Major Caribbean and Central American frog faunas originated by ancient ... http://evo.bio.psu.edu/hedgeslab_site/Publications/PDF-files/189-SIt.htm
Please see PNAS web site (www.pnas.org) for official versions of these documents. These are copies.
SI Text
Taxonomic Considerations. The recent discovery that Brachycephalus is allied with the eleutherodactylines (1, 2) has made uncertain the valid family name for Eleutherodactylus and its relatives. However, the decision to place all ~800 species of eleutherodactylines in the family Brachycephalidae (2, 3) was based on analysis of 16 eleutherodactyline species, only six of which were from South America (2). In our analyses here of many more species, Brachycephalus appears in a basal position in the trees and does not group significantly with any species or clade of eleutherodactylines (SI Figs. 5-13). The association of Brachycephalus with the eleutherodactyline lineage, in itself, does not require the use of the family name Brachycephalidae for the entire assemblage. If multiple families are recognized, the correct allocation of these names will depend on a more robust phylogeny, especially concerning the basal branches. For example, Brachycephalidae might be appropriate only for Brachycephalus, with one or more other family names applied to the eleutherodactylines. Also, the suggestion by Frost et al. (2) that two genera of eleutherodactylines might be close relatives of Brachycephalus was not supported in a recent morphological study (4). For these reasons, we use Brachycephalidae as a family name only for Brachycephalus and refer in this current study to the remaining assemblage of genera and species as "eleutherodactyline" frogs, pending further study.
Assignment of unsampled species to the major clades (genera) defined here (SI Table 2) was based largely on their species-group affiliation. Although our analyses show many changes in content for previously defined species groups, most species assigned to the same species group are placed here in the same genus. Exceptions include Phrynopus and species from southeast Brazil, which will require further systematic study (see below).
We restrict the generic name Eleutherodactylus Duméril and Bibron, 1841 (type species, Hylodes martinicensis) to the Caribbean Clade and continue recognition of the included subgenera. The subgenus Eleutherodactylus is now restricted to the West Indies, and Syrrhophus includes two species in Cuba (E. symingtoni and E. zeus), besides those in Middle America. Eleutherodactylus counouspeus will be assigned to a new subgenus elsewhere. We consider Eleutherodactylus planirostris rogersi as a species (Eleutherodactylus rogersi) distinct from E. planirostris because they were not found to be closest relatives.
Because sequence data are unavailable for the type species of Phrynopus Peters, 1873 (Phrynopus peruanus), it is not possible to allocate that generic name to the separate clades defined here as including species of "Phrynopus," and, therefore, we make no changes in their generic status. The molecular phylogeny (Fig. 2) places into question the validity of the morphological species groups, restricting us from making any assumptions about species believed to be closely related to P. peruanus based on morphology.
The Southeast Brazil Clade is a similar situation in that we lack sequence data for the type species (Eleutherodactylus verrucosus) of the earliest possible generic name for the group, Ischnocnema Reinhardt and Lütken, 1862. However, in this case, we have confidence that the generic name Eleutherodactylus (The Caribbean Clade) does not apply to any of the species, based on geography and morphology (5-7). Also, our analyses (Fig. 2) indicate that E. binotatus and, by implication, its close relative E. plicifer, belong to a separate genus that we will name elsewhere. These two species also have an unusually long first finger which appears to set them apart from almost all of the other species of Eleutherodactylus in southeast Brazil except E. paulodutrai and E. ramagii, which differ significantly in other characters (5, 6). Although the number of species in this study from the Southeast Brazil Clade is small (four), they represent several clusters of species, each sharing a suite of morphological traits indicating relatedness (5-9). By implication, this increases the size of the clade to a minimum of 12 species: E. epipedus, E. erythromerus, E. gualteri, E. guentheri, E. hoehnei, E. izecksohni, E. juipoca, E. nasutus, E. oeus, E. parvus, E. pusillus, and E. vinhai.
Until additional data are collected, we cannot say with confidence that E. verrucosus and the remaining species of Eleutherodactylus in southeastern Brazil belong to this Southeast Brazil Clade. Nonetheless, those remaining species form several clusters themselves (e.g., lacteus group and ramagii group) and some species, in the past, have been placed in the same morphological species group (6) along with species that we confidently place in the Southeast Brazil Clade. Until further study can clarify the relationships of these species, and considering the geographic isolation of this group, we assign all of the species of Eleutherodactylus in southeastern Brazil (excluding E. binotatus and E. plicifer) to the genus Ischnocnema.
For the large South American Clade, we resurrect the name Pristimantis Jiménez de la Espada, 1870 (type species, Pristimantis galdi). P. galdi has been placed in the unistrigatus group of Eleutherodactylus (10), a species group that contains species that appear in the South American Clade in our analyses. After this study was completed, we obtained sequence of this species and have confirmed that it is highly nested in the South American Clade. For the clade encompassing members of the anomalus, bufoniformis, and sulcatus groups, we apply the available name Limnophys Jiménez de la Espada, 1871 (type species, Limnophys cornutus). The clade including members of the dolops and nigrovittatus groups, as well as some species of Phrynopus, requires a new generic name, which will be described elsewhere. Further details on all of these taxonomic decisions will be treated elsewhere by us in a monograph on the classification of this complex of >800 species.
Geographic Distributions of Major Clades. Although the three major clades (the Caribbean Clade, the Middle American Clade, and the South American Clade) are strongly associated with geography, each includes species that occur in other areas. In the Caribbean Clade, 24 members of the subgenus Syrrhophus (all except Eleutherodactylus zeus and E. symingtoni) occur in North and Middle America. In the Middle American Clade, five species (Craugastor crassidigitus, C. fitzingeri, C. longirostris, C. opimus, and C. raniformis) occur in both Central and South America, and one (C. biporcatus) is endemic to South America. In the South American Clade, two species are endemic to the Lesser Antilles (Pristimantis euphronides and P. shrevei), nine are endemic to southern Central America (P. altae, P. cerasinus, P. diastema, P. hylaeformis, P. laticorpus, P. museosus, P. pardalis, P. pirrensis, and P. tigrillo), and nine are found in Central and South America (P. achatinus, P. caryophyllaceus, P. cruentus, P. gaigeae, P. moro, P. quidditus, P. ridens, P. taeniatus, and P. vocator). It can be assumed that those species of Craugastor and Pristimantis occurring in both Central and South America achieved their current distributions through Pliocene or later overland dispersal. However, the possibility of over-water dispersal for C. biporcatus or endemic Central American Pristimantis cannot be excluded. Our data set includes none of these endemics, so no determination based on times of divergence can be made. Thus, recent (<3 Mya) speciation or overland dispersal, followed by source-area extinction, or earlier over-water dispersal all remain possible explanations for the current distributions of these species.
Data Collection. In addition to broadly sampling the eleutherodactyline genera, our data set also spans a broad geographic range. Included were seven eleutherodactyline species from Southeast Brazil (plus one species of Brachycephalus), 116 from other parts of South America, 19 Middle American species, and 140 West Indian species. These regions respectively contain totals of 47, 477, 154, and 149 described species.
Tissue samples were hand-collected by using approved methods (Pennsylvania State University Institutional Animal Care and Use Committee approval 17632, for those collected by S.B.H.). They were frozen in liquid nitrogen or preserved in ethanol and kept cold during transport. Additional ethanol-preserved or frozen tissue samples were obtained from museum sources or other researchers. In the laboratory, samples were maintained at -80°C. In addition to sequences generated from these tissues, additional sequences were obtained from GenBank. SI Table 4 lists all individual specimens used in this study, including source, tissue collection number (if applicable), museum voucher number (if available), genes sampled, and corresponding GenBank accession numbers for each sequence. We chose the 12S and 16S genes because of their slower rate of evolution, as compared to other mitochondrial genes, in an attempt to avoid saturation problems (multiple nucleotide substitutions at the same site). The fragment of nuclear gene Tyr was chosen because it has proven informative in other anuran studies (2, 11). The fragment of nuclear gene Rag-1 is from the relatively faster-evolving first half of the gene.
Genomic DNA was extracted using the Qiagen DNeasy tissue extraction kit under the manufacturer's protocol. PCR amplification of samples was performed in 50-ml reactions using AmpliTaq DNA polymerase and ThermoPol buffer (New England Biolabs). For amplification of mitochondrial genes, each reaction contained ThermoPol buffer at 1×, dNTPs at 4 mM, forward and reverse primers at 1 mM, one unit of polymerase, and 1 ml of extracted DNA (more for low-quality tissue). For amplification of nuclear genes, dNTP was increased to 6.6 mM, polymerase to 2.5 units, and extracted DNA to 5 ml. Standard reaction conditions were an initial hold for 5 min at 94°C, followed by 40 cycles of 94°C for 30 s, 50°C for 30 s, and 72°C for 60 s. After 40 cycles, a final hold of 72°C for 7 min was performed before terminating the reaction at 4°C. For low- or nonyielding samples, annealing temperature was dropped from 50°C to 46°C. Primers used in PCR reactions were obtained from the literature or designed in the lab (see SI Table 5). Amplified PCR products were isolated by running on agarose gels and filtering with Millipore Ultrafree-DA gel filters or by vacuum filtration using Millipore Multiscreen filters.
Cycle sequencing was performed by using either the Amersham Pharmacia DYEnamic ET terminator cycle sequencing kit or ABI BigDye terminator cycle sequencing kit under manufacturers' guidelines. DNA sequencing was performed with an ABI 3100-Avant or 3730 genetic analyzer. Cycle sequencing and analysis were performed by the authors or by the Pennsylvania State University Nucleic Acid Facility. All fragments were sequenced in both forward and reverse directions.
Before analyses involving any sequence, all chromatograms were fully inspected, and all sequences were compared against their reverse complement to detect any call errors. Embedded primer sequences were deleted from all sequence fragments before assembly or alignment. Alignments of 12S and 16S sequences were created by using CLUSTAL X under default parameters. Resulting alignments were inspected for errors and compared against secondary structure models available from the European ribosomal RNA database. Regions of
1 of 33 9/28/2010 9:23 AM Major Caribbean and Central American frog faunas originated by ancient ... http://evo.bio.psu.edu/hedgeslab_site/Publications/PDF-files/189-SIt.htm
uncertain homology were excluded from analysis. Sequences for Rag-1 and Tyr were aligned by eye.
Phylogenetic Analyses. In certain cases, species deemed important to the study were missing large parts of data for one gene. This was due in part to the lack of available tissues or GenBank sequences and in part to the inability to amplify or sequence certain regions. In these instances, the available sequences were used, and unknown regions were coded as missing data. Additionally, 7 species in the 65-species data set were missing data for one of the two nuclear genes (SI Table 4). In the case of Limnophys anomalus, the sequence of the closely related species L. bufoniformis was substituted for the Tyr fragment because L. anomalus was the only species of Limnophys in the 65 species data set and Tyr is the least variable gene in our study.
Model choice for likelihood and minimum evolution analyses were based partly on the limitations of the software packages used. Our preferred model for all analyses was GTR + I + G. However, neither RAxML nor MEGA can employ this model. Therefore, substitute models available in each package close to the GTR + I + G model were chosen for likelihood and minimum evolution analyses.
Bayesian analyses were run for 20,000,000 (280-species), 10,000,000 (146-species), or 2,000,000 (65-species) generations with three heated and one cold chain. Chains were sampled every 1,000, 500, or 100 generations, respectively. The first 25% of samples were discarded as burn-in. To ensure that this was an adequate number of samples discarded for each analysis, plots of log likelihood vs. generation were produced for every Bayesian analysis. In all cases, the region of increasing log likelihood values was encompassed in the first 25% of samples. Convergence for each Bayesian analysis was assessed by using the program Tracer 1.3 (12) to obtain estimated sample sizes for each model parameter (six substitution frequency categories, four nucleotide frequency categories, g-parameter, proportion of invariant sites, tree length, and log likelihood). Estimated sample sizes of each parameter were >100 for both independent runs of nearly all analyses, except for a substitution frequency (ESS = 99) and a nucleotide frequency parameter (ESS = 90) for one of the 146-species runs, the tree length parameter (ESS = 98) for the other 146-species run, and the tree length parameter (ESS = 94) for one run of the 65-species nuclear + mitochondrial data set. All ESS values were >200 when the two independent runs of each analysis were combined.
For the 65-species dataset, ME, ML, and Bayesian analyses were run with the nuclear gene data set separately (data not shown). The same major clades appeared in all of these analyses.
Divergence Time Estimation. Geologic times and boundaries of periods used here are from a recent update (13). The five chosen calibrations were based on several independent lines of evidence. Jamaica did not become permanently emergent until 10 Mya (14, 15), setting a maximum time for basal divergences in the Jamaican clade (including representative species E. gossei and E. luteolus). The Hispaniolan South Island has a similar geologic history (16), setting a maximum time of 10 Mya for the basal divergence in the South Island clade (e.g., between representative species E. thorectes and E. caribe). An Eleutherodactylus fossil in amber from northern Hispaniola (17) is dated 15-20 Mya (18). The fossil is assumed to be in the subgenus Eleutherodactylus based on location (North Island of Hispaniola), age (older than uplift of South Island), and normal head width as compared with members of the subgenus Pelorius (which are wide-headed) (19). This establishes a minimum date for the origin of the lineage leading to the subgenus Eleutherodactylus on Hispaniola (divergence of the subgenera Pelorius and Eleutherodactylus). Australian hylids (pelodryadines) are most closely related to South American hylids (phyllomedusines), and probably arrived by overland dispersal via Antarctica (20, 21). The time window for this dispersal was 35-70 Mya (22-25), providing constraints for the divergence of representatives Litoria caerulea and Agalychnis callidryas.
Multidivtime requires prior estimates for rttm, rtsd, rtrate, rtratesd, brownmean, brownsd, and bigtime. The prior for the rttm (in-group root) parameter was set at 65 Mya based on recent data (26) that place hyloid family divergences near the K-T boundary. Rttmsd, the standard deviation of rttm, was set at 25 Mya. This is a conservative estimate, considering that the true date of the ingroup root is almost certainly less than one standard deviation from rttm in either direction. Higher values of rttm (80 Mya) and rttmsd (40 Mya) were also used to test their results on timing analyses. The prior for rtrate was set at 0.0075 for the mt analysis, 0.0015 for the nuclear analysis, and 0.0035 for the combined analysis. These values were obtained by first dividing the typical root-to-tip branch length for each gene (as determined by estbranches in the Multidivtime package) by rttm, and then taking the average of these values for the genes used in each respective analysis. As a conservative measure, the prior for rtratesd was set equal to rtrate in each analysis. The prior for brownmean was set at 0.0125, arrived at by dividing one by rttm. The prior for brownsd was set equal to brownmean because of the large measure of uncertainty in the prior for brownmean. Bigtime was set at 150 Mya. All other parameters (minab, newk, othk, thek) were maintained at default values. Analyses were run for 1,100,000 generations, with a sample frequency of 100 after a burn-in of 100,000 generations.
In addition to the times presented (SI Table 3), analyses were also performed with higher values for the rttm and rttmsd priors (see SI Text). Changing these priors had little effect on resulting dates, which differed by <3% when both rttm and rttmsd are increased, and by even less if only one of the priors was increased.
1. Darst CR, Cannatella DC (2004) Mol Phylogenet Evol 31:462-475.
2. Frost DR, Grant T, Faivovich J, Bain RH, Haas A, Haddad CFB, De Sa RO, Channing A, Wilkinson M, Donnellan SC, et al. (2006) Bull Am Mus Nat Hist 297:1-371.
3. Frost DR (2007) Amphibian Species of the World: An Online Reference. Version 5.0 (American Museum of Natural History, New York) http://research.amnh.org/herpetology /amphibia/index.php.
4. Da Silva HR, Campos LA, Sebben A (2007) Zootaxa 1422:59-68.
5. Heyer WR (1984) Smithson Contrib Zool 402:1-42.
6. Lynch JD (1976) Occ Pap Mus Nat Hist Univ Kansas 61:1-24.
7. Lynch JD, Duellman WE (1997) Univ Kansas Spec Publ 23:1-236.
8. Caramaschi U, Kisteumacher G (1989) Herpetologica 44:423-426.
9. Castanho LM, Haddad CFB (2000) Copeia 2000:777-781.
10. Duellman WE, Pramuk JB (1999) Sci Pap Nat Hist Mus Univ Kansas 13:1-78.
11. Bossuyt F, Milinkovitch MC (2000) Proc Natl Acad Sci USA 97:6585-6590.
12. Rambaut A, Drummond A (2005) Tracer version 1.3 (University of Oxford, Oxford).
13. Gradstein FM, Ogg JG, Smith AG, eds (2005) A Geologic Timescale 2004 (Cambridge Univ Press, Cambridge, UK).
14. Mitchell SF (2004) Cainozoic Res 3:5-30.
15. Donovan SK (2002) Geology Today 18:143-151.
16. Iturralde-Vinent MA, MacPhee RDE (1999) Bull Am Mus Nat Hist 238:1-95.
17. Poinar GO, Cannatella DC (1987) Science 237:1215-1216.
18. Iturralde-Vinent MA, MacPhee RDE (1996) Science 273:1850-1852.
19. Hedges SB (1989) in Biogeography of the West Indies: Past, Present, and Future, ed Woods CA (Sandhill Crane, Gainesville, FL), pp 305-370.
20. Maxson LR, Wilson AC (1975) Nature 255:397-400.
21. Duellman WE, Trueb L (1986) Biology of Amphibians (McGraw-Hill, New York).
2 of 33 9/28/2010 9:23 AM Major Caribbean and Central American frog faunas originated by ancient ... http://evo.bio.psu.edu/hedgeslab_site/Publications/PDF-files/189-SIt.htm
22. Sanmartin I, Ronquist F (2004) Syst Biol 53:216-243.
23. Woodburne MO, Case JA (1996) J Mamm Evol 3:121-161.
24. Li ZX, Powell CM (2001) Earth-Sci Rev 53:237-277.
25. Springer MS, Westerman M, Kavanagh JR, Burk A, Woodburne MO, Kao DJ, Krajewski C (1998) Proc R Soc London Ser B 265:2381-2386.
26. Roelants K, Gower DJ, Wilkinson M, Loader SP, Biju SD, Guillaume K, Moriau L, Bossuyt F (2007) Proc Natl Acad Sci USA 104:887-892.
Table 2. Taxonomic listing of all eleutherodactylines and Brachycephalus (812 sp.)
Spix, 1824 "Eleutherodactylus" binotatus*
Boulenger, 1888 "Eleutherodactylus" plicifer*
Boulenger, 1902 "Eleutherodactylus" cruralis†
Peracca, 1895 "Eleutherodactylus" discoidalis†
Miranda-Ribeiro, 1937 "Eleutherodactylus" heterodactylus†
Reichle, Lötters and de la Riva, 2001 "Eleutherodactylus" ibischi†
Padial, Gonzáles, and De la Riva, 2005 "Eleutherodactylus" madidi†
Lynch, 1975 "Eleutherodactylus" pereger
Reichle and Köhler, 1997 "Eleutherodactylus" zongoensis†
Lynch, 2003 "Eleutherodactylus" adercus‡
Duellman and Pramuk, 1999 "Eleutherodactylus" araiodactylus‡
Lynch, 1989 "Eleutherodactylus" babax‡
Lynch and Duellman, 1980 "Eleutherodactylus" dolops‡
Lynch, 1973 "Eleutherodactylus" elassodiscus‡
Duellman, 2000 "Eleutherodactylus" fallaciosus‡
Parker, 1938 "Eleutherodactylus" flavomaculatus‡
Lynch, 1989 "Eleutherodactylus" latens‡
Cannatella, 1984 "Eleutherodactylus" lucida‡
Lehr, 2005 "Eleutherodactylus" lundbergi‡
Boulenger, 1908 "Eleutherodactylus" mantipus‡
Cannatella, 1984 "Eleutherodactylus" nebulanastes‡
Andersson, 1945 "Eleutherodactylus" nigrovittatus‡
Lynch, 1975 "Phrynopus" brunneus‡
Lynch, 1975 "Phrynopus" peraccai‡
3 of 33 9/28/2010 9:23 AM Major Caribbean and Central American frog faunas originated by ancient ... http://evo.bio.psu.edu/hedgeslab_site/Publications/PDF-files/189-SIt.htm
Hoogmoed and Lescure, 1984 Adelophryne adiastola
Hoogmoed, Borges, and Cascon, 1994 Adelophryne baturitensis
Hoogmoed and Lescure, 1984 Adelophryne gutturosa
Hoogmoed, Borges, and Cascon, 1994 Adelophryne maranguapensis
Hoogmoed, Borges, and Cascon, 1994 Adelophryne pachydactyla
Lynch and Ruiz-Carranza, 1982 Atopophrynus syntomopus
Boulenger, 1898 Barycholos pulcher
Miranda-Ribeiro, 1937 Barycholos ternetzi
Pombal and Gasparini, 2006 Brachycephalus alipioi
Ribero, Alves, Haddad, and Dos Reis, 2005 Brachycephalus brunneus
Izecksohn, 1971 Brachycephalus didactylus
Spix, 1824 Brachycephalus ephippium
Alves, Ribeiro, Haddad, and Dos Reis, 2006 Brachycephalus ferruginus
Giaretta and Sawaya, 1998 Brachycephalus hermogenesi
Ribero, Alves, Haddad, and Dos Reis, 2005 Brachycephalus izecksohni
Miranda-Ribeiro, 1920 Brachycephalus nodoterga
Pombal, Wistuba, and Bornschein, 1998 Brachycephalus pernix
Alves, Ribeiro, Haddad, and Dos Reis, 2006 Brachycephalus pombali
Pombal, 2001 Brachycephalus vertebralis
Campbell, 1994 Craugastor adamastus
Boulenger, 1898 Craugastor alfredi
Campbell and Savage, 2000 Craugastor amniscola
Savage, McCranie and Wilson, 1988 Craugastor anciano
Savage, 1974 Craugastor andi
Savage, 1975 Craugastor angelicus
Campbell, 1994 Craugastor aphanus
Dugès, 1879 Craugastor augusti
Savage, McCranie and Wilson, 1988 Craugastor aurilegulus
Savage, 1975 Craugastor azueroensis
Taylor, 1940 Craugastor batrachylus
Peters, 1870 Craugastor berkenbuschii
4 of 33 9/28/2010 9:23 AM Major Caribbean and Central American frog faunas originated by ancient ... http://evo.bio.psu.edu/hedgeslab_site/Publications/PDF-files/189-SIt.htm
Peters, 1863 Craugastor biporcatus
Brocchi, 1877 Craugastor bocourti
Cope, 1886 Craugastor bransfordii
Boulenger, 1882 Craugastor brocchi
Smith, 2005 Craugastor campbelli
Campbell and Savage, 2000 Craugastor catalinae
Savage, 1987 Craugastor chac
Campbell and Savage, 2000 Craugastor charadra
McCranie, Savage and Wilson, 1989 Craugastor chrysozetetes
McCranie and Köhler, 1999 Craugastor coffeus
Taylor, 1952 Craugastor crassidigitus
McCranie, Savage and Wilson, 1989 Craugastor cruzi
Savage, 1980 Craugastor cuaquero
McCranie and Smith, 2006 Craugastor cyanochthebius
Ford and Savage, 1984 Craugastor daryi
Taylor, 1942 Craugastor decoratus
Lynch, 1985 Craugastor emcelae
Dunn and Emlen, 1932 Craugastor emleni
McCranie and Wilson, 1997 Craugastor epochthidius
Savage, 1975 Craugastor escoces
McCranie and Wilson, 1997 Craugastor fecundus
Schmidt, 1857 Craugastor fitzingeri
Boettger, 1892 Craugastor fleischmanni
Canseco-Márquez and Smith, 2004 Craugastor galacticorhinus
Lynch, 1967 Craugastor glaucus
Peters, 1863 Craugastor gollmeri
Bumzahem, 1955 Craugastor greggi
Lynch, 1967 Craugastor guerreroensis
Cope, 1875 Craugastor gulosus
Taylor, 1937 Craugastor hobartsmithi
Campbell and Savage, 2000 Craugastor inachus
5 of 33 9/28/2010 9:23 AM Major Caribbean and Central American frog faunas originated by ancient ... http://evo.bio.psu.edu/hedgeslab_site/Publications/PDF-files/189-SIt.htm
Lynch, 1980 Craugastor jota
Werner, 1896 Craugastor laevissimus
Duméril, 1853 Craugastor laticeps
Savage, McCranie and Espinal, 1996 Craugastor lauraster
Brocchi, 1879 Craugastor lineatus
Shannon and Werler, 1955 Craugastor loki
Boulenger, 1898 Craugastor longirostris
Taylor, 1941 Craugastor matudai
Cope, 1875 Craugastor megacephalus
Shannon and Werler, 1955 Craugastor megalotympanum
Cope, 1875 Craugastor melanostictus
Schmidt, 1933 Craugastor merendonensis
Brocchi, 1877 Craugastor mexicanus
Schmidt, 1933 Craugastor milesi
Taylor, 1955 Craugastor mimus
Dunn, 1940 Craugastor monnichorum
Lynch, 1965 Craugastor montanus
Savage, 2000 Craugastor myllomyllon
Smith, 2005 Craugastor nefrens
Barbour and Dunn, 1921 Craugastor noblei
Barbour, 1928 Craugastor obesus
Taylor, 1941 Craugastor occidentalis
McCranie and Wilson, 1999 Craugastor olanchano
Günther, 1900 Craugastor omiltemanus
McCranie and Wilson, 1997 Craugastor omoaensis
Savage and Myers, 2002 Craugastor opimus
Campbell and Savage, 2000 Craugastor palenque
McCranie and Wilson, 1999 Craugastor pechorum
Campbell and Savage, 2000 Craugastor pelorus
Barbour, 1926 Craugastor persimilis
Lips and Savage, 1996 Craugastor phasma
6 of 33 9/28/2010 9:23 AM Major Caribbean and Central American frog faunas originated by ancient ... http://evo.bio.psu.edu/hedgeslab_site/Publications/PDF-files/189-SIt.htm
Cope, 1875 Craugastor podiciferus
Campbell, Lamar and Hillis, 1989 Craugastor polymniae
Cope, 1886 Craugastor polyptychus
Johnson and Savage, 1995 Craugastor pozo
Campbell, Savage and Meyer, 1994 Craugastor psephosypharus
Peters, 1863 Craugastor punctariolus
Taylor, 1937 Craugastor pygmaeus
Boulenger, 1896 Craugastor raniformis
Cope, 1886 Craugastor ranoides
Savage and DeWeese, 1979 Craugastor rayo
Cope, 1867 Craugastor rhodopis
Campbell and Savage, 2000 Craugastor rhyacobatrachus
Campbell and Savage, 2000 Craugastor rivulus
Werner, 1896 Craugastor rostralis
Peters, 1873 Craugastor rugosus
Cope, 1870 Craugastor rugulosus
Campbell and Savage, 2000 Craugastor rupinius
Campbell and Savage, 2000 Craugastor sabrinus
McCranie and Wilson, 1997 Craugastor saltuarius
Schmidt, 1941 Craugastor sandersoni
Lynch, 1967 Craugastor silvicola
Smith, 1939 Craugastor spatulatus
Schmidt, 1936 Craugastor stadelmani
Cope, 1893 Craugastor stejnegerianus
Lynch, 1967 Craugastor stuarti
Craugastor tabasarae Savage, Hollingsworth, Lips, and Jaslow, 2004
Dunn, 1931 Craugastor talamancae
Taylor, 1940 Craugastor tarahumaraensis
Taylor, 1958 Craugastor taurus
Lynch, 1966 Craugastor taylori
Campbell, 1994 Craugastor trachydermus
7 of 33 9/28/2010 9:23 AM Major Caribbean and Central American frog faunas originated by ancient ... http://evo.bio.psu.edu/hedgeslab_site/Publications/PDF-files/189-SIt.htm
Boulenger, 1896 Craugastor underwoodi
Savage, 1984 Craugastor uno
Taylor, 1940 Craugastor vocalis
Shannon and Werler, 1955 Craugastor vulcani
Stuart, 1941 Craugastor xucanebi
Lynch, 1965 Craugastor yucatanensis
Ayarzagüena, 1985 Dischidodactylus colonnelloi
Rivero, 1968 Dischidodactylus duidensis
Cochran, 1923 Eleutherodactylus (Eleutherodactylus) abbotti
Kaiser, Green and Schmid, 1994 Eleutherodactylus (Eleutherodactylus) amplinympha
Reinhardt and Lütken, 1863 Eleutherodactylus (Eleutherodactylus) antillensis
Cochran, 1934 Eleutherodactylus (Eleutherodactylus) audanti
Noble, 1923 Eleutherodactylus (Eleutherodactylus) auriculatoides
Cope, 1862 Eleutherodactylus (Eleutherodactylus) auriculatus
Lynch, 1965 Eleutherodactylus (Eleutherodactylus) barlagnei
Schwartz, 1960 Eleutherodactylus (Eleutherodactylus) bartonsmithi
Schmidt, 1920 Eleutherodactylus (Eleutherodactylus) brittoni
Grant, 1932 Eleutherodactylus (Eleutherodactylus) cochranae
Grant, 1932 Eleutherodactylus (Eleutherodactylus) cooki
Thomas, 1966 Eleutherodactylus (Eleutherodactylus) coqui
Dunn, 1926 Eleutherodactylus (Eleutherodactylus) eileenae
Rivero, 1959 Eleutherodactylus (Eleutherodactylus) eneidae
Noble, 1923 Eleutherodactylus (Eleutherodactylus) flavescens
Schwartz, 1973 Eleutherodactylus (Eleutherodactylus) fowleri
Estrada and Hedges, 1997 Eleutherodactylus (Eleutherodactylus) glamyrus
Schmidt, 1920 Eleutherodactylus (Eleutherodactylus) gryllus
Hedges, Estrada and Thomas, 1992 Eleutherodactylus (Eleutherodactylus) guantanamera
Barbour, 1942 Eleutherodactylus (Eleutherodactylus) haitianus
Rivero, 1963 Eleutherodactylus (Eleutherodactylus) hedricki
Schwartz, 1960 Eleutherodactylus (Eleutherodactylus) ionthus
Drewry and Jones, 1976 Eleutherodactylus (Eleutherodactylus) jasperi
8 of 33 9/28/2010 9:23 AM Major Caribbean and Central American frog faunas originated by ancient ... http://evo.bio.psu.edu/hedgeslab_site/Publications/PDF-files/189-SIt.htm
Barbour, 1914 Eleutherodactylus (Eleutherodactylus) johnstonei
Grant, 1931 Eleutherodactylus (Eleutherodactylus) karlschmidti
Schwartz, 1973 Eleutherodactylus (Eleutherodactylus) lamprotes
Schwartz, 1965 Eleutherodactylus (Eleutherodactylus) leberi
Schmidt, 1920 Eleutherodactylus (Eleutherodactylus) locustus
Hedges, Estrada and Thomas, 1992 Eleutherodactylus (Eleutherodactylus) mariposa
Tschudi, 1838 Eleutherodactylus (Eleutherodactylus) martinicensis
Hedges, Estrada and Thomas, 1992 Eleutherodactylus (Eleutherodactylus) melacara
Noble, 1923 Eleutherodactylus (Eleutherodactylus) minutus
Schmidt, 1919 Eleutherodactylus (Eleutherodactylus) montanus
Schwartz, 1964 Eleutherodactylus (Eleutherodactylus) parabates
Schwartz, 1965 Eleutherodactylus (Eleutherodactylus) patriciae
Schwartz, 1967 Eleutherodactylus (Eleutherodactylus) pinchoni
Schwartz, 1965 Eleutherodactylus (Eleutherodactylus) pituinus
Cochran, 1938 Eleutherodactylus (Eleutherodactylus) poolei
Schmidt, 1927 Eleutherodactylus (Eleutherodactylus) portoricensis
Estrada and Hedges, 1997 Eleutherodactylus (Eleutherodactylus) principalis
Stejneger, 1904 Eleutherodactylus (Eleutherodactylus) richmondi
Schwartz, 1960 Eleutherodactylus (Eleutherodactylus) ronaldi
Thomas, 1966 Eleutherodactylus (Eleutherodactylus) schwartzi
Stejneger, 1904 Eleutherodactylus (Eleutherodactylus) unicolor
Gundlach and Peters, 1864 Eleutherodactylus (Eleutherodactylus) varians
Cochran, 1932 Eleutherodactylus (Eleutherodactylus) wetmorei
Schmidt, 1920 Eleutherodactylus (Eleutherodactylus) wightmanae
Schwartz, 1960 Eleutherodactylus (Euhyas) acmonis
Diaz, Cadiz and Hedges, 2003 Eleutherodactylus (Euhyas) adelus
Barbour and Shreve, 1937 Eleutherodactylus (Euhyas) albipes
Schwartz, 1971 Eleutherodactylus (Euhyas) alcoae
Lynn, 1937 Eleutherodactylus (Euhyas) alticola
Hedges, Thomas and Franz, 1987 Eleutherodactylus (Euhyas) amadeus
Lynn, 1937 Eleutherodactylus (Euhyas) andrewsi
9 of 33 9/28/2010 9:23 AM Major Caribbean and Central American frog faunas originated by ancient ... http://evo.bio.psu.edu/hedgeslab_site/Publications/PDF-files/189-SIt.htm
Schwartz, 1973 Eleutherodactylus (Euhyas) apostates
Noble and Hassler, 1933 Eleutherodactylus (Euhyas) armstrongi
Dunn, 1925 Eleutherodactylus (Euhyas) atkinsi
Cochran, 1935 Eleutherodactylus (Euhyas) bakeri
Estrada, Diaz and Rodriguez, 1998 Eleutherodactylus (Euhyas) blairhedgesi
Schwartz, 1960 Eleutherodactylus (Euhyas) bresslerae
Shreve, 1936 Eleutherodactylus (Euhyas) brevirostris
Hedges and Thomas, 1992 Eleutherodactylus (Euhyas) caribe
Dunn, 1926 Eleutherodactylus (Euhyas) casparii
Lynn, 1954 Eleutherodactylus (Euhyas) cavernicola
Hedges and Thomas, 1992 Eleutherodactylus (Euhyas) corona
Barbour, 1942 Eleutherodactylus (Euhyas) cubanus
Dunn, 1926 Eleutherodactylus (Euhyas) cundalli
Cope, 1862 Eleutherodactylus (Euhyas) cuneatus
Cochran, 1935 Eleutherodactylus (Euhyas) darlingtoni
Cope, 1862 Eleutherodactylus (Euhyas) dimidiatus
Hedges and Thomas, 1992 Eleutherodactylus (Euhyas) dolomedes
Dunn, 1926 Eleutherodactylus (Euhyas) emiliae
Schwartz, 1958 Eleutherodactylus (Euhyas) etheridgei
Schwartz, 1973 Eleutherodactylus (Euhyas) eunaster
Shreve and Williams, 1963 Eleutherodactylus (Euhyas) furcyensis
Lynn and Dent, 1943 Eleutherodactylus (Euhyas) fuscus
Cochran, 1935 Eleutherodactylus (Euhyas) glandulifer
Shreve, 1936 Eleutherodactylus (Euhyas) glanduliferoides
Schwartz, 1973 Eleutherodactylus (Euhyas) glaphycompus
Schwartz and Fowler, 1973 Eleutherodactylus (Euhyas) glaucoreius
Schwartz, 1960 Eleutherodactylus (Euhyas) goini
Dunn, 1926 Eleutherodactylus (Euhyas) gossei
Dunn, 1926 Eleutherodactylus (Euhyas) grabhami
Schwartz, 1979 Eleutherodactylus (Euhyas) grahami
Dunn, 1926 Eleutherodactylus (Euhyas) greyi
10 of 33 9/28/2010 9:23 AM Major Caribbean and Central American frog faunas originated by ancient ... http://evo.bio.psu.edu/hedgeslab_site/Publications/PDF-files/189-SIt.htm
Crombie, 1986 Eleutherodactylus (Euhyas) griphus
Estrada and Rodriguez, 1985 Eleutherodactylus (Euhyas) guanahacabibes
Schmidt, 1920 Eleutherodactylus (Euhyas) gundlachi
Shreve and Williams, 1963 Eleutherodactylus (Euhyas) heminota
Estrada and Hedges, 1996 Eleutherodactylus (Euhyas) iberia
Barbour and Shreve, 1937 Eleutherodactylus (Euhyas) intermedius
Barbour, 1910 Eleutherodactylus (Euhyas) jamaicensis
Estrada and Alonso, 1997 Eleutherodactylus (Euhyas) jaumei
Cochran, 1937 Eleutherodactylus (Euhyas) jugans
Dunn, 1926 Eleutherodactylus (Euhyas) junori
Schwartz, 1959 Eleutherodactylus (Euhyas) klinikowskii
Cope, 1862 Eleutherodactylus (Euhyas) lentus
Shreve and Williams, 1963 Eleutherodactylus (Euhyas) leoncei
Cope, 1862 Eleutherodactylus (Euhyas) limbatus
Schwartz, 1980 Eleutherodactylus (Euhyas) lucioi
Gosse, 1851 Eleutherodactylus (Euhyas) luteolus
Díaz, Cádiz, and Navarro, 2005 Eleutherodactylus (Euhyas) maestrensis
Díaz, Cádiz, and Navarro, 2007 Eleutherodactylus (Euhyas) michaelschmidi
Meerwarth, 1901 Eleutherodactylus (Euhyas) monensis
Dunn, 1926 Eleutherodactylus (Euhyas) nubicola
Dunn, 1928 Eleutherodactylus (Euhyas) orcutti
Barbour and Shreve, 1973 Eleutherodactylus (Euhyas) orientalis
Duméril and Bibron, 1841 Eleutherodactylus (Euhyas) oxyrhyncus
Dunn, 1926 Eleutherodactylus (Euhyas) pantoni
Schwartz, 1964 Eleutherodactylus (Euhyas) paulsoni
Schwartz and Fowler, 1973 Eleutherodactylus (Euhyas) pentasyringos
Schwartz, 1960 Eleutherodactylus (Euhyas) pezopetrus
Cochran, 1935 Eleutherodactylus (Euhyas) pictissimus
Dunn, 1926 Eleutherodactylus (Euhyas) pinarensis
Cope, 1862 Eleutherodactylus (Euhyas) planirostris
Schwartz, 1965 Eleutherodactylus (Euhyas) probolaeus
11 of 33 9/28/2010 9:23 AM Major Caribbean and Central American frog faunas originated by ancient ... http://evo.bio.psu.edu/hedgeslab_site/Publications/PDF-files/189-SIt.htm
Schwartz, 1980 Eleutherodactylus (Euhyas) rhodesi
Duméril and Bibron, 1841 Eleutherodactylus (Euhyas) ricordii
Estrada and Hedges, 1998 Eleutherodactylus (Euhyas) riparius
Diaz, Estrada and Hedges, 2001 Eleutherodactylus (Euhyas) rivularis
Goin, 1955 Eleutherodactylus (Euhyas) rogersi
Noble and Hassler, 1933 Eleutherodactylus (Euhyas) rufifemoralis
Noble, 1923 Eleutherodactylus (Euhyas) schmidti
Schwartz, 1973 Eleutherodactylus (Euhyas) sciagraphus
Shreve, 1936 Eleutherodactylus (Euhyas) semipalmatus
Díaz and Fong, 2001 Eleutherodactylus (Euhyas) simulans
Crombie, 1977 Eleutherodactylus (Euhyas) sisyphodemus
Estrada and Hedges, 1996 Eleutherodactylus (Euhyas) tetajulia
Schwartz, 1959 Eleutherodactylus (Euhyas) thomasi
Hedges, 1988 Eleutherodactylus (Euhyas) thorectes
Estrada and Hedges, 1991 Eleutherodactylus (Euhyas) toa
Estrada and Hedges, 1997 Eleutherodactylus (Euhyas) tonyi
Barbour and Shreve, 1937 Eleutherodactylus (Euhyas) turquinensis
Dunn, 1925 Eleutherodactylus (Euhyas) varleyi
Shreve, 1936 Eleutherodactylus (Euhyas) ventrilineatus
Schwartz, 1976 Eleutherodactylus (Euhyas) warreni
Barbour, 1914 Eleutherodactylus (Euhyas) weinlandi
Schwartz, 1958 Eleutherodactylus (Euhyas) zugi
Schwartz, 1976 Eleutherodactylus (Pelorius) chlorophenax
Schwartz, 1965 Eleutherodactylus (Pelorius) hypostenor
Barbour, 1914 Eleutherodactylus (Pelorius) inoptatus
Schwartz, 1976 Eleutherodactylus (Pelorius) nortoni
Hedges and Thomas, 1987 Eleutherodactylus (Pelorius) parapelates
Noble, 1923 Eleutherodactylus (Pelorius) ruthae
Lynch, 1991 Eleutherodactylus (Syrrhophus) albolabris
Taylor, 1940 Eleutherodactylus (Syrrhophus) angustidigitorum
Cope, 1817 Eleutherodactylus (Syrrhophus) cystignathoides
12 of 33 9/28/2010 9:23 AM Major Caribbean and Central American frog faunas originated by ancient ... http://evo.bio.psu.edu/hedgeslab_site/Publications/PDF-files/189-SIt.htm
Lynch, 1970 Eleutherodactylus (Syrrhophus) dennisi
Davis and Dixon, 1955 Eleutherodactylus (Syrrhophus) dilatus
Dixon, 1957 Eleutherodactylus (Syrrhophus) grandis
Cope, 1979 Eleutherodactylus (Syrrhophus) guttilatus
Langebartel and Shannon, 1956 Eleutherodactylus (Syrrhophus) interorbitalis
Cope, 1879 Eleutherodactylus (Syrrhophus) leprus
Baird, 1859 Eleutherodactylus (Syrrhophus) longipes
Cope, 1878 Eleutherodactylus (Syrrhophus) marnockii
Hedges, 1989 Eleutherodactylus (Syrrhophus) maurus
Taylor, 1942 Eleutherodactylus (Syrrhophus) modestus
Peters, 1870 Eleutherodactylus (Syrrhophus) nitidus
Dixon and Webb, 1996 Eleutherodactylus (Syrrhophus) nivicolimae
Duellman, 1958 Eleutherodactylus (Syrrhophus) pallidus
Taylor, 1940 Eleutherodactylus (Syrrhophus) pipilans
Taylor and Smith, 1945 Eleutherodactylus (Syrrhophus) rubrimaculatus
Duellman and Dixon, 1959 Eleutherodactylus (Syrrhophus) rufescens
Webb, 1962 Eleutherodactylus (Syrrhophus) saxatilis
Schwartz, 1957 Eleutherodactylus (Syrrhophus) symingtoni
Hoyt, 1965 Eleutherodactylus (Syrrhophus) syristes
Duellman, 1958 Eleutherodactylus (Syrrhophus) teretistes
Cope, 1885 Eleutherodactylus (Syrrhophus) verrucipes
Peters, 1870 Eleutherodactylus (Syrrhophus) verruculatus
Schwartz, 1958 Eleutherodactylus (Syrrhophus) zeus
Schwartz, 1964 Eleutherodactylus counouspeus
Parker, 1926 Euparkerella brasiliensis
Izecksohn, 1988 Euparkerella cochranae
Izecksohn, 1988 Euparkerella robusta
Izecksohn, 1988 Euparkerella tridactyla
Ruthveni, 1915 Geobatrachus walkeri
Lutz, 1958 Holoaden bradei
Miranda-Ribero, 1920 Holoaden luederwaldti
13 of 33 9/28/2010 9:23 AM Major Caribbean and Central American frog faunas originated by ancient ... http://evo.bio.psu.edu/hedgeslab_site/Publications/PDF-files/189-SIt.htm
Bokermann, 1975 Ischnocnema bilineata
Lutz, 1925 Ischnocnema bolbodactyla
Heyer, 1984 Ischnocnema epipeda
Heyer, 1984 Ischnocnema erythromera
Miranda-Ribeiro, 1926 Ischnocnema gehrti
Lutz, 1974 Ischnocnema gualteri
Steindachner, 1864 Ischnocnema guentheri
Peters, 1870 Ischnocnema henselii
Lutz, 1958 Ischnocnema hoehnei
Cochran, 1948 Ischnocnema holti
Caramaschi and Kisteumacher, 1989 Ischnocnema izecksohni
Sazima and Cardoso, 1978 Ischnocnema juipoca
Miranda-Ribeiro, 1923 Ischnocnema lactea
Garcia, 1996 Ischnocnema manezinho
Lutz, 1925 Ischnocnema nasuta
Lutz, 1925 Ischnocnema nigriventris
Bokermann, 1965 Ischnocnema octavioi
Heyer, 1984 Ischnocnema oeus
Langone and Segalla, 1996 Ischnocnema paranaensis
Girard, 1853 Ischnocnema parva
Bokermann, 1975 Ischnocnema paulodutrai
Bokermann, 1967 Ischnocnema pusilla
Boulenger, 1888 Ischnocnema ramagii
Heyer, 1985 Ischnocnema randorum
Castanho and Haddad, 2000 Ischnocnema sambaqui
Heyer, 1985 Ischnocnema spanios
Lutz, 1958 Ischnocnema venancioi
Reinhardt and Lütken, 1862 Ischnocnema verrucosa
Bokermann, 1975 Ischnocnema vinhai
Lynch and Myers, 1983 Limnophys anatipes
Boulenger, 1898 Limnophys anomalus
14 of 33 9/28/2010 9:23 AM Major Caribbean and Central American frog faunas originated by ancient ... http://evo.bio.psu.edu/hedgeslab_site/Publications/PDF-files/189-SIt.htm
Boulenger, 1896 Limnophys bufoniformis
Lynch, 1986 Limnophys cadenai
Lynch, 1975 Limnophys cerastes
Lynch, 1990 Limnophys cheiroplethus
Jiménez de la Espada, 1871 Limnophys cornutus
Lynch, 1975 Limnophys helonotus
Cochran and Goin, 1961 Limnophys ingeri
Myers and Lynch, 1997 Limnophys laticorpus
Lynch, 1975 Limnophys necerus
Lynch, 1997 Limnophys necopinus
Lynch, 1981 Limnophys ruizi
Cope, 1874 Limnophys sulcatus
Lynch and Myers, 1983 Limnophys zygodactylus
Harvey and Sheehy, 2005 Oreobates choristolemma
Jiménez de la Espada, 1872 Oreobates quixensis
Harvey and Keck, 1995 Oreobates sanctaecrucis
Padial, Reichle, and De la Riva Oreobates sanderi
Duellman, 1990 Oreobates saxatilis
Padial, Reichle, and De La Riva, 2005 Oreobates simmonsi
Ardila-Robayo, Ruiz-Carranza, and Barrera- Phrynopus adenobrachius Rodriguez, 1996
Aguayo-Vedia and Harvey, 2001 Phrynopus adenopleurus
Lynch, 1986 Phrynopus bagrecitoi
Lehr and Aguilar, 2002 Phrynopus barthlenae
Lehr, 2006 Phrynopus boettgeri
Hedges, 1990 Phrynopus bracki
Lehr, Lundberg, and Aguilar, 2005 Phrynopus bufoides
Werner, 1899 Phrynopus columbianus
Lynch, 1975 Phrynopus cophites
Lehr, Aguilar, and Köhler, 2002 Phrynopus dagmarae
Lehr, 2001 Phrynopus heimorum
Lehr, Köhler, and Ponce, 2000 Phrynopus horstpauli
15 of 33 9/28/2010 9:23 AM Major Caribbean and Central American frog faunas originated by ancient ... http://evo.bio.psu.edu/hedgeslab_site/Publications/PDF-files/189-SIt.htm
Aguayo-Vedia and Harvey, 2001 Phrynopus iatamasi
Shreve, 1938 Phrynopus juninensis
Lehr, Aguilar, and Köhler, 2002 Phrynopus kauneorum
De la Riva, 1992 Phrynopus kempffi
Shreve, 1938 Phrynopus montium
Goin and Cochran, 1963 Phrynopus nanus
Lynch, 1975 Phrynopus parkeri
Lehr, Lundberg, and Aguilar,2005 Phrynopus paucari
Peters, 1873 Phrynopus peruanus
Noble, 1921 Phrynopus peruvianus
Lehr, Lundberg, and Aguilar, 2005 Phrynopus pesantesi
Harvey and Ergueta, 1998 Phrynopus pinguis
Lehr and Aguilar, 2003 Phrynopus tautzorum
Duellman, 2000 Phrynopus thompsoni
Parker, 1932 Phrynopus wettsteini
De la Riva and Köhler, 1998 Phyllonastes carrascoicola
Lehr, Aguilar, and Lundberg, 2004 Phyllonastes duellmani
Lynch, 1986 Phyllonastes heyeri
Lynch, 1976 Phyllonastes lochites
Duellman, 1991 Phyllonastes lynchi
Lynch, 1976 Phyllonastes myrmecoides
Köhler, 2000 Phyllonastes ritarasquinae
Heyer, 1977 Phyzelaphryne miriamae
Lynch and Lescure, 1980 Pristimantis aaptus
Lynch and Ruíz-Carranza, 1983 Pristimantis acatallelus
Lynch and Duellman, 1980 Pristimantis acerus
Boulenger, 1898 Pristimantis achatinus
Lynch and Rueda-Almonacid, 1998 Pristimantis actinolaimus
Lynch, 1979 Pristimantis actites
Shreve, 1935 Pristimantis acuminatus
Lynch, 1984 Pristimantis acutirostris
16 of 33 9/28/2010 9:23 AM Major Caribbean and Central American frog faunas originated by ancient ... http://evo.bio.psu.edu/hedgeslab_site/Publications/PDF-files/189-SIt.htm
Ruíz-Carranza, Lynch and Ardila-Robayo, 1997 Pristimantis aemulatus
Werner, 1899 Pristimantis affinis
Roa-Trujillo and Ruíz-Carranza, 1991 Pristimantis alalocophus
Lynch and Ruíz-Carranza, 1996 Pristimantis albericoi
Dunn, 1942 Pristimantis altae
Barbour and Dunn, 1921 Pristimantis altamazonicus
Duellman and Pramuk, 1999 Pristimantis anemerus
Lynch, 1998 Pristimantis angustilineata
Duellman and Hedges, 2005 Pristimantis aniptopalmatus
Lynch, 1983 Pristimantis anolirex
Walker and Test, 1955 Pristimantis anotis
Lynch, 2001 Pristimantis anthrax
Lynch and Burrowes, 1990 Pristimantis apiculatus
Werner, 1894 Pristimantis appendiculatus
Barrio-Amores and Molina, 2006 Pristimantis aracamuni
Duellman and Pramuk, 1999 Pristimantis ardalonychus
Köhler, 2000 Pristimantis ashkapara
Duellman and Pramuk, 1999 Pristimantis atrabracus
Lynch, 1979 Pristimantis atratus
Ruíz-Carranza, Lynch and Ardila-Robayo, 1997 Pristimantis aurantiguttatus
Guayasamin et al. 2006 Pristimantis aureolineatus
Duellman and Pramuk, 1999 Pristimantis avicuporum
Myers and Donnelly, 1997 Pristimantis avius
Lynch, 1984 Pristimantis bacchus
Lynch, 1998 Pristimantis baiotis
Lynch, 1979 Pristimantis balionotus
Lynch, 1979 Pristimantis baryecuus
Lynch, 2003 Pristimantis batrachites
Duellman, 1992 Pristimantis bearsei
Lynch, 1992 Pristimantis bellona
Lynch, 1986 Pristimantis bernali
17 of 33 9/28/2010 9:23 AM Major Caribbean and Central American frog faunas originated by ancient ... http://evo.bio.psu.edu/hedgeslab_site/Publications/PDF-files/189-SIt.htm
Rueda-Almonacid and Lynch, 1983 Pristimantis bicolor
Peters, 1863 Pristimantis bicumulus
Duellman and Hedges, 2005 Pristimantis bipunctatus
Werner, 1899 Pristimantis bisignatus
Rivero and Mayorga, 1973 Pristimantis boconoensis
Peters, 1863 Pristimantis bogotensis
Lynch, 1981 Pristimantis boulengeri
Lynch, 1981 Pristimantis brevifrons
Boulenger, 1903 Pristimantis briceni
Lynch, 1979 Pristimantis bromeliaceus
Rodriguez, 1994 Pristimantis buccinator
Boulenger, 1882 Pristimantis buckleyi
Cochran and Goin, 1970 Pristimantis cabrerai
Lynch, 1992 Pristimantis cacao
Barbour and Noble, 1920 Pristimantis cajamarcensis
Boulenger, 1908 Pristimantis calcaratus
Lynch, 1976 Pristimantis calcarulatus
Lynch, 1996 Pristimantis caliginosus
Myers and Donnelly, 1996 Pristimantis cantitans
Lynch, 1998 Pristimantis capitonis
Lynch, 1977 Pristimantis caprifer
Arroyo, 2007 Pristimantis carlossanchezi
Ruthven, 1922 Pristimantis carmelitae
Lynch, 1994 Pristimantis carranguerorum
Lutz, 1952 Pristimantis carvalhoi
Barbour, 1928 Pristimantis caryophyllaceus
Myers and Donnelly, 1997 Pristimantis cavernibardus
Lynch, 1976 Pristimantis celator
Cope, 1875 Pristimantis cerasinus
Duellman and Wild, 1993 Pristimantis ceuthospilus
Peters, 1873 Pristimantis chalceus
18 of 33 9/28/2010 9:23 AM Major Caribbean and Central American frog faunas originated by ancient ... http://evo.bio.psu.edu/hedgeslab_site/Publications/PDF-files/189-SIt.htm
Kaiser, Dwyer, Feichtinger and Schmid, 1995 Pristimantis charlottevillensis
Lynch and Hoogmoed, 1977 Pristimantis chiastonotus
Lynch, 1969 Pristimantis chloronotus
Lynch and Ruíz-Carranza, 1996 Pristimantis chrysops
Duellman, 1992 Pristimantis citriogaster
Lynch, 1979 Pristimantis colodactylus
Lynch and Duellman, 1997 Pristimantis colomai
La Marca and Smith, 1982 Pristimantis colostichos
Lynch and Duellman, 1980 Pristimantis condor
Günther, 1858 Pristimantis conspicillatus
Lehr and Duellman, 2007 Pristimantis cordovae
Lynch and Suárez-Mayorga, 2003 Pristimantis corniger
Duellman, Lehr, and Venegas, 2006 Pristimantis corrugatus
Duellman, 1978 Pristimantis cosnipatae
Lynch and Duellman, 1980 Pristimantis cremnobates
Lynch, 1976 Pristimantis crenunguis
Bokermann, 1965 Pristimantis crepitans
Lynch and Ruíz-Carranza, 1985 Pristimantis cristinae
Lynch, 1968 Pristimantis croceoinguinis
Boulenger, 1899 Pristimantis crucifer
Lehr, Lundberg, Aguilar, and von May, 2006 Pristimantis cruciocularis
Peters, 1873 Pristimantis cruentus
Lynch, 1979 Pristimantis cryophilius
Lynch, 1979 Pristimantis cryptomelas
Lynch, 2003 Pristimantis cuentasi
Duellman and Pramuk, 1999 Pristimantis cuneirostris
Boulenger, 1882 Pristimantis curtipes
Duellman, 1978 Pristimantis danae
Lynch and Duellman, 1997 Pristimantis degener
Lynch, 1996 Pristimantis deinops
Ruthven, 1917 Pristimantis delicatus
19 of 33 9/28/2010 9:23 AM Major Caribbean and Central American frog faunas originated by ancient ... http://evo.bio.psu.edu/hedgeslab_site/Publications/PDF-files/189-SIt.htm
Duellman and Mendelson, 1995 Pristimantis delius
Boulenger, 1880 Pristimantis devillei
Jiménez de la Espada, 1875 Pristimantis diadematus
Lynch, 1986 Pristimantis diaphonus
Cope, 1875 Pristimantis diastema
Lynch and Ruíz-Carranza, 1996 Pristimantis diogenes
Lynch and Duellman, 1997 Pristimantis dissimulatus
Rivero and Serna, 1988 Pristimantis dorsopictus
Lynch, 1996 Pristimantis douglasi
Lynch, 1980 Pristimantis duellmani
Lynch, 2001 Pristimantis duende
Heyer and Muñoz, 1999 Pristimantis dundeei
Peters, 1863 Pristimantis elegans
Lynch and Suárez-Mayorga, 2000 Pristimantis epacrus
Lynch, 1980 Pristimantis eremitus
Lynch and Duellman, 1980 Pristimantis eriphus
Flores, 1987 Pristimantis ernesti
Boulenger, 1896 Pristimantis erythropleura
Guayasamin, 2004 Pristimantis esmeraldas
Lynch and Duellman, 1997 Pristimantis eugeniae
Schwartz, 1967 Pristimantis euphronides
Hedges and Schlüter, 1992 Pristimantis eurydactylus
Duellman and Pramuk, 1999 Pristimantis exoristus
Lynch and Rueda-Almonacid, 1998 Pristimantis factiosus
Lynch and Rueda-Almonacid, 1999 Pristimantis fallax
Steindachner, 1864 Pristimantis fenestratus
Peracca, 1904 Pristimantis festae
Lynch and Rueda-Almonacid, 1998 Pristimantis fetosus
Lehr, Lundberg, Aguilar, and von May, 2006 Pristimantis flavobracatus
Lynch and Duellman, 1997 Pristimantis floridus
Werner, 1899 Pristimantis frater
20 of 33 9/28/2010 9:23 AM Major Caribbean and Central American frog faunas originated by ancient ... http://evo.bio.psu.edu/hedgeslab_site/Publications/PDF-files/189-SIt.htm
Lynch and McDiarmid, 1987 Pristimantis fraudator
Dunn, 1931 Pristimantis gaigeae
Jiménez de la Espada, 1871 Pristimantis galdi
Duellman and Lynch, 1988 Pristimantis ganonotus
Lynch and Duellman, 1997 Pristimantis gentryi
Rivero, 1964 Pristimantis ginesi
Lynch, 1976 Pristimantis gladiator
Boulenger, 1880 Pristimantis glandulosus
Lynch, 1986 Pristimantis gracilis
Lynch, 1984 Pristimantis grandiceps
Boulenger, 1898 Pristimantis gularis
Hoogmoed, Lynch and Lescure, 1977 Pristimantis gutturalis
Flores, 1994 Pristimantis hamiotae
Lynch and Burrowes, 1990 Pristimantis hectus
Lynch and Rueda-Almonacid, 1998 Pristimantis helvolus
Lynch and Ruíz-Carranza, 1983 Pristimantis hernandezi
Guayasamin, Almeida-Reinoso, and Nogales- Pristimantis huicundo Sornosa, 2004
Lynch, 1992 Pristimantis hybotragus
Cope, 1875 Pristimantis hylaeformis
Lynch and Duellman, 1980 Pristimantis ignicolor
Lynch and Duellman, 1997 Pristimantis illotus
Duellman, 1978 Pristimantis imitatrix
Lynch and Duellman, 1980 Pristimantis incanus
Lutz, 1927 Pristimantis incertus
Lynch and Duellman, 1980 Pristimantis incomptus
Duellman and Pramuk, 1999 Pristimantis infraguttatus
Parker, 1940 Pristimantis inguinalis
Ruthven, 1917 Pristimantis insignitus
Lynch and Duellman, 1980 Pristimantis inusitatus
Lynch, 2003 Pristimantis ixalus
Lynch, 1992 Pristimantis jaimei
21 of 33 9/28/2010 9:23 AM Major Caribbean and Central American frog faunas originated by ancient ... http://evo.bio.psu.edu/hedgeslab_site/Publications/PDF-files/189-SIt.htm
Rivero and Serna, 1988 Pristimantis johannesdei
Lynch, 1994 Pristimantis jorgevelosai
Lynch, 1996 Pristimantis juanchoi
Garcia and Lynch, 2006 Pristimantis jubatus
La Marca, 2005 Pristimantis kareliae
Flores, 1988 Pristimantis katoptroides
Lynch, 1998 Pristimantis kelephas
Flores, 1985 Pristimantis kirklandi
Lynch, Ruíz-Carranza and Ardila-Robayo, 1994 Pristimantis labiosus
Jiménez de la Espada, 1875 Pristimantis lacrimosus
Donoso-Barros, 1965 Pristimantis lancinii
Lynch, 1975 Pristimantis lanthanites
Lynch, 1995 Pristimantis lasalleorum
Lynch and Burrowes, 1990 Pristimantis laticlavius
Boulenger, 1898 Pristimantis latidiscus
Lynch and Rueda-Almonacid, 1998 Pristimantis lemur
Rivero, 1984 Pristimantis lentiginosus
Lynch, 1976 Pristimantis leoni
Lynch, 1980 Pristimantis leptolophus
Lynch, 1976 Pristimantis leucopus
Flores and Vigle, 1994 Pristimantis librarius
Lynch and Rueda-Almonacid, 1997 Pristimantis lichenoides
Duellman, 1978 Pristimantis lindae
Dwyer, 1995 Pristimantis lirellus
Lynch and Duellman, 1980 Pristimantis lividus
Köhler and Lötters, 1999 Pristimantis llojsintuta
Lynch, 1979 Pristimantis loustes
Duellman and Mendelson, 1995 Pristimantis luscombei
Lynch, 1976 Pristimantis luteolateralis
Lynch, 1984 Pristimantis lutitus
Barbour and Noble, 1920 Pristimantis lymani
22 of 33 9/28/2010 9:23 AM Major Caribbean and Central American frog faunas originated by ancient ... http://evo.bio.psu.edu/hedgeslab_site/Publications/PDF-files/189-SIt.htm
Duellman and Simmons, 1977 Pristimantis lynchi
Lynch and Lescure, 1980 Pristimantis lythrodes
Lynch, 1991 Pristimantis maculosus
Lynch, 1980 Pristimantis malkini
Fuentes-Ramos and Barrio-Amoros, 2004 Pristimantis marahuaka
Boulenger, 1900 Pristimantis marmoratus
Lynch and Ruíz-Carranza, 1996 Pristimantis mars
Lynch, 1974 Pristimantis martiae
Lynch, 1994 Pristimantis medemi
Ruthven, 1917 Pristimantis megalops
Duellman and Pramuk, 1999 Pristimantis melanogaster
Rivero, 1984 Pristimantis melanoproctus
Myers and Donnelly, 1997 Pristimantis memorans
Duellman, 1978 Pristimantis mendax
Lynch and McDiarmid, 1987 Pristimantis mercedesae
Lehr and Duellman, 2007 Pristimantis meridionalis
Lynch, 1984 Pristimantis merostictus
Duellman and Pramuk, 1999 Pristimantis metabates
Lynch, 1984 Pristimantis miyatai
Lynch, 1998 Pristimantis mnionaetes
Lynch, 1981 Pristimantis modipeplus
Lynch, 1986 Pristimantis molybrignus
Rivero, 1984 Pristimantis mondolfii
Savage, 1965 Pristimantis moro
Lynch and Miyata, 1980 Pristimantis muricatus
Duellman and Pramuk, 1999 Pristimantis muscosus
Ibáñez, Jaramillo and Arosemena, 1994 Pristimantis museosus
Goin and Cochran, 1963 Pristimantis myersi
Lynch, 1998 Pristimantis myops
Duellman and Pramuk, 1999 Pristimantis nephophilus
Lynch, 1994 Pristimantis nervicus
23 of 33 9/28/2010 9:23 AM Major Caribbean and Central American frog faunas originated by ancient ... http://evo.bio.psu.edu/hedgeslab_site/Publications/PDF-files/189-SIt.htm
Cochran and Goin, 1970 Pristimantis nicefori
Andersson, 1945 Pristimantis nigrogriseus
Lynch, 1976 Pristimantis nyctophylax
Lynch, 1980 Pristimantis obmutescens
Lynch and Burrowes, 1990 Pristimantis ocellatus
Boulenger, 1912 Pristimantis ockendeni
Lynch, 1981 Pristimantis ocreatus
Köhler, Morales, Lötters, Reichle and Aparicio, Pristimantis olivaceus 1998
Lynch, 1972 Pristimantis orcesi
Lynch, 1979 Pristimantis orestes
Despax, 1911 Pristimantis ornatissimus
Lehr, Lundberg, Aguilar, and von May, 2006 Pristimantis ornatus
Lynch, Ruíz-Carranza and Ardila-Robayo, 1994 Pristimantis orpacobates
Lynch, 1970 Pristimantis orphnolaimus
Guayasamin, Almeida-Reinoso, and Nogales- Pristimantis ortizi Sornosa, 2004
Mueses-Cisneros, 2006 Pristimantis padrecarlosi
Lynch and Ardila-Robayo, 1999 Pristimantis paisa
Boulenger, 1912 Pristimantis palmeri
Rivero, 1984 Pristimantis paramerus
Lehr, Lundberg, Aguilar, and von May, 2006 Pristimantis pardalinus
Barbour, 1928 Pristimantis pardalis
Lynch and Rueda-Almonacid, 1998 Pristimantis parectatus
Lynch, 1976 Pristimantis parvillus
Andersson, 1945 Pristimantis pastazensis
Duellman and Pramuk, 1999 Pristimantis pataikos
Lynch, 1974 Pristimantis paululus
Duellman and Lynch, 1988 Pristimantis pecki
La Marca, 2004 Pristimantis pedimontanus
Lynch and Rueda-Almonacid, 1999 Pristimantis penelopus
Lynch, 1980 Pristimantis peraticus
Duellman and Pramuk, 1999 Pristimantis percnopterus
24 of 33 9/28/2010 9:23 AM Major Caribbean and Central American frog faunas originated by ancient ... http://evo.bio.psu.edu/hedgeslab_site/Publications/PDF-files/189-SIt.htm
Lynch, 1979 Pristimantis percultus
Lynch, Ruíz-Carranza and Ardila-Robayo, 1994 Pristimantis permixtus
Melin, 1941 Pristimantis peruvianus
Lynch and Duellman, 1980 Pristimantis petersi
Duellman, 1991 Pristimantis petrobardus
Lynch, 1998 Pristimantis phalarus
Lynch and Duellman, 1995 Pristimantis philipi
Lynch, 1979 Pristimantis phoxocephalus
Rivero and Serna, 1988 Pristimantis phragmipleuron
Lynch, Ruíz-Carranza and Ardila-Robayo, 1996 Pristimantis piceus
Duellman and Pramuk, 1999 Pristimantis pinguis
Ibañez and Crawford, 2004 Pristimantis pirrensis
Lynch, 1996 Pristimantis platychilus
Boulenger, 1903 Pristimantis platydactylus
Rivero, 1984 Pristimantis pleurostriatus
De la Riva and Lynch, 1997 Pristimantis pluvicanorus
Lynch and Ardila-Robayo, 2004 Pristimantis polemistes
Ruíz-Carranza, Lynch and Ardila-Robayo, 1997 Pristimantis polychrus
Lynch and Duellman, 1980 Pristimantis prolatus
Lynch, 1978 Pristimantis prolixodiscus
Lynch, 1979 Pristimantis proserpens
Myers and Donnelly, 1996 Pristimantis pruinatus
Shreve, 1935 Pristimantis pseudoacuminatus
Lynch and Duellman, 1997 Pristimantis pteridophilus
Lynch, 1998 Pristimantis ptochus
Lynch, 1973 Pristimantis pugnax
Rivero, 1968 Pristimantis pulvinatus
Lynch, 1979 Pristimantis pycnodermis
Lynch, 1976 Pristimantis pyrrhomerus
Lynch, 1998 Pristimantis quantus
Lynch, 1974 Pristimantis quaquaversus
25 of 33 9/28/2010 9:23 AM Major Caribbean and Central American frog faunas originated by ancient ... http://evo.bio.psu.edu/hedgeslab_site/Publications/PDF-files/189-SIt.htm
Lynch, 2001 Pristimantis quidditus
Lynch and Trueb, 1980 Pristimantis quinquagesimus
Lynch, 1980 Pristimantis racemus
Lynch, 2003 Pristimantis reclusas
Lynch, 2000 Pristimantis renjiforum
Lynch, 1984 Pristimantis repens
Lynch, 1996 Pristimantis restrepoi
Walker and Test, 1955 Pristimantis reticulatus
Duellman and Hedges, 2005 Pristimantis rhabdocnemus
Duellman, 1978 Pristimantis rhabdolaemus
Duellman and Wild, 1993 Pristimantis rhodoplichus
Duellman and Pramuk, 1999 Pristimantis rhodostichus
Cope, 1866 Pristimantis ridens
Lynch and de La Marca, 1993 Pristimantis riveroi
Despax, 1911 Pristimantis riveti
Flores, 1988 Pristimantis rosadoi
Boulenger, 1918 Pristimantis roseus
Rivero, 1961 Pristimantis rozei
Jiménez de la Espada, 1875 Pristimantis rubicundus
Ruíz-Carranza, Lynch and Ardila-Robayo, 1997 Pristimantis ruedai
Duellman and Pramuk, 1999 Pristimantis rufioculis
Lynch, 1979 Pristimantis ruidus
Lynch and Ruíz-Carranza, 1985 Pristimantis ruthveni
Lehr, Aguilar and Duellman, 2004 Pristimantis sagittulus
Duellman, 1978 Pristimantis salaputium
Köhler and Jungfer, 1995 Pristimantis samaipatae
Ruthven, 1917 Pristimantis sanctaemartae
Lynch, 1998 Pristimantis sanguineus
Lynch, 1995 Pristimantis satagius
Pyburn and Lynch, 1981 Pristimantis savagei
Duellman, 1990 Pristimantis schultei
26 of 33 9/28/2010 9:23 AM Major Caribbean and Central American frog faunas originated by ancient ... http://evo.bio.psu.edu/hedgeslab_site/Publications/PDF-files/189-SIt.htm
Duellman, 1978 Pristimantis scitulus
Lynch, 1991 Pristimantis scoloblepharus
Lynch and Burrowes, 1990 Pristimantis scolodiscus
Lynch, Ruíz-Carranza and Ardila-Robayo, 1996 Pristimantis scopaeus
Duellman and Pramuk, 1999 Pristimantis serendipitus
Schwartz, 1967 Pristimantis shrevei
Ruíz-Carranza, Lynch and Ardila-Robayo, 1997 Pristimantis signifer
Lynch and Ruíz-Carranza, 1996 Pristimantis silverstonei
Wiens and Coloma, 1992 Pristimantis simonbolivari
Boulenger, 1900 Pristimantis simonsii
Lynch, Ruíz-Carranza and Ardila-Robayo, 1997 Pristimantis simoteriscus
Lynch, 1980 Pristimantis simoterus
Lynch and Burrowes, 1990 Pristimantis siopelus
Flores and Rodriguez, 1997 Pristimantis skydmainos
Lynch, 1980 Pristimantis sobetes
Lynch, 1984 Pristimantis spilogaster
Lynch, 1979 Pristimantis spinosus
Walker and Test, 1955 Pristimantis stenodiscus
Duellman and Wild, 1993 Pristimantis sternothylax
Duellman, Lehr, and Venegas, 2006 Pristimantis stictoboubonus
Duellman and Hedges, 2005 Pristimantis stictogaster
Boulenger, 1902 Pristimantis subsigillatus
Lynch and Rueda-Almonacid, 1998 Pristimantis suetus
Lynch and Burrowes, 1990 Pristimantis sulculus
Lynch, 1979 Pristimantis supernatis
Boulenger, 1882 Pristimantis surdus
Rueda-Almonacid, Lynch and Galvis, 2003 Pristimantis susaguae
Lynch and Suárez-Mayorga, 2003 Pristimantis taciturnus
Boulenger, 1912 Pristimantis taeniatus
Cochran and Goin, 1970 Pristimantis tamsitti
Lynch and Ruíz-Carranza, 1985 Pristimantis tayrona
27 of 33 9/28/2010 9:23 AM Major Caribbean and Central American frog faunas originated by ancient ... http://evo.bio.psu.edu/hedgeslab_site/Publications/PDF-files/189-SIt.htm
La Marca, 2005 Pristimantis telefericus
Lynch and Miyata, 1980 Pristimantis tenebrionis
Rivero, 1961 Pristimantis terraebolivaris
Lynch, 1975 Pristimantis thectopternus
Lynch, 1976 Pristimantis thymalopsoides
Lynch, 1972 Pristimantis thymelensis
Savage, 1997 Pristimantis tigrillo
Lynch, 2001 Pristimantis tinker
Duellman, 1978 Pristimantis toftae
Lynch and Rueda-Almonacid, 1998 Pristimantis torrenticola
Boulenger, 1918 Pristimantis trachyblepharis
Lynch and Rueda-Almonacid, 1997 Pristimantis tribulosus
Lynch and Duellman, 1997 Pristimantis truebae
Rivero, 1984 Pristimantis tubernasus
Hardy, 2001 Pristimantis turpinorum
Rivero, 1961 Pristimantis turumiquirensis
Lynch, 2003 Pristimantis uisae
Günther, 1859 Pristimantis unistrigatus
Lynch, 1991 Pristimantis uranobates
Boettger, 1894 Pristimantis urichi
La Marca, 1984 Pristimantis vanadise
Lynch, 1968 Pristimantis variabilis
Lynch and Rueda-Almonacid, 1997 Pristimantis veletis
Boulenger, 1912 Pristimantis ventrimarmoratus
Lynch and Burrowes, 1990 Pristimantis verecundus
Lynch, 1979 Pristimantis versicolor
Boulenger, 1886 Pristimantis vertebralis
Lynch and Ruíz-Carranza, 1983 Pristimantis vicarius
Lynch, 1979 Pristimantis vidua
Lynch and Rueda-Almonacid, 1999 Pristimantis viejas
Melin, 1941 Pristimantis vilarsi
28 of 33 9/28/2010 9:23 AM Major Caribbean and Central American frog faunas originated by ancient ... http://evo.bio.psu.edu/hedgeslab_site/Publications/PDF-files/189-SIt.htm
Lynch, 1977 Pristimantis viridicans
Ruíz-Carranza, Lynch and Ardila-Robayo, 1997 Pristimantis viridis
Taylor, 1955 Pristimantis vocator
Lynch, 1974 Pristimantis walkeri
Duellman and Wild, 1993 Pristimantis wiensi
Boettger, 1892 Pristimantis w-nigrum
Lynch, 2001 Pristimantis xeniolum
Lynch, 1995 Pristimantis xestus
Lynch and Ruíz-Carranza, 1996 Pristimantis xylochobates
Myers and Donnelli, 1996 Pristimantis yaviensis
Lynch and Hoogmoed, 1977 Pristimantis zeuctotylus
Heyer and Hardy, 1991 Pristimantis zimmermanae
Lynch and Ardila-Robayo, 1999 Pristimantis zophus
*E. binotatus and E. plicifer to be placed in a new genus. See SI Text.
†No members of the discoidalis group were included in this study. Based on morphology, they have been suggested to resemble Oreobates, the Southeast Brazil clade, and members of the nigrovittatus group (1-2). Genetic data are needed to resolve their position.
‡Members of the dolops, nigrovittatus, and Phrynopus flavomaculatus groups, to be placed in a new genus. See SI Text.
1. Padial JM, Reichle S, De La Riva I (2005) J Herpetol 39:186-191.
2. Lynch JD (1976) Occas Pap Mus Nat Hist Univ Kansas 61:1-24.
Table 3. Times of divergence (Mya) for eleutherodactylines
All data Nuclear data only Mitochondrial data only
Node Time S.D. 95% C.I. Time S.D. 95% C.I. Time S.D. 95% C.I.
(35.33, (35.15, (35.62, 1 44.21 7.09 61.44) 39.91 4.67 52.32) 47.76 8.42 66.31)
2 10.60 2.14 (7.04, 15.20) 10.62 2.38 (6.55, 15.96) 11.18 2.41 (6.99, 16.16)
3 4.53 1.04 (2.76, 6.72) 4.51 1.65 (1.41, 7.84) 4.70 1.12 (2.77, 6.94)
4 6.70 1.39 (4.25, 9.52) 6.96 1.72 (3.47, 9.80) 7.01 1.48 (4.30, 9.71)
5 8.83 1.78 (5.84, 12.70) 5.30 1.77 (2.16, 9.14) 10.16 2.18 (6.31, 14.68)
6 11.55 2.20 (7.81, 16.18) 9.93 2.13 (6.21, 14.56) 12.70 2.56 (8.14, 17.83)
7 12.32 2.33 (8.37, 17.22) 11.91 2.43 (7.87, 17.40) 13.49 2.71 (8.65, 18.91)
8 13.49 2.55 (9.15, 18.89) 13.87 2.71 (9.36, 19.98) 14.68 2.95 (9.43, 20.70)
(12.33, (10.89, (13.11, 9 17.79 3.26 24.70) 15.97 3.03 22.90) 19.91 3.88 27.97)
10 6.48 1.50 (3.86, 9.52) 8.30 1.39 (4.86, 9.94) 6.31 1.54 (3.59, 9.43)
(12.27, (11.14, (12.74, 11 17.74 3.27 24.69) 16.33 3.10 23.18) 19.40 3.84 27.33)
(13.54, (12.77, (14.29, 12 19.33 3.47 26.67) 18.26 3.31 25.78) 21.49 4.11 29.86)
(13.06, (12.34, (13.47, 13 19.05 3.62 26.92) 18.62 3.76 26.98) 20.93 4.30 30.04)
29 of 33 9/28/2010 9:23 AM Major Caribbean and Central American frog faunas originated by ancient ... http://evo.bio.psu.edu/hedgeslab_site/Publications/PDF-files/189-SIt.htm
(15.61, (15.21, (16.49, 14 22.07 3.95 30.55) 21.51 3.91 30.48) 24.62 4.67 34.25)
(11.18, (12.28, 15 16.37 3.23 23.54) 12.93 3.34 (7.32, 20.41) 19.13 4.10 28.08)
16 12.62 2.67 (8.32, 18.57) 13.95 3.32 (8.23, 21.30) 13.42 3.07 (8.30, 20.24)
17 12.26 2.58 (8.04, 17.98) 7.84 3.08 (2.39, 14.35) 14.16 3.26 (8.78, 21.30)
(12.14, (11.10, (12.74, 18 17.64 3.40 25.24) 16.48 3.34 24.37) 19.65 4.12 28.56)
(11.62, (12.50, 19 16.96 3.32 24.43) 13.91 3.23 (8.55, 21.20) 19.39 4.14 28.33)
(13.04, (12.25, (13.80, 20 18.81 3.57 26.81) 17.64 3.45 25.90) 21.23 4.39 30.61)
(16.06, (14.12, (17.45, 21 22.73 4.16 32.02) 19.61 3.66 28.20) 26.05 5.13 37.01)
(17.45, (15.55, (19.28, 22 24.63 4.46 34.53) 21.38 3.95 30.81) 28.56 5.51 40.27)
(20.95, (21.03, (22.47, 23 29.09 5.05 40.35) 29.00 5.07 40.61) 32.56 6.01 45.11)
(10.13, (12.86, 24 15.26 3.14 22.40) 8.80 2.66 (4.33, 14.85) 19.98 4.40 29.77)
(15.04, (10.36, (17.66, 25 21.50 4.08 30.79) 16.15 3.52 23.95) 26.35 5.39 38.08)
(13.16, (10.69, (14.52, 26 19.33 3.81 28.02) 16.77 3.58 24.84) 22.20 4.75 32.56)
27 9.60 2.06 (6.29, 14.24) 6.05 2.15 (2.28, 10.74) 11.45 2.67 (7.17, 17.38)
28 11.77 2.45 (7.84, 17.34) 9.49 2.47 (5.34, 15.03) 13.67 3.11 (8.69, 20.61)
(10.99, 29 14.47 2.94 (9.78, 21.17) 11.37 2.79 (6.70, 17.57) 17.00 3.73 25.26)
(11.70, (13.20, 30 16.95 3.31 24.50) 13.34 2.98 (8.41, 20.07) 20.03 4.23 29.31)
(12.77, (10.58, (14.29, 31 18.44 3.54 26.62) 16.05 3.31 23.53) 21.52 4.49 31.28)
32 10.20 2.31 (6.50, 15.50) 11.71 2.95 (6.65, 18.38) 10.54 2.68 (6.24, 16.59)
(10.54, 33 14.51 2.97 (9.78, 21.29) 13.50 3.10 (8.25, 20.45) 16.40 3.67 24.58)
(14.21, (10.39, (15.93, 34 20.29 3.83 28.98) 15.91 3.28 23.32) 23.84 4.87 34.38)
(15.03, (12.02, (16.89, 35 21.36 4.00 30.52) 17.75 3.49 25.62) 25.08 5.06 36.03)
(15.66, (12.87, (17.66, 36 22.30 4.17 31.71) 18.95 3.69 27.34) 26.15 5.26 37.49)
37 8.83 1.99 (5.63, 13.40) 8.23 2.43 (4.16, 13.60) 10.01 2.50 (6.07, 15.75)
38 11.39 2.45 (7.48, 17.17) 11.05 2.78 (6.39, 17.35) 12.94 3.07 (8.06, 19.73)
39 7.12 1.70 (4.42, 10.89) 4.27 1.92 (0.96, 8.56) 8.91 2.32 (5.18, 14.19)
40 13.12 2.78 (8.67, 19.46) 9.41 2.93 (4.55, 15.94) 15.70 3.63 (9.82, 23.81)
(12.90, (10.52, (14.20, 41 18.92 3.72 27.47) 16.49 3.55 24.32) 21.64 4.61 31.89)
(15.02, (11.95, (16.88, 42 21.47 4.07 30.84) 17.94 3.64 26.19) 25.30 5.17 36.40)
(16.11, (13.70, (18.15, 43 22.91 4.27 32.69) 20.02 3.86 28.84) 26.92 5.40 38.58)
(17.30, (19.83, 44 24.45 4.51 34.82) 21.26 4.08 (14.51, 30.49 29.12 5.80 41.68)
(26.56, (19.88, (29.25, 45 36.52 6.38 50.81) 28.51 5.23 40.24) 41.48 7.73 58.21)
46 9.87 2.37 (6.07, 15.36) 7.04 2.64 (2.51, 12.94) 12.03 3.13 (7.06, 19.16)
30 of 33 9/28/2010 9:23 AM Major Caribbean and Central American frog faunas originated by ancient ... http://evo.bio.psu.edu/hedgeslab_site/Publications/PDF-files/189-SIt.htm
(24.42, (14.77, (28.17, 47 34.03 6.07 47.34) 22.78 4.78 33.35) 40.39 7.65 56.68)
(29.03, (21.75, (32.03, 48 39.68 6.79 55.11) 30.55 5.42 42.98) 45.18 8.25 62.80)
(24.03, (16.37, (26.02, 49 34.15 6.33 48.56) 25.55 5.35 37.73) 38.81 7.79 56.00)
(26.26, (19.38, (29.06, 50 36.56 6.53 51.33) 29.02 5.66 41.59) 41.87 7.94 58.91)
(30.35, (23.96, (33.25, 51 41.38 7.07 57.37) 33.32 5.73 46.27) 46.77 8.50 64.96)
(31.36, (26.40, (34.13, 52 42.76 7.28 59.18) 36.60 6.19 50.74) 48.00 8.71 66.65)
(14.05, (15.81, 53 20.74 4.19 30.30) 16.99 4.16 (9.99, 26.31) 24.38 5.31 36.06)
(11.60, 54 14.23 3.07 (9.25, 21.20) 8.04 2.80 (3.24, 14.24) 18.53 4.31 28.23)
(16.40, (11.70, (18.85, 55 23.69 4.58 34.15) 19.20 4.44 29.14) 28.39 5.85 41.41)
(21.67, (16.65, (24.32, 56 30.51 5.57 43.17) 25.45 5.29 37.41) 35.51 6.86 50.52)
(30.99, (24.82, (33.85, 57 42.39 7.29 58.99) 35.14 6.22 49.35) 47.63 8.65 66.08)
(33.38, (28.97, (35.97, 58 45.25 7.62 62.43) 39.68 6.53 54.62) 50.28 9.02 69.43)
(34.03, (30.85, (36.43, 59 45.99 7.72 63.46) 42.04 6.84 57.48) 50.89 9.12 70.26)
(35.09, (32.83, (37.26, 60 47.28 7.90 65.26) 44.32 7.11 60.40) 52.03 9.29 71.65)
(15.72, (20.95, 61 23.28 4.76 33.89) 13.16 3.70 (6.97, 21.43) 31.79 6.58 46.42)
(37.18, (35.81, (39.04, 62 49.79 8.30 68.67) 48.43 7.83 66.38) 54.24 9.67 74.65)
(43.52, (44.59, (42.99, 63 56.79 9.16 78.13) 57.93 8.39 77.18) 58.87 10.32 80.75)
Times are based on the combined nuclear and mitochondrial data set, nuclear data set, and mitochondrial data set, respectively. Standard deviations and credibility intervals are reported. Node numbers refer to guide tree, SI Fig. 14.
Table 5. Primers used in this study
Primer Sequence* Direction Location† Source
12s/tRNA-Val/16s
12L9 AAAGCAHRRCACTGAARATGYYDAGA F 229-254 This study
12L29E AAAGCRTAGCACTGAAAATGCTAAGA F 229-254 This study
12.1L4E TACACATGCAAGTYTCCGC F 322-340 This study
12L12E CAAACTGGGATTAGATACCCCACTATG F 697-723 This study
12L15 CAAACTGGGATTAGATACCCCACTAT F 697-722 This study
12.2L4E GCTTAAAACCYAARGGAYTTGACG F 775-798 This study
12H42 GCTGCACCTTGACCTGACGTATTG R 939-961 This study
12L27 ACGTCAGGTCAARGTGCAGC F 943-962 This study
31 of 33 9/28/2010 9:23 AM Major Caribbean and Central American frog faunas originated by ancient ... http://evo.bio.psu.edu/hedgeslab_site/Publications/PDF-files/189-SIt.htm
12H46E GCTGCACYTTGACCTGACGT R 943-962 This study
12L30E GTACAMACCGCCCGTCACCCTC F 1097-1118 This study
12.2H1E TCCGGTATACTTACCATGTTAC R 1175-1196 This study
12L34 GTAACATGGTAAGYRTACCGGA F 1175-1196 This study
12H10 CACYTTCCRGTRCRYTTACCRTGTTACGACTT R 1170-1201 This study
16L43E CTYGTACCTTTTGCATCATGGTTTA F 1462-1486 This study
16H50 TARACCATRATGCAAAAGGTAC R 1465-1486 This study
16L19 AATACCTAACGAACTTAGCGATAGCTGGTT F 1614-1644 This study
16H49E AACCAGCTATMRCTAAGTTCGSTAGG R 1618-1644 This study
16L33E AAGTWGGCCTAARAGCAGCCAYCTTT F 1792-1817 This study
16H48E AAAGRTGGCTGCTYTYAGGCC R 1797-1817 This study
16L28E AAGTRGGCCTAARAGCAGCCA F 1792-1812 This study
16L42 GGCCTRATAGCAGCCAYCT F 1797-1815 This study
16H46 TCWTGTTACTAGTTYTARCAT R 1919-1939 This study
16L37 GATTAYAAGAAAAAGAAGGAACTCGGCA F 2082-2109 This study
16H41 GAGGCGATGTTTTTGGTAAACAGGC R 2122-2144 This study
16L34 TTTAACGGCCGCGGTATCCTAACCG F 2186-2210 This study
16H24 TACCTTCGCACGGTTAGKRTACCGCGGCCGTT R 2190-2220 This study
16L29E TATCCTAACCGTGCRAAGCTAGC F 2200-2222 This study
16L1 CTGACCGTGCAAAGGTAGCGTAATCACT F 2204-2231 This study
16H36E AAGCTCCAWAGGGTCTTCTCGTC R 2341-2363 This study
16H37 TTACTCCGGTCTGAACTCAGATC R 2710-2732 This study
16H25 GACCTGGATTACTCCGGTCTGAACTCAGAT R 2711-2740 This study
16H1 CTCCGGTCTGAACTCAGATCACGTAGG R 2703-2729 This study
16H47 AAAGRGCTTAGRTCTTTYGCA R 2903-2923 This study
Rag-1
D. Cannatella, personal R182 GCCATAACTGCTGGAGCATYAT F 1391-1412 communication
Rag1FF2 ATGCATCRAAAATTCARCAAT F 1411-1431 This study
Rag1FR2 CCYCCTTTRTTGATAKGGWCATA R 2029-2051 This study
D. Cannatella, personal R270 AGYAGATGTTGCCTGGGTCTTC R 2051-2072 communication
Tyr
32 of 33 9/28/2010 9:23 AM Major Caribbean and Central American frog faunas originated by ancient ... http://evo.bio.psu.edu/hedgeslab_site/Publications/PDF-files/189-SIt.htm
Tyr1C GGCAGAGGAWCRTGCCAAGATGT F 101-123 (11)
TyrFE GTTGTYGTATCTACCTCRCC F 122-141 This study
TyrRE GMAGGGAATGGTGAARTTCTC R 635-655 This study
Tyr1G TGCTGGGCRTCTCTCCARTCCCA R 656-678 (11)
*Written 5' to 3'.
†Location on reference sequences: AY458592 (mitochondrial), L19324 (Rag-1), AY333967 (Tyr).
FIGURE LEGENDS
Fig. 5. Maximum-likelihood phylogeny of eleutherodactyline frogs. Data include 1,206 aligned bases (after removal of ambiguous regions) of the 12S and 16S rRNA genes for 276 eleutherodactylines and Brachycephalus and three out-group species. Bootstrap support values are shown.
Fig. 6. Minimum evolution phylogeny of eleutherodactyline frogs. Data include 1,206 aligned bases (after removal of ambiguous regions) of the 12S and 16S rRNA genes for 276 eleutherodactyline and Brachycephalus and three out-group species. Bootstrap support values are shown.
Fig. 7. Bayesian phylogeny of eleutherodactyline frogs. Data include 1,206 aligned bases (after removal of ambiguous regions) of the 12S and 16S rRNA genes for 276 eleutherodactyline and Brachycephalus and three out-group species. Posterior probabilities are shown.
Fig. 8. Maximum-likelihood phylogeny of eleutherodactyline frogs. Data include the complete 12S, tRNA-Val, and 16S rRNA genes (2,578 bases after removal of ambiguous regions) for 136 eleutherodactyline and Brachycephalus and nine out-group species. Bootstrap support values are shown.
Fig. 9. Minimum-evolution phylogeny of eleutherodactyline frogs. Data include the complete 12S, tRNA-Val, and 16S rRNA genes (2,578 bases after removal of ambiguous regions) for 136 eleutherodactyline and Brachycephalus and nine out-group species. Bootstrap support values are shown.
Fig. 10. Bayesian phylogeny of eleutherodactyline frogs. Data include the complete 12S, tRNA-Val, and 16S rRNA genes (2,578 bases after removal of ambiguous regions) for 136 eleutherodactyline and Brachycephalus and nine out-group species. Posterior probabilities are shown.
Figure 11. Maximum-likelihood phylogeny of eleutherodactyline frogs. Data include the complete 12S, tRNA-Val, and 16S rRNA genes (2,578 bases after removal of ambiguous regions) and fragments of Rag-1 (639 bases) and Tyr (493 bases) for 61 eleutherodactyline and Brachycephalus and three out-group species. Bootstrap support values are shown.
Fig. 12. Minimum-evolution phylogeny of eleutherodactyline frogs. Data include the complete 12S, tRNA-Val, and 16S rRNA genes (2,578 bases after removal of ambiguous regions) and fragments of Rag-1 (639 bases) and Tyr (493 bases) for 61 eleutherodactyline and Brachycephalus and three out-group species. Bootstrap support values are shown.
Fig. 13. Bayesian phylogeny of eleutherodactyline frogs. Data include the complete 12S, tRNA-Val, and 16S rRNA genes (2,578 bases after removal of ambiguous regions) and fragments of Rag-1 (639 bases) and Tyr (493 bases) for 61 eleutherodactyline and Brachycephalus and three out-group species. Posterior probabilities are shown.
Fig. 14. Guide tree for divergence time analyses. Numbers at nodes correspond to numbers in SI Table 3.
33 of 33 9/28/2010 9:23 AM Table 4. Specimens used in this study Lab Genbank accession no. Data set Museum No. Genus Species Origin tissue 280 146 65 voucher 12S 16S Rag1 Tyr no. sp. sp. sp. Eleutherodactylus 1 portoricensis This study USNM326885 101784 EF493720 EF493548 x (Eleutherodactylus) Eleutherodactylus 2 wightmanae This study USNM326905 172080 EF493721 EF493549 x (Eleutherodactylus) Eleutherodactylus 3 coqui This study USNM305421 172037 EF493722 EF493550 x (Eleutherodactylus) Eleutherodactylus 4 schwartzi This study No voucher 266012 EF493723 EF493551 x (Eleutherodactylus) Eleutherodactylus 5 gryllus This study USNM269304 101684 EF493724 EF493552 x (Eleutherodactylus) Eleutherodactylus 6 sp. 1 This study UPRRP6361 267815 EF493538 EF493365 x (Eleutherodactylus) Eleutherodactylus 7 cochranae This study USNM326775 172062 EF493725 EF493555 x (Eleutherodactylus) Eleutherodactylus 8 hedricki This study USNM564995 191587 EF493726 EF493553 x (Eleutherodactylus) Eleutherodactylus 9 brittoni This study USNM326765 172078 EF493727 EF493554 x (Eleutherodactylus) Eleutherodactylus 10 antillensis This study USNM326747 172065 EF493728 EF493556 x (Eleutherodactylus) Eleutherodactylus 11 eneidae This study USNM326857 101754 EF493729 EF493557 x (Eleutherodactylus) Eleutherodactylus 12 locustus This study USNM326861 172085 EF493730 EF493558 x (Eleutherodactylus) Eleutherodactylus 13 cooki This study USNM326784 160048 EF493539 EF493413 EF493455 x x x (Eleutherodactylus) Eleutherodactylus 14 flavescens This study USNM331662 102358 EF493731 EF493559 x (Eleutherodactylus) Eleutherodactylus 15 martinicensis This study USNM565001 102092 EF493343 EF493419 EF493456 x x x (Eleutherodactylus) Eleutherodactylus 16 amplinympha This study USNM564978 194183 EF493732 EF493560 x (Eleutherodactylus) Lab Genbank accession no. Data set Museum No. Genus Species Origin tissue 280 146 65 voucher 12S 16S Rag1 Tyr no. sp. sp. sp. Eleutherodactylus 17 johnstonei This study USNM336018 172650 EF493733 EF493561 x (Eleutherodactylus) Eleutherodactylus 18 pinchoni This study USNM565006 101896 EF493734 EF493562 x (Eleutherodactylus) Eleutherodactylus 19 barlagnei This study USNM564982 102110 EF493735 EF493563 x (Eleutherodactylus) Eleutherodactylus 20 auriculatus This study USNM564980 192808 EF493344 EF493417 EF493458 x x x (Eleutherodactylus) Eleutherodactylus 21 bartonsmithi This study USNM309753 190019 EF493736 EF493576 x (Eleutherodactylus) Eleutherodactylus 22 glamyrus This study USNM564987 190453 EF493737 EF493575 x (Eleutherodactylus) Eleutherodactylus 23 mariposa This study MNHNCu591 190919 EF493738 EF493573 x (Eleutherodactylus) Eleutherodactylus 24 ronaldi This study USNM309760 190023 EF493739 EF493574 x (Eleutherodactylus) Eleutherodactylus 25 eileenae This study No voucher 172823 EF493740 EF493577 x (Eleutherodactylus) Eleutherodactylus 26 minutus This study USNM331987 101305 EF493741 EF493578 x (Eleutherodactylus) Eleutherodactylus 27 poolei This study USNM332236 160779 EF493742 EF493579 x (Eleutherodactylus) Eleutherodactylus 28 haitianus This study No voucher 103103 EF493743 EF493583 x (Eleutherodactylus) Eleutherodactylus 29 abbotti This study USNM564974 267594 EF493540 EF493412 EF493457 x x x (Eleutherodactylus) Eleutherodactylus 30 audanti This study USNM331514 161405 EF493744 EF493584 x (Eleutherodactylus) Eleutherodactylus 31 sp. 2 This study USNM337773 161469 EF493745 EF493580 x (Eleutherodactylus) Eleutherodactylus 32 parabates This study USNM332136 161393 EF493746 EF493581 x (Eleutherodactylus) 33 Eleutherodactylus pituinus This study USNM332229 161658 EF493747 EF493582 x Lab Genbank accession no. Data set Museum No. Genus Species Origin tissue 280 146 65 voucher 12S 16S Rag1 Tyr no. sp. sp. sp. (Eleutherodactylus) Eleutherodactylus 34 ionthus This study USNM309757 190915 EF493748 EF493564 x (Eleutherodactylus) Eleutherodactylus 35 guantanamera This study MNHNCu590 191061 EF493749 EF493565 x (Eleutherodactylus) Eleutherodactylus 36 varians This study USNM309763 172526 EF493750 EF493566 x (Eleutherodactylus) Eleutherodactylus 37 leberi This study USNM309758 190598 EF493342 EF493403 EF493459 x x x (Eleutherodactylus) Eleutherodactylus 38 melacara This study USNM309733 190442 EF493751 EF493567 x (Eleutherodactylus) Eleutherodactylus 39 lamprotes This study USNM564997 192242 EF493379 EF493460 x x x (Eleutherodactylus) Eleutherodactylus 40 fowleri This study USNM269266 160239 EF493752 EF493568 x (Eleutherodactylus) Eleutherodactylus 41 wetmorei This study USNM332369 104639 EF493753 EF493569 x (Eleutherodactylus) Eleutherodactylus 42 auriculatoides This study USNM331627 161584 EF493754 EF493572 x (Eleutherodactylus) Eleutherodactylus 43 patriciae This study No voucher 161628 EF493755 EF493570 x (Eleutherodactylus) Eleutherodactylus 44 montanus This study USNM332069 161648 EF493756 EF493571 x (Eleutherodactylus) Eleutherodactylus 45 richmondi This study USNM326894 172042 EF493541 EF493461 x x x (Eleutherodactylus) Eleutherodactylus 46 unicolor This study USNM326897 160038 EF493542 EF493398 EF493462 x x x (Eleutherodactylus) Eleutherodactylus 47 hypostenor This study USNM257731 101336 EF493757 EF493585 x (Pelorius) Eleutherodactylus 48 parapelates This study USNM257726 104622 EF493758 EF493587 x (Pelorius) Eleutherodactylus 49 ruthae This study USNM257752 160686 EF493759 EF493586 x (Pelorius) Lab Genbank accession no. Data set Museum No. Genus Species Origin tissue 280 146 65 voucher 12S 16S Rag1 Tyr no. sp. sp. sp. Eleutherodactylus 50 nortoni This study USNM257744 160630 EF493760 EF493588 x (Pelorius) Eleutherodactylus 51 chlorophenax This study USNM257730 160673 EF493543 EF493589 x (Pelorius) Eleutherodactylus 52 inoptatus This study USNM331931 101237 EF493380 EF493405 EF493463 x x x (Pelorius) 53 Eleutherodactylus counouspeus This study USNM329989 103848 EF493719 x x Eleutherodactylus 54 cundalli This study USNM266364 103511 EF493761 EF493612 x (Euhyas) Eleutherodactylus 55 glaucoreius This study USNM305366 103568 EF493762 EF493613 x (Euhyas) Eleutherodactylus 56 cavernicola This study USNM266357 103261 EF493763 EF493614 x (Euhyas) Eleutherodactylus 57 gossei This study USNM327419 103312 EF493716 EF493410 EF493466 x x x (Euhyas) Eleutherodactylus 58 junori This study USNM269239 161028 EF493764 EF493617 x (Euhyas) Eleutherodactylus 59 griphus This study USNM564992 103185 EF493381 EF493415 EF493465 x x x (Euhyas) Eleutherodactylus 60 pentasyringos This study USNM266455 103477 EF493765 EF493615 x (Euhyas) Eleutherodactylus 61 pantoni This study USNM327822 103514 EF493766 EF493616 x (Euhyas) Eleutherodactylus 62 orcutti This study USNM327808 103499 EF493767 EF493619 x (Euhyas) Eleutherodactylus 63 alticola This study USNM266340 103583 EF493768 EF493620 x (Euhyas) Eleutherodactylus 64 fuscus This study USNM266380 103205 EF493769 EF493618 x (Euhyas) Eleutherodactylus 65 jamaicensis This study USNM327594 161119 EF493770 EF493621 x (Euhyas) Eleutherodactylus This study USNM327267 171593 66 andrewsi EF493544 EF493623 x (Euhyas) This study USNM327274 103275 Lab Genbank accession no. Data set Museum No. Genus Species Origin tissue 280 146 65 voucher 12S 16S Rag1 Tyr no. sp. sp. sp. Eleutherodactylus 67 nubicola This study USNM327777 103272 EF493771 EF493622 x (Euhyas) Eleutherodactylus 68 grabhami This study USNM327565 161260 EF493772 EF493624 x (Euhyas) Eleutherodactylus 69 sisyphodemus This study USNM266467 103219 EF493773 EF493625 x (Euhyas) Eleutherodactylus 70 luteolus This study USNM327744 101469 EF493545 EF493464 x x x (Euhyas) Eleutherodactylus 71 riparius 1 n/a n/a Y10944 x x (Euhyas) Eleutherodactylus 72 rivularis This study USNM565009 193690 EF493376 EF493626 x (Euhyas) Eleutherodactylus 73 toa This study USNM306544 191333 EF493774 EF493627 x (Euhyas) Eleutherodactylus 74 cuneatus This study USNM564985 191146 EF493775 EF493608 x (Euhyas) Eleutherodactylus 75 turquinensis This study USNM348803 193530 EF493776 EF493609 x (Euhyas) Eleutherodactylus 76 darlingtoni This study USNM307236 104190 EF493777 EF493610 x (Euhyas) Eleutherodactylus 77 leoncei This study USNM564999 267599 EF493375 EF493715 EF493404 EF493468 x x x (Euhyas) Eleutherodactylus 78 alcoae This study USNM564977 194867 EF493382 EF493406 EF493469 x x x (Euhyas) Eleutherodactylus 79 armstrongi This study USNM329962 160557 EF493778 EF493611 x (Euhyas) Eleutherodactylus 80 rhodesi This study USNM332259 267890 EF493779 EF493629 x (Euhyas) Eleutherodactylus 81 weinlandi This study USNM332332 160385 EF493780 EF493630 x (Euhyas) Eleutherodactylus 82 grahami This study USNM564990 192409 EF493781 EF493632 x (Euhyas)
Eleutherodactylus 83 pictissimus This study USNM266310 101354 EF493782 EF493631 x (Euhyas) Eleutherodactylus 84 lentus This study USNM564998 266089 EF493717 EF493418 EF493471 x x x (Euhyas) Eleutherodactylus 85 monensis This study USNM565002 192871 EF493783 EF493633 x (Euhyas) Eleutherodactylus 86 probolaeus This study USNM322252 160303 EF493784 EF493634 x (Euhyas) Eleutherodactylus 87 bresslerae This study USNM564983 190021 EF493785 EF493635 x (Euhyas) Eleutherodactylus 88 ricordii This study USNM565008 190351 EF493786 EF493636 x (Euhyas) Eleutherodactylus 89 acmonis This study USNM564975 190024 EF493787 EF493637 x (Euhyas) Eleutherodactylus 90 orientalis This study USNM565003 190034 EF493373 EF493592 x (Euhyas) Eleutherodactylus 91 etheridgei This study USNM335715 161908 EF493794 EF493593 x (Euhyas) Eleutherodactylus 92 limbatus This study USNM565000 172513 EF493795 EF493590 x (Euhyas) Eleutherodactylus 93 iberia This study MNHNCu1001 266768 EF493374 EF493591 x (Euhyas) Eleutherodactylus 94 cubanus This study No voucher 193693 EF493796 EF493594 x (Euhyas) Eleutherodactylus 95 casparii This study USNM564984 172843 EF493788 EF493599 x (Euhyas) Eleutherodactylus 96 planirostris This study USNM565007 192884 EF493346 EF493396 EF493470 x x x (Euhyas) Eleutherodactylus 97 guanahacabibes This study USNM564993 192798 EF493789 EF493600 x (Euhyas) Eleutherodactylus 98 tonyi This study No voucher 193932 EF493790 EF493602 x (Euhyas) Eleutherodactylus 99 rogersi This study USNM565010 192891 EF493372 EF493603 x (Euhyas)
Eleutherodactylus 100 goini This study USNM335725 172589 EF493791 EF493604 x (Euhyas) Eleutherodactylus 101 thomasi This study No voucher 266681 EF493370 EF493605 x (Euhyas) Eleutherodactylus 102 blairhedgesi This study No voucher 266679 EF493371 EF493606 x (Euhyas) Eleutherodactylus 103 pinarensis This study USNM565005 191490 EF493792 EF493607 x (Euhyas) Eleutherodactylus 104 atkinsi This study USNM335686 172520 EF493797 EF493598 x (Euhyas) Eleutherodactylus 105 gundlachi This study USNM564994 190260 EF493798 EF493597 x (Euhyas) Eleutherodactylus 106 cf. varleyi This study MNHNCu1002 266765 EF493345 EF493408 EF493467 x x x (Euhyas) Eleutherodactylus 107 intermedius This study USNM564996 190245 EF493799 EF493595 x (Euhyas) Eleutherodactylus 108 varleyi This study USNM335732 172529 EF493800 EF493596 x (Euhyas) Eleutherodactylus 109 pezopetrus This study USNM565004 190536 EF493793 EF493601 x (Euhyas) Eleutherodactylus 110 greyi This study USNM564991 172799 EF493801 EF493628 x (Euhyas) Eleutherodactylus 111 emiliae This study No voucher 266680 EF493368 EF493638 x (Euhyas) Eleutherodactylus 112 dimidiatus This study USNM564986 190049 EF493802 EF493640 x (Euhyas) Eleutherodactylus 113 maestrensis This study MNHNCu1003 266593 EF493369 EF493639 x (Euhyas) Eleutherodactylus 114 albipes This study USNM564976 190449 EF493386 EF493409 EF493475 x x x (Euhyas) Eleutherodactylus 115 schmidti This study USNM332313 161668 EF493803 EF493641 x (Euhyas) Eleutherodactylus 116 eunaster This study No voucher 267897 EF493804 EF493646 x (Euhyas)
117 Eleutherodactylus (Euhyas) caribe This study USNM314179 191962 EF493385 EF493411 EF493472 x x x 118 Eleutherodactylus (Euhyas) corona This study KU218431 192197 EF493807 EF493645 x 119 Eleutherodactylus (Euhyas) heminota This study USNM331829 267899 EF493806 EF493649 x 120 Eleutherodactylus (Euhyas) amadeus This study USNM329866 267898 EF493805 EF493644 x 121 Eleutherodactylus (Euhyas) bakeri This study USNM564981 104652 EF493808 EF493647 x 122 Eleutherodactylus (Euhyas) glaphycompus This study USNM292259 103958 EF493383 x x 123 Eleutherodactylus (Euhyas) dolomedes This study KU218434 192109 EF493809 EF493648 x 124 Eleutherodactylus (Euhyas) glanduliferoides This study USNM564989 160571 EF493546 EF493364 x 125 Eleutherodactylus (Euhyas) thorectes This study USNM565011 192230 EF493384 EF493416 EF493473 x x x 126 Eleutherodactylus (Euhyas) jugans This study USNM331952 267901 EF493810 EF493652 x 127 Eleutherodactylus (Euhyas) apostates This study USNM564979 192240 EF493811 EF493650 x 128 Eleutherodactylus (Euhyas) oxyrhynchus This study USNM332073 267902 EF493812 EF493651 x 129 Eleutherodactylus (Euhyas) rufifemoralis This study No voucher 160226 EF493813 EF493653 x 130 Eleutherodactylus (Euhyas) furcyensis This study USNM331673 267903 EF493814 EF493654 x 131 Eleutherodactylus (Euhyas) paulsoni This study USNM310833 191998 EF493815 EF493659 x 132 Eleutherodactylus (Euhyas) glandulifer This study USNM564988 192074 EF493816 EF493655 x 133 Eleutherodactylus (Euhyas) sciagraphus This study USNM332316 103943 EF493817 EF493656 x 134 Eleutherodactylus (Euhyas) ventrilineatus This study USNM332320 267904 EF493818 EF493658 x 135 Eleutherodactylus (Euhyas) brevirostris This study USNM329968 267905 EF493819 EF493657 x 136 Eleutherodactylus (Euhyas) zugi This study USNM335744 172578 EF493347 EF493401 EF493474 x x x 137 Eleutherodactylus (Euhyas) klinikowskii This study MNHNCu1004 266592 EF493547 EF493363 x This study 194156 EF493820 EF493642 138 Eleutherodactylus (Syrrhophus) marnockii No voucher n/a EF493399 EF493476 x x x 2 n/a DQ283102 DQ283101 139 Eleutherodactylus (Syrrhophus) symingtoni This study No voucher 172583 EF493821 EF493643 x 140 Eleutherodactylus (Syrrhophus) zeus This study USNM335740 172582 EF493718 EF493402 EF493477 x x x 141 Barycholos ternetzi 2 n/a n/a DQ283094 DQ284144 x x x This study USNM303077 267339 142 "Eleutherodactylus" binotatus EF493361 EF493397 DQ282918 x x x 2 n/a n/a 143 Craugastor rhodopis 2 n/a n/a DQ283317 x x 144 Craugastor mexicanus 3 n/a n/a AY326006 x x 145 Craugastor podiciferus This study MVZ12020 266082 EF493360 EF493450 EF493481 x x x AMNH- 146 Craugastor bransfordii This study 267852 EF493822 EF493661 x A124398 147 Craugastor longirostris This study KU177803 267853 EF493395 EF493454 EF493482 x x x 148 Craugastor fitzingeri 3 n/a n/a AY326001 x x 149 Craugastor sandersoni This study UTA-A49803 267854 EF493712 x x 150 Craugastor punctariolus 2 n/a n/a DQ283168 x x 151 Craugastor pygmaeus This study UTA-A55241 267855 EF493711 EF493451 EF493479 x x x 152 Craugastor montanus This study UTA-A51105 267888 EF493530 EF493453 EF493478 x x x 153 Craugastor augusti 2 n/a n/a DQ283271 x x 154 Craugastor bocourti This study UTA-A55235 267856 EF493713 x x 155 Craugastor alfredi 2 n/a n/a DQ283318 x x 156 Craugastor daryi This study UTA-A57940 267858 EF493531 EF493452 EF493480 x x x 157 Brachycephalus ephippium 3, 2 n/a n/a n/a n/a AY326008 DQ283091 DQ282917 x x x 158 "Phrynopus" peraccai This study KU178266 267859 EF493710 EF493420 EF493485 x x x 159 "Phrynopus" brunneus This study KU178258 267860 EF493357 EF493422 EF493484 x x x 160 "Eleutherodactylus" elassodiscus This study KU177282 267861 EF493358 x x 161 "Eleutherodactylus" dolops This study No voucher 267862 EF493394 EF493414 EF493483 x x x 162 Pristimantis walkeri This study KU218116 267231 EF493518 EF493428 EF493490 x x x 163 Pristimantis luteolateralis This study KU177807 267863 EF493517 x x 164 Pristimantis parvillus This study KU177821 267864 EF493351 x x 165 Pristimantis chalceus This study KU177638 267865 EF493675 x x 166 Pristimantis ockendeni This study KU222023 267253 EF493519 EF493434 EF493496 x x x 167 Pristimantis unistrigatus This study KU218057 267227 EF493387 EF493444 EF493505 x x x 168 Pristimantis cajamarcensis This study KU217845 267211 EF493823 EF493663 x 169 Pristimantis ceuthospilus This study KU 212216 267198 EF493520 x x 170 Pristimantis lirellus This study KU212226 267200 EF493521 x x 171 Pristimantis imitatrix This study KU215476 267205 EF493824 EF493667 x 172 Pristimantis croceoinguinis This study KU217862 267213 EF493669 EF493665 x 173 Pristimantis altamazonicus This study KU215460 267204 EF493670 EF493441 x x x 174 Pristimantis orestes This study KU218257 267249 EF493388 x x 175 Pristimantis simonbolivari This study KU218254 267248 EF493671 x x 176 Pristimantis riveti This study KU218035 267224 EF493348 x x 177 Pristimantis versicolor This study KU218096 267228 EF493389 EF493431 EF493493 x x x 178 Pristimantis phoxocephalus This study KU218025 267222 EF493349 x x 179 Pristimantis spinosus This study KU218052 267225 EF493673 x x 180 Pristimantis cryophilius This study KU217863 267214 EF493672 x x 181 Pristimantis rhodoplichus This study KU219788 267250 EF493674 x x 182 Pristimantis wiensi This study KU219796 267251 EF493377 EF493668 x 183 Pristimantis petrobardus This study KU212293 267202 EF493825 EF493367 x MHNSM- 184 Pristimantis melanogaster This study 267438 EF493826 EF493664 x WED56846 185 Pristimantis simonsii 4 n/a n/a AM039709 AM039641 x 186 Pristimantis appendiculatus This study KU177637 267866 EF493524 x x 187 Pristimantis pycnodermis This study KU218028 267223 EF493680 x x 188 Pristimantis dissimulatus This study KU179090 267867 EF493522 x x 189 Pristimantis calcarulatus This study KU177658 267868 EF493523 x x 190 Pristimantis orcesi This study KU218021 267221 EF493679 x x 191 Pristimantis glandulosus This study KU218002 267217 EF493676 x x 192 Pristimantis inusitatus This study KU218015 267218 EF493677 x x 193 Pristimantis acerus This study KU217786 267207 EF493678 x x 194 Pristimantis schultei This study KU212220 267199 EF493681 x x 195 Pristimantis bromeliaceus This study KU291702 171051 EF493351 x x 196 Pristimantis subsigillatus This study KU218147 267246 EF493525 x x 197 Pristimantis nyctophylax This study KU177812 267869 EF493526 EF493425 EF493487 x x x 198 Pristimantis shrevei This study No voucher 266036 EF493692 x x 199 Pristimantis euphronides This study BWMC6918 266624 EF493527 EF493427 EF493489 x x x 200 Pristimantis rozei This study No voucher 102308 EF493691 EF493429 EF493491 x x x 201 Pristimantis gentryi This study KU218109 267230 EF493511 x x 202 Pristimantis truebae This study KU218013 267229 EF493512 x x 203 Pristimantis curtipes This study KU217871 267215 EF493513 EF493435 EF493497 x x x 204 Pristimantis vertebralis This study KU177972 267870 EF493689 x x 205 Pristimantis buckleyi This study KU217836 267210 EF493350 x x 206 Pristimantis devillei This study KU217991 267216 EF493688 x x 207 Pristimantis surdus This study KU177847 267871 EF493687 x 208 Pristimantis quinquagesimus This study KU179374 267872 EF493690 x x 3, This n/a 209 Pristimantis duellmani n/a KU217998 AY326003 EF493500 x x x study 267444 EF493438 210 Pristimantis thymalopsoides This study KU177861 267873 EF493514 x x 211 Pristimantis ocreatus This study KU208508 267439 EF493682 x x 212 Pristimantis pyrrhomerus This study KU218030 267441 EF493683 x x 213 Pristimantis festae This study KU218234 267247 EF493515 x x 214 Pristimantis leoni This study KU218227 267437 EF493684 EF493433 EF493495 x x x 215 Pristimantis verecundus This study QCAZ12410 267646 EF493686 x x 216 Pristimantis celator This study KU177684 267874 EF493685 x x 217 Pristimantis chloronotus 3 n/a n/a AY326007 x x 218 Pristimantis thymelensis This study QCAZ16428 267644 EF493516 EF493442 EF493503 x x x 219 Pristimantis supernatis 3 n/a n/a AY326005 x x 220 Pristimantis sp. 1 3 n/a n/a AY326002 x x 221 Pristimantis urichi This study USNM336098 101646 EF493699 EF493426 EF493488 x x x 222 Pristimantis latidiscus This study KU218016 267219 EF493698 x x 223 Pristimantis colomai This study QCAZ17101 267635 EF493354 EF493440 EF493502 x x x AMNH- 224 Pristimantis cruentus This study 267876 EF493697 x x A12444-448 AMNH- 225 Pristimantis ridens This study 267877 EF493355 x x A124551 226 Pristimantis cremnobates This study KU177252 267878 EF493528 EF493424 EF493486 x x x 227 Pristimantis w-nigrum 3 n/a n/a AY326004 x x 228 Pristimantis actites This study KU217830 267209 EF493696 EF493432 EF493494 x x x 229 Pristimantis lanthanites This study KU222001 267252 EF493695 x x 230 Pristimantis crenunguis This study KU177730 267879 EF493693 EF493666 x 231 Pristimantis labiosus This study QCAZ19771 267640 EF493694 x x MHNSM- 232 Pristimantis sp. 2 This study 266049 EF493356 x x LR4341 233 Pristimantis conspicillatus This study QCAZ28448 267636 EF493529 EF493437 EF493499 x x x 234 Pristimantis condor This study KU217857 267212 EF493701 EF493443 EF493504 x x x 235 Pristimantis citriogaster This study KU212278 267201 EF493700 x x 236 Pristimantis achatinus This study KU217809 267208 EF493827 EF493660 x 237 Pristimantis lymani This study KU218019 267220 EF493392 x x 238 Pristimantis fenestratus This study MHNSM9298 266046 EF493703 x x 239 Pristimantis bipunctatus This study KU291638 171021 EF493702 EF493430 EF493492 x x x 240 Pristimantis skydmainos This study MHNSM10071 266052 EF493393 x x 241 Pristimantis toftae This study KU215493 267206 EF493353 x x 242 Pristimantis rhabdolaemus This study KU173492 267875 EF493706 x x 243 Pristimantis pluvicanorus 5 n/a n/a AY843586 x x 244 Pristimantis sagittulus This study KU291635 171098 EF493705 EF493439 EF493501 x x x 245 Pristimantis stictogaster This study KU291659 171080 EF493704 EF493445 EF493506 x x x 246 Pristimantis aniptopalmatus This study KU291627 171070 EF493390 x x 247 Pristimantis peruvianus This study MHNSM9267 266050 EF493707 EF493436 EF493498 x x x 248 Pristimantis caprifer This study KU177680 267880 EF493391 x x This study, KU178249-250 267881 EF493828 EF493662 249 Oreobates quixensis x x 6 n/a n/a AY819344 AY819474 250 Oreobates sp. 2 n/a n/a DQ283060 DQ283061 x 251 Phrynopus parkeri 4 n/a n/a AM039707 AM039639 x 252 Phrynopus juninensis 4 n/a n/a AM039725 AM039657 x 253 Phrynopus kauneorum 4 n/a n/a AM039718 AM039650 x 254 Phrynopus tautzorum 4 n/a n/a AM039720 AM039652 x 255 Phrynopus barthlenae 4 n/a n/a AM039717 AM039649 x 256 Phrynopus horstpauli 4 n/a n/a AM039715 AM039647 x 257 Phrynopus pesantesi 4 n/a n/a AM039724 AM039656 x 258 Phrynopus bufoides 4 n/a n/a AM039713 AM039645 x 259 Phrynopus heimorum 4 n/a n/a AM039703 AM039635 x 260 Phrynopus bracki This study USNM286919 171045 EF493709 EF493421 EF493507 x x x 261 Phrynopus sp. 1 This study KU291634 171082 EF493708 x x 262 Phrynopus cophites This study KU173497 267882 EF493537 EF493423 EF493508 x x x 263 Phrynopus iatamasi 4 n/a n/a AM039712 AM039644 x 264 Phrynopus wettsteini 4 n/a n/a AM039711 AM039643 x 265 Phrynopus sp. 2 4 n/a n/a AM039710 AM039642 x 266 Phrynopus sp. 3 5 n/a n/a AY843720 x 267 Phrynopus peruvianus This study KU173495 267889 EF493714 x x 268 Phyllonastes sp. 4 n/a n/a AM039714 AM039646 x 269 Holoaden bradei This study USNM207945 267883 EF493378 EF493366 EF493449 x x 270 Limnophys anomalus This study KU177627 267884 EF493534 EF493447 x x x/2 271 Limnophys bufoniformis 2 n/a n/a DQ283165 DQ282942 x x x/2 272 Limnophys necerus This study KU179076 267885 EF493535 x x 273 Limnophys sulcatus This study KU218055 267226 EF493536 x x 274 Ischnocnema guentheri This study No voucher 267345 EF493533 EF493407 EF493510 x x x 275 Ischnocnema hoehnei This study No voucher 267886 EF493359 x 276 Ischnocnema parva This study No voucher 267328 EF493532 EF493400 EF493509 x x x 277 Ischnocnema juipoca 2 n/a n/a DQ283093 x x 5, This n/a 278 Litoria caerulea n/a No voucher AY843692 AY844131 x x x study 267887 EF493446
2, D. Cannatella,
279 Agalychnis callidryas personal n/a n/a n/a n/a DQ283423 DQ283018 x x x EF493362 communi- cation n/a 7, This n/a No voucher 280 Rana catesbeiana 266591 M57527 DQ283257 x x x study, 2 n/a EF493448 DQ282959 n/a n/a Bufo melanostictus 8 n/a n/a AY458592 x n/a Centrolene prosoblepon 5 n/a n/a AY843574 x n/a Ceratophrys cornuta 3 n/a n/a AY326014 x n/a Cryptobatrachus sp. 3 n/a n/a AY326050 x n/a Dendrobates sylvaticus 9 n/a n/a AY364569 x n/a Hyla chinensis 8 n/a n/a AY458593 x n/a Leptodactylus pentadactylus 3 n/a n/a AY326017 x
For each specimen, source, GenBank accession no., data sets in which species appear, museum voucher and tissue collection number (if sequence generated by the authors) are reported. Museum abbreviations are AMNH (American Museum of Natural History; prefix “A” refers to amphibians), BWMC (Bobby Witcher Memorial Collection, Avila University), KU (University of Kansas Museum of Natural History), MNHNCu (National Museum of Natural History, Havana, Cuba), MVZ (Museum of Vertebrate Zoology, University of California, Berkeley), QCAZ (Catholic University of Ecuador, Museum of Zoology), UPRRP (University of Puerto Rico, at Rio Piedras, Museum of Natural History), USNM (United States National Museum of Natural History, Smithsonian Institution), UTA (University of Texas at Arlington, Museum of Natural History), MHNSM (Universidad Nacional Mayor de San Marcos, Lima, Peru). Specimens are numbered as they appear in Fig. 2.
1. Feller AE, Hedges SB (1998) Mol Phylogenet Evol 9:509-516. 2. Frost DR, Grant T, Faivovich J, Bain RH, Haas A, Haddad CFB, De Sa RO, Channing A, Wilkinson M, Donnellan SC, et al. (2006) Bull Am Mus Nat Hist 297:1-371. 3. Darst CR, Cannatella DC (2004) Mol Phylogenet Evol 31:462-475. 4. Lehr E, Fritzsch G, Muller A (2005) Zool Scr 34:593-603. 5. Faivovich J, Haddad CFB, Garcia PCA, Frost DR, Campbell JA, Wheeler WC (2005) Bull Am Mus Nat Hist 294:1-240. 6. Wiens JJ, Fetzner JW, Parkinson CL, Reeder TW (2005) Syst Biol 54:719-748. 7. Nagae, Y. (1988) J. Nippon Med. Sch. 55 , 417-430. 8. Zhang, P., Zhou, H., Chen, Y. Q., Liu, Y. F. & Qu, L. H. (2005) Syst Biol 54 , 391-400. 9. Santos, J. C., Coloma, L. A., & Cannatella, D. C. (2003) Proc Natl Acad Sci U.S.A. 100 , 12792-12797. 80 E. (Eleutherodactylus) portoricensis 72 E. (Eleutherodactylus) wightmanae E. (Eleutherodactylus) coqui 89 97 E. (Eleutherodactylus) schwartzi E. (Eleutherodactylus) gryllus 64 100 E. (Eleutherodactylus) sp. 1 91 E. (Eleutherodactylus) cochranae 74 E. (Eleutherodactylus) hedricki 95 E. (Eleutherodactylus) brittoni 92 E. (Eleutherodactylus) antillensis 98 99 E. (Eleutherodactylus) eneidae E. (Eleutherodactylus) locustus 100 E. (Eleutherodactylus) cooki 77 E. (Eleutherodactylus) flavescens 100 E. (Eleutherodactylus) martinicensis 96 E. (Eleutherodactylus) amplinympha E. (Eleutherodactylus) johnstonei 99 E. (Eleutherodactylus) pinchoni 100 E. (Eleutherodactylus) barlagnei 63 E. (Eleutherodactylus) auriculatus 58 E. (Eleutherodactylus) bartonsmithi 92 E. (Eleutherodactylus) glamyrus 90 E. (Eleutherodactylus) mariposa 97 97 E. (Eleutherodactylus) ronaldi 35 E. (Eleutherodactylus) eileenae E. (Eleutherodactylus) minutus 62 E. (Eleutherodactylus) poolei 58 E. (Eleutherodactylus) haitianus 99 49 E. (Eleutherodactylus) abbotti 38 E. (Eleutherodactylus) audanti E. (Eleutherodactylus) sp. 2 72 79 E. (Eleutherodactylus) parabates E. (Eleutherodactylus) pituinus 100 E. (Eleutherodactylus) ionthus 51 100 39 E. (Eleutherodactylus) guantanamera 96 E. (Eleutherodactylus) varians 45 E. (Eleutherodactylus) leberi 99 E. (Eleutherodactylus) melacara 84 E. (Eleutherodactylus) lamprotes 100 E. (Eleutherodactylus) fowleri E. (Eleutherodactylus) wetmorei 74 99 E. (Eleutherodactylus) auriculatoides 99 E. (Eleutherodactylus) patriciae 55 E. (Eleutherodactylus) montanus E. (Eleutherodactylus) richmondi 97 E. (Eleutherodactylus) unicolor 80 56 E. (Pelorius) hypostenor 100 E. (Pelorius) parapelates E. (Pelorius) ruthae 100 E. (Pelorius) nortoni 79 E. (Pelorius) chlorophenax 100 E. (Pelorius) inoptatus Eleutherodactylus counouspeus 56 E. (Euhyas) cundalli 66 E. (Euhyas) glaucoreius 8 E. (Euhyas) cavernicola E. (Euhyas) gossei 32 28 E. (Euhyas) junori E. (Euhyas) griphus 36 32 E. (Euhyas) pentasyringos 75 E. (Euhyas) pantoni 28 E. (Euhyas) orcutti 51 E. (Euhyas) alticola 12 43 E. (Euhyas) fuscus E. (Euhyas) jamaicensis 49 E. (Euhyas) andrewsi 37 E. (Euhyas) nubicola 71 E. (Euhyas) grabhami 66 47 E. (Euhyas) sisyphodemus E. (Euhyas) luteolus 35 E. (Euhyas) riparius E. (Euhyas) rivularis 70 68 E. (Euhyas) toa E. (Euhyas) cuneatus 17 68 E. (Euhyas) turquinensis 100 E. (Euhyas) darlingtoni 83 E. (Euhyas) leoncei E. (Euhyas) alcoae 77 E. (Euhyas) armstrongi 34 88 E. (Euhyas) rhodesi 41 E. (Euhyas) weinlandi 67 E. (Euhyas) grahami 99 E. (Euhyas) pictissimus 100 E. (Euhyas) lentus E. (Euhyas) monensis 48 E. (Euhyas) probolaeus 91 97 E. (Euhyas) bresslerae E. (Euhyas) ricordii 100 E. (Euhyas) acmonis
0.1 39 E. (Euhyas) orientalis 48 E. (Euhyas) etheridgei 99 98 86 E. (Euhyas) limbatus 99 E. (Euhyas) iberia E. (Euhyas) cubanus 100 E. (Euhyas) casparii 97 E. (Euhyas) planirostris 35 25 E. (Euhyas) guanahacabibes 67 E. (Euhyas) tonyi E. (Euhyas) rogersi 65 48 E. (Euhyas) goini 93 100 E. (Euhyas) thomasi 100 E. (Euhyas) blairhedgesi 86 23 E. (Euhyas) pinarensis E. (Euhyas) atkinsi 29 E. (Euhyas) gundlachi 31 E. (Euhyas) cf. varleyi 66 87 E. (Euhyas) intermedius 95 E. (Euhyas) varleyi E. (Euhyas) pezopetrus E. (Euhyas) greyi 98 E. (Euhyas) emiliae 86 E. (Euhyas) dimidiatus 99 E. (Euhyas) maestrensis 20 E. (Euhyas) albipes 86 E. (Euhyas) schmidti 87 E. (Euhyas) eunaster 33 E. (Euhyas) caribe 20 E. (Euhyas) corona 50 E. (Euhyas) heminota 33 31 E. (Euhyas) amadeus 25 E. (Euhyas) bakeri E. (Euhyas) glaphycompus 63 77 E. (Euhyas) dolomedes 46 E. (Euhyas) glanduliferoides 30 E. (Euhyas) thorectes 46 E. (Euhyas) jugans 47 E. (Euhyas) apostates 16 99 E. (Euhyas) oxyrhynchus 64 E. (Euhyas) rufifemoralis 99 99 E. (Euhyas) furcyensis 99 E. (Euhyas) paulsoni 76 E. (Euhyas) glandulifer E. (Euhyas) sciagraphus E. (Euhyas) ventrilineatus 34 88 46 E. (Euhyas) brevirostris E. (Euhyas) zugi 100 E. (Euhyas) klinikowskii E. (Syrrhophus) marnockii 80 E. (Syrrhophus) symingtoni E. (Syrrhophus) zeus 16 100 Barycholos ternetzi "Eleutherodactylus" binotatus 100 Craugastor rhodopis 100 Craugastor mexicanus 99 Craugastor podiciferus 98 Craugastor bransfordii 100 Craugastor longirostris 15 Craugastor fitzingeri 97 96 100 Craugastor sandersoni Craugastor punctariolus 69 99 Craugastor pygmaeus Craugastor montanus 99 59 Craugastor augusti 100 Craugastor bocourti Craugastor alfredi Craugastor daryi Brachycephalus ephippium 82 "Phrynopus" peraccai 99 "Phrynopus" brunneus 27 "Eleutherodactylus" elassodiscus "Eleutherodactylus" dolops 99 Pristimantis walkeri 99 Pristimantis luteolateralis 94 Pristimantis parvillus 85 Pristimantis chalceus 63 Pristimantis ockendeni Pristimantis unistrigatus Pristimantis cajamarcensis 74 59 51 Pristimantis ceuthospilus 99 Pristimantis lirellus 71 100 Pristimantis imitatrix Pristimantis croceoinguinis 96 Pristimantis altamazonicus Pristimantis orestes 45 100 Pristimantis simonbolivari 81 Pristimantis riveti 93 Pristimantis versicolor 14 Pristimantis phoxocephalus 93 Pristimantis spinosus 47 Pristimantis cryophilius 33 Pristimantis rhodoplichus 69 Pristimantis wiensi 60 Pristimantis petrobardus Pristimantis melanogaster 15 Pristimantis simonsii
0.1 41 Pristimantis appendiculatus 30 57 Pristimantis pycnodermis 69 Pristimantis dissimulatus 52 Pristimantis calcarulatus 91 Pristimantis orcesi 80 Pristimantis glandulosus 15 Pristimantis inusitatus 9 99 Pristimantis acerus 69 99 Pristimantis schultei Pristimantis bromeliaceus 89 Pristimantis subsigillatus 100 Pristimantis nyctophylax 100 Pristimantis shrevei Pristimantis euphronides 13 Pristimantis rozei 100 Pristimantis gentryi 8 98 Pristimantis truebae 5 39 Pristimantis curtipes Pristimantis vertebralis 92 92 Pristimantis buckleyi 24 Pristimantis devillei 95 Pristimantis surdus Pristimantis quinquagesimus 52 Pristimantis duellmani 11 70 Pristimantis thymalopsoides 59 Pristimantis ocreatus 99 63 Pristimantis pyrrhomerus 72 Pristimantis festae Pristimantis leoni 23 97 Pristimantis verecundus 91 Pristimantis celator 59 Pristimantis chloronotus 65 Pristimantis thymelensis Pristimantis supernatis 100 Pristimantis sp. 1 9 Pristimantis urichi 100 Pristimantis latidiscus 96 Pristimantis colomai 71 Pristimantis cruentus Pristimantis ridens 71 Pristimantis cremnobates 99 Pristimantis w-nigrum 77 99 Pristimantis actites Pristimantis lanthanites 88 Pristimantis crenunguis 29 100 Pristimantis labiosus 100 Pristimantis sp. 2 60 Pristimantis conspicillatus 99 61 Pristimantis condor 93 Pristimantis citriogaster 76 Pristimantis achatinus 3 83 Pristimantis lymani 92 Pristimantis fenestratus 95 Pristimantis bipunctatus 70 Pristimantis skydmainos 77 Pristimantis toftae 36 Pristimantis rhabdolaemus 75 32 Pristimantis pluvicanorus 76 Pristimantis sagittulus Pristimantis stictogaster 100 98 Pristimantis aniptopalmatus Pristimantis peruvianus 22 Pristimantis caprifer 100 Oreobates quixensis 29 Oreobates sp. Phrynopus parkeri 95 Phrynopus juninensis 70 Phrynopus kauneorum 41 Phrynopus tautzorum Phrynopus barthlenae 75 42 89 Phrynopus horstpauli 56 Phrynopus pesantesi 73 Phrynopus bufoides Phrynopus heimorum Phrynopus bracki 99 Phrynopus sp. 1 Phrynopus cophites 36 Phrynopus iatamasi 62 Phrynopus wettsteini 8 99 Phrynopus sp. 2 97 Phrynopus sp. 3 9 Phrynopus peruvianus Phyllonastes sp. 5 10 Holoaden bradei 93 Limnophys anomalus 96 Limnophys bufoniformis Limnophys necerus 99 Limnophys sulcatus 68 Ischnocnema guentheri 82 Ischnocnema hoehnei Ischnocnema parva 99 Ischnocnema juipoca Litoria caerulea 50 Agalychnis callidryas Rana catesbeiana
0.1 76 E. (Eleutherodactylus) portoricensis 66 E. (Eleutherodactylus) wightmanae 78 E. (Eleutherodactylus) schwartzi 87 E. (Eleutherodactylus) coqui E. (Eleutherodactylus) gryllus 54 99 E. (Eleutherodactylus) sp. 1 85 E. (Eleutherodactylus) cochranae 95 E. (Eleutherodactylus) hedricki 68 E. (Eleutherodactylus) brittoni 83 E. (Eleutherodactylus) antillensis 99 99 E. (Eleutherodactylus) eneidae 99 E. (Eleutherodactylus) locustus E. (Eleutherodactylus) cooki 69 E. (Eleutherodactylus) flavescens 99 E. (Eleutherodactylus) martinicensis 85 E. (Eleutherodactylus) amplinympha 99 E. (Eleutherodactylus) johnstonei 99 E. (Eleutherodactylus) barlagnei E. (Eleutherodactylus) pinchoni 62 99 E. (Eleutherodactylus) guantanamera 99 E. (Eleutherodactylus) ionthus 96 E. (Eleutherodactylus) varians 39 99 E. (Eleutherodactylus) leberi E. (Eleutherodactylus) melacara 79 99 E. (Eleutherodactylus) lamprotes E. (Eleutherodactylus) fowleri 99 E. (Eleutherodactylus) wetmorei 92 E. (Eleutherodactylus) patriciae 66 99 E. (Eleutherodactylus) montanus E. (Eleutherodactylus) auriculatoides 40 E. (Eleutherodactylus) abbotti 33 E. (Eleutherodactylus) haitianus 53 E. (Eleutherodactylus) audanti E. (Eleutherodactylus) pituinus E. (Eleutherodactylus) sp. 2 80 E. (Eleutherodactylus) parabates 93 E. (Eleutherodactylus) mariposa 97 21 E. (Eleutherodactylus) ronaldi 96 68 E. (Eleutherodactylus) glamyrus 75 E. (Eleutherodactylus) bartonsmithi 50 E. (Eleutherodactylus) auriculatus E. (Eleutherodactylus) eileenae 36 57 E. (Eleutherodactylus) minutus E. (Eleutherodactylus) poolei 99 E. (Eleutherodactylus) unicolor E. (Eleutherodactylus) richmondi Eleutherodactylus counouspeus 60 E. (Pelorius) parapelates 41 99 E. (Pelorius) hypostenor E. (Pelorius) ruthae 59 E. (Pelorius) inoptatus 99 E. (Pelorius) chlorophenax 99 E. (Pelorius) nortoni 81 E. (Euhyas) pantoni 37 E. (Euhyas) pentasyringos 37 53 E. (Euhyas) gossei 20 E. (Euhyas) junori E. (Euhyas) griphus 9 E. (Euhyas) fuscus E. (Euhyas) orcutti E. (Euhyas) cavernicola 13 54 E. (Euhyas) cundalli 67 E. (Euhyas) glaucoreius 48 E. (Euhyas) nubicola 22 E. (Euhyas) jamaicensis 75 26 E. (Euhyas) andrewsi E. (Euhyas) alticola 69 E. (Euhyas) grabhami 37 41 E. (Euhyas) sisyphodemus E. (Euhyas) luteolus 19 E. (Euhyas) toa 65 E. (Euhyas) rivularis E. (Euhyas) riparius E. (Euhyas) cuneatus 99 17 52 E. (Euhyas) turquinensis E. (Euhyas) greyi E. (Euhyas) armstrongi 61 E. (Euhyas) alcoae 60 E. (Euhyas) darlingtoni 99 E. (Euhyas) leoncei 18 36 E. (Euhyas) weinlandi 42 E. (Euhyas) pictissimus 77 E. (Euhyas) rhodesi 99 E. (Euhyas) grahami 49 99 E. (Euhyas) lentus E. (Euhyas) probolaeus E. (Euhyas) monensis 45 97 E. (Euhyas) bresslerae 99 E. (Euhyas) ricordii 39 E. (Euhyas) acmonis E. (Euhyas) schmidti 99 E. (Euhyas) iberia 70 E. (Euhyas) limbatus 39 E. (Euhyas) cubanus 74 E. (Euhyas) orientalis 20 E. (Euhyas) etheridgei E. (Euhyas) atkinsi 99 E. (Euhyas) casparii 97 E. (Euhyas) planirostris 38 E. (Euhyas) guanahacabibes 54 E. (Euhyas) tonyi 48 E. (Euhyas) rogersi 36 E. (Euhyas) goini E. (Euhyas) pezopetrus 1 99 E. (Euhyas) blairhedgesi 99 E. (Euhyas) thomasi E. (Euhyas) pinarensis 94 E. (Euhyas) varleyi 16 81 E. (Euhyas) intermedius E. (Euhyas) gundlachi E. (Euhyas) cf. varleyi
0.05 52
97 E. (Euhyas) dimidiatus 0 96 E. (Euhyas) emiliae E. (Euhyas) albipes 74 E. (Euhyas) maestrensis 36 E. (Euhyas) eunaster 12 4 E. (Euhyas) dolomedes 98 E. (Euhyas) bakeri 7 E. (Euhyas) amadeus 17 E. (Euhyas) heminota 21 16 E. (Euhyas) corona 26 E. (Euhyas) caribe E. (Euhyas) glaphycompus 46 E. (Euhyas) thorectes 27 E. (Euhyas) glanduliferoides 70 99 E. (Euhyas) oxyrhynchus E. (Euhyas) apostates E. (Euhyas) jugans 97 E. (Euhyas) paulsoni E. (Euhyas) rufifemoralis 99 E. (Euhyas) furcyensis E. (Euhyas) ventrilineatus 85 E. (Euhyas) brevirostris 70 E. (Euhyas) sciagraphus 45 98 E. (Euhyas) glandulifer 99 E. (Euhyas) zugi 69 E. (Euhyas) klinikowskii E. (Syrrhophus) marnockii 37 99 E. (Syrrhophus) zeus E. (Syrrhophus) symingtoni 64 Ischnocnema guentheri 0 59 Ischnocnema hoehnei 96 Ischnocnema parva 9 Ischnocnema juipoca "Eleutherodactylus" elassodiscus 99 "Phrynopus" brunneus 56 "Phrynopus" peraccai 96 Phyllonastes sp. 13 0 Barycholos ternetzi Brachycephalus ephippium 98 Limnophys anomalus 83 Limnophys bufoniformis 99 0 Limnophys necerus Limnophys sulcatus 27 Holoaden bradei 7 Phrynopus peruvianus 85 Phrynopus iatamasi 91 Phrynopus sp. 2 14 87 2 Phrynopus sp. 3 Phrynopus wettsteini 34 Phrynopus cophites 99 Craugastor rhodopis 98 Craugastor mexicanus Craugastor podiciferus 84 92 Craugastor bransfordii 99 Craugastor fitzingeri 99 Craugastor longirostris 39 99 Craugastor punctariolus Craugastor sandersoni 99 Craugastor augusti 90 66 Craugastor bocourti Craugastor alfredi Craugastor daryi 99 Craugastor pygmaeus Craugastor montanus Phrynopus parkeri 13 "Eleutherodactylus" binotatus 25 99 Oreobates quixensis Oreobates sp. 29 Phrynopus bracki 13 Phrynopus bufoides 10 Phrynopus tautzorum 12 Phrynopus pesantesi 28 Phrynopus horstpauli 75 Phrynopus barthlenae 81 Phrynopus kauneorum 68 Phrynopus juninensis Phrynopus sp. 1 18 Phrynopus heimorum
0.05 52 Pristimantis phoxocephalus 90 14 53 Pristimantis versicolor 71 Pristimantis riveti 34 Pristimantis spinosus Pristimantis cryophilius 18 Pristimantis rhodoplichus 99 Pristimantis orestes 8 Pristimantis simonbolivari 74 Pristimantis lirellus 74 84 Pristimantis croceoinguinis Pristimantis imitatrix 5 Pristimantis altamazonicus 99 Pristimantis luteolateralis 99 86 Pristimantis walkeri Pristimantis parvillus 28 Pristimantis chalceus 99 Pristimantis euphronides 1 Pristimantis shrevei 38 Pristimantis cajamarcensis 26 94 Pristimantis ceuthospilus Pristimantis ockendeni 47 Pristimantis unistrigatus 42 Pristimantis wiensi 42 Pristimantis melanogaster Pristimantis petrobardus Pristimantis simonsii 94 Pristimantis glandulosus 98 32 Pristimantis inusitatus 3 Pristimantis acerus 78 Pristimantis orcesi Pristimantis calcarulatus 54 Pristimantis pycnodermis 29 Pristimantis dissimulatus 53 Pristimantis appendiculatus 37 99 Pristimantis nyctophylax 9 Pristimantis subsigillatus Pristimantis mendax 86 Pristimantis schultei 67 Pristimantis ocreatus 60 Pristimantis pyrrhomerus 61 Pristimantis festae 5 97 Pristimantis leoni 20 Pristimantis celator 60 Pristimantis verecundus 24 99 Pristimantis truebae 78 93 Pristimantis gentryi 35 Pristimantis curtipes 88 Pristimantis surdus 44 Pristimantis devillei 33 Pristimantis vertebralis 97 54 Pristimantis buckleyi Pristimantis thymalopsoides Pristimantis quinquagesimus 22 41 Pristimantis duellmani 29 Pristimantis urichi Pristimantis rozei 40 Pristimantis sp. 1 8 55 Pristimantis thymelensis Pristimantis chloronotus 99 Pristimantis supernatis 30 Pristimantis pluvicanorus 30 Pristimantis rhabdolaemus 46 Pristimantis sagittulus 22 71 Pristimantis toftae 98 95 Pristimantis aniptopalmatus Pristimantis stictogaster Pristimantis peruvianus 55 Pristimantis citriogaster 97 Pristimantis condor 84 Pristimantis conspicillatus 99 Pristimantis sp. 2 38 Pristimantis achatinus 53 58 83 Pristimantis lymani Pristimantis fenestratus Pristimantis bipunctatus 51 Pristimantis skydmainos 99 Pristimantis w-nigrum 99 Pristimantis actites 65 Pristimantis lanthanites 99 Pristimantis labiosus Pristimantis crenunguis 23 Pristimantis caprifer 99 Pristimantis colomai 81 Pristimantis latidiscus 44 Pristimantis cruentus Pristimantis cremnobates 36 Pristimantis ridens "Eleutherodactylus" dolops 29 Agalychnis callidryas Litoria caerulea Rana catesbeiana
0.05 100 E. (Eleutherodactylus) portoricensis 98 E. (Eleutherodactylus) wightmanae 100 E. (Eleutherodactylus) coqui 100 E. (Eleutherodactylus) schwartzi E. (Eleutherodactylus) gryllus 95 100 E. (Eleutherodactylus) sp. 1 100 E. (Eleutherodactylus) cochranae 99 E. (Eleutherodactylus) hedricki 100 E. (Eleutherodactylus) brittoni 100 E. (Eleutherodactylus) antillensis 100 100 E. (Eleutherodactylus) eneidae 100 E. (Eleutherodactylus) locustus E. (Eleutherodactylus) cooki 98 E. (Eleutherodactylus) flavescens 100 E. (Eleutherodactylus) martinicensis 100 E. (Eleutherodactylus) amplinympha 100 E. (Eleutherodactylus) johnstonei E. (Eleutherodactylus) pinchoni 100 E. (Eleutherodactylus) barlagnei 87 E. (Eleutherodactylus) auriculatus 54 85 E. (Eleutherodactylus) bartonsmithi 100 E. (Eleutherodactylus) glamyrus 100 E. (Eleutherodactylus) mariposa E. (Eleutherodactylus) ronaldi 83 100 E. (Eleutherodactylus) eileenae E. (Eleutherodactylus) minutus 100 E. (Eleutherodactylus) poolei 100 97 E. (Eleutherodactylus) haitianus 99 E. (Eleutherodactylus) abbotti 70 E. (Eleutherodactylus) audanti 100 100 E. (Eleutherodactylus) sp. 2 97 E. (Eleutherodactylus) parabates E. (Eleutherodactylus) pituinus 100 E. (Eleutherodactylus) ionthus 100 E. (Eleutherodactylus) guantanamera 100 E. (Eleutherodactylus) varians 69 E. (Eleutherodactylus) leberi 84 100 E. (Eleutherodactylus) melacara 100 E. (Eleutherodactylus) lamprotes 100 E. (Eleutherodactylus) fowleri 100 E. (Eleutherodactylus) wetmorei E. (Eleutherodactylus) auriculatoides E. (Eleutherodactylus) patriciae 100 100 61 E. (Eleutherodactylus) montanus E. (Eleutherodactylus) richmondi 100 E. (Eleutherodactylus) unicolor 94 E. (Pelorius) hypostenor 100 100 E. (Pelorius) parapelates 100 E. (Pelorius) ruthae 100 E. (Pelorius) nortoni E. (Pelorius) chlorophenax 100 E. (Pelorius) inoptatus Eleutherodactylus counouspeus 60 E. (Euhyas) cundalli 63 E. (Euhyas) glaucoreius 27 E. (Euhyas) cavernicola E. (Euhyas) gossei 59 46 E. (Euhyas) junori E. (Euhyas) pantoni 62 100 E. (Euhyas) pentasyringos 52 E. (Euhyas) griphus 60 E. (Euhyas) fuscus 67 E. (Euhyas) orcutti 60 100 E. (Euhyas) alticola E. (Euhyas) jamaicensis 83 E. (Euhyas) nubicola 97 E. (Euhyas) andrewsi 100 E. (Euhyas) grabhami 62 64 E. (Euhyas) sisyphodemus E. (Euhyas) luteolus 90 100 E. (Euhyas) riparius 96 E. (Euhyas) rivularis E. (Euhyas) toa 100 E. (Euhyas) cuneatus 55 E. (Euhyas) turquinensis 94 E. (Euhyas) armstrongi E. (Euhyas) alcoae 100 E. (Euhyas) darlingtoni 100 E. (Euhyas) leoncei 100 E. (Euhyas) casparii 100 E. (Euhyas) planirostris 55 E. (Euhyas) guanahacabibes 99 E. (Euhyas) tonyi E. (Euhyas) rogersi 95 58 82 E. (Euhyas) goini 100 E. (Euhyas) blairhedgesi E. (Euhyas) thomasi 55 100 E. (Euhyas) pinarensis 100 E. (Euhyas) intermedius 40 E. (Euhyas) varleyi 96 E. (Euhyas) cf. varleyi 75 52 E. (Euhyas) gundlachi E. (Euhyas) atkinsi 84 E. (Euhyas) etheridgei 70 E. (Euhyas) orientalis E. (Euhyas) limbatus 96 100 100 E. (Euhyas) iberia E. (Euhyas) cubanus E. (Euhyas) pezopetrus
0.1 100
98 E. (Euhyas) weinlandi 47 E. (Euhyas) rhodesi 100 98 100 100 E. (Euhyas) grahami E. (Euhyas) pictissimus 100 E. (Euhyas) lentus E. (Euhyas) monensis 68 E. (Euhyas) probolaeus 100 100 E. (Euhyas) ricordii 100 E. (Euhyas) bresslerae 100 E. (Euhyas) acmonis E. (Euhyas) greyi 100 52 99 E. (Euhyas) emiliae 100 E. (Euhyas) dimidiatus E. (Euhyas) maestrensis E. (Euhyas) albipes 100 E. (Euhyas) schmidti 100 E. (Euhyas) klinikowskii 100 E. (Euhyas) zugi 100 E. (Euhyas) eunaster 45 E. (Euhyas) caribe 99 E. (Euhyas) corona 68 E. (Euhyas) amadeus 59 E. (Euhyas) heminota 78 E. (Euhyas) bakeri E. (Euhyas) glaphycompus 100 100 E. (Euhyas) dolomedes 79 E. (Euhyas) glanduliferoides 90 82 63 E. (Euhyas) thorectes E. (Euhyas) jugans 99 E. (Euhyas) apostates 100 E. (Euhyas) oxyrhynchus 79 E. (Euhyas) rufifemoralis 56 100 E. (Euhyas) furcyensis 100 E. (Euhyas) paulsoni 100 E. (Euhyas) glandulifer E. (Euhyas) sciagraphus 100 E. (Euhyas) ventrilineatus 61 59 E. (Euhyas) brevirostris E. (Syrrhophus) marnockii 100 E. (Syrrhophus) zeus 100 E. (Syrrhophus) symingtoni "Eleutherodactylus" binotatus 45 Barycholos ternetzi 100 Craugastor rhodopis 61 100 Craugastor mexicanus 100 Craugastor podiciferus 100 Craugastor bransfordii 100 Craugastor longirostris 100 Craugastor fitzingeri 100 100 Craugastor sandersoni Craugastor punctariolus 98 100 Craugastor pygmaeus Craugastor montanus 100 99 Craugastor augusti 100 Craugastor bocourti Craugastor alfredi Craugastor daryi Brachycephalus ephippium 100 "Phrynopus" peraccai 100 93 "Phrynopus" brunneus "Eleutherodactylus" elassodiscus "Eleutherodactylus" dolops 100 Pristimantis walkeri 100 Pristimantis luteolateralis 100 Pristimantis parvillus 100 Pristimantis chalceus 99 Pristimantis unistrigatus 99 Pristimantis ockendeni 100 Pristimantis ceuthospilus 92 Pristimantis cajamarcensis 100 Pristimantis lirellus 100 100 Pristimantis imitatrix Pristimantis croceoinguinis 100 Pristimantis altamazonicus 100 99 Pristimantis orestes Pristimantis simonbolivari 100 Pristimantis versicolor 100 Pristimantis riveti 90 100 Pristimantis phoxocephalus Pristimantis spinosus 82 85 Pristimantis cryophilius 85 Pristimantis rhodoplichus Pristimantis simonsii 95 Pristimantis wiensi Pristimantis petrobardus 100 Pristimantis melanogaster
0.1 100 Pristimantis bromeliaceus 100 Pristimantis schultei 84 Pristimantis nyctophylax 71 100 Pristimantis subsigillatus 40 Pristimantis appendiculatus 84 Pristimantis pycnodermis 100 100 97 Pristimantis dissimulatus Pristimantis calcarulatus Pristimantis orcesi 100 32 100 Pristimantis inusitatus Pristimantis glandulosus 100 Pristimantis acerus 100 Pristimantis sp. 2 80 100 Pristimantis conspicillatus Pristimantis condor 100 Pristimantis citriogaster 98 Pristimantis lymani 75 100 98 Pristimantis achatinus Pristimantis fenestratus 100 Pristimantis bipunctatus 99 Pristimantis skydmainos 20 100 Pristimantis euphronides Pristimantis shrevei 100 Pristimantis buckleyi 41 Pristimantis vertebralis 47 Pristimantis devillei 100 Pristimantis truebae 100 Pristimantis gentryi 100 Pristimantis curtipes 100 Pristimantis surdus 89 Pristimantis duellmani 24 Pristimantis quinquagesimus 98 Pristimantis thymalopsoides 98 Pristimantis ocreatus 100 99 100 Pristimantis pyrrhomerus Pristimantis festae Pristimantis leoni 100 Pristimantis verecundus 100 Pristimantis celator 49 Pristimantis chloronotus 65 96 100 Pristimantis thymelensis Pristimantis supernatis Pristimantis sp. 1 15 Pristimantis rozei 67 Pristimantis urichi 99 Pristimantis rhabdolaemus 57 98 53 Pristimantis toftae Pristimantis pluvicanorus 52 99 Pristimantis sagittulus 45 Pristimantis stictogaster 100 100 Pristimantis aniptopalmatus Pristimantis peruvianus 100 Pristimantis actites 100 Pristimantis w-nigrum 100 Pristimantis lanthanites 100 Pristimantis crenunguis 100 Pristimantis labiosus 100 Pristimantis colomai 100 100 Pristimantis latidiscus Pristimantis cruentus 100 Pristimantis cremnobates 99 Pristimantis ridens Pristimantis caprifer 97 100 Oreobates quixensis Oreobates sp. 100 Phrynopus juninensis 86 Phrynopus kauneorum 62 Phrynopus tautzorum 100 Phrynopus barthlenae 100 89 Phrynopus horstpauli 86 33 Phrynopus pesantesi 100 Phrynopus bufoides 100 Phrynopus heimorum Phrynopus bracki Phrynopus sp. 1 54 Phrynopus parkeri Phrynopus cophites 80 Phrynopus iatamasi 92 100 Phrynopus wettsteini 100 Phrynopus sp. 2 49 54 Phrynopus sp. 3 Phrynopus peruvianus Holoaden bradei 28 Phyllonastes sp. 100 Limnophys anomalus 100 50 100 Limnophys bufoniformis Limnophys necerus Limnophys sulcatus 93 Ischnocnema guentheri 100 Ischnocnema hoehnei 100 Ischnocnema parva Ischnocnema juipoca 81 Agalychnis callidryas Litoria caerulea Rana catesbeiana
0.1 63 E. (Eleutherodactylus) cooki 99 E. (Eleutherodactylus) martinicensis 100 E. (Eleutherodactylus) lamprotes 68 E. (Eleutherodactylus) leberi 73 99 E. (Eleutherodactylus) auriculatus E. (Eleutherodactylus) abbotti 98 E. (Eleutherodactylus) unicolor 100 E. (Eleutherodactylus) richmondi E. (Pelorius) inoptatus 53 Eleutherodactylus counouspeus 99 E. (Euhyas) griphus 98 E. (Euhyas) gossei 98 E. (Euhyas) luteolus 78 E. (Euhyas) riparius 100 47 E. (Euhyas) lentus 100 E. (Euhyas) leoncei 83 E. (Euhyas) alcoae 28 E. (Euhyas) cf. varleyi 85 E. (Euhyas) planirostris 77 E. (Euhyas) caribe 19 27 E. (Euhyas) glaphycompus 52 100 E. (Euhyas) thorectes E. (Euhyas) zugi E. (Euhyas) albipes 100 E. (Syrrhophus) marnockii 90 E. (Syrrhophus) zeus "Eleutherodactylus" binotatus 100 Craugastor rhodopis 100 13 Craugastor mexicanus 57 Craugastor podiciferus 100 Craugastor sandersoni 99 Craugastor punctariolus 99 Craugastor fitzingeri 100 Craugastor longirostris 92 100 Craugastor pygmaeus Craugastor montanus 98 99 Craugastor bocourti Craugastor alfredi 25 99 Craugastor augusti Craugastor daryi Brachycephalus ephippium 45 "Phrynopus" peraccai 99 “Phrynopus” brunneus 64 "Eleutherodactylus" elassodiscus "Eleutherodactylus" dolops 25 99 Limnophys anomalus 100 Limnophys bufoniformis Limnophys necerus 100 Limnophys sulcatus 100 Pristimantis walkeri 100 Pristimantis luteolateralis 96 Pristimantis parvillus 99 Pristimantis chalceus Pristimantis ockendeni 92 68 Pristimantis unistrigatus 36 Pristimantis ceuthospilus 94 Pristimantis altamazonicus 91 Pristimantis lirellus Pristimantis simonbolivari 70 100 Pristimantis orestes 96 Pristimantis versicolor 100 Pristimantis riveti 99 54 Pristimantis phoxocephalus Pristimantis spinosus 99 Pristimantis cryophilius Pristimantis rhodoplichus 40 Pristimantis calcarulatus 37 55 98 Pristimantis dissimulatus 96 Pristimantis appendiculatus 85 Pristimantis pycnodermis 97 Pristimantis orcesi 48 Pristimantis glandulosus Pristimantis inusitatus 100 Pristimantis acerus 98 100 Pristimantis nyctophylax Pristimantis subsigillatus 93 Pristimantis schultei 100 Pristimantis bromeliaceus 96 Pristimantis gentryi 61 100 Pristimantis truebae 81 Pristimantis curtipes Pristimantis vertebralis 97 93 26 Pristimantis buckleyi 100 Pristimantis devillei Pristimantis duellmani 70 Pristimantis quinquagesimus 100 69 Pristimantis thymalopsoides 77 Pristimantis pyrrhomerus 67 Pristimantis ocreatus 12 90 Pristimantis leoni Pristimantis festae 33 99 Pristimantis celator 98 Pristimantis verecundus 25 Pristimantis supernatis 44 Pristimantis thymelensis Pristimantis chloronotus 100 Pristimantis sp. 1 41 Pristimantis caprifer Pristimantis shrevei 27 11 100 Pristimantis euphronides 96 Pristimantis rozei 90 Pristimantis toftae 95 Pristimantis rhabdolaemus 95 Pristimantis pluvicanorus 91 Pristimantis sagittulus 100 Pristimantis aniptopalmatus 100 Pristimantis stictogaster 45 Pristimantis peruvianus 26 78 100 Pristimantis sp. 2 32 99 Pristimantis conspicillatus 99 Pristimantis citriogaster 58 Pristimantis condor Pristimantis lymani 100 Pristimantis fenestratus 100 Pristimantis skydmainos 99 Pristimantis bipunctatus Pristimantis urichi 100 Pristimantis latidiscus 99 Pristimantis colomai 99 Pristimantis cruentus 32 Pristimantis cremnobates 52 64 Pristimantis ridens 100 Pristimantis w-nigrum 97 100 Pristimantis actites Pristimantis lanthanites 98 Pristimantis labiosus Oreobates quixensis 100 Phrynopus bracki 50 Phrynopus sp. 1 43 Phrynopus peruvianus 27 Barycholos ternetzi Phrynopus cophites 33 Holoaden bradei 63 Ischnocnema parva 99 Ischnocnema guentheri Ischnocnema juipoca Ceratophrys cornuta 30 20 Leptodactylus pentadactylus Bufo melanostictus 25 Centrolene prosoblepon 41 Dendrobates sylvaticus 20 47 Litoria caerulea Agalychnis callidryas 26 Hyla chinensis 0.1 Cryptobatrachus sp. Rana catesbeiana 99 E. (Eleutherodactylus) lamprotes 30 E. (Eleutherodactylus) leberi E. (Eleutherodactylus) martinicensis 83 37 E. (Eleutherodactylus) cooki E. (Eleutherodactylus) auriculatus 32 96 E. (Eleutherodactylus) abbotti Eleutherodactylus counouspeus 93 E. (Eleutherodactylus) unicolor 99 E. (Eleutherodactylus) richmondi E. (Pelorius) inoptatus E. (Euhyas) albipes 91 99 E. (Euhyas) gossei 98 E. (Euhyas) griphus 83 E. (Euhyas) luteolus 39 E. (Euhyas) riparius 24 E. (Euhyas) lentus 95 99 E. (Euhyas) alcoae 82 E. (Euhyas) leoncei 10 E. (Euhyas) planirostris 44 E. (Euhyas) cf. varleyi 82 E. (Euhyas) thorectes 99 37 E. (Euhyas) glaphycompus E. (Euhyas) caribe 68 E. (Euhyas) zugi E. (Syrrhophus) marnocki 39 E. (Syrrhophus) zeus “Phrynopus” brunneus 9936 “Eleutherodactylus” elassodiscus “Phrynopus” perracai 99 Craugastor punctariolus 99 Craugastor sandersoni 66 Craugastor longirostris 99 Craugastor fitzingeri Craugastor podiciferus 86 99 Craugastor rhodopis 99 Craugastor mexicanus Craugastor montanus 82 99 Craugastor pygmaeus Craugastor daryi 40 87 Craugastor bocourti Craugastor alfredi 99 Craugastor augusti Brachycephalus ephippium 1 45 Ischnocnema guentheri Ischnocnema juipoca 98 Ischnocnema parva 73 Phrynopus peruvianus Barycholos ternetzi 13 “Eleutherodactylus” binotatus 21 “Eleutherodactylus” dolops 3 Phrynopus sp. 1 99 Phrynopus bracki 66 Pristimantis riveti 99 Pristimantis versicolor 67 Pristimantis phoxocephalus 93 Pristimantis spinosus 98 Pristimantis cryophilius 68 Pristimantis rhodoplichus 65 Pristimantis simonbolivari 99 Pristimantis orestes Pristimantis lirellus 95 Pristimantis altamazonicus 91 99 Pristimantis luteolateralis 99 Pristimantis w alkeri 97 Pristimantis parvillus Pristimantis chalceus 50 Pristimantis unistrigatus 86 Pristimantis ockendeni 99 Pristimantis ceuthospilus 42 52 Pristimantis calcarulatus 35 Pristimantis dissimulatus 71 Pristimantis appendiculatus Pristimantis pycnodermis 98 Pristimantis orcesi 59 Pristimantis glandulosus Pristimantis inusitatus 99 Pristimantis acerus 87 99 Pristimantis subsigillatus Pristimantis nyctophylax 91 Pristimantis bromeliaceus 99 Pristimantis schultei 71 99 Pristimantis truebae 99 Pristimantis gentryi 82 Pristimantis curtipes 94 Pristimantis vertebralis 56 Pristimantis buckleyi 67 Pristimantis devillei 99 Pristimantis thymalopsoides 3 Pristimantis duellmani 77 Pristimantis quinquagesimus 99 87 Pristimantis ocreatus 28 48 Pristimantis pyrrhomerus 49 99 Pristimantis festae Pristimantis leoni 99 Pristimantis verecundus 46 99 Pristimantis celator 45 Pristimantis sp. 1 21 86 Pristimantis supernatis Pristimantis thymelensis 99 Pristimantis chloronotus Pristimantis urichi 40 Pristimantis rozei 99 Pristimantis shrevei 23 Pristimantis euphronides 39 Pristimantis caprifer 43 Pristimantis rhabdolaemus 37 Pristimantis toftae 87 Pristimantis pluvicanorus 66 Pristimantis sagittulus Pristimantis stictogaster 46 99 Pristimantis aniptopalmatus 99 Pristimantis peruvianus 99 Pristimantis conspicillatus 72 Pristimantis sp. 2 98 Pristimantis citriogaster 95 Pristimantis condor 55 Pristimantis lymani 99 Pristimantis bipunctatus 98 Pristimantis skydmainos 97 Pristimantis fenestratus 99 Pristimantis colomai 93 Pristimantis latidiscus 64 Pristimantis cruentus 97 Pristimantis cremnobates Pristimantis ridens 17 99 Pristimantis actites 90 99 Pristimantis w -nigrum Pristimantis lanthanites 99 Pristimantis labiosus Oreobates quixensis 29 Holoaden bradei 99 Limnophys anomalus 99 Limnophys bufoniformis 99 Limnophys necerus 23 Limnophys sulcatus Phrynopus cophites 51 52 Agalychnis callidryas 23 Hyla chinensis Litoria caerulea 2754 Ceratophrys cornuta 33 Leptodactylus pentadactylus Centrolene prosoblepon 29 Bufo melanostictus 37 Dendrobates sylvaticus Cryptobatrachus sp. Rana catesbeiana 0.05 100 E. (Eleutherodactylus) lamprotes 99 E. (Eleutherodactylus) leberi E. (Eleutherodactylus) abbotti 100 100 E. (Eleutherodactylus) auriculatus 94 E. (Eleutherodactylus) cooki 100 E. (Eleutherodactylus) martinicensis 100 E. (Eleutherodactylus) richmondi 100 E. (Eleutherodactylus) unicolor Eleutherodactylus counouspeus 79 E. (Pelorius) inoptatus 100 100 E. (Euhyas) gossei 100 E. (Euhyas) griphus 100 E. (Euhyas) luteolus E. (Euhyas) riparius 100 72 E. (Euhyas) lentus 100 E. (Euhyas) alcoae 100 E. (Euhyas) leoncei 58 E. (Euhyas) planirostris 100 E. (Euhyas) cf. varleyi 59 99 E. (Euhyas) caribe 77 E. (Euhyas) glaphycompus 99 100 E. (Euhyas) thorectes 100 E. (Euhyas) zugi E. (Euhyas) albipes E. (Syrrhophus) marnockii 100 E. (Syrrhophus) zeus 76 “Eleutherodactylus” binotatus Brachycephalus ephippium 100 Craugastor sandersoni 100 Craugastor punctariolus 76 Craugastor longirostris 100 Craugastor fitzingeri 83 100 Craugastor podiciferus 100 100 Craugastor mexicanus Craugastor rhodopis 100 100 Craugastor montanus Craugastor pygmaeus 100 100 Craugastor bocourti 100 Craugastor alfredi Craugastor augusti Craugastor daryi 76 Phrynopus peruvianus 38 Barycholos ternetzi 81 Phrynopus cophites Holoaden bradei 99 65 100 “Phrynopus” brunneus 99 “Phrynopus” peraccai “Eleutherodactylus” elassodiscus “Eleutherodactylus” dolops 59 100 100 Limnophys bufoniformis 100 Limnophys anomalus Limnophys necerus Limnophys sulcatus 100 100 Pristimantis luteolateralis 100 Pristimantis w alkeri Pristimantis parvillus 100 Pristimantis chalceus 99 Pristimantis ockendeni 100 Pristimantis unistrigatus 73 Pristimantis ceuthospilus 100 Pristimantis lirellus 100 Pristimantis altamazonicus Pristimantis simonbolivari 93 100 Pristimantis orestes 100 Pristimantis phoxocephalus 81 100 57 Pristimantis riveti 100 Pristimantis versicolor 100 Pristimantis spinosus Pristimantis cryophilius Pristimantis rhodoplichus 58 Pristimantis appendiculatus 100 100 Pristimantis calcarulatus 100 Pristimantis dissimulatus 63 Pristimantis pycnodermis 100 Pristimantis orcesi 71 Pristimantis inusitatus Pristimantis glandulosus 100 Pristimantis acerus 100 100 Pristimantis schultei Pristimantis bromeliaceus 100 100 Pristimantis nyctophylax Pristimantis subsigillatus 99 100 Pristimantis gentryi 100 Pristimantis truebae 99 Pristimantis curtipes 100 Pristimantis buckleyi 100 Pristimantis vertebralis 88 100 Pristimantis devillei 97 Pristimantis duellmani 100 Pristimantis quinquagesimus 100 99 Pristimantis thymalopsoides 100 Pristimantis ocreatus 53 82 Pristimantis pyrrhomerus 100 Pristimantis leoni Pristimantis festae 56 100 Pristimantis verecundus 100 Pristimantis celator 100 Pristimantis thymelensis Pristimantis supernatis 48 Pristimantis chloronotus 62 Pristimantis sp. 1 89 Pristimantis urichi Pristimantis rozei 97 100 100 Pristimantis toftae 100 Pristimantis rhabdolaemus Pristimantis pluvicanorus 98 Pristimantis sagittulus 100 Pristimantis stictogaster 100 Pristimantis aniptopalmatus Pristimantis peruvianus 100 60 99 Pristimantis conspicillatus 100 Pristimantis sp. 2 100 Pristimantis citriogaster 50 Pristimantis condor 98 100 Pristimantis lymani Pristimantis fenestratus 74 100 Pristimantis skydmainos 100 Pristimantis bipunctatus 100 Pristimantis euphronides Pristimantis shrevei 97 Pristimantis caprifer 100 100 Pristimantis actites 100 Pristimantis w -nigrum 100 Pristimantis lanthanites Pristimantis labiosus 100 Pristimantis latidiscus 100 Pristimantis colomai 100 Pristimantis cruentus 100 Pristimantis ridens 87 Pristimantis cremnobates 100 Phrynopus bracki Phrynopus sp. 1 81 Oreobates quixensis 100100 Ischnocnema parva Ischnocnema guentheri Ischnocnema juipoca 100 Ceratophrys cornuta 80 Dendrobates sylvaticus Centrolene prosoblepon 99 Bufo melanostictus 67 Leptodactylus pentadactylus 98 99 Agalychnis callidryas Litoria caerulea 76 Hyla chinensis Cryptobatrachus sp. Rana catesbeiana
0.1 100 E. (Eleutherodactylus) auriculatus 49 E. (Eleutherodactylus) abbotti E. (Eleutherodactylus) lamprotes 99 100 E. (Eleutherodactylus) leberi 71 E. (Eleutherodactylus) martinicensis 64 E. (Eleutherodactylus) cooki 100 E. (Eleutherodactylus) richmondi 100 E. (Eleutherodactylus) unicolor E. (Pelorius) inoptatus 90 E. (Euhyas) gossei 100 E. (Euhyas) griphus 40 E. (Euhyas) luteolus 100 63 E. (Euhyas) leoncei 99 E. (Euhyas) alcoae 99 E. (Euhyas) planirostris 66 77 E. (Euhyas) cf. varleyi E. (Euhyas) lentus 93 E. (Euhyas) albipes 100 E. (Euhyas) caribe E. (Euhyas) thorectes 100 62 E. (Euhyas) zugi E. (Syrrhophus) zeus 99 E. (Syrrhophus) marnockii 65 Craugastor podiciferus 100 Craugastor longirostris 100 Craugastor pygmaeus 49 100 Craugastor montanus Craugastor daryi "Eleutherodactylus" binotatus 96 Pristimantis unistrigatus 97 Pristimantis ockendeni 41 97 Pristimantis walkeri 87 Pristimantis altamazonicus 96 Pristimantis versicolor Pristimantis nyctophylax 22 90 Pristimantis curtipes 100 Pristimantis duellmani 8 26 Pristimantis leoni Pristimantis thymelensis Pristimantis urichi Pristimantis rozei 64 60 28 100 Pristimantis condor 100 Pristimantis conspicillatus 44 Pristimantis bipunctatus Pristimantis euphronides 100 95 Pristimantis stictogaster 99 24 Pristimantis sagittulus 100 Pristimantis peruvianus 71 100 Pristimantis colomai Pristimantis cremnobates 33 96 Pristimantis actites 34 Phrynopus bracki 100 "Phrynopus" peraccai 27 "Phrynopus" brunneus 81 "Eleutherodactylus" dolops 36 Phrynopus cophites 39 Barycholos ternetzi 46 Holoaden bradei Limnophys Brachycephalus ephippium Ischnocnema guentheri 100 Ischnocnema parva Litoria caerulea 99 Agalychnis callidryas Rana catesbeiana
0.1 99 E. (Eleutherodactylus) abbotti 54 E. (Eleutherodactylus) auriculatus E. (Eleutherodactylus) martinicensis 98 43 E. (Eleutherodactylus) lamprotes 55 100 E. (Eleutherodactylus) leberi E. (Eleutherodactylus) cooki 99 E. (Eleutherodactylus) unicolor 100 E. (Eleutherodactylus) richmondi E. (Pelorius) inoptatus 97 E. (Euhyas) luteolus 100 E. (Euhyas) gossei 39 E. (Euhyas) griphus 38 E. (Euhyas) cf. varleyi 99 46 E. (Euhyas) leoncei 100 77 E. (Euhyas) alcoae E. (Euhyas) planirostris 51 E. (Euhyas) lentus 100 E. (Euhyas) caribe 65 E. (Euhyas) thorectes 39 E. (Euhyas) zugi E. (Euhyas) albipes 100 E. (Syrrhophus) zeus 78 E. (Syrrhophus) marnockii 100 Craugastor montanus 99 Craugastor pygmaeus 100 Craugastor longirostris 17 98 Craugastor podiciferus Craugastor daryi 91 “Eleutherodactylus” binotatus 13 96 Barycholos ternetzi Brachycephalus ephippium 37 Ischnocnema guentheri 100 Ischnocnema parva 58 Pristimantis unistrigatus 69 Pristimantis ockendeni 55 Pristimantis altamazonicus 50 Pristimantis versicolor 56 Pristimantis w alkeri Pristimantis thymelensis 33 Pristimantis nyctophylax 37 76 Pristimantis curtipes 22 Pristimantis duellmani 99 Pristimantis leoni 23 Pristimantis urichi 34 55 Pristimantis rozei 100 Pristimantis condor 100 Pristimantis conspicillatus 44 56 Pristimantis bipunctatus Pristimantis euphronides 98 Pristimantis stictogaster 100 Pristimantis sagittulus 100 Pristimantis peruvianus 46 100 Pristimantis colomai Pristimantis cremnobates 5 60 Pristimantis actites Phrynopus bracki 53 Phrynopus cophites Holoaden bradei 15 9 Limnophys 100 “Phrynopus” brunneus “Phrynopus” peraccai 42 “Eleutherodactylus” dolops Litoria caerulea 80 Agalychnis callidryas Rana catesbeiana
0.05 100 E. (Eleutherodactylus) auriculatus 53 E. (Eleutherodactylus) abbotti 100 E. (Eleutherodactylus) martinicensis 100 E. (Eleutherodactylus) cooki 98 E. (Eleutherodactylus) leberi 100 E. (Eleutherodactylus) lamprotes 100 E. (Eleutherodactylus) richmondi 100 E. (Eleutherodactylus) unicolor E. (Pelorius) inoptatus 100 E. (Euhyas) gossei 100 E. (Euhyas) griphus 50 E. (Euhyas) luteolus 100 100 E. (Euhyas) cf. varleyi E. (Euhyas) planirostris 100 E. (Euhyas) alcoae 100 100 E. (Euhyas) leoncei E. (Euhyas) lentus 100 E. (Euhyas) albipes 100 E. (Euhyas) thorectes E. (Euhyas) caribe 100 91 E. (Euhyas) zugi E. (Syrrhophus) marnockii 100 E. (Syrrhophus) zeus 93 Craugastor podiciferus 100 Craugastor longirostris 100 Craugastor pygmaeus 94 100 Craugastor montanus Craugastor daryi “Eleutherodactylus” binotatus 98 “Eleutherodactylus” dolops “Phrynopus” brunneus 68 100 “Phrynopus” peraccai 100 Pristimantis unistrigatus 100 Pristimantis ockendeni 100 Pristimantis w alkeri 100 100 Pristimantis altamazonicus Pristimantis versicolor Pristimantis nyctophylax 27 100 Pristimantis duellmani 100 Pristimantis curtipes 76 75 40 Pristimantis leoni 48 Pristimantis thymelensis 100 Pristimantis condor 100 Pristimantis conspicillatus 99 Pristimantis bipunctatus 100 99 Pristimantis euphronides 54 100 Pristimantis stictogaster Pristimantis sagittulus 93 100 100 Pristimantis peruvianus Pristimantis urichi 67 98 Pristimantis rozei 100 Pristimantis cremnobates 100 Pristimantis colomai 100 Pristimantis actites 90 Phrynopus bracki 76 Phrynopus cophites Barycholos ternetzi 97 Holoaden bradei Limnophys Brachycephalus ephippium Ischnocnema guentheri 100 Ischnocnema parva Agalychnis callidryas 100 Litoria caerulea Rana catesbeiana
0.1 16 E. (Eleuth.) auriculatus 18 E. (Eleuth.) abbotti 20 E. (Eleuth.) lamprotes 17 E. (Eleuth.) leberi 21 E. (Eleuth.) martinicensis 19 E. (Eleuth.) cooki 22 E. (Eleuth.) richmondi 15 E. (Eleuth.) unicolor E. (Pelorius) inoptatus 3 E. (Euhyas) gossei 4 E. (Euhyas) griphus 6 E. (Euhyas) luteolus 23 7 E. (Euhyas) leoncei 5 E. (Euhyas) alcoae 8 E. (Euhyas) planirostris 9 2 E. (Euhyas) cf. varleyi E. (Euhyas) lentus 12 E. (Euhyas) albipes 10 E. (Euhyas) caribe E. (Euhyas) thorectes 14 11 E. (Euhyas) zugi E. (Syrrhophus) zeus 13 E. (Syrrhophus) marnockii 53 Craugastor podiciferus 55 Craugastor longirostris 56 Craugastor pygmaeus 57 54 Craugastor montanus Craugastor daryi "Eleutherodactylus" binotatus 27 Pristimantis unistrigatus 28 Pristimantis ockendeni 29 60 30 Pristimantis walkeri 31 Pristimantis altamazonicus Pristimantis versicolor 35 Pristimantis nyctophylax 32 Pristimantis curtipes 33 Pristimantis duellmani 36 Pristimantis leoni 34 Pristimantis thymelensis Pristimantis urichi 26 Pristimantis rozei 58 43 39 Pristimantis condor 40 Pristimantis conspicillatus 41 Pristimantis bipunctatus 44 Pristimantis euphronides 37 62 42 Pristimantis stictogaster Pristimantis sagittulus 38 45 Pristimantis peruvianus 24 Pristimantis colomai Pristimantis cremnobates 48 25 Pristimantis actites 59 Phrynopus bracki 46 "Phrynopus" brunneus 51 63 "Phrynopus" peraccai 47 "Eleutherodactylus" dolops 49 Phrynopus cophites 52 Barycholos ternetzi 50 Holoaden bradei Limnophys Brachycephalus ephippium Ischnocnema guentheri 61 Ischnocnema parva Litoria caerulea 1 Agalychnis callidryas