DOCSLIB.ORG

Gene Symbol Genbank MCF7-T MCF-F De

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Gene Symbol Genbank MCF7-T MCF-F De Table S2. Genes with altered expression in MCF7-T and MCF7-F cells Fold Change (vs. MCF7) Gene symbol Genbank MCF7-T MCF-F Description Downregulated in both MCF7-T and MCF7-F ABAT NM_020686 -3.10 -4.55 4-aminobutyrate aminotransferase ASCL2 NM_005170 -3.58 -6.11 Achaete-scute complex-like 2 (Drosophila) AZGP1 NM_001185 -29.21 -5.09 Alpha-2-glycoprotein 1, zinc CAP2 NM_006366 -3.23 -6.03 CAP, adenylate cyclase-associated protein, 2 (yeast) CD24 NM_013230 -4.20 -3.89 CD24 antigen (small cell lung carcinoma cluster 4 antigen) CDC42EP5 NM_145057 -3.89 -6.01 CDC42 effector protein (Rho GTPase binding) 5 CISH NM_145071 -4.76 -3.03 Cytokine inducible SH2-containing protein CLDN3 NM_001306 -4.24 -3.05 Claudin 3 CRIP1 NM_001311 -3.70 -12.43 Cysteine-rich protein 1 (intestinal) CRIP2 NM_001312 -5.03 -5.30 Cysteine-rich protein 2 CTXN1 Hs.250879 -3.53 -3.21 Cortexin 1 DLC1 NM_182643 -4.03 -21.61 Deleted in liver cancer 1 DNAJC12 NM_201262 -3.17 -67.76 DnaJ (Hsp40) homolog, subfamily C, member 12 EFEMP1 NM_018894 -5.30 -4.99 EGF-containing fibulin-like extracellular matrix protein 1 EFS NM_032459 -3.31 -25.59 Embryonal Fyn-associated substrate FHL1 NM_001449 -24.97 -110.29 Four and a half LIM domains 1 FLJ23548 NM_024590 -8.42 -8.30 Arylsulfatase J FOLR1 NM_016731 -4.56 -4.54 Folate receptor 1 (adult) GREB1 NM_148903 -97.58 -59.66 GREB1 protein HEY2 NM_012259 -7.29 -8.42 Hairy/enhancer-of-split related with YRPW motif 2 HRASLS3 NM_007069 -3.51 -4.84 HRAS-like suppressor 3 INHBB NM_002193 -5.74 -3.73 Inhibin, beta B (activin AB beta polypeptide) KLK10 NM_145888 -12.11 -3.81 Kallikrein 10 KLK11 NM_144947 -62.25 -16.30 Kallikrein 11 LOC387911 Hs.434541 -4.29 -10.84 Prostate collagen triple helix MAGEA1 NM_004988 -5.94 -5.59 Melanoma antigen family A, 1 (directs expression of antigen MZ2-E) MAGEA2 NM_175743 -6.61 -7.80 Melanoma antigen family A, 2 MIDN Hs.302969 -3.12 -3.21 midnolin MIPEP NM_005932 -10.64 -5.42 Mitochondrial intermediate peptidase MME NM_007289 -4.82 -6.50 Membrane metallo-endopeptidase (CALLA, CD10) MT1X NM_005952 -3.84 -3.75 Metallothionein 1X NEDD4L NM_015277 -6.07 -3.67 Neural precursor cell expressed, developmentally down-regulated 4-like NPY1R NM_000909 -10.26 -581.64 Neuropeptide Y receptor Y1 NPY5R NM_006174 -3.18 -9.30 Neuropeptide Y receptor Y5 NXPH1 NM_152745 -33.70 -3.54 Neurexophilin 1 PDZK1 NM_002614 -3.09 -15.24 PDZ domain containing 1 PKIB NM_181795 -37.26 -33.38 Protein kinase (cAMP-dependent, catalytic) inhibitor beta PLS3 NM_005032 -24.83 -3.02 Plastin 3 (T isoform) QPRT NM_014298 -5.18 -3.76 Quinolinate phosphoribosyltransferase RAB34 NM_031934 -5.69 -23.81 RAB34, member RAS oncogene family RHOD NM_014578 -3.53 -6.81 Ras homolog gene family, member D S100A13 Hs.446592 -4.02 -3.74 S100 calcium binding protein A13 S100A14 NM_020672 -7.11 -3.07 S100 calcium binding protein A14 S100A16 NM_080388 -13.05 -7.30 S100 calcium binding protein A16 SLC6A14 NM_007231 -10.30 -47.38 Solute carrier family 6 (amino acid transporter), member 14 SOX3 NM_005634 -10.04 -18.76 SRY (sex determining region Y)-box 3 SPANXA1 NM_013453 -53.76 -28.43 SPANX family, member A2 SPANXC NM_022661 -9.81 -13.17 SPANX family, member C SUSD3 NM_145006 -3.39 -3.05 Sushi domain containing 3 SYTL4 NM_080737 -5.33 -6.06 Synaptotagmin-like 4 (granuphilin-a) TFF3 NM_003226 -13.72 -75.86 Trefoil factor 3 (intestinal) TNFRSF19 NM_148957 -21.63 -13.63 Tumor necrosis factor receptor superfamily, member 19 TNFSF13 NM_172089 -4.23 -7.18 Tumor necrosis factor (ligand) superfamily, member 12 TNRC9 Hs.110826 -45.48 -5.30 trinucleotide repeat containing 9 TOSO NM_005449 -3.50 -11.57 Fas apoptotic inhibitory molecule 3 VGLL1 NM_016267 -118.86 -5.64 Vestigial like 1 (Drosophila) WWP1 NM_007013 -3.27 -5.49 WW domain containing E3 ubiquitin protein ligase 1 1 Table S2. Genes with altered expression in MCF7-T and MCF7-F cells (continued) Fold Change (vs. MCF7) Gene symbol Genbank MCF7-T MCF-F Description Upregulated in both MCF7-T and MCF7-F cells ABCG1 NM_016818 3.10 4.99 ATP-binding cassette, sub-family G (WHITE), member 1 ABCG2 NM_004827 4.10 7.40 ATP-binding cassette, sub-family G (WHITE), member 2 ANAPC7 NM_016238 3.10 5.40 Anaphase promoting complex subunit 7 APOE NM_000041 6.04 4.07 Apolipoprotein E AUTS2 NM_015570 3.99 4.32 Autism susceptibility candidate 2 AXIN2 NM_004655 5.72 3.01 Axin 2 (conductin, axil) B4GALT6 NM_004775 4.90 3.79 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6 BRIP1 NM_032043 3.31 7.30 BRCA1 interacting protein C-terminal helicase 1 C1GALT1 NM_020156 5.92 13.20 glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase, 1 CD109 NM_133493 3.14 3.99 CD109 antigen (Gov platelet alloantigens) CHD5 NM_015557 3.24 6.28 Chromodomain helicase DNA binding protein 5 CILP2 NM_153221 5.25 4.53 Cartilage intermediate layer protein 2 COL6A2 NM_058175 3.49 6.32 Collagen, type VI, alpha 2 CPE NM_001873 3.28 5.49 Carboxypeptidase E CXCR4 Hs.421986 5.15 4.35 Chemokine (C-X-C motif) receptor 4 CYBRD1 NM_024843 7.95 16.82 Cytochrome b reductase 1 CYP1B1 NM_000104 3.76 6.58 Cytochrome P450, family 1, subfamily B, polypeptide 1 DEPDC1 NM_017779 3.04 3.85 DEP domain containing 1 DIAPH2 NM_007309 3.64 3.09 Early lymphoid activation protein ENPP4 Hs.54037 3.95 4.36 Ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative function) ENPP5 NM_021572 4.55 3.47 Ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative function) ERO1LB NM_019891 5.97 12.48 ERO1-like beta (S. cerevisiae) FACL2 NM_021122 3.01 4.68 fatty-acid-Coenzyme A ligase, long-chain 2 FBN1 NM_000138 3.69 3.69 Fibrillin 1 (Marfan syndrome) FBXL10 NM_032590 4.97 4.04 F-box and leucine-rich repeat protein 10 FHOD3 Hs.444746 6.67 10.75 formin homology 2 domain containing 3 FLJ14490 Hs.75668 3.48 5.18 Major facilitator superfamily domain containing 2 FLJ20406 NM_017806 3.12 5.17 Lck interacting transmembrane adaptor 1 FLJ31842 NM_152487 4.04 5.75 Transmembrane protein 56 FLJ37927 Hs.289044 3.16 3.03 CDC20-like protein FN1 NM_054034 3.20 14.43 Fibronectin 1 FRAS1 NM_025074 8.28 8.74 Fraser syndrome 1 GSTA4 NM_001512 3.68 5.39 Glutathione S-transferase A4 HECTD2 NM_182765 3.87 19.28 HECT domain containing 2 HLA-A NM_002116 3.01 10.06 Major histocompatibility complex, class I, A HLA-C NM_002117 3.95 7.13 Major histocompatibility complex, class I, C JAG2 NM_145159 3.89 3.09 Jagged 2 KIAA2028 Hs.255938 3.37 4.96 similar to PH (pleckstrin homology) domain LDLR NM_000527 3.07 3.58 Low density lipoprotein receptor (familial hypercholesterolemia) LIPG NM_006033 3.66 8.92 Lipase, endothelial LOC85028 Hs.40092 6.62 7.64 PNAS-123 LPIN1 NM_145693 3.43 3.03 Lipin 1 LSS NM_002340 4.20 5.53 Lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase) MARK3 Hs.35828 3.64 5.07 MAP/microtubule affinity-regulating kinase 3 MEF2C NM_002397 12.79 37.53 MADS box transcription enhancer factor 2, polypeptide C MEIS1 NM_002398 3.08 5.81 Meis1, myeloid ecotropic viral integration site 1 homolog (mouse) MVD NM_002461 5.52 3.34 Mevalonate (diphospho) decarboxylase NPC1 NM_000271 3.27 3.88 Niemann-Pick disease, type C1 NR3C1 NM_000176 3.03 18.66 Nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor) OSMR NM_003999 3.69 5.61 Oncostatin M receptor PCOLCE2 NM_013363 12.47 3.77 Procollagen C-endopeptidase enhancer 2 PGAP1 NM_024989 4.29 4.03 GPI deacylase PRKACB NM_182948 5.10 4.26 Protein kinase, cAMP-dependent, catalytic, beta PRKAR2B NM_002736 10.39 3.39 Protein kinase, cAMP-dependent, regulatory, type II, beta PTGER4 NM_000958 11.44 7.95 Prostaglandin E receptor 4 (subtype EP4) RGS6 NM_004296 4.87 4.97 Regulator of G-protein signalling 6 RPL17 NM_000985 4.42 4.64 Ribosomal protein L17 SAT NM_002970 3.62 5.37 Spermidine/spermine N1-acetyltransferase SC4MOL Hs.105269 3.82 8.08 Sterol-C4-methyl oxidase-like 2 Table S2. Genes with altered expression in MCF7-T and MCF7-F cells (continued) Fold Change (vs. MCF7) Gene symbol Genbank MCF7-T MCF-F Description Upregulated in both MCF7-T and MCF7-F cells SCD NM_005063 3.86 4.20 Stearoyl-CoA desaturase (delta-9-desaturase) SCML1 NM_006746 4.11 3.20 Sex comb on midleg-like 1 (Drosophila) SFRS3 NM_003017 3.01 7.24 Splicing factor, arginine/serine-rich 3 SIAT9 NM_003896 6.92 11.07 ST3 beta-galactoside alpha-2,3-sialyltransferase 5 SLC2A6 NM_017585 3.00 4.08 Solute carrier family 2 (facilitated glucose transporter), member 6 SLC35B4 NM_032826 3.45 4.64 Solute carrier family 35, member B4 SREBF1 NM_004176 3.18 5.01 Sterol regulatory element binding transcription factor 1 SSBP1 NM_003143 3.79 4.72 Single-stranded DNA binding protein 1 STX16 NM_003763 3.07 6.72 Syntaxin 16 TFAP2A NM_003220 5.05 6.15 Transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha) TGFBR3 NM_003243 4.14 4.36 Transforming growth factor, beta receptor III (betaglycan, 300kDa) TIMP3 NM_000362 5.17 15.78 Tissue inhibitor of metalloproteinase 3 TM7SF1 NM_003272 3.61 7.41 Transmembrane 7 superfamily member 1 (upregulated in kidney) TNFRSF25 NM_148974 3.14 5.38 Tumor necrosis factor receptor superfamily, member 25 TYMS NM_001071 4.40 3.76 Thymidylate synthetase WASPIP NM_003387 5.07 3.86 Wiskott-Aldrich syndrome protein interacting protein WFDC2 NM_080736 4.88 3.06 WAP four-disulfide core domain 2 WNT5A NM_003392 11.59 12.91 Wingless-type MMTV integration site family, member 5A ZNF222 NM_013360 4.71 4.83 Zinc finger protein 222 ZNF230 NM_006300 3.29 13.36 Zinc finger protein 230 ZNF519 NM_145287 3.51 3.31 Zinc finger protein 519 ZNF537 NM_020856 10.49 5.36 Zinc finger protein 537 Upregulated in MCF7-T, unchanged in MCF7-F ACLY NM_198830 3.47 2.46 ATP citrate
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Download (PDF)
    ANALYTICAL SCIENCES NOVEMBER 2020, VOL. 36 1 2020 © The Japan Society for Analytical Chemistry Supporting Information Fig. S1 Detailed MS/MS data of myoglobin. 17 2 ANALYTICAL SCIENCES NOVEMBER 2020, VOL. 36 Table S1 : The protein names (antigens) identified by pH 2.0 solution in the eluted-fraction. These proteins were identified one or more out of six analyses. Accession Description P08908 5-hydroxytryptamine receptor 1A OS=Homo sapiens GN=HTR1A PE=1 SV=3 - [5HT1A_HUMAN] Q9NRR6 72 kDa inositol polyphosphate 5-phosphatase OS=Homo sapiens GN=INPP5E PE=1 SV=2 - [INP5E_HUMAN] P82987 ADAMTS-like protein 3 OS=Homo sapiens GN=ADAMTSL3 PE=2 SV=4 - [ATL3_HUMAN] Q9Y6K8 Adenylate kinase isoenzyme 5 OS=Homo sapiens GN=AK5 PE=1 SV=2 - [KAD5_HUMAN] P02763 Alpha-1-acid glycoprotein 1 OS=Homo sapiens GN=ORM1 PE=1 SV=1 - [A1AG1_HUMAN] P19652 Alpha-1-acid glycoprotein 2 OS=Homo sapiens GN=ORM2 PE=1 SV=2 - [A1AG2_HUMAN] P01011 Alpha-1-antichymotrypsin OS=Homo sapiens GN=SERPINA3 PE=1 SV=2 - [AACT_HUMAN] P01009 Alpha-1-antitrypsin OS=Homo sapiens GN=SERPINA1 PE=1 SV=3 - [A1AT_HUMAN] P04217 Alpha-1B-glycoprotein OS=Homo sapiens GN=A1BG PE=1 SV=4 - [A1BG_HUMAN] P08697 Alpha-2-antiplasmin OS=Homo sapiens GN=SERPINF2 PE=1 SV=3 - [A2AP_HUMAN] P02765 Alpha-2-HS-glycoprotein OS=Homo sapiens GN=AHSG PE=1 SV=1 - [FETUA_HUMAN] P01023 Alpha-2-macroglobulin OS=Homo sapiens GN=A2M PE=1 SV=3 - [A2MG_HUMAN] P01019 Angiotensinogen OS=Homo sapiens GN=AGT PE=1 SV=1 - [ANGT_HUMAN] Q9NQ90 Anoctamin-2 OS=Homo sapiens GN=ANO2 PE=1 SV=2 - [ANO2_HUMAN] P01008 Antithrombin-III
    [Show full text]
  • Supplementary Materials: Evaluation of Cytotoxicity and Α-Glucosidase Inhibitory Activity of Amide and Polyamino-Derivatives of Lupane Triterpenoids
    Supplementary Materials: Evaluation of cytotoxicity and α-glucosidase inhibitory activity of amide and polyamino-derivatives of lupane triterpenoids Oxana B. Kazakova1*, Gul'nara V. Giniyatullina1, Akhat G. Mustafin1, Denis A. Babkov2, Elena V. Sokolova2, Alexander A. Spasov2* 1Ufa Institute of Chemistry of the Ufa Federal Research Centre of the Russian Academy of Sciences, 71, pr. Oktyabrya, 450054 Ufa, Russian Federation 2Scientific Center for Innovative Drugs, Volgograd State Medical University, Novorossiyskaya st. 39, Volgograd 400087, Russian Federation Correspondence Prof. Dr. Oxana B. Kazakova Ufa Institute of Chemistry of the Ufa Federal Research Centre of the Russian Academy of Sciences 71 Prospeсt Oktyabrya Ufa, 450054 Russian Federation E-mail: [email protected] Prof. Dr. Alexander A. Spasov Scientific Center for Innovative Drugs of the Volgograd State Medical University 39 Novorossiyskaya st. Volgograd, 400087 Russian Federation E-mail: [email protected] Figure S1. 1H and 13C of compound 2. H NH N H O H O H 2 2 Figure S2. 1H and 13C of compound 4. NH2 O H O H CH3 O O H H3C O H 4 3 Figure S3. Anticancer screening data of compound 2 at single dose assay 4 Figure S4. Anticancer screening data of compound 7 at single dose assay 5 Figure S5. Anticancer screening data of compound 8 at single dose assay 6 Figure S6. Anticancer screening data of compound 9 at single dose assay 7 Figure S7. Anticancer screening data of compound 12 at single dose assay 8 Figure S8. Anticancer screening data of compound 13 at single dose assay 9 Figure S9. Anticancer screening data of compound 14 at single dose assay 10 Figure S10.
    [Show full text]
  • Reprogramming of Trna Modifications Controls the Oxidative Stress Response by Codon-Biased Translation of Proteins
    Reprogramming of tRNA modifications controls the oxidative stress response by codon-biased translation of proteins The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation Chan, Clement T.Y. et al. “Reprogramming of tRNA Modifications Controls the Oxidative Stress Response by Codon-biased Translation of Proteins.” Nature Communications 3 (2012): 937. As Published http://dx.doi.org/10.1038/ncomms1938 Publisher Nature Publishing Group Version Author's final manuscript Citable link http://hdl.handle.net/1721.1/76775 Terms of Use Article is made available in accordance with the publisher's policy and may be subject to US copyright law. Please refer to the publisher's site for terms of use. Reprogramming of tRNA modifications controls the oxidative stress response by codon-biased translation of proteins Clement T.Y. Chan,1,2 Yan Ling Joy Pang,1 Wenjun Deng,1 I. Ramesh Babu,1 Madhu Dyavaiah,3 Thomas J. Begley3 and Peter C. Dedon1,4* 1Department of Biological Engineering, 2Department of Chemistry and 4Center for Environmental Health Sciences, Massachusetts Institute of Technology, Cambridge, MA 02139; 3College of Nanoscale Science and Engineering, University at Albany, SUNY, Albany, NY 12203 * Corresponding author: PCD, Department of Biological Engineering, NE47-277, Massachusetts Institute of Technology, 77 Massachusetts Avenue, Cambridge, MA 02139; tel 617-253-8017; fax 617-324-7554; email [email protected] 2 ABSTRACT Selective translation of survival proteins is an important facet of cellular stress response. We recently demonstrated that this translational control involves a stress-specific reprogramming of modified ribonucleosides in tRNA.
    [Show full text]
  • Deep Learning–Based Multi-Omics Integration Robustly Predicts Survival in Liver Cancer Kumardeep Chaudhary1, Olivier B
    Published OnlineFirst October 5, 2017; DOI: 10.1158/1078-0432.CCR-17-0853 Statistics in CCR Clinical Cancer Research Deep Learning–Based Multi-Omics Integration Robustly Predicts Survival in Liver Cancer Kumardeep Chaudhary1, Olivier B. Poirion1, Liangqun Lu1,2, and Lana X. Garmire1,2 Abstract Identifying robust survival subgroups of hepatocellular car- index (C-index) ¼ 0.68]. More aggressive subtype is associated cinoma (HCC) will significantly improve patient care. Current- with frequent TP53 inactivation mutations, higher expression ly, endeavor of integrating multi-omicsdatatoexplicitlypredict of stemness markers (KRT19 and EPCAM)andtumormarker HCC survival from multiple patient cohorts is lacking. To fill BIRC5, and activated Wnt and Akt signaling pathways. We this gap, we present a deep learning (DL)–based model on HCC validated this multi-omics model on five external datasets of that robustly differentiates survival subpopulations of patients various omics types: LIRI-JP cohort (n ¼ 230, C-index ¼ 0.75), in six cohorts. We built the DL-based, survival-sensitive model NCI cohort (n ¼ 221, C-index ¼ 0.67), Chinese cohort (n ¼ on 360 HCC patients' data using RNA sequencing (RNA-Seq), 166, C-index ¼ 0.69), E-TABM-36 cohort (n ¼ 40, C-index ¼ miRNA sequencing (miRNA-Seq), and methylation data from 0.77), and Hawaiian cohort (n ¼ 27, C-index ¼ 0.82). This TheCancerGenomeAtlas(TCGA),whichpredictsprognosis is the first study to employ DL to identify multi-omics features as good as an alternative model where genomics and clinical linked to the differential survival of patients with HCC. Given data are both considered. This DL-based model provides two its robustness over multiple cohorts, we expect this workflow to optimal subgroups of patients with significant survival differ- be useful at predicting HCC prognosis prediction.
    [Show full text]
  • Allele-Specific Expression of Ribosomal Protein Genes in Interspecific Hybrid Catfish
    Allele-specific Expression of Ribosomal Protein Genes in Interspecific Hybrid Catfish by Ailu Chen A dissertation submitted to the Graduate Faculty of Auburn University in partial fulfillment of the requirements for the Degree of Doctor of Philosophy Auburn, Alabama August 1, 2015 Keywords: catfish, interspecific hybrids, allele-specific expression, ribosomal protein Copyright 2015 by Ailu Chen Approved by Zhanjiang Liu, Chair, Professor, School of Fisheries, Aquaculture and Aquatic Sciences Nannan Liu, Professor, Entomology and Plant Pathology Eric Peatman, Associate Professor, School of Fisheries, Aquaculture and Aquatic Sciences Aaron M. Rashotte, Associate Professor, Biological Sciences Abstract Interspecific hybridization results in a vast reservoir of allelic variations, which may potentially contribute to phenotypical enhancement in the hybrids. Whether the allelic variations are related to the downstream phenotypic differences of interspecific hybrid is still an open question. The recently developed genome-wide allele-specific approaches that harness high- throughput sequencing technology allow direct quantification of allelic variations and gene expression patterns. In this work, I investigated allele-specific expression (ASE) pattern using RNA-Seq datasets generated from interspecific catfish hybrids. The objective of the study is to determine the ASE genes and pathways in which they are involved. Specifically, my study investigated ASE-SNPs, ASE-genes, parent-of-origins of ASE allele and how ASE would possibly contribute to heterosis. My data showed that ASE was operating in the interspecific catfish system. Of the 66,251 and 177,841 SNPs identified from the datasets of the liver and gill, 5,420 (8.2%) and 13,390 (7.5%) SNPs were identified as significant ASE-SNPs, respectively.
    [Show full text]
  • Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-Like Mouse Models: Tracking the Role of the Hairless Gene
    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Doctoral Dissertations Graduate School 5-2006 Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-like Mouse Models: Tracking the Role of the Hairless Gene Yutao Liu University of Tennessee - Knoxville Follow this and additional works at: https://trace.tennessee.edu/utk_graddiss Part of the Life Sciences Commons Recommended Citation Liu, Yutao, "Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino- like Mouse Models: Tracking the Role of the Hairless Gene. " PhD diss., University of Tennessee, 2006. https://trace.tennessee.edu/utk_graddiss/1824 This Dissertation is brought to you for free and open access by the Graduate School at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. To the Graduate Council: I am submitting herewith a dissertation written by Yutao Liu entitled "Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-like Mouse Models: Tracking the Role of the Hairless Gene." I have examined the final electronic copy of this dissertation for form and content and recommend that it be accepted in partial fulfillment of the requirements for the degree of Doctor of Philosophy, with a major in Life Sciences. Brynn H. Voy, Major Professor We have read this dissertation and recommend its acceptance: Naima Moustaid-Moussa, Yisong Wang, Rogert Hettich Accepted for the Council: Carolyn R.
    [Show full text]
  • Primary Antibodies Flyer
    Primary Antibodies Your choice of size and format Format Concentration Size CF® dye conjugates (13 colors) 0.1 mg/mL 100 or 500 uL Biotin, HRP or AP conjugates 0.1 mg/mL 100 or 500 uL R-PE, APC, or Per-CP conjugates 0.1 mg/mL 250 uL Purified, with BSA 0.1 mg/mL 100 or 500 uL Purified, BSA-free (Mix-n-Stain™ Ready) 1 mg/mL 50 uL Advantages Figure 1. IHC staining of human prostate Figure 2. Flow cytometry analysis of U937 • More than 1000 monoclonal antibodies carcinoma with anti-ODC1 clone cells with anti-CD31/PECAM clone C31.7, • Growing selection of monoclonal rabbit ODC1/485. CF647 conjugate (blue) or isotype control (orange). antibodies • Validated in IHC and other applications Your choice of 13 bright and photostable CF® dyes • Choose from 13 bright and stable CF® dyes CF® dye Ex/Em (nm) Features • Also available with R-PE, APC, PerCP, HRP, AP, CF®405S 404/431 • Better fit for the 450/50 flow cytometer channel than Alexa Fluor® 405 or biotin CF®405M 408/452 • More photostable than Pacific Blue®, with less green spill-over • Purified antibodies available BSA-free, 1 mg/mL, • Compatible with super-resolution imaging by SIM ready to use for Mix-n-Stain™ labeling or other CF®488A 490/515 • Less non-specific binding and spill-over than Alexa Fluor® 488 conjugation • Very photostable and pH-insensitive • Compatible with super-resolution imaging by TIRF • Offered in affordable 100 uL size CF®543 541/560 • Brighter than Alexa Fluor® 546 CF®555 555/565 • Brighter than Cy®3 • Validated in multicolor super-resolution imaging by STORM CF®568
    [Show full text]
  • Synergistic Genetic Interactions Between Pkhd1 and Pkd1 Result in an ARPKD-Like Phenotype in Murine Models
    BASIC RESEARCH www.jasn.org Synergistic Genetic Interactions between Pkhd1 and Pkd1 Result in an ARPKD-Like Phenotype in Murine Models Rory J. Olson,1 Katharina Hopp ,2 Harrison Wells,3 Jessica M. Smith,3 Jessica Furtado,1,4 Megan M. Constans,3 Diana L. Escobar,3 Aron M. Geurts,5 Vicente E. Torres,3 and Peter C. Harris 1,3 Due to the number of contributing authors, the affiliations are listed at the end of this article. ABSTRACT Background Autosomal recessive polycystic kidney disease (ARPKD) and autosomal dominant polycystic kidney disease (ADPKD) are genetically distinct, with ADPKD usually caused by the genes PKD1 or PKD2 (encoding polycystin-1 and polycystin-2, respectively) and ARPKD caused by PKHD1 (encoding fibrocys- tin/polyductin [FPC]). Primary cilia have been considered central to PKD pathogenesis due to protein localization and common cystic phenotypes in syndromic ciliopathies, but their relevance is questioned in the simple PKDs. ARPKD’s mild phenotype in murine models versus in humans has hampered investi- gating its pathogenesis. Methods To study the interaction between Pkhd1 and Pkd1, including dosage effects on the phenotype, we generated digenic mouse and rat models and characterized and compared digenic, monogenic, and wild-type phenotypes. Results The genetic interaction was synergistic in both species, with digenic animals exhibiting pheno- types of rapidly progressive PKD and early lethality resembling classic ARPKD. Genetic interaction be- tween Pkhd1 and Pkd1 depended on dosage in the digenic murine models, with no significant enhancement of the monogenic phenotype until a threshold of reduced expression at the second locus was breached.
    [Show full text]
  • Table 2. Significant
    Table 2. Significant (Q < 0.05 and |d | > 0.5) transcripts from the meta-analysis Gene Chr Mb Gene Name Affy ProbeSet cDNA_IDs d HAP/LAP d HAP/LAP d d IS Average d Ztest P values Q-value Symbol ID (study #5) 1 2 STS B2m 2 122 beta-2 microglobulin 1452428_a_at AI848245 1.75334941 4 3.2 4 3.2316485 1.07398E-09 5.69E-08 Man2b1 8 84.4 mannosidase 2, alpha B1 1416340_a_at H4049B01 3.75722111 3.87309653 2.1 1.6 2.84852656 5.32443E-07 1.58E-05 1110032A03Rik 9 50.9 RIKEN cDNA 1110032A03 gene 1417211_a_at H4035E05 4 1.66015788 4 1.7 2.82772795 2.94266E-05 0.000527 NA 9 48.5 --- 1456111_at 3.43701477 1.85785922 4 2 2.8237185 9.97969E-08 3.48E-06 Scn4b 9 45.3 Sodium channel, type IV, beta 1434008_at AI844796 3.79536664 1.63774235 3.3 2.3 2.75319499 1.48057E-08 6.21E-07 polypeptide Gadd45gip1 8 84.1 RIKEN cDNA 2310040G17 gene 1417619_at 4 3.38875643 1.4 2 2.69163229 8.84279E-06 0.0001904 BC056474 15 12.1 Mus musculus cDNA clone 1424117_at H3030A06 3.95752801 2.42838452 1.9 2.2 2.62132809 1.3344E-08 5.66E-07 MGC:67360 IMAGE:6823629, complete cds NA 4 153 guanine nucleotide binding protein, 1454696_at -3.46081884 -4 -1.3 -1.6 -2.6026947 8.58458E-05 0.0012617 beta 1 Gnb1 4 153 guanine nucleotide binding protein, 1417432_a_at H3094D02 -3.13334396 -4 -1.6 -1.7 -2.5946297 1.04542E-05 0.0002202 beta 1 Gadd45gip1 8 84.1 RAD23a homolog (S.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • 4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
    Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4).
    [Show full text]