195 132 63 53 4 24 25 Celeryville ALH C 192 65 43 22 31 2 8 21 ALH P 115 65 57 8 42 1 4 37 ALH RL 352 352 226 126 114 63 42 9 2009 ALH GL 349 349 260 89 130 57 56 17 ALH R 454 454 327 127 163 31 132 0 ALH C 291 291 172 119 86 57 16 13 ALH P 242 242 94 148 47 32 8 7 RL 200 200 77 123 38 5 31 2 2009 GL 136 136 38 98 19 0 17 2 R 176 176 16 160 8 3 4 1 C 160 160 16 144 8 2 4 2

6 P 146 146 30 116 15 3 6 6

1ALH: Aster leafhopper; RL: Red leaf lettuce; GL: Green leaf lettuce; R: Romaine; C: Cilantro; P: Parsley; 2 Aster yellows phytoplasma subgroups 16SrI-A and subgroup 16SrI-B detected by multiplex PCR assays; 3 total numbers of samples that tested negative with aster yellows phytoplasma strain-specific primers in the multiplex PCR assay.

Location Year Vector / Samples Nested PCR Multiplex PCR Plant Host Collected Tested +Phytoplasma -Phytoplasma Tested 16SrI-A2 16SrI-B2 -Aster yellows3 ALH RL1 265 106 70 36 37 5 13 19 2008 ALH GL 180 60 56 4 33 9 16 8 ALH R 534 299 234 65 97 4 31 62 Hartville ALH C 100 30 20 10 14 1 10 3 ALH P 95 30 15 15 15 1 4 10 ALH RL 448 448 170 278 85 12 46 27 2009 ALH GL 376 376 162 214 81 25 42 14 ALH R 328 328 172 156 86 13 62 11

7 ALH C 236 236 118 118 59 9 45 5 ALH P 250 250 56 194 28 1 18 9 RL 219 219 88 131 44 10 23 11 2009 GL 232 232 102 130 51 15 19 17 R 179 179 98 81 49 14 22 13 C 166 166 36 130 18 2 11 5 P 152 152 60 92 30 6 16 8

Figure 14. Healthy (left) and aster yellows-infected (right) romaine lettuce in Hartville, Ohio.

Figure 15. Healthy (left, right) and aster yellows-infected (center) green leaf lettuce, Celeryville, Ohio.

Fixed Total Proportion of Proportion of Proportion of Proportion of Proportion of Proportion of effects ALH1 aster yellows 16SrI-A 16SrI-B AY-S2 AY-BD22 AY-BW2 collected phytoplasma- (AY-WB)2 infected

0 ALH Plants ALH Plants ALH Plants ALH Plants ALH Plants ALH Plants Crop 0.006 0.5929 0.3509 0.5119 0.6764 0.0353 0.7688 0.4747 0.4349 0.1123 0.2523 0.8694 0.4570 Time 0.0001 0.0006 0.0103 0.0187 0.5155 0.0001 0.0112 0.4682 0.6042 0.0214 0.0718 0.8431 0.2699 Crop*Time 0.0057 0.6656 0.9782 0.9300 0.8298 0.0956 0.8258 0.4325 0.4805 0.0012 0.9153 0.9654 0.9645

1ALH: Aster leafhopper; 2AY-WB: aster yellows witches‟-broom; AY-S: aster yellows severe; AY-BD2: aster yellows bolt distortion no. 2 and AY-BW: aster yellows bolt white.

Percentage of aster Percentage Percentage Percentage yellows phytoplasma- of of of Sampling infected leafhoppers 16SrI-A 16SrI-B AY-BD2 Time (AY-WB) (16SrI-B)

June 69.5 a 9.7 ab 6.8 bc 24.2 a July 68.0 a 16.1 a 14.1 b 34.9 a August 44.9 b 9.8 ab 27.8 a 39.4 a September 36.5 b 3.5 b 3.6 c 8.0 b

Table 11. Mean estimates of the effect of sampling time over the growing seasons on the percentage of aster yellows phytoplasma-infected leafhoppers collected in Ohio lettuce, cilantro and parsley fields and on the percentage of phytoplasmas belonging to 16SrI subgroup A and B, and identified as strain AY-BD2 (also 16SrI-B). Values in each column followed by the same letter are not significantly different at p = 0.05.

Percentage of aster Percentage of yellows phytoplasma- 16SrI-B Sampling Time infected plants June 30.2 a 36.2 a July 39.1 a 26.2 a

August 42.5 a 27.1 a

September 6.5 b 5.5 b

Year 2008 2009 Host Leafhopper Leafhopper Plant Aster 16SrI-A 16SrI-B 16SrI-A 16SrI-B 16SrI-A 16SrI-B yellows subgroup strain AY- AY- AY- AY- AY- AY- AY- AY- AY- AY- AY- AY- WB1 S1 BD21 BW1 WB S BD2 BW WB S BD2 BW Celeryville 21.9 0.7 25.3 39.7 47.1 2.9 20.3 14.4 14.7 2.2 45.4 22.7

Hartville 21.0 0 23.8 46.6 17.6 3.2 27.1 32.4 24.4 2.6 17.7 27.0

1AY-WB: aster yellows witches‟-broom; AY-S: aster yellows severe; AY-BD2: aster yellows bolt distortion no. 2 and AY-BW: aster yellows bolt white.

Table 13. Percentages of the aster yellows phytoplasma strains detected in leafhoppers and lettuce, cilantro and parsley crops in Ohio.

Location Number of unidentified isolates Celeryville Total Hartville Total

Host 2008 2009 2008 2009 Leafhopper 35 77 112 11 66 77 Plant - 13 13 - 54 54

Table 14. Number of unidentified phytoplasma isolates collected from leafhoppers and plants samples in Celeryville and Hartville over the growing season in 2008 and 2009.

Aster Location Place of Natural Host Sequence 16SrI- Yellows Isolation Type Subgroup IsolatesSE5 Plant Hartville Cilantro Sequence type 16SrI-B SE26 ALH 1 SE13 ALH SE14 Hartville Romaine Sequence type 16SrI-B SE22 Plant lettuce 2 SE36 SE9 ALH SE12 Celeryville Red leaf Sequence type 16SrI-B SE39SE7 Plant lettuce 3 SE20SE33 SE16SE4 Plant Hartville Parsley Sequence type 16SrI-B SE37SE31 4 SE35 ALH

SE11 ALH Celeryville Cilantro Sequence type 16SrI-B 5 SE21 ALH Celeryville Green leaf Sequence type 16SrI-A lettuce 6 SE29 ALH Celeryville Red leaf Sequence type 16SrI-B lettuce 7 SE10 ALH Celeryville Parsley Sequence type 16SrI-B 8 SE38 Plant Celeryville Cilantro Sequence type 16SrI-A 9 SE18 Plant Celeryville Romaine Sequence type 16SrI-B lettuce 10 SE27 Plant Celeryville Parsley Sequence type 16SrI-A 11 SE6 ALH Hartville Cilantro Sequence type 16SrI-A 12 SE19 ALH Hartville Romaine Sequence type 16SrI-B lettuce 13 SE30 ALH Hartville Green leaf Sequence type 16SrI-B lettuce 14 SE3 Plant Hartville Parsley Sequence type 16SrI-A 15 SE8 Plant Hartville Red leaf Sequence type 16SrI-A lettuce 16

Table 15. Classification of the unidentified phytoplasma isolates present in lettuce, cilantro and parsley plants and aster leafhoppers collected from Celeryville and Hartville, Ohio.

Phytoplasma Place of Natural 16SrI- Accession Location Reference Strains Isolation Host Subgroup Number AY-WB Ohio, Lettuce 16SrI-A AY389828 1-1534 Zhang et USA al. 2004 AY-BW Ohio, Lettuce 16SrI-B AY389820 1-1830 Zhang et USA al. 2004 AY-S Ohio, Lettuce 16SrI-B AY389824 1-1830 Zhang et USA al. 2004 AY-BD2 Ohio, Lettuce 16SrI-B AY389826 1-1830 Zhang et USA al. 2004 Severe aster California, Celery 16SrI-B AF222063 1-1830 Kuske and yellows USA Kirkpatrick (SAY) 1992 Carrot Serbia Carrot 16SrI-A EU215424 1-1720 Duduk et Phytoplasma al. 2009 (ca2006/1) Tomato Italy Tomato 16SrXII- EF193364 1-1222 Martini et stolbur A al. 2007 phytoplasma (PTV strain) Aster Wisconsin, Carrot 16SrI-A AF268408 1-1824 Lee et al. yellows USA 2002 (99UW111) Aster yellow Texas, Parsley 16SrI-B AY180954 1-1528 Lee et al. phytoplasma USA 2003 (ParsD1) Aster yellow Texas, Parsley 16SrI-A AY180940 1-1528 Lee et al. phytoplasma USA 2003 (ParsD3)

Table 16. Phytoplasma reference strains used in the phylogenetic analysis based on their 16SrRNA sequence retrieved from the GenBank database.

SE36 A. yellows phytoplasma AY-S (AY389824) A. yellows phytoplasma SAY (AF222063) A. yellows phytoplasma AY-BW (AY389820) SE18 SE10 SE29 16SrI-B SE20 88 A. yellows phytoplasma AY-BD2 (AY389826) SE11 SE26 SE4 SE30 SE19 84 A. yellows phytoplasma ParsD1 (AY180954) SE6

8 SE3

6 SE8 SE21 SE27 64 A. yellows phytoplasma ParsD3 (AY180940) 16SrI-A C. phytoplasma sp. ca2006/1 (EU215424) A. yellows phytoplasma 99UW111(AF268408) SE38 A. yellows phytoplasma AY-WB (AY389828) T. stolbur phytoplasma PTV (EF193364) Figure 16. Phylogenetic tree of aster yellows unidentified isolates constructed by neighbor-joining analysis of partial length of 16SrRNA sequences collected from vegetable crops: lettuce (vars. red, green and romaine), cilantro and parsley; aster leafhoppers collected from lettuce, cilantro and parsley plants from Celeryville and Hartville in 2008 and 2009; and reference strains: AY-S (16SrI-B), SAY (16SrI-B), AY-BW (16SrI-B), AY-BD2 (16SrI-B), ParsD1 (16SrI-B), 99UW111 (16SrI-A), ca2006/1 (16SrI-A), AY-WB (16SrI-A), ParsD3 (16SrI-A); employing tomato stolbur phytoplasma as the 86 outgroup.

Bibliography

Ahrens, U. and Seemüller, E. 1992. Detection of DNA of plant pathogenic mycoplasmalike organisms by a polymerase chain reaction that amplifies a sequence of the 16SrRNA gene. Phytopath. 82:828-832.

Ahrens, U., and Seemüller, E. 1994. Detection of mycoplasmalike organisms in declining oaks by polymerase chain reaction. Eur. J. For. Path. 24:55-63.

Ahrens, U., Lorenz K. H., and Seemüller, E. 1993. Genetic diversity among mycoplasma like organisms associated with stone fruit diseases. Mol. Plant-Microbe Interact. 6:686-91.

Ali, M., Chikh, M. T., Natsuaki, K. T., Natsuaki, T. 2010. The simultaneous differentiation of Potato virus Y strains including the newly described strain PVYNTN-NW by multiplex PCR assay. J. Virol. Methods 165:15-20.

Alma, A., Marzachì, C., d'Aquilio, M. and Bosco, D. 2000. Cyclamen (Cyclamen persicum L.): a dead-end host species for 16Sr-IB and -IC subgroup phytoplasmas. Ann Appl. Biol. 136:173-178.

Al-Saady, N. A., Khan, A. J., Calari, A., Al-Subhi, A. M. and Bertaccini, A. 2008. Candidatus phytoplasma omanense, associated with witches‟-broom of Cassia italica (Mill.) Spreng. in Oman. Int. J. Syst. Evol. Microbiol. 58:461-466.

Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W. and Lipman, D. J. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389–3402.

Ammar, E. D. and Hogenhout, S. A. 2006. Mollicutes associated with arthropods and plants. In: Insect Symbiosis, Vol. 2, Eds. Kostas, B. and Miller, T., pp. 97-118. CRC Press, Taylor and Francis Group, Boca Raton, FL., USA.

Anfoka, G. H., and Fattash, I. 2004. Detection and Identification of Aster Yellows (16SrI) Phytoplasma in Peach Trees in Jordan by RFLP Analysis of PCR- Amplified Products (16SrDNAs). J. Phytopath. 152:210-214.

Arocha, Y., Antesana, O., Montellano, E., Franco, P., Plata, G., and Jones, P. 2007. „Candidatus Phytoplasma lycopersici‟, a phytoplasma associated with „hoja de perejil‟ disease in Bolivia. Int. J. Syst. Evo. Microbiol. 57:1704-1710. 87

Backus, E. A., Serrano, M. S., and Ranger, C. M. 2005. Mechanisms of hopper burn: an overview of insect taxonomy, behavior, and physiology. Ann. Rev. Entomol. 50:125-51.

Bai, X., Correa, V. R., Toruño, T. Y., Ammar, E. D., Kamoun, S. and Hogenhout, S. A. 2009. AY-WB phytoplasma secretes a protein that targets plant cell nuclei. Mol. Plant Microbe Interact. 22:18-30.

Bai, X., Zhang, J., Ewing, A., Miller, S. A., Jancso Radek, A., and Shevchenko, D. V. 2006. Living with genome instability: the adaptation of phytoplasmas to diverse environments of their insect and plant hosts. J. of Bacteriol. 188: 3682-3696.

Beanland, L., Hoy C. W., Miller S. A., and Nault, L. R. 1999. Leafhopper (Homoptera: Cicadellidae) transmission of aster yellows phytoplasma: does gender matter? Env. Ento. 28:1101-1106.

Beanland, L., Hoy, C. W., Miller, S. A. and Nault, L. R. 2000. Influence of aster yellows phytoplasma on the fitness of aster leafhopper (Homoptera: Cicadellidae). Ann. Ento. Soc. Am. 93:271-276.

Beanland, L., Madden, L. V., Hoy, C. W., Miller, S. A. and Nault, L. R. 2005. Temporal distribution of aster leaf hopper sex ratios and spatial pattern of aster yellows phytoplasma disease in Lettuce. Ann. Ento. Soc. Am. 98:756-762.

Bedendo, I. P., Davis, R. E., Dally, E. L. 2000. Detection and identification of the maize bushy stunt phytoplasma in corn plants in Brazil using PCR and RFLP. Int. J. Pest Manag. 46:73-76.

Berges, R., Cousin, M. T., Roux, J., Maurer, R., and Seemüller, E. 1997. Detection of phytoplasma infections in declining Populus nigra 'Italica' trees and molecular differentiation of the aster yellows phytoplasmas identified in various Populus species. Eur. J. Forest Path. 27:33-43.

Bertaccini, A. 2007. Phytoplasmas: diversity, taxonomy, and epidemiology. Frontiers in Bioscience. 12:673-689.

Bertaccini, A., Mittempergher, L., and Vibio, M. 1996. Identification of phytoplasmas associated with a decline of European hackberry (Celtis australis). Ann. Appl. Bio. 128:245-253.

Bertaccini, A., Vibio, M., Stefani, E. 1995. Detection and molecular characterization of phytoplasmas infecting grapevine in Liguria (Italy). Phytopath. Mediterr.34:137- 41. 88

Bertaccini, A., Vorackova, Z., Vibio, M., Franova, J., Navratil, M., Spak, J., and Nebesarova, J. 1998. Comparison of phytoplasmas infecting winter oilseed rape in the Czech Republic with Italian Brassica phytoplasmas and their relationship to the aster yellows group. Plant Path. 47:317-32.

Bertolini, E., Torres, E., Olmos, A., Martin, M. P., Bertaccini, A., and Cambra, M. 2007. Co-operational PCR coupled with dot blot hybridization for detection and 16SrX grouping of phytoplasmas. Plant Path.56: 677-682.

Blomquist, C. L., Kirkpatrick, B. C. 2002. Identification of phytoplasma taxa and insect vectors of peach yellow leaf roll disease in California. Plant Disease 86:759-63.

Bosco, D., Minucci, C., Boccardo, G. and Conti, M. 1997. Differential acquisition of chrysanthemum yellows phytoplasma by three leafhopper species. Ento. Exp. App. 83:219-224.

Botti, S., and Bertaccini, A. 2007. Grapevine yellows in northern Italy: molecular identification of Flavescence dorée phytoplasma strains and of Bois noir phytoplasmas. J. App. Microbiol. 103:2325-2330.

Boudon-Padieu, E. T., Terwisscha Van Scheltinga, T., Lherminier, J. and Caudwell, R. 1986. Elisa and immunofluorescence (IF) detection of the MLO agent of the grapevine flavescence dorée (FD) on individual leafhopper vectors. 6th International Congress of the International Organization for Mycoplasmology, 198.

Boudon-Padieu, E., Larrue, J. and Caudwell, A., 1989. ELISA and Dot-blot detection of Flavescence dorée-MLO in individual leafhopper vectors during latency and inoculative state. Curr. Microbiol. 19:357-364.

Braun, E. J., and Sinclair, W. A. 1979. Phloem necrosis of elms: symptoms and histopathological observations in tolerant hosts. Phytopath. 69:54-358.

Cai, H., Wei, W., Davis, R. E., Chen, H., and Zhao, Y. 2008. Genetic diversity among phytoplasmas infecting Opuntia species: virtual RFLP analysis identifies new subgroups in the peanut witches‟-broom phytoplasma group. Int. J. Syst. Evo. Microbiol. 58:1448-1457.

Canik, D., and Ertunc, F. 2007. Distribution and molecular characterization of apple proliferation phytoplasma in Turkey. Bulletin of Insect. 60:335-336.

Carraro, L., Osler, R., Loi, N., Ermacora, P. and Refatti, E. 1998. Transmission of European stone fruit yellows phytoplasma by Cacopsylla pruni. J. Plant Path. 80:233-239.

Chamberlain, J. S., and J. R. Chamberlain. 1994. Optimization of multiplex PCRs, p. 38- 46. In K. B. Mullis, F. Ferre, and R. A. Gibbs (eds.), The polymerase chain reaction. Birkhauser, Boston, Mass.

Chang, F., Chen, C., and Lin, C. 1995. Monoclonal antibody for the detection and identification of a phytoplasma associated with rice yellow dwarf. Eur. J. Plant Path. 101:511-518.

Chen, K. H., Credi, R. C., Loi, N., Maixner, M., Chen, T. A. 1994. Identification and grouping of mycoplasmalike organisms associated with grapevine yellows and clover phyllody diseases based on immunological and molecular analyses. Appl. Env. Microbiol. 60:1905-13.

Chen, K. H., Guo, J. R., Wu, X., Loi, N., Carraro, L., Guo, Y. H., Chen, Y. D., Osler, R., Pearson, R., and Chen, T. A. 1993.Comparison of monoclonal antibodies, DNA probes, and PCR for detection of the grapevine yellows disease agent. Phytopath. 83:915-22.

Chen, M., and Lin, C. 1997. DNA probes and PCR primers for the detection of a phytoplasma associated with peanut witches'- broom. Eur. J. Plant Path. 103:137- 145.

Chen, T. A., and Jiang, X. F. 1988. Monoclonal antibodies against the maize bushy stunt agent. Can. J. Microbiol. 34:6-11.

Chen, T. A., Lei, J. D. and Lin, C. P. 1992. Detection and identification of plant and insect mollicutes. pp. 393-424. In: The Mycoplasmas. vol. 5. Eds. R. F. Whitcomb and J. G. Tully, New York: Academic Press.

Chiykowski, L. N. 1981. Epidemiology of diseases caused by leafhopper-borne pathogens. In Plant Disease and Vectors, pp. 106-159. Eds. K. Maramorosch and K. F. Harris. New York: Academic Press.

Chiykowski, L. N., and Chapman. K. 1965. Migration of the six spotted leafhopper in Central North America. Wisc. Agric. Exp. Stn. Res. Bull. 261, 21-45.

Christensen, N. M., Nicolaisen, M., Hansen, M., and Schulz, A. 2004. Distribution of phytoplasmas in infected plants as revealed by real-time PCR and bioimaging. Mol. Plant-Microbe Int. 17:1175-84.

Chung, B. N., Kim, J. S. and Cheong, S. R. 2007. Phytoplasma-associated Shoot Proliferation and Leaf Yellowing in Lettuce. Plant Path. J. 23:151-154.

Clark, M. F., Morton, A., and Buss, D. L. 1989. Preparation of MLO immunogens from plants and a comparison of polyclonal and monoclonal antibodies made against primula yellows MLO-associated antigens. Ann. Appl. Biol. 114:111-124.

Cousin, M. T., Sharma, A. K. and Misra, S. 1986. Correlation between light and electron microscopic observations and identification of mycoplasmalike organisms using consecutive 350 nm thick sections. J. Phytopath. 115:368-374.

D‟Arcy, C. J., and Nault, L. R. 1982. Insect transmission of plant viruses and mycoplasmalike and rickettsialike organisms. Plant Disease 66:99-104.

Daire, X., Clair, D., Larrue, J., Boudon-Padieu, E., Alma, A. 1993. Occurrence of diverse MLOs in tissues of grapevine affected by grapevine yellows in different countries. Vitis 32:247-48.

Daire, X., Clair, D., Reinert, S. W., and Boudon-Padieu, E. 1997. Detection and differentiation of grapevine yellows phytoplasmas belonging to the elm yellows group and to the stolbur subgroup by PCR amplification of non-ribosomal DNA. Eur. J. Plant Path. 103:507-14.

Danielli, A., Bertaccini, A., Vibio, M., Mori, N., Murari, E., Posenato, G., and Girolami, V. 1996. Detection and molecular characterization of phytoplasmas in the planthopper Metcalfa pruinosa (Say) (Homoptera: Flatidae). Phytopath. Medit 35:62-65.

Davies, D. L., and Clark, M. F. 1992. Production and characterization of polyclonal and monoclonal antibodies against peach yellow leaf roll MLO-associated antigens. Acta Hortic. 383:275-83.

Davies, D. L., Barbara, D. J., and Clark, M. F. 1995. The detection of MLOs associated with pear decline in pear trees and pear psyllids by polymerase chain reaction. Acta Hortic. 386:484-88.

Davies, D. L., Guise, C. M., M, Clark, F. and Adams, A. N. 1992. Parry's disease of pears is similar to pear decline and is associated with mycoplasma-like organisms transmitted by Cacopsylla pyricola. Plant Path. 41:195-203.

Davis, M. J., Tsai J. H., Cox, R. L., McDaniel, L. L., and Harrison, N. A. 1988. Cloning of chromosomal and extra-chromosomal DNA of the mycoplasma-like organism that causes maize bushy stunt disease. Mol. Plant-Microbe Interact. 1:295-302. 91

Davis, R. E., and Lee, I. M. 1993. Cluster-specific polymerase chain reaction amplification of 16SrDNA sequences for detection and identification of mycoplasmalike organisms. Phytopath. 83:1008-11.

Davis, R. E., and Sinclair, W.A. 1998. Phytoplasma identity and disease etiology. Phytopathology 88:1372-76.

Davis, R. E., Lee, I. M., Douglas, S. M., and Dally, E. L. 1990. Molecular cloning and detection of chromosomal and extra-chromosomal DNA of the mycoplasma-like organism (MLO) associated with little leaf disease in periwinkle (Catharanthus roseus). Phytopath. 80:789-93.

Deng, S. J., R. J. Forster, C. Hiruki, and R. M. Teather. 1993. Simultaneous amplification and sequencing of genomic DNA (SAS): sequencing of 16S rRNA genes using total genomic DNA from Butyrivibrio fibrisolvents, and detection and genotyping of non-culturable mycoplasmalike organisms directly from total DNA isolated from infected plants. J. Microbiol. Methods 17:103-113.

Deng, S., and Hiruki, C. 1991. Amplification of 16SrRNA genes from culturable and non-culturable Mollicutes. J. Microbiol. Methods.14:53-61.

Doi, Y. M., Teranaka, M., Yora, K., and Asuyama, H. 1967. Mycoplasma or PLT-group- like microorganisms found in the phloem elements of plants infected with mulberry dwarf, potato witches‟ broom, aster yellows, or paulownia witches‟ broom. Ann. Phytopath. Soc. Jpn. 33:259-66.

Drake, D. C., and Chapman, R. K. 1965. Evidence for long distance migration of the six- spotted leafhopper in Wisconsin. Wisconsin Agric. Exp. Stn. Res. Bull. 261:3-20.

Duduk, B., and Bertaccini, A. 2006. Corn with symptoms of reddening: new host of stolbur phytoplasma. Plant Disease 90:1313-1319.

Duduk, B., Bulaji, C. A., Duduk, N., Calari, A., Paltrinieri, S., Krsti, C. B., Bertaccini, A. 2007. Identification of phytoplasmas belonging to aster yellows ribosomal group in vegetables in Serbia. Bulletin of Insect. 60:341-342.

Duduk, B., Calari, A., Paltrinieri, S., Duduk, N. and Bertaccini, A. 2008. Multigene analysis for differentiation of aster yellows phytoplasmas infecting carrots in Serbia 2008. Ann. App. Bio.154:219-229.

Edwards, M. C., and R. A. Gibbs. 1994. Multiplex PCR: advantages, development, and applications. PCR Methods Appl. 3:S65-S75. 92

Efron, D., Nestel, D., and Glazer, I. 2001. Spatial Analysis of Entomopathogenic Nematodes and Insect Hosts in a Citrus Grove in a Semi-Arid Region in Israel. Env. Ento.30:254-261.

Errampalli, D. and Fletcher, J. 1993. Production of mono-specific polyclonal antibodies against aster yellows mycoplasma-like organism-associated antigen. Phytopath. 83:1279-1282.

Errampalli, D., Fletcher, J., and Claypool, P. L. 1991. Incidence of yellows in carrot and lettuce and characterization of mycoplasma-like organism isolates in Oklahoma. Plant Disease. 75:579-84.

Firrao, G., Garcia-Chapa, M. and Marzachì, C. 2007. Phytoplasmas: genetics, diagnosis and relationships with the plant and insect host. Frontiers in Bioscience 12:1353- 1375.

Firrao, G., Gibb, K. and Streten, C. 2005. Short taxonomic guide to the Genus „Candidatus Phytoplasma‟. J. Plant Path. 87:249-263.

Firrao, G., Gobbi, E., and Locci, R. 1993. Use of polymerase chain reaction to produce chain reaction to produce oligonucleotide probes for mycoplasmalike organisms. Phytopath. 83:602-7.

Firrao, G., Gobbi, E., and Locci, R. L. 1994. Rapid diagnosis of apple proliferation mycoplasma-like organism using a polymerase chain reaction procedure. Plant Path. 43:669-74.

Fletcher, J., Wayadande, A. C., Melcher, U. and Ye, F. 1998. The phytopathogenic mollicute-insect vector interface: A closer look. Phytopath. 88:1351-1358.

Fos, A., Danet, J., Zreik, L., Garnier M., and Bové, J. M. 1992. Use of a monoclonal antibody to detect the stolbur mycoplasmalike organism in plants and insects and to identify a vector in France. Plant Disease 76:1092-1096

Gajardo, A., Fiore, N., Prodan, S., Paltrinieri, S., Botti, S., Pino, A. M., Zamorano, A., Montealegre, J., and Bertaccini, A. 2009. Phytoplasmas Associated with Grapevine Yellows Disease in Chile. Plant Disease 93:789-796.

Garcia-Chapa, M., Sabate, J., Lavina, A. and Batlle, A. 2005. Role of Cacopsylla pyri in the epidemiology of pear decline in Spain. Eur. J. Plant Path. 111:9-17.

Gatineau, F., Larrue, J., Clair, D., Lorton, F., Richard- Molard, M., and Boudon-Padieu, E. 2001. A new natural planthopper vector of stolbur phytoplasma in the genus Pentastiridius (Hemiptera: Cixiidae). Eur. J. Plant Path. 107:263-271.

Gibb, K. S. and Padovan, A. 1994. A DNA extraction method that allows reliable PCR amplification of MLO DNA from 'difficult' plant host species. PCR Meth. Appl. 4:56-58.

Gomes, E. A., Jardim, S. N., Guimarães, C. T., Souza, I. R. P., and Oliveira, E. 2004. Genetic variability of Brazilian phytoplasma and spiroplasma isolated from maize plants. Pesq. agropec. bras., Brasília. 39:61-65.

Gomez, G. G., Conci, L. R., Ducasse, D. A. and Nome, S. F. 1996. Purification of the phytoplasma associated with China-tree (Melia azedarach L.) decline and the production of a polyclonal antiserum for its detection. J. Phytopath. 144:473-477.

Goto, M., Honda, E., Ogura, A., Nomoto, A., and Hanaki, K. I. 2009. Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxyl napthol blue. BioTechniques 46:167-72.

Green, M. J., Thompson, D. A., and MacKenzie, D. J. 1999. Easy and efficient DNA extraction from woody plants for the detection of phytoplasmas by polymerase chain reaction. Plant Disease 83:482-485.

Griffiths, H. M., Gundersen, D. E., Sinclair, W. A., Lee, I. M., and Davis, R. E. 1994. Mycoplasmalike organisms from milkweed, goldenrod, and spirea represent two new 16SrRNA subgroups and three new strain subclusters related to peach X- disease. Can. J. Plant Path. 16:255-66.

Griffiths, H. M., Sinclair, W. A., Smart, C. D., and Davis, R. E. 1999. The phytoplasma associated with ash yellows and lilac witches‟ broom: „Candidatus Phytoplasma fraxini‟. Int. J. Syst. Bacteriol. 49:1605-1614.

Grylls, N. E. 1979. Leafhopper vectors and the plant disease agents they transmit in Australia. In: Leafhopper Vectors and Plant Disease Agents, Eds. Maramorosch K., and K.F. Harris, New York: Academic 115a, pp. 179-213.

Gundersen, D. E., Lee, I. M., Rehner, S. A., Davis, R. E. and Kingsbury, D. T. 1994. Phylogeny of mycoplasmalike organisms (phytoplasmas): a basis for their classification. J. Bacteriol. 176:5244-5254.

Gundersen, D. E., Lee, I. M., Schaff, D. A., Harrison, N. A., Chang, C. J., Davis, R. E., and Kingsbury, D.T. 1996. Genomic diversity and differentiation among phytoplasma strains in 16SrRNA groups I (aster yellows and related 94

phytoplasmas) and III (X-disease and related phytoplasmas). Int. J. Sys. Bacteriol. 46:64-75.

Gunderson, D.E.; and Lee, I.M. 1996. Ultrasensitive detection of phytoplasmas by nested-PCR assays using two universal primer pair. Phytopathologia Mediterrranea, 35:144-151.

Guo, Y. H., Cheng, Z. M., and Walla, J. A. 2000. Amplification of the 23S rRNA gene and its application in differentiation and detection of phytoplasmas. Can. J. Plant Path. 22:380-386.

Guo, Y. H., Cheng, Z. M., and Walla, J. A. 2003. Rapid PCR based detection of phytoplasmas from infected plants. Hort. Science 38:1134-1136.

Guo, Y. H., Cheng, Z. M., Walla, J. A., and Zhang, Z. 1998. Diagnosis of X-disease phytoplasma in stone fruits by a monoclonal antibody developed directly from a woody plant. J. Env. Hort. 16:33-37.

Haggis, G. H., and Sinha, R. C. 1978. Scanning electron microscopy of mycoplasmalike organisms after freeze fracture of plant tissues affected with clover phyllody and aster yellows. Phytopath. 68:677-80.

Hanboonsong, C., Choosai, S., Panyim, D. and Damak, S. 2002. Transovarial transmission of sugarcane white leaf phytoplasma in the insect vector Matsumuratettix hiroglyphicus (Matsumura). Insect Mol. Biol. 11:97-103.

Harrison, N. A., and Richardson, P. A. 1994. Comparative investigation of MLOs associated with Caribbean and African coconut lethal decline diseases by DNA hybridization and PCR assays. Plant Disease. 78:507-11.

Harrison, N. A., Richardson, P. A., Tsai, J. H., and Ebbert, M. A. 1996. PCR assay for detection of the phytoplasma associated with maize bushy stunt disease. Plant Disease. 80:263-69.

Heinrich, M., Botti, S., Caprara, L., Arthofer, W., Strommer, S., Hanzer, V., Paltrinieri. 2001. Improved detection methods for fruit tree phytoplasmas. Plant Mol. Biol. Rep.19:169-179.

Henegariu, O., N. A. Heerema, S. R. Dlouhy, G. H. Vance, and P. H. Vogt. 1997. Multiplex PCR: critical parameters and step-by-step protocol. Bio-Techniques 23:504–511.

Higgins D., Thompson J., Gibson T., Thompson J.D., Higgins D.G., and Gibson T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence 95

alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22:4673-4680.

Hiruki, C. and Rocha, A. D. 1986. Histochemical diagnosis of mycoplasma infections in Catharanthus roseus by means of a fluorescent DNA-binding agent, 4'-6'- diamidino-2-phenylindole-HC1 (DAPI). Can. J. Plant Path. 8:185-188.

Hiruki, C. and Wang, K. 2004. Clover proliferation phytoplasma: „Candidatus Phytoplasma trifolii‟. Int. J. Syst. Evo. Microbiol. 54:1349-1353.

Hobbs, H. A., Reddy, D. V. R., and Reddy, A. S. 1987. Detection of a mycoplasma-like organism in peanut plants with witches' broom using indirect enzyme-linked immune-sorbent assay (ELISA). Plant Path. 36:164-167.

Hodgetts, J., Ball, T., Boonham, N., Mumford, R., Dickinson, M. 2007. Use of terminal restriction fragment length polymorphism (T-RFLP) for identification of phytoplasmas in plants. Plant Path. 56:357-65.

Hodgetts, J., Boonham, N., Mumford, R., and Dickinson, M. 2009. Panel of 23S rRNA gene-based real-time PCR assays for improved universal and group-specific detection of phytoplasmas. App. Env. Microbiol. 75:2945-50.

Hodgetts, J., Boonham, N., Mumford, R., Harrison, N., Dickinson, M. 2008. Phytoplasma phylogenetics based on analysis of secA and 23SrRNA gene sequences for improved resolution of candidate species of „Candidatus Phytoplasma‟. Int. J. Syst. Evo. Microbiol. 58:1826-37.

Hogenhout, S. A., and Loria, R. 2008. Virulence mechanisms of gram positive plant pathogenic bacteria. Curr. Op. in. Plant Biol. 11:449-456.

Hogenhout, S. A., Oshima, K., Ammar, E., Kakizawa, S., Kingdom, H., and Namba, S. 2008. Phytoplasmas: bacteria that manipulate plants and insects. Mol. Plant Path. 9:403-423.

Hollingsworth, C. R., Atkinson, L. M., Samac, D. A., Larsen, J. E., Motteberg, C. D., Abrahamson, M. D., Glogoza, P., MacRae, I. V. 2008. Small grain: Region and Field Level Distributions of Aster Yellows Phytoplasma in Small Grain Crops. Plant Disease 92:623-630.

Howard, R. J., Garland, A. J. and Seaman, L.W. 1994. Diseases and pests of vegetable crops in Canada. Can. Phytopath. Soc. Ento. Soc. 144-157.

Hoy, C. W., Heady, S. E., and Koch, T. A. 1992. Species composition, phenology, and possible origins of leafhoppers (Cicadellidae) in Ohio vegetable crops. J. Econ. Ent. 85:2336-43.

Hoy, C. W., Zhou, X., Nault, L. R., Miller, S. A. and Styer, J. A. 1999. Host plant, phytoplasma, and reproductive status effects on flight behavior of aster leafhopper (Homoptera: Cicadellidae). Ann. Ento. Society of America, 92:523-528.

Hren, M., Boben, J., Rotter, A., Kralj, P., Gruden, K., and Ravnikar, M. 2007. Real-time PCR detection systems for Flavescence dorée and Bois noir phytoplasma in grapevine: comparison with conventional PCR detection and application in diagnostic. Plant Path.56:785-796.

Hughes, G. and Madden, L.V. 1994. Aggregation and incidence of disease: Some implications for sampling. Aspects App. Biol. 37:25-31.

Hunt, R. E., Parr, J. C., and Haynes, K. F. 1993. Influence of leafhopper (Homoptera: Cicadellidae) gender and female mating status on plant disease dynamics within a simple habitat. Env. Ent. 22:109-115.

IRPCM Phytoplasma/Spiroplasma Working Team-Phytoplasma taxonomy group 2004. Candidatus Phytoplasma, a taxon for the wall-less, non-helical prokaryotes that colonize plant phloem and insects. Int. J. Syst. Evol. Microbiol. 54:1243-1255.

Irwin, M. E. and Ruesink, W.G. 1986. Vector intensity: a product of propensity and activity. In Plant Virus Epidemics: Monitoring, Modeling and Predicting Outbreaks, pp. 13-33. Eds. G. D. McLean, R. G. Garrett and W. G. Ruesink. New York: Academic Press.

Jarausch, W., Lansac, M., Saillard, C., Broquaire, J. M., and Dosba, F. 1998. PCR assay for specific detection of European stone fruit yellows phytoplasmas and its use for epidemiological studies in France. Eur. J. Plant Path. 104:17-27.

Jiang, H., Wei, W., Saiki, T., Kawakita, H., Watanabe, K., and Sato, M. 2004. Distribution patterns of mulberry dwarf phytoplasma in reproductive organs, winter buds, and roots of mulberry trees. J. Gen. Plant Path. 70:168-173.

Jomantiene, R., Davis, R. E., Maas, J. and Dally, E. L. 1998. Classification of new phytoplasmas associated with diseases of strawberry in Florida, based on analysis of 16S rRNA and ribosomal protein gene operon sequences. Int. J. Syst. Bacteriol. 48:269-277.

Jones, A. L., Hooper, G. R., and Rosenberger, D. A. 1974. Association of mycoplasmalike bodies with little peach and X-disease. Phytopath. 64:755-756.

Jovic, J., Cvrkovi, T., Mitrovi, M., Krnjanji, S., Petrovi, A., Redinbaugh, M. G., Pratt, R. C., Hogenhout, S. A., Toevski, I. 2009. Maize Redness Transmitted by Reptalus panzeri: the Disease Cycle in Serbia. J. Phytopath. 99:1053-1069.

Jung, H. Y., Sawayanagi, T., and Kakizawa, S. 2002. „Candidatus Phytoplasma castaneae‟, a novel phytoplasma taxon associated with chestnut witches‟ broom disease. Int. J. Syst. Evo. Microbiol. 52:1543-1549.

Jung, H. Y., Sawayanagi, T., and Kakizawa, S. 2003. „Candidatus Phytoplasma ziziphi‟, a novel phytoplasma taxon associated with jujube witches‟-broom disease. Int. J. Syst. Evo. Microbiol. 53:1037-1041.

Kawakita, H., Saiki T., Wei W., Mitsuhashi, W., and Watanabe, K. 2000. Identification of mulberry dwarf phytoplasmas in the genital organs and eggs of leafhopper Hishimonoides sellatiformis. Phytopath. 90:909-914.

Khadhair, A. H., Duplessis McAllister, P., Ampong-Nyarko, K., and Bains, P. 2003. Transmission and characterization of phytoplasma diseases associated with infected potato cultivars in Alberta. Acta Horticulturae 619:167-176.

Khadhair, A. H., and Hiruki, C. 1995. The molecular genetics relatedness of willow witches‟-broom phytoplasma to the clover proliferation group. Proceedings of the Japan Academy, Series B, Physical and Biological Sciences 71:145-147.

Khadhair, A. H., Hiruki, C., and Hwang, S. F. 1997a. Molecular detection of alfalfa witches broom phytoplasma in four leafhopper species associated with infected alfalfa plants. Microbiological Research 152:269-275.

Khadhair, A. H., Hiruki, C., and Deyholos, M. 2008. Molecular characterization of aster yellows phytoplasma associated with valerian and sow thistle plants by PCR- RFLP analyses. J. Phytopath. 156:326-331.

Khadhair, A. H., Hwang, S. F., Chang, K. F., and Howard, R. J. 1997b. Molecular identification of aster yellows phytoplasmas in purple coneflower and monarda based on PCR amplification and RFLP analysis of 16SrDNA sequences. Zeitschrift für Pflanzenkrankheiten und Pflanzenschutz. 104:403-410. 98

Khadhair, A. H., Kawchuk, L. M., Taillon, R. C., and Botar, G. 1998. Detection and molecular characterization of an aster yellows phytoplasma in parsley. Can. J. Plant Path. 20:55-61.

Khadhair, A. H., Tewari, J. P., Howard, R. J., and Choban, B. 2001. Association of aster yellows and witches‟-broom phytoplasmas with several hosts in Alberta. Can. J. Plant Path. 23:185.

Khan, Z. R. and Saxena, R. C. 1984. Technique for demonstrating phloem or xylem feeding by leafhoppers (Homoptera: Cicadellidae) and planthoppers (Homoptera: Delphacidae) in rice plant. J. Econ. Ento. 77:550-52.

Kirkpatrick, B. C., Smart, C. D., Gardner, S. L., Gao, L., and Ahrens, U. 1994. Phylogenetic relationships of plant pathogenic MLOs established by 16/23SrDNA spacer sequences. IOM Letter. 3:228-29.

Kirkpatrick, B.C. and Smart, C. D. 1995. Phytoplasmas: can phylogeny provide the means to understand pathogenicity? In: Advances in Botanical Research, eds. Andrews, J. H. and Tommerup, I.C. pp. 188-212. New York: Academic Press.

Kirkpatrick, B. C., Stenger, D. C., Morris, T. J., and Purcell, A. H. 1987. Cloning and detection of DNA from a non-culturable plant pathogenic mycoplasma-like organism. Science 238:197-200.

Kison, H., Schneider, B., and Seemüller, E. 1994. Restriction fragment length polymorphisms within the apple proliferation mycoplasmalike organism. J. Phytopath. 141:395-401.

Kube, M., Schneider, B., Kuhl, H., Dandekar, T., Heitmann, K., Migdoll, A. M., Reinhardt, R., and Seemüller, E. 2008. The linear chromosome of the plant- pathogenic mycoplasma „Candidatus Phytoplasma mali‟. BMC Genomics 9:306.

Kunkel, L. O. 1926. Studies on aster yellows. Am. J. Botany 13:646-705.

Kunkel, L. O. 1941. Heat cure of aster yellows in periwinkles. Am. J. Bot., 28:761-69.

Kunkel, L. O. 1943. Potato witches‟-broom transmission by dodder and cure by heat. Proceedings of the American Phytopathological Society 86: 470-475.

Kunkel, L. O. 1955. Cross-protection between strains of yellows type virus. Adv. Virus. Res. 3:251-273.

Kunkel, L. O. 1957. Acquired immunity to infection by strains of aster yellows virus in aster leafhopper. Science 126:1233.

Kuske, C. R. and Kirkpatrick, B. C. 1992. Phylogenetic relationships between the western aster yellows mycoplasmalike organism and other prokaryotes established by 16S rRNA gene sequence. Int. J. Syst. Bacteriol. 42:226-233.

Langer, M., Darimont, H., and Maixner, M. 2003. Characterization of isolates of Vergilbung skrankheit-phytoplasma by RFLP-analysis and their association with grapevine, herbaceous host pants and vectors. Proc. 14th ICVG Conference, pp.66-67. Locorotondo, Italy.

Lauer, U., and Seemüller, E. 1998. Physical map of the apple proliferation phytoplasma genome. Program Abs., Int. Organ. Mycoplasm. Conf., 12th, Sydney, Aust., p. 155

Lebsky, V., Poghosyan, A. 2007. Phytoplasma associated diseases in tomato and pepper in the state of BCS, Mexico: a brief overview. Bulletin of Insect. 60:131-132.

Lee, I. M., Bertaccini, A., Vibio, M. and Gundersen, D. E. 1995. Detection of multiple phytoplasmas in perennial fruit trees with decline symptoms in Italy. Phytopath. 85:728-35.

Lee, I. M., Bottner, K. D., Dally, E. L. and Davis, R. E. 2008. First report of Purple Coneflower phyllody associated with a 16SrI-B phytoplasma in Maryland. Plant Disease 92:654.

Lee, I. M., and Davis, R. E. 1992. Mycoplasmas which infect plants and insects. In: Mycoplasmas: Molecular Biology and Pathogenesis, eds. J. Maniloff, R. N. Mc- Elhansey, L. R. Finch, and Baseman, J.B. pp.379-90. Washington, DC: American Society for Microbiology.

Lee, I. M., Davis R. E., Chen T. A., Chiykowski L. N., and Fletcher, J. 1992. A genotype-based system for identification and classification of mycoplasma-like organisms (MLOs) in the aster yellows MLO strain cluster. Phytopath. 82:977-86.

Lee, I. M., Davis, R. E. and D. E. and Gundersen, D. E. 2000. Phytoplasma: phytopathogenic mollicutes. Ann. Rev. Micro. 54:221-255.

Lee, I. M., Davis, R. E., and Hiruki, C. 1991. Genetic relatedness among clover proliferation mycoplasma like organisms (MLOs) and other MLOs investigated by nucleic acid hybridization and restriction fragment length polymorphism analyses. Appl. Environ. Micro. 57:3565-69.

100

Lee, I. M., Gundersen, D. E., Davis, R. E., and Bartoszyk, I. M. 1998. Revised classification scheme of phytoplasmas based on RFLP analyses of 16SrRNA and ribosomal protein gene sequences. Int. J. Syst. Bact. 48:1153-69.

Lee, I. M., Gundersen, D. E., Davis, R. E., Bottner, K. D., Marcone, C. and Seemüller, E. 2004a. Candidatus Phytoplasma asteris, a novel phytoplasma taxon associated with aster yellows and related diseases. Int. J. Syst. Evol. Microbiol. 54:1037- 1048.

Lee, I. M., Gundersen, D. E., Davis, R. E., and Chiykowski, L. N. 1992. Identification and Analysis of a Genomic Strain Cluster of Mycoplasmalike Organisms Associated with Canadian Peach (Eastern) X Disease, Western X Disease, and Clover Yellow Edge. J. Bacteriol. 174:6694-6698.

Lee, I. M., Gundersen, D. E., Hammond, R. W. and Davis, R. E. 1994. Use of mycoplasmalike organisms (MLO) group-specific oligonucleotide primers for nested PCR assays to detect mixed- MLO infections in a single host plant. Phytopath. 84:559-566.

Lee, I. M., Hammond, R. W., Davis, R. E. and Gundersen, D. E. 1993b. Universal amplification and analysis of pathogen 16SrDNA for classification and identification of mycoplasmalike organisms. Phytopath. 83:834-842.

Lee, I. M., Martini, M., Marcone, C. and Zhu, S. F. 2004b. Classification of phytoplasma strains in the elm yellows group (16SrV) and proposal of Candidatus Phytoplasma ulmi for the phytoplasma associated with elm yellows. Int. J. Syst. Evol. Microbiol. 54:337-347.

Lee, I. M., Pastore, M., Vibio, M., Danielli, A., and Attathom, S. 1997. Detection and characterization of phytoplasma associated with annual blue grass (Poa annua) white leaf in southern Italy. Eur. J. Plant Path.103:251-54.

Lee, I. M., Zhao, Y. and Bottner, K. D. 2005. Novel insertion sequence-like elements in phytoplasma strains of the aster yellows group are putative new members of the IS3 family. FEMS Microbiol. Letters. 242:353-360.

Lee, I. M., Zhao, Y. and Bottner, K. D. 2006. SecY gene sequence analysis for finer differentiation of diverse strains in the aster yellows phytoplasma group. Mol. Cell Probes 20:87-91.

Lee, I. M., Zhu, S., Gundersen, D. E., Zhang C., and Hadidi, A. 1995. Detection and identification of a new phytoplasma associated with cherry lethal yellows in China. Phytopath. 85:1179.

101

Lefol, C., Caudwell, A., Lherminier, J., and Larrue, J. 1993. Attachment of the Flavescence dorée pathogen (MLO) to leafhopper vectors and other insects. Ann. App. Biol. 123:611-22.

LeGall, F., Bové, J. M., and Garnier M. 1998. Engineering of a single-chain variable fragment (scFv) antibody specific for the stolbur phytoplasma (mollicute) and its expression in Escherichia coli and tobacco plants. App. Env. Microbiol. 64:4566- 72.

Lett, J. M., Granier, M., Grondin, M., Turpin, P., and Molinaro, F. 2001. Electrical penetration graphs from Cicadulina mbila on maize, the fine structure of its stylet pathways and consequences for virus transmission efficiency. Ent. Exp. Appl. 101:93-109.

Levy, L., Lee, I. M., and Hadidi, A. 1994. Simple and rapid preparation of infected plant tissue extracts for PCR amplification of virus, viroid, and MLO nucleic acids. J. Vir. Methods. 49:295-304.

Lherminier, J., Courtois, M., and Caudwell, R. 1994. Determination of the distribution and multiplication sites of flavescence dorée mycoplasma-like organisms in the host plant Vicia faba by ELISA and immune-cytochemistry. Physiol. Mol. Plant Path. 45:25-138.

Lherminier, J., Prensier, G., Boudon-Padieu, E., and Caudwell, A. 1990. Immuno labeling of grapevine Flavescence dorée MLO in salivary glands of Euscelidius variegatus: a light and electron microscopy study. J. Histochem. Cytochem. 38:79-86.

Lherminier, J., Scheltinga, T. T. V., Boudon-Padieu, E. and Caudwell, A. 1989. Rapid immuno-fluorescent detection of the grapevine flavescence dorée mycoplasmalike organism in the salivary glands of the leafhopper Euscelidius variegates Kbm. J. Phytopath. 125:353-360.

Liefting, L. W., and Kirkpatrick, B. C. 2003. Cosmid cloning and sample sequencing of the genome of the uncultivable mollicute, Western X-disease phytoplasma, using DNA purified by pulsed-field gel electrophoresis. FEMS Microbiol. Lett. 221:203-211.

Lievens, B., and Thomma, B. P. H. J. 2005. Recent Developments in Pathogen Detection Arrays: Implications for Fungal Plant Pathogens and Use in Practice. Phytopath. 95:1374-1380.

102

Lim, P. O., and Sears, B. B. 1989. 16SrRNA sequence indicates that plantpathogenic mycoplasmalike organisms are evolutionarily distinct from animal mycoplasmas. J. Bacteriol. 171:5901-5906.

Lim, P. O. and Sears, B. B. 1991. The genome size of a plant-pathogenic mycoplasmalike organism resembles those of animal mycoplasmas. J. Bacteriol. 173:2128-2130.

Lim, P. O. and Sears, B. B. 1992. Evolutionary relationships of a plantpathogenic mycoplasmalike organism and Acholeplasma laidlawii deduced from two ribosomal protein gene sequences. J. Bacteriol. 174:2606-2611.

Lin, C. P., and Chen, T. A. 1985. Chen: Monoclonal antibodies against the aster yellows agent. Science 227:1233-35.

Lin, C. P., and Chen, T. A. 1986. Comparison of monoclonal antibodies and polyclonal antibodies in detection of the aster yellows mycoplasmalike organism. Phytopath. 76:45-50.

Lin, C. and Chen, T. 1996. In vitro and in vivo immunization techniques for the production of monoclonal antibodies against the aster yellows phytoplasma. Plant Path. Bulletin 5:28-32.

Littau, V. C., and Maramorosch, K. 1960. A study of the cytological effects of aster yellows virus on its insect vector. Virology. 10:483-500.

Liyang, Z., Hoy, C. W., Miller, S. A. and Nault, L. R. 2003. Marking methods and field experiments to estimate aster leafhopper (Macrosteles quadrilineaus) dispersal rates. Enviro. Ento. 32:1177-1186.

Loi, N., Ermacora, Carraro, P. L., Osler, R. and Chen, T.A. 2002. Production of monoclonal antibodies against apple proliferation phytoplasma and their use in serological detection. Eur. J. Plant Path. 108:81-6.

Lorenz, K. H., Schneider, B., Ahrens, U., and Seemüller, E. 1995. Detection of the apple proliferation and pear decline phytoplasmas by PCR amplification of ribosomal and nonribosomal DNA. Phytopath. 85:771-776.

Madden, L.V., Nault, L. R., Murral, D. J., and Apelt, M. R. 1995. Spatial pattern analysis of the incidence of aster yellows disease in lettuce. Res. Pop. Eco. 37:279-89.

Maixner, M., Ahrens, U. and Seemüller, E. 1995. Detection of the German grapevine yellows (Vergibungskrankheit) MLO in grapevine, alternative hosts, and a vector by a specific PCR procedure. Eur. J. Plant Path. 101:241-50.

103

Maixner, M. and Reinert, W. 1999. Oncopsis alni (Schrank) (Auchenorrhyncha: Cicadellidae) as a vector of the alder yellows phytoplasma of Alnus glutinosa (L.) Gaertn. Eur. J. Plant Path. 105:87-94.

Malinowski, T., Zandarski, J., Komorowska, B. and Zawadzka, B. 1996. Application of DAPI staining and PCR amplification of DNA for the identification of pear decline phytoplasma in declining trees in Poland. Phytopath. Polonica 12:103- 110.

Malisano, G., Firrao, G. and Locci, R. 1996. 16SrDNA derived oligonucleotide probes for the differential diagnosis of plum leptonecrosis and apple proliferation phytoplasmas. EPPO Bulletin 26:421-428.

Maramorosch, K. 1952. Studies on the nature of the specific transmission of aster yellows and corn-stunt viruses. Phytopath. 42:663-668.

Marcone, C., Lee, I. M., Davis, R. E., Ragozzino, A., and Seemüller, E. 2000. Classification of aster yellows-group phytoplasmas based on combined analyses of RNA and tuf gene sequences. Int. J. Syst. Evo. Microbiol. 50:1703-1713.

Marcone, C. and Ragozzino, A. 1996. Comparative ultrastructural studies on genetically different phytoplasmas using scanning electron microscopy. Petria 6:125-136.

Marcone, G., Ragozzino, A., and Seemüller, E. 2004. Identification and characterization of the phytoplasma associated with elm yellows in southern Italy and its relatedness to other phytoplasmas of the elm yellows group Eur. J. For. Path. 27:45-54.

Martinez, S., Cordova, I., Maust, B. E., Trejo, C., Oropeza, C. and Santamaria, J. M. 2000. Is abscissic acid responsible for abnormal stomatal closure in coconuts palms showing lethal yellowing. J. Plant Path. 156:319-322.

Martini, M., Lee, I. M., Bottner, K. D., Zhao, Y., Botti, S., Bertaccini, A., Harrison, N. A., Carraro, L., Marcone, C., Khan, J., Osler, R. 2007. Ribosomal protein gene- based phylogeny for finer differentiation and classification of phytoplasmas. Inter. J. Syst. Evol. Micro. 57:2037-2051.

Martini, S., Katinger, M., Bertaccini, H. A. and Laimer, M. Saeed, E., Rage, P. and Cousin, M. T. 1992. Determination of the antigenic protein size associated with Faba bean phyllody MLO by using (SDS-PAGE) electrophoresis and Immune- transfer. J. Phytopath. 136:1-8.

Marzachì, C., Veratti, F. and Bosco, D. 1998. Direct PCR detection of phytoplasmas in experimentally infected insects. Ann. App. Bio. 133:45-54. 104

Maurer, R., Seemüller, E., and Sinclair, W.A. 1993. Genetic relatedness mycoplasma-like organisms affecting elm, alder, and ash in Europe and North America. Phytopath. 83:971-76.

McClure, M. S. 1982. Factors affecting colonization of an orchard by leafhopper (Homoptera: Cicadellidae) vectors of peach X-disease. Env. Ent. 11:695-99.

McCoy, R. E., Caudwell, A., Chang, C. J., Chen, T. A., and Chiykowski, L. N. 1989. Plant diseases associated with mycoplasma-like organisms. In The Mycoplasmas, Eds. Whitcomb, R. F. and E. D., Tully. pp.545-60. New York: Academic Press.

Meade, A. B., and Peterson, A. G. 1964. Origin of populations of the six-spotted leafhopper, Macrosteles fascifrons, in Anoka County, Minnesota. J. Econ. Ent. 57:885-888.

Montano, H. G., Davis, R. E., Dally, E. L., Hogenhout, S., Pimentel, J. P., and Brioso, P. S. T. 2001. „Candidatus Phytoplasma brasiliense‟, a new phytoplasma taxon associated with hibiscus witches‟ broom disease. Int. J. Syst. Evol. Microbiol. 51: 1109-1118.

Moya-Raygoza, G. and Nault, L. R. 1998. Transmission biology of maize bushy stunt Phytoplasma by the corn leafhopper (Homoptera: Cicadellidae). Ann. Entomol. Soc. Am. 91:668-676.

Mpunami, A. A., Tymon, A., Jones, P. and Dickinson, M. J. 1999. Genetic diversity in the coconut lethal yellowing disease phytoplasmas of East Africa. Plant Path. 48:109-114.

Murral, D. J., Nault, L. R., Hoy, C. W., Madden, L. V., and Miller, S. A. 1996. Effects of temperature and vector age on transmission of two Ohio strains of aster yellows phytoplasma by the aster leafhopper (Homoptera: Cicadellidae). J. Econ. Ento. 89:1223-1232.

Nagaich, B. B., Puri, B. K., Sinha, R. C., Dhingra, M. K., and Bhardwaj, V. P. 1974. Mycoplasma like organisms in plants affected with purple top-roll, marginal flavescence and witches‟-broom diseases of potatoes. Phytopathol. Z. 81:273-379.

Nakashima, K. and Hayashi, T. 1995. Multiplication and distribution or rice yellow dwarf phytoplasma in infected tissues of rice and green rice leafhopper Nephytettix cincticeps. Ann. Phytopath. Soc. Jpn. 61:519-528.

105

Nakashima, K., Kato, S., Iwanami S., and Murata, N. 1993. DNA probes reveal relatedness of rice yellow dwarf mycoplasma like organisms (MLOs) and distinguish them from other MLOs. App. Env. Microbiol. 59:1206-12.

Namba, S., Kato, S., Iwanam, I. S., Oyaizu, H., Shiozawa, H., and Tsuchizaki, T. 1993. Detection and differentiation of plant-pathogenic mycoplasmalike organisms using polymerase chain reaction. Phytopath. 83:786-91.

Namba, S., Oyaizu, H., Kato, S., Iwanami, S., and Tsuchizaki, T. 1993b. Phylogenetic diversity of phytopathogenic mycoplasmalike organisms. Int. J. Syst. Bacteriol. 43:461-467.

Nault, L. R. 1980. Maize bushy stunt and corn stunt: A comparison of disease symptoms, pathogen host ranges, and vectors by. Phytopathology 70:659-662.

Nichiporick, W. 1965. The aerial migration of the six-spotted leafhopper and the spread of the virus disease aster yellows. Int. J. Biom. 9:219-227.

Oliveira, E. D., Santos, J. C., Magalhães, P. C., and Cruz, I. 2007. Maize bushy stunt phytoplasma transmission by Dalbulus maidis is affected by spiroplasma acquisition and environmental conditions. Bulletin of insect. 60:229-230.

Olivier, C. Y., Lowery, D. T., Stobbs L. W., Vincent, C., Galka, B., Saguez, J., Bittner, L., Johnson, R., Rott, M., Masters, C., and Green, M. 2009. First report of aster yellow phytoplasmas („Candidatus Phytoplasma asteris‟) in canadian grapevines. Plant Disease. 93:669.

Oshima, K., Kakizawa, S., Arashida, R., Ishii, Y., Hoshi, A., Hayashi, Y., Kagiwada, S., and Namba, S. 2007. Presence of two glycolytic gene clusters in a severe pathogenic line of Candidatus Phytoplasma asteris. Mol. Plant Path. 8:481-489.

Oshima, K., Kakizawa, S., Nishigawa, H., Jung, H. Y., Wei, W., Suzuki, S., Arashida, R. Nakata, D., Miyata, S., Ugaki, M., and Namba, S. 2004. Reductive evolution suggested from the complete genome sequence of a plant-pathogenic phytoplasma. Nat. Genet. 36:27-29.

Padovan, A. C., Gibb, K. S., Bertaccini, A., Bonfiglioli, R. E., Magnet, P. A., and Sears, B. B. 1995. Molecular detection of the Australian grapevine yellows phytoplasma and comparison with grapevine yellows phytoplasmas from Italy. Aust. J. Grape Wine Res. 1:25-31.

Padovan, A. C. and Gibb, K. S. 2001. Epidemiology of phytoplasma diseases in papaya in Northern Australia. J. Phytopathology 149:649-658.

106

Palermo, S., Arzone, A. and Bosco, D. 2001. Vector-pathogen host plant relationships of chrysanthemum yellows (CY) phytoplasma and the vector leafhoppers Macrosteles quadripunctulatus and Euscelidius variegatus. Ento. Exp. Appl. 99:347-354.

Palermo, S., Elekes, M., Botti, S., Ember, I., Alma, A., Orosz, A., Bertaccini, A., and Kölber, M. 2004. Presence of Stolbur phytoplasma in Cixiidae from Hungarian grapevine growing areas. Vitis 43:201-203.

Palmano, S. and Firrao, G. 2000. Diversity of phytoplasmas isolated from insects, determined by a DNA heteroduplex mobility assay and a length polymorphism of the 16S-23SrDNA spacer region analysis. J. App. Microbio. 89:744-750.

Parthasarathy, M. V. 1974. Mycoplasmalike organisms associated with lethal yellowing disease of palms. Phytopath. 64:667-674.

Peterson, A. G. 1973. Host plant and aster leafhopper relationships. Proc. North Cent. Branch Ento. Soc. Am. 28:66-70.

Poghosyan, A. V., Lebsky, V. K., Arce-Montoya, M., and Landa, L. 2004. Possible phytoplasma disease in papaya (Carica papaya L.) from Baja California Sur: diagnosis by scanning electron microscopy. J. Phytopath. 152:376-380.

Power, A. G. 1987. Plant community diversity, herbivore movement, and an insect- transmitted disease of maize. Ecology 68:1658-1669.

Prince, J. P., Davis, R. E., Wolf, T. K., Lee, I. M., Mogen, B. D., Dally, E. L., Bertaccini, A., Credi, R. and Barba, M. 1993. Molecular detection of diverse mycoplasmalike organisms (MLOs) associated with grapevine yellows and their classification with aster yellows, X-disease, and elm yellows MLOs. Phytopath. 83:1130-37.

Purcell, A. H., and Suslow, K. G. 1987. Pathogenicity and effects on transmission of a mycoplasmalike organism of a transovarially infective bacterium on the leafhopper Euscelidius variegatus (Homoptera: Cicadellidae). J. Invert. Path. 50:285-290.

Quaglino, F., Zhao, Y., Bianco, P. A., Wei, W., Casati, P., Durante, G. and Davis, R. E. 2009. New 16Sr subgroups and distinct SNP lineages among grapevine Bois noir phytoplasma populations. Ann. App. Bio. 154:279-289.

Rhode, W., Kullaya, A., Mpunami, A. and Becker, D. 1993. Rapid and sensitive diagnosis of mycoplasmalike organisms associated with lethal disease of coconut palm by a specifically primed polymerase chain reaction for the amplification of 16SrDNA. Oleagineux. 48:319-322. 107

Rojas-Martínez, R. I., Zavaleta-Mejía, E., Lee, I. M., Martin, M., and Aspiros, H. S. 2003. Detection and characterization of the phytoplasma associated with marigold phyllody in Mexico. J. Plant Path. 85:81-86.

Santos-Cervantes, M. E., Chávez-Medina, J. A., Méndez-Lozano, J., and N. E. Leyva- López. 2008. Detection and molecular characterization of two little leaf phytoplasma strains associated with pepper and tomato diseases in Guanajuato and Sinaloa, Mexico. Plant Disease 92:1007-1011.

Saqib, M., Bayliss, K. L., and Jones, G. K. 2006. Identification of sweet potato little leaf phytoplasma associated with Vigna unguiculata var. sesquipedalis and Lycopersicon esculentum. Australas. Plant Path. 35:293-296.

Sarindu, N. and Clark, M. F. 1993: Antibody production and identity of MLOs associated with sugar-cane white leaf disease and bermuda-grass white leaf disease from Thailand. Plant Path. 42:396-402.

Sawayanagi, T., Horikoshi, N., Kanehira, T., Shinohara, M., and Bertaccini, A. 1999. Candidatus Phytoplasma japonicum, a new phytoplasma taxon associated with Japanese Hydrangea phyllody. Int. J. Syst. Bacteriol. 49:1275-85.

Saxton, A. M. 1998. A macro for converting mean separation output to letter groupings in Proc Mixed. In Proc. 23rd SAS Users Group Intl. Cary, NC: SAS Institute, pp. 1243-1246

Schaff, D., Lee, I. M. and Davis, R. E. 1992. Sensitive detection and identification of mycoplasma-like organisms in plants by polymerase chain reactions. Biochemical and Biophysical Res. Communications. 186:1503-1509.

Schaper, U. and Converse, R. H. 1985. Detection of mycoplasmalike organisms in infected blueberry cultivars by the DAPI technique. Plant Disease 69:193-196.

Scheltinga, T. T. V., Boudon-Padieu, E., and Caudwell, A. 1989. Rapid immunofluorescent detection of the grapevine flavescence dorée mycoplasmalike organism in the salivary glands of the leafhopper Euscelidius variegates. Kbm. J. Phytopath. 125:353-360.

Schneider, B., Ahrens, U., Kirkpatrick B.C., and Seemüller, E. 1993. Classification of plant-pathogenic mycoplasma-like organisms using restriction-site analysis of PCR-amplified 16SrDNA. J. Gen. Microbiol.139:519-27.

Schneider, B., Cousin, M. T., Klinkong, S., and Seemüller, E. 1995. Taxonomic relatedness and phylogenetic positions of phytoplasmas associated with diseases 108

of faba bean, sunnhemp, sesame, soybean, and eggplant. Z Pflanzenk Pflanzenschutz 102:225-232.

Schneider, B., Gibb, K. S., and Seemüller, E. 1997. Sequence and RFLP analysis of the elongation factor Tu gene used in differentiation and classification of phytoplasmas. Microbiology 143:3381-89.

Schneider, B., Seemüller, E., Smart, C. D., and Kirkpatrick, B. C. 1995. Phylogenetic classification of plant pathogenic mycoplasmalike organisms or phytoplasmas. Pages 369-380 in: Molecular and Diagnostic Procedures in Mycoplasmology, Vol. 2. S. Razin and J. G. Tully, eds. Academic Press, New York.

Schneider, B., Torres, E., Martin, M. P., Schroder, M., Behnke, H. D., and Seemüller, E. 2005. „Candidatus Phytoplasma pini‟, a novel taxon from Pinus silvestris and Pinus halepensis. Int. J. Syst. Evo. Microbio. 55:303-307.

Schneider, H. 1977. Indicator Hosts for Pear Decline: Symptomatology, Histopathology, and Distribution of Mycoplasmalike Organisms in Leaf Veins. Phytopath. 67:592- 601.

Schuiling, M. and Forstel-Neuhaus, A. 1992. The use of the fluorochrome DAPI in the diagnosis of lethal disease of coconut palm (Cocos nucifera) in Tanzania. Z Pflanzenk Pflanzen. 99:614-616.

Schultz, G. A. 1973. Plant resistance to aster yellows. Proc. N. C. B. Entomol. Soc. Amer. 28:93-99.

Seddas, A., Meignoz, R., Daire, X., and Boudon-Padieu, E., 1996. Generation and characterization of monoclonal antibodies to flavescence dorée phytoplasma: serological relationships and differences in electro blot immunoassay profiles of flavescence dorée and elm yellows phytoplasmas. Eur. J. Plant Path. 102: 757- 764.

Seemüller, E., Schneider, B., Maurer, R., Ahrens, U., Daire, X., Kison, H., Lorenz, K. H., Firrao, G., Avinent, L. and Sears, B. B. 1994. Phylogenetic classification of phytopathogenic mollicutes by sequence analysis of 16S ribosomal DNA. Int. J. Syst. Bacteriol. 44:440-446.

Seemüller, E., and Schneider, B. 2004. Candidatus Phytoplasma mali, Candidatus Phytoplasma pyri and Candidatus Phytoplasma prunorum, the causal agents of apple proliferation, pear decline and European stone fruit yellows, respectively. Int. J. Syst. Evol. Microbiol. 54:1217-1226.

109

Seemüller, E. and Schneider, B. 2007. Differences in Virulence and Genomic Features of Strains of „Candidatus Phytoplasma mali‟, the Apple Proliferation Agent. Phytopath. 97:964-970.

Seemüller, E., Marcone, C., Lauer, U., Ragozzino, A., Göschl, M. 1998. Current status of molecular classification of the phytoplasmas. J. Plant Path. 80:3-26.

Sforza, R., Clair, Daire, D. X., Larrue, J. and Boudon-Padieu, E. 1998. The role of Hyalesthes obsoletus (Hemiptera: Cixiidae) in the occurrence of bois noir of grapevines in France. J. Phytopath. 146:549-556.

Shaw, M. E., Kirkpatrick B. C., and Golino, D. A. 1993. The beet leafhopper-transmitted virescence agent causes tomato big bud disease in California. Plant Disease 77:290-95.

Sinclair, W. A., Griffiths, H. M., Davis R. E. and Lee, I. M. 1992. Detection of ash yellows mycoplasmalike organisms in different tree organs and in chemically preserved specimens by a DNA probe vs. DAPI. Plant Disease 76:154-158.

Sinclair, W. A., Griffiths, H. M. and Davis, R. E. 1996. Ash yellows and lilac witches'- broom: phytoplasmal diseases of concern in forestry and horticulture. Plant Disease 80: 468-475.

Sinclair, W. A., Iuli, R. J., Dyer, A. T. and Larsen, A. O. 1989. Sampling and histological procedures for diagnosis of ash yellows. Plant Disease 73:432-435.

Singh, S. J. 1991. Electron microscopic evidence of the association of mycoplasma-like organism with phyllody disease of bottlegourd. Plant Disease Research 6:117-20.

Sinha, R. C., and Benhamou, N. 1983. Detection of mycoplasmalike organism antigens from aster yellows diseased plants by two serological procedures. Phytopath. 73:1199-1202.

Sinha, R. C., and Chiykowski, L. N. 1986. Detection of mycoplasmalike organisms in leafhopper vectors of aster yellows and peach-X disease by immune-sorbent electron microscopy. Can. J. Plant Path. 4:387-393.

Smart, C. D., B. Schneider, L. Blomquist, J. Guerra, N. A. Harrison, U. Ahrens, K. H. Lorenz, E. Seemüller, and B. C. Kirkpatrick. 1996. Phytoplasma-specific PCR primers based on sequences of the I6S-23S rRNA spacer region. App. Env. Microbio. 62:2988-2993.

110

Soustrade, I. R., Legrand, D., Gagnevin, L. 2010. Multiplex Nested PCR for Detection of Xanthomonas axonopodis pv. allii from Onion Seeds. App. Env. Microbiol. 76:2697-2703.

Srinivasulu, B., and Narayanasamy, P. 1995. Serological detection of phyllody disease in sesamum and leafhopper Orosius albicinctus. Indian J. Mycology and Plant Path. 25:154-159.

Stanosz, G. R., Heimann M. F., and Lee, I-M. 1997. Purple coneflower is a host of the aster yellows phytoplasma. Plant Disease 81:424.

Streten, C., and Gibb, K. S. 2003. Identification of genes in the tomato big bud phytoplasma and comparison to those in sweet potato little leaf-V4 phytoplasma. Microbiol. 149:1797-1805.

Swenson, K. 1971. Relation of age, sex and mating of Macrosteles fascifrons to transmission of aster yellows. Phytopathology 61:657-59.

Tamura K., Dudley J., Nei M., and Kumar S., 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24:1596-1599.

Tanaka, M., Osada, S. and Matsuda, I. 2000. Transmission of rhus (Rhus javanica L.) yellows by Hishimonus sellatus and host range of the causal phytoplasma. J Gen. Plant Path. 66:323-326.

Thomas, S., and Balasundaran, M. 2001. Purification of sandal spike phytoplasma for the production of polyclonal antibody. Curr. Sci. 80:1489-1494.

Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F., and Higgins, D. G. 1997. The CLUSTAL_X windows interface: Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25:4876-4882.

Tomlinsona, J. A., Boonhama, N., and Dickinson, M. 2010. Development and evaluation of a one-hour DNA extraction and loop-mediated isothermal amplification assay for rapid detection of phytoplasmas. Plant Path. 59:465-471.

Toth, K. F., Harrison, N. and Sears, B. B. 1994. Phylogenetic relationships among members of the class Mollicutes deduced from rps3 gene sequences. Int. J. Syst. Bacterio. 44:119-124.

Tran-Nguyen, L. T. T., Kube, M., Schneider, B., Reinhardt, R., and Gibb, K. S. 2008. Comparative genome analysis of „Candidatus Phytoplasma australiense‟

111

(subgroup tuf-Australia I; rp-A) and „Ca. Phytoplasma asteris‟ strains OYM and AY-WB. J. Bacteriol. 190:3979-3991.

Valiunas, D., Staniulis, J., and Davis, R. E. 2006. „Candidatus phytoplasma fragariae‟, a novel phytoplasma taxon discovered in yellows disease strawberry, Fragaria × ananassa. Int. J. Syst. Evo. Microbiol. 56:277-281.

Vega, F. E., Davis R. E., Barbosa, P., Dally, E. L., and Purcell, A. H. 1993. Detection of a plant pathogen in a non vector insect species by the polymerase chain reaction. Phytopathology 83:621-24.

Vega, F. E., Davis, R. E., Dally, E. L., Barbosa, P., and Purcell, A. H. 1994. Use of a biotinylated DNA probe for detection of the aster yellows mycoplasma-like organism in Dalbulus maidis and Macrosteles fascifrons (Homoptera: Cicadellidae) Fla. Ento. 77:330-34.

Vera, C., and Milne, R. G. 1994. Immuno-sorbent electron microscopy and gold label antibody decoration of MLOs from crude preparations of infected plants and vector insects. Plant Path. 43:190-199.

Verdin, E., Salar, P., Danet, J. L., Choueiri, E., Jreijiri, F., El Zammar, S., Gélie, B., Bové, J. M., and Garnier, M. 2003. „Candidatus Phytoplasma phoenicium‟ sp. nov., a novel phytoplasma associated with an emerging lethal disease of almond trees in Lebanon and Iran. Int. J. Syst. Evo. Microbiol. 53:833-838.

Vibio, M., Bertaccini, A., Lee, I. M., Davis, R. E., and Clark, M. F. 1996. Differentiation and classification of aster yellows and related European phytoplasmas. Phytopath. Medit. 35:33-42.

Wallis, R. L. 1962. Spring migration of the six-spotted leafhopper in the western Great Plains. J. Eco. Ento. 55:871-874.

Wally, O., El Hadrami, A., Khadhair, A. H., Adam, L. R., Shinners-Carnelley, T., Elliott, B., Daayf, F. 2008. DNA sequencing reveals false positives during the detection of aster yellows phytoplasmas in leafhoppers116:130-137.

Wang, K. and Hiruki, C. 2000. Heteroduplex mobility assay detects DNA mutations for differenation of closely related phytoplasma strains. J. Micro. Methods. 41:59-68.

Wang, K., Hiruki, C. and Yeh, F. 2003. Molecular evolution of phytoplasmas based on polymorphisms in the 16S rRNA genes and the 16/23S spacer regions. P. Jpn. Acad. B-Phys. 79:155-162.

112

Wartenberg, D. 1989. SAAP- a spatial autocorrelation analysis program. Department of Environmental and Community Medical, Robert Wood Johnson Medical School, University of Medical and Dentistry of New Jersey, Piscataway, N. J.

Wayadande, A. C., Baker, G. R., and Fletcher, J. 1997. Comparative ultra-structure of the salivary glands of two phytopathogen vectors, the beet leafhopper, Circulifer tenellus (Baker), and the corn leafhopper, Dalbulus maidis Delong and Wolcott (Homoptera: Cicadellidae). Int. J. Insect Morphol. Embryo. 26:113-20.

Webb, D. R., Bonfiglioli, R. G., Carraro, L., Osler, R., and Symons, R. H. 1999. Oliogonucleotides as hybridization probes to localize phytoplasmas in host plants and insect vectors. Phytopath. 89:894-901.

Wei, W., Davis, R. E., Jomantiéne, R., and Zhao, Y. 2008a. Ancient, recurrent phage attacks and recombination shaped dynamic sequence-variable mosaics at the root of phytoplasma genome evolution. Pro. Nat. Acad. Sciences 105:11827-11832.

Wei, W., Davis, R.E., Lee, I.-M., and Zhao, Y. 2007. Computer-simulated RFLP analysis of 16S rRNA genes: identification of ten new phytoplasma groups. International Journal of Systematic and Evolutionary Microbiology, 57:1855-1867.

Wei, W., Lee, I.-M., Davis, R. E., Suo, X. and Zhao, Y. 2008b. Automated RFLP pattern comparison and similarity coefficient calculation for rapid delineation of new and distinct phytoplasma 16Sr subgroup lineages. Int. J. Syst. Evo. Microbio. 58:2368-2377.

Weintraub, P. G. 2007. Insect vectors of phytoplasmas and their control - an update. Bull. Insect. 60:169-173.

Weintraub, P. G., and Beanland, L. 2006. Insect vectors of phytoplasmas. Ann. Rev. Ento. 51:91-111.

Weintraub, P. G., Zeidan, M., Spiegel, S., Gera, A. 2007. Diversity of the known phytoplasmas in Israel. Bulletin Insect. 60:143-144.

Whitcomb, R. F., and Tully, E. D. 1989. The Mycoplasmas: Vol. 5. San Diego: Academic Press, Inc.

White, D. T., Blackall, L. L., Scott, P. T., and Walsh, K. B. 1998. Phylogenetic positions of phytoplasmas associated with dieback, yellow crinkle and mosaic diseases of papaya, and their proposed inclusion in „Candidatus Phytoplasma australiense‟ and a new taxon, „Candidatus Phytoplasma australasia‟. Int. J. Syst. Bacteriol. 48:941-951.

113

Woese, C. R., Maniloff, J., and Zablen, L. B. 1980. Phylogenetic analysis of the mycoplasmas. Proc. Natl Acad. Sci. USA. 77:494-498.

Yu, Y. L., Yeh, K. W., and Lin, C. P. 1998. An antigenic protein gene of a phytoplasma associated with sweet potato witches‟-broom. Microbiol. 144:1257-62.

Zhang, J., Hogenhout, S. A., Nault, L. R., Hoy, C. W., and Miller, S. A. 2004. Molecular and symptom analyses of phytoplasma strains from lettuce reveal a diverse population. Phytopathology 94:842-49.

Zhang, Y., Uyemoto, J. K., and Kirkpatrick, B. C. 1998. A small-scale procedure for extracting nucleic acids from woody plants infected with various phytopathogens for PCR assay. J. Virol. Method. 71:45-50.

Zhao, Y., Wei, W., Lee, I-M., Shao, J., Suo, X., and Davis, R. E. 2009. Construction of an interactive online phytoplasma classification tool, iPhyClassifier, and its application in analysis of the peach X-disease phytoplasma group (16SrIII). Int. J. Syst. Evo. Microbiol. 59:2582-2593.

Zhou, J., Hoy, C. W., Miller, S. A., and Nault, L. R. 2003. Marking methods and Þeld experiments to estimate aster leafhopper (Macrosteles quadrilineatus) dispersal rates. Enviro. Ento. 32:1177-1186.

Zhu, S. F., Lee, I. M., Gundersen, D. E., Zhang, C. L., and Hadidi, A. 1996. Phytoplasmas associated with cherry lethal yellows and jujube witches‟-broom in China represent a new Candidatus subspecies level taxon. IOM Lett. 4:218.

Zreik, L., Carle P., Bové J. M., and Garnier, M. 1995. Characterization of the mycoplasma-like organism associated with witches‟-broom disease of lime and proposition of a Candidatus taxon for the organism, „Candidatus Phytoplasma aurantifolia‟. Int. J. Syst. Bacteriol.45:449-453.

114