University of South Florida Scholar Commons

Graduate Theses and Dissertations Graduate School

5-2001

Regulation of YY1, a Multifunctional Transcription Factor

Ya-Li Yao University of South Florida

Follow this and additional works at: https://scholarcommons.usf.edu/etd

Part of the American Studies Commons

Scholar Commons Citation Yao, Ya-Li, "Regulation of YY1, a Multifunctional Transcription Factor" (2001). Graduate Theses and Dissertations. https://scholarcommons.usf.edu/etd/1544

This Dissertation is brought to you for free and open access by the Graduate School at Scholar Commons. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Scholar Commons. For more information, please contact [email protected]. Office of Graduate Studies University of South Florida Tampa, Florida

CERTIFICATE OF APPROVAL ______

Ph.D. Dissertation ______

This is to certify that the Ph.D. Dissertation of

YA-LI YAO

with a major in Medical Sciences has been approved for the dissertation requirement on April 9, 2001 for the Doctor of Philosophy degree.

Examining Committee:

______Major Professor : Edward Seto, Ph.D.

______Member : Burt Anderson, Ph.D.

______Member: Peter Medveczky, M.D.

______Member: Richard Jove, Ph.D. REGULATION OF YY1, A MULTIFUNCTIONAL TRANSCIPTION FACTOR

by

YA-LI YAO

A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Medical Microbiology and Immunology College of Medicine University of South Florida

May 2001

Major Professor: Edward Seto, Ph.D. DEDICATION

To my parents, Ta-Chung (Righteous and Magnanimous) and Shiao-Hung (Little

Rainbow). ACKNOWLEDGEMENTS

I am eternally grateful to my Lord, Who gave me the chance to fulfill my dream of earning a Ph.D. degree. I would like to thank my mentor, Dr. Edward Seto, for his endless support and guidance. Without him I would never have accomplished my goal. My gratitude also extends to my committee members, who gave me invaluable advice and helped me meet the requirements of the department. My special acknowledgement goes to my husband, Dr. Wen-Ming Yang, whose help and encouragement accompanied me when I needed them the most.

I thank Dr. Nancy Olashaw for critical reading and the core facilities at the

Moffitt Cancer Center as well as the Protein Chemistry Core at the University of

Florida for technical support. I would also like to express my gratitude to Kathy

(Mom), Linda, Susan, Cheryl, Sally, and B.J. They made my life as a graduate student much easier and happier. TABLE OF CONTENTS

LIST OF FIGURES iv

ABSTRACT viii

INTRODUCTION 1

Transcription is an important step in gene regulation. 1

Transcription in prokaryotes. 2

Transcription in eukaryotes. 3

RNA polymerase II and the eukaryotic promoter. 4

Activators and transcriptional activation. 6

Repressors and transcriptional repression. 8

Chromatin and transcription. 9

Chromatin remodeling. 10

Histone acetyltransferases as co-activators. 11

Histone deacetylases as co-repressors. 13

YY1 is a transcriptional regulator. 13

General characteristics of YY1. 14

YY1 and transcriptional initiation. 15

OBJECTIVES 17

MATERIALS AND METHODS 20

Isolation of YY1 genomic clones. 20

i Plasmids. 20

Sequencing of the human YY1 promoter. 22

Primer extension. 22

Cell line, transfection, luciferase assays, and CAT assays. 23

Recombinant proteins. 23

In vitro acetylation reactions. 24

Immunoprecipitation and western blot analysis. 24

In vitro protein-protein interaction assays. 25

Histone deacetylation assays. 25

Immunofluorescence analysis. 26

Electrophoretic mobility shift assays. 26

Gel filtration analysis of YY1. 27

Purification of a YY1 complex by anion exchange and immobilized-

metal affinity chromatography. 27

Coomassie staining and silver staining. 27

Purification of a YY1 complex by anion exchange and antibody-

affinity chromatography. 28

Purification of the F-YY1 complex. 28

Radioimmunoprecipitation analysis (RIPA) of F-YY1. 28

Accession number. 29

RESULTS 30

Determination of the transcriptional start site of the human YY1

gene. 30

ii Transcriptional analysis of the human YY1 promoter. 31

Sequence analysis of the human YY1 promoter. 33

E1A-mediated repression of the human YY1 promoter. 35

YY1 does not autoregulate its own promoter. 37

YY1 is acetylated by p300 and PCAF. 38

Lysine-to-arginine mutations within YY1 residues 170-200

significantly reduce the transcriptional repression activity of YY1. 45

Acetylation of YY1 residues 170-200 increases YY1 binding to

HDACs. 46

HDAC1 and HDAC2 deacetylate YY1 170-200 but not the C-

terminal region of YY1. 46

HDACs bind YY1 at multiple regions. 52

YY1 contains associated histone deacetylase activity, which localizes 52

to C-terminal residues 261-333 of YY1.

Acetylation of YY1 at the C-terminal zinc finger domain decreases 54

the DNA-binding activity of YY1.

YY1 exists in a high molecular weight protein complex. 57

Purification of native YY1 complexes. 57

Purification of a Flag-tagged YY1 complex. 65

DISCUSSION 70

REFERENCES 80

ABOUT THE AUTHOR End Page

iii LIST OF FIGURES

FIG. 1. Step-wise assembly of the transcriptional initiation complex. 5

FIG. 2. Regulation of transcription: a model. 7

FIG. 3. Determination of the 5’ end of the human YY1 transcript. 30

FIG. 4. Expression of luciferase enzymatic activity driven by the

human YY1 promoter in transiently transfected cells. 32

FIG. 5A. DNA sequences upstream of the translational start codon of

the human YY1 gene. 33

FIG. 5B. Comparison of the YY1 promoter DNA sequences between

mouse and human. 34

FIG. 6. Adenovirus E1A proteins repress the YY1 promoter. 36

FIG. 7. The YY1 protein does not autoregulate the YY1 promoter. 37

FIG. 8. Multiple functional domains of transcription factor YY1. 38

FIG. 9A. Acetylation of YY1 by PCAF. 39

FIG. 9B. Acetylation of YY1 by p300. 40

FIG. 9C. Acetylation of YY1 is dependent on p300 or PCAF. 41

FIG. 9D. YY1 is acetylated in vivo. 42

FIG. 9E. Identification of regions of YY1 acetylated in vivo. 43

FIG. 9F, G. Determination of the number of acetylated lysines by mass

spectrometry. 44

iv FIG. 10. The effect of acetylation of YY1 residues 170-200 on the

transcriptional repressor activity of YY1. 45

FIG. 11. Increased HDAC-binding to YY1 residues 170-200 by

acetylation. 47

FIG. 12A. YY1 peptide deacetylation by HDACs. 48

FIG. 12B. YY1 protein deacetylation by HDACs. 49

FIG. 12C. Deacetylation of YY1 serial deletion proteins by HDAC1. 50

FIG. 13. Mapping of the HDAC-interaction domains of YY1. 51

FIG. 14A. Histone deacetylase activity of endogenous YY1 in HeLa

cells. 52

FIG. 14B, C. Identification of amino acid 261-333 as the histone

deacetylase activity domain of YY1. 53

FIG. 14D. Expression of F-YY1 deletion mutants. 54

FIG. 14E. Sub-cellular localization of F-YY1 deletion constructs. 55

FIG. 15A, B. The effect of acetylation on YY1’s sequence-specific DNA-

binding activity. 56

FIG. 16. Gel filtration analysis of YY1 in HeLa cells. 57

FIG. 17A, B. Purification of a native YY1 complex from HeLa cells using

anion exchange chromatography and IMAC. (A) A

Coomassie-stained SDS-polyacrylamide gel of the Q

Sepharose fractions. (B) Western blot analysis of the Q

Sepharose fractions. 58

FIG. 17C, D. Purification of a native YY1 complex from HeLa cells using

v anion exchange chromatography and IMAC. (C). EMSA of

the Q Sepharose fractions using the AAV P5+1 YY1 binding

sequence as a probe. (D). Histone deacetylation assay of the

Q Sepharose fractions. 59

FIG. 17E, F. Purification of a native YY1 complex from HeLa cells using

anion exchange chromatography and IMAC. (E) Western

blot analysis of the Ni2+ column fractions. (F) EMSA of the

300 mM imidazole-eluted fractions using the AAV P5+1

YY1 binding sequence as a probe. 60

FIG. 17G. Purification of a native YY1 complex from HeLa cells using

anion exchange chromatography and IMAC. (G) Silver-

staining analysis of the second fraction from the 300 mM

imidazole-eluted fractions. 61

FIG. 18A, B. Purification of a native YY1 complex from HeLa cells using

anion exchange chromatography and antibody-affinity

chromatography. (A) A Coomassie-stained SDS-

polyacrylamide gel of the Q Sepharose fractions. (B)

Western blot analysis of the Q Sepharose fractions. 62

FIG. 18C, D. Purification of a native YY1 complex from HeLa cells using

anion exchange chromatography and antibody-affinity

chromatography. (C) EMSA of the Q Sepharose fractions

using the AAV P5+1 YY1 binding sequence as a probe. (D)

Histone deacetylation assay of the Q Sepharose fractions. 63

vi FIG. 18E. Purification of a native YY1 complex from HeLa cells using

anion exchange chromatography and antibody-affinity

chromatography: (E) Silver-staining analysis of fractions

from the anti-YY1 H-10 column (lane 2) and the protein G

control column (lane 1). 64

FIG. 18F. Purification of a native YY1 complex from HeLa cells using

anion exchange chromatography and antibody-affinity

chromatography. (F) Histone deacetylation assay from the

protein G control column (protein G) and the anti-YY1 H-10

column (H-10) against the H4 peptide. 65

FIG. 19A. Silver-staining analysis of the second fractions from the

Flag-alone (lane 1) column and the F-YY1 column (lane 2). 66

FIG. 19B. Histone deacetylation analysis of the second fractions from

the Flag alone column and the F-YY1 column against the H4

peptide. 67

FIG. 20A. A representative autoradiograph showing proteins bound to

Flag alone or F-YY1. 68

FIG. 20B. A representative autoradiograph showing proteins bound to

different F-YY1. 69

FIG. 21 Summary of regulation of YY1 by acetylation and

deacetylation. 72

vii REGULATION OF YY1, A MULTIFUNCTIONAL TRANSCRIPTIONAL

FACTOR

by

YA-LI YAO

An Abstract

of a dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Medical Microbiology and Immunology College of Medicine University of South Florida

May 2001

Major Professor: Edward Seto, Ph.D.

viii Yin Yang 1 (YY1) is a sequence-specific DNA binding transcription factor that plays an important role in development and differentiation. It activates or represses many genes during cell growth and differentiation and is also required for the normal development of the mammalian embryo. Moreover, it has been shown that YY1 may function as a transcriptional initiator. In this dissertation, regulation of human YY1 is analyzed systematically at three levels: At the genomic level, one major transcriptional initiation site of the YY1 gene was mapped to 478 bp upstream of the

ATG translational start site. The YY1 promoter was localized to within 277 bp upstream of the major transcriptional initiation site and was shown to contain multiple binding sites for transcriptional factor Sp1 but lack a consensus TATA box. Over- expression of the adenovirus E1A protein represses expression of the YY1 promoter.

At the polypeptide level, the activity of YY1 is regulated through acetylation by p300 and PCAF and deacetylation by HDACs. YY1 was acetylated in two regions: both p300 and PCAF acetylated the central glycine/lysine-rich domain of residues 170-

200, and PCAF also acetylated YY1 at the C-terminal DNA-binding domain.

Acetylation of the central region was required for the full transcriptional repression activity of YY1 and targeted YY1 for active deacetylation by HDACs. However, the

C-terminal region of YY1 could not be deacetylated. Rather, the acetylated C- terminal region interacted with HDACs, which resulted in stable histone deacetylase activity associated with the YY1 protein. Furthermore, acetylation of the C-terminal domain decreased the DNA binding activity of YY1. At the protein complex level,

YY1 was shown to form a complex with up to four different proteins consistently throughout different purification methods. These proteins are likely to have important

ix regulatory roles in the transcriptional activity of YY1. Taken together, these findings will provide valuable information to our understanding of the regulatory mechanisms of transcription in general.

Abstract Approved: ______Major Professor: Edward Seto, Ph.D. Associate Professor, Interdisciplinary Oncology Program

Date Approved: ______

x INTRODUCTION

Transcription is an important step in gene regulation. The Big Bang of our knowledge on gene regulation happened in 1961, with the debut of the concept of the prokaryotic operon (77, 78). Monod and Jacob pictured the perfect regulatory circuitry of making proteins out of genes using an amplifiable intermediate, which they called the messenger RNA (mRNA). In this model, genes of the same biochemical pathway are grouped into an operon, which is immediately preceded by a regulatory DNA element called the operator. A repressor protein binds the operator and keeps the operon in the “off” position. Upon proper environmental cues, an inducer molecule binds the repressor protein, inducing an allosteric modification. In this configuration, the repressor no longer binds the operator, thus causing the operon to switch to the “on” position. When the operon is “on,” mRNA is being made. This process is referred called transcription. mRNA, the product of transcription, is the template recognized by the ribosomes for making proteins (17, 50). This linear relationship among DNA, mRNA, and proteins is so important that it is called the

Central Dogma of Biology, and transcription has been recognized as an important step in gene regulation.

Much of the original operon model proposed by Monod and Jacob still holds true today. However, some modifications are needed. For example, we now know that all operons are not regulated by repression/de-repression. Some operons are regulated by activation, and some operons are under control of multiple regulatory 1 mechanisms. Moreover, transcription regulation can occur at multiple stages, including initiation, which was essentially what Monod and Jacob initially described, as well as elongation and termination, two steps subsequent to the initiation stage.

Nevertheless, the concept that mRNA is made according to precisely regulated interplay among DNA regulatory elements, repressors and activators remains as the true essence of transcriptional regulation, and the importance of understanding how genes are regulated will likely to continue rising with the complete sequencing of the human genome.

Transcription in prokaryotes. The initial operon model soon expanded to full understanding of transcriptional control in prokaryotes (for a historical review, see reference 107). In prokaryotes, such as bacteria, transcription is catalyzed by an enzyme called RNA polymerase. The RNA polymerase is a four-unit protein consisted of two α subunits and two β subunits. During transcriptional initiation,

RNA polymerase scans the length of the bacterial DNA. When it encounters a specific sequence about 35 bp upstream from the transcriptional initiation site, it becomes associated with a specific protein called σ factor and anchors on the DNA.

Then it spreads along the DNA until it finds another sequence, which usually lies about 10 bp upstream from the initiation site. This -10 sequence tells the polymerase where to lay down the first nucleotide, and the polymerase faithfully unwinds the

DNA and starts incorporating nucleotides to make RNA. The σ factor then falls off, and the polymerase becomes dedicated to the next phase of transcription, elongation.

Both the protein players, including the polymerase and the σ factor, and the DNA sequences, including the -35 and -10 sequences, have tremendous influence on where,

2 when, and how often transcription starts. Regulation of transcriptional initiation largely relies on manipulation of this system. For example, a repressor usually blocks the binding of the RNA polymerase to either the -35 or the -10 sequence, and no transcription can occur in this configuration. An activator may augment the association between DNA and the RNA polymerase, causing more frequent firing of the polymerase and higher levels of transcription. These findings significantly enriched our understanding of transcriptional control. In the mean time, with the continuous efforts from numerous researchers, it became apparent that transcription in eukaryotes is regulated in very similar fashions. The differences between prokaryotic transcription and eukaryotic transcription, in fact, are the complex layers and flavors in regulations that are unique to eukaryotes.

Transcription in eukaryotes. The most significant difference between prokaryotes and eukaryotes is the nucleus. The nucleus by itself provides excellent regulation because mRNA export in eukaryotes is a highly regulated process (49, 79).

However, the consequences of having a nucleus are far beyond mere physical barriers: In eukaryotic nuclei, DNA is packaged into chromatin (151). Even though the basic layouts of transcription in eukaryotes are the same as those in prokaryotes, chromatin inevitably inhibits access of the RNA polymerase to the DNA. Therefore, as opposed to gene-specific activators/repressors observed in prokaryotes, genes in eukaryotes are repressed in general due to the way DNA is organized. Furthermore, prokaryotes are unicellular organisms, but many eukaryotes are multi-cellular organisms with complex body plans. Prokaryotic gene regulators activate or repress transcription in a swift fashion because prokaryotes need to respond to the

3 environmental changes quickly. Cells in complex eukaryotes, however, are committed to specific functions after differentiation, and only a certain fraction of the genome is active in a certain place at a certain time. As a result, transcriptional control in eukaryotes is characterized by developmentally timed up- and down- regulations of specific subsets of genes whose accessibility is determined by the chromatin structure. The beauty of eukaryotic transcriptional control, therefore, lies in the intricate connections among the RNA polymerase, activators, repressors, and the DNA promoter elements organized within the chromatin along the temporal and spatial axes.

RNA polymerase II and the eukaryotic promoter. The RNA polymerase responsible for making mRNA in eukaryotes is the RNA polymerase (Pol) II. Pol II enzyme in yeast is a multi-subunit protein complex comprising 12 polypeptides (174).

Pol II needs additional protein factors to recognize promoters and initiate transcription; these protein factors are termed general transcription factors (reviewed in references 32, 175). It has been suggested that the general transcription factors for

Pol II, designated TFIID, -B, -F, -E, and -H, cooperate with Pol II in a highly coordinated fashion to form the transcriptional initiation complex (20, 175) (Figure

1): First, TFIID recognizes the promoter by virtue of its TBP subunit binding to the

TATA box in the promoter. The TATA box is analogous to the -10 sequence in prokaryotes, and TBP is analogous to the σ factor. Upon recognizing the TATA box,

TBP bends DNA and creates a binding surface for TFIIB, which associates with Pol II and recruits Pol II to the promoter. TFIIF associates with both Pol II and TFIIB.

Through multiple interactions with TFIID, TFIIB, and TFIIF, Pol II is accurately

4 positioned on the promoter. Under some circumstances, this minimal complex can initiate transcription without TFIIE and TFIIH.

TFIIB

TFIIF Pol II

TFIID TFIIA TBP TATA +1 FIG. 1. Step-wise assembly of the

transcriptional initiation complex. A

thick line represents DNA. A bent TFIIF TFIIB TFIID arrow depicts the direction of Pol II TFIIA TBP TATA +1 transcription. The transcriptional

TFIIE initiation site is indicated by “+1.”

TFIH TATA represents the TATA box

(adapted from reference 20). TFIIE TFIIF TFIIB TFIH TFIID Pol II TFIIA TBP TATA +1

The association of TFIIE with the polymerase is required for the subsequent recruitment of TFIIH. TFIIH possesses an ATP-dependent helicase activity, which unwinds DNA around the transcriptional initiation site and triggers transcriptional initiation. It is thought that TFIIE and TFIIH are key players in converting the process of transcription from the initiation phase to the elongation phase, an event sometimes called promoter clearance.

5 Activators and transcriptional activation. Activators are usually DNA- binding proteins with modular structures of activation domains that can be defined by fusing to a heterologous DNA-binding motif. Typical activation domains have been characterized as acidic (reviewed in reference 56), glutamine rich, or proline rich

(reviewed in reference 113). Detailed structural and mutagenesis studies suggest that the mechanisms of activation domains might involve ionic and hydrophobic interactions between the repeated amino acids within the activation domains and their target general transcription factors (37, 44, 157). However, in vitro, transcriptional activation cannot occur without participation of another protein complex called the

Mediator (reviewed in reference 14). In yeast, the Mediator complex contains 20 subunits, many of which have been shown to be important in transcriptional control in vivo (118). For example, inactivation of SRB4 (suppressor of RNA polymerase B 4) immediately causes cessation of transcription by Pol II (156). Interestingly, a human

Mediator complex was also isolated as a co-activator complex specifically associated with ligand-bound nuclear hormone receptors (53). Subsequent efforts of purification demonstrate significant similarities between the human and the yeast Mediator complexes (reviewed in reference 59). The consensus at this moment is that transcriptional activators directly interact with components of the Mediator complex, which in turn cause the polymerase to initiate transcription more often than the basal level (Figure 2).

The Mediator complex is thought to tether directly to the C-terminal domain of Pol II (85, 155). Affinity purification involving components of the Mediator complex suggests that in vivo, the Mediator complex exists in a form of a RNA

6 polymerase holoenzyme containing Pol II, general transcription factors, the Mediator, and proteins involved in chromatin remodeling (reviewed in references 87, 125, 169).

It has been further suggested that interactions between activators and any components

co-activator complex Mediator

Ac Ac Pol II TFs

General Transcription Factors co-repressor complex FIG. 2. Regulation of transcription: a model. The basic unit of chromatin, the

nucleosome, is depicted as a flat cylinder of histone octamers wrapped around by

two turns of DNA. DNA-binding transcription factors (TFs) that activate

transcription have been shown to interact with the Mediator proteins, which in turn

associate with the general transcription machinery, causing increased levels of

transcription. TFs also interact with co-activators or co-repressors. Some co-

activators have HAT activity, and some co-repressors have HDAC activity

(adapted from reference 89).

of the holoenzyme can lead to transcriptional activation (27). This view implies that the holoenzyme represents a single target of transcriptional activation in vivo, and perhaps repression as well, since an SRB complex purified as part of the holoenzyme has been shown to act as a co-repressor (reviewed in reference 118). This view also

7 directly contradicts the ordered-assembly view of the transcriptional initiation complex formation. Recent evidence supports the idea of a stable holoenzyme complex; however, it has not been proven that the ordered-assembly view is wrong.

Therefore, the detailed kinetics of transcriptional activation in vivo remains unclear.

Repressors and transcriptional repression. Transcription of eukaryotic genes is also regulated by repressors, which turn off transcription. The mechanism of repression is even less well understood than that of activation. Traditionally, it is thought that repressors employ the following strategies to repress transcription: (1) by competing with an activator for its binding site in DNA, such as competition of transcription factor YY1 with serum-response protein for binding to the serum response element in α-actin gene (28); (2) by physical interactions with the activator, which result in either masking of the activation domain or dimerization leading to inactivation of the activator. Examples include interactions between MDM2 and p53

(115) as well as MyoD dimerization with Id proteins (12); (3) by post-translational modification of the activator, such as acetylation of HMG-1, which renders it unable to activate IFN-β (reviewed in reference 150); (4) by interfering with the formation of a functional initiation complex. Examples include the yeast SRB10 protein, which phosphorylates the C-terminal domain of Pol II prior to initiation and marks the polymerase incapable of transcriptional initiation (reviewed in reference 118). Recent understanding of transcriptional repression adds another class of transcriptional repressors: those involved in modification of chromatin by deacetylation, which establishes a transcriptionally repressive chromatin environment.

8 Chromatin and transcription. Although it had long been suspected that chromatin played a role in transcription, it was the proposal more than 25 years ago that the eukaryotic chromatin is based on repeating units of nucleosomes first laid down the ground stone for subsequent elucidation of the relationship between chromatin and transcription (88). Nucleosomes, the basic units of chromatin, are organized by DNA wrapping around a histone octamer, which composes of two copies of histone proteins, namely H2A, H2B, H3 and H4 (83, 90, 132). Micrococcal nuclease digestion reveals that these four histones are closely associated with 146 base pairs of DNA, forming the core particle of nucleosomes (123). A short stretch of

DNA, called linker DNA, connects two nucleosomes. Histone proteins have two general structural domains: the globular histone fold domain and the flexible N- terminal tails. The X-ray crystal structure of the core particle suggests that while the

DNA winds around the surface of the histone core, it winds two turns with grooves aligned, creating a gap where the N-terminal tails of H2B and H3 pass through to the outside of the core particle. The tails of H2A and H4 also extend from the flat surfaces of the core particle to the outside (108). These exposed tails are thought to contact neighboring core particles and can be critical in mediating higher-order structures of chromatin beyond the nucleosomal level. In vivo and in vitro studies show that these histone tails also contact DNA (39, 120, 166). However, the high ionic crystal environment and the lack of linker DNA preclude direct observation of histone tail-DNA contact (108, 166). Interestingly, nucleosomes have intrinsic plasticity suggested by the observation that the twist of DNA around histone core is slightly altered, and the lost of about 1 base per turn is readily accommodated at

9 various locations within the core particle (108). This structural plasticity also suggests that nucleosomes can be subjected to remodeling.

Nucleosomes have a general inhibitory effect on transcription. In vitro studies show that transcriptional initiation is stalled by packaging of promoters into nucleosomes (86, 106). Early genetic studies in yeast also demonstrated that histone proteins are important in transcriptional repression: When synthesis of normal core histone H2B or H4 is repressed, promoters of inducible genes become accessible to the general transcription machinery (52). Deletions of histone H2A/H2B genes (170) and point mutations in H3 (67) have been identified as suppressor mutations in switch-independent (SIN) genes, which allow inducible gene transcription in yeast strains deficient for switch (SWI) genes or sucrose nonfermenting (SNF) genes, two general activators in yeast (68, 122, 129). Most researchers agree that gene regulation by modifying chromatin structures occurs in two flavors, chromatin remodeling and histone acetylation/deacetylation, which are often found in the same protein complexes.

Chromatin remodeling. Genetic studies suggest that two classes of activator proteins, SWI and SNF, act to antagonize the negative effects of chromatin on transcription (reviewed in references 13, 170). Subsequently, a multi-protein complex containing the SWI/SNF proteins was purified and shown to remodel chromatin (25,

35, 74). Since then, the yeast SWI/SNF complex has become the paradigm of the

ATP-dependent chromatin remodeling complexes, which utilize energy from ATP hydrolysis to change the chromatin structure and are often required for the full functioning of a variety of transcription factors (22). To date, two families of ATP-

10 dependent chromatin remodeling complexes have been purified: the SWI/SNF family and the ISWI family. The SWI/SNF family of chromatin remodeling machines contains large protein complexes. They destabilize nucleosomes by disrupting the contacts between DNA and histones, resulting in increased accessibility of nucleosomal DNA to DNase I, restriction enzymes, or DNA-binding transcription factors (35, 74, 105). In contrast, the ISWI family of chromatin remodeling machines contains smaller protein complexes, which uses ISWI (imitation SWI) protein as the

ATPase (76, 159, 162). ISWI chromatin remodeling complexes enable sliding of histone octamers to adjacent positions on the same strand of DNA (33, 58, 94).

Purification of these ATP-dependent chromatin remodeling complexes suggest that the nucleosome is a dynamic structure subject to intricate modulations, and that transcription and chromatin structure are tightly linked in vivo.

Histone acetyltransferases as co-activators. Several lysine residues in the core histones can be acetylated at the ε-amino positions. This kind of histone modification has been associated with various biological processes, one of them transcriptional control (4, 65, 140, 163). It has been postulated that charge neutralization caused by lysine acetylation reduces the affinity of histone tails to DNA and increases the accessibility of regulatory elements to transcription factors (69).

Some researchers believe that lysine acetylation does not influence the strength of interaction between histone tails and DNA but rather opens up the higher-order structure of the chromatin by disrupting the interaction between histone tails protruding from nucleosomes within the chromatin fiber (89). Nevertheless, there is a positive correlation between the extent of histone acetylation and gene activity. For

11 example, the transcriptional inactive heterochromatin is associated with hypoacetylated histones (65, 163).

The enzymes catalyzing the addition of acetyl groups to histones are histone acetyltransferases (HATs). The first definitive link between transcriptional activation and histone acetylation came with the identification that the yeast Gcn5 protein, which is a transcriptional co-activator of many genes, is a HAT (19). Most significantly, the HAT activity of Gcn5 is required for its transcriptional activation activity (91), and there is a general increase in histone H3 acetylation in the promoter of a Gcn5-regulated gene upon induction (21). Since then, many transcription factors have been identified as HATs, including the TAFII250 subunit of TFIID (114), p300/CBP (8, 124), PCAF (173), and SRC-1 (148). p300/CBP and SRC-1 family members were first identified as transcriptional co-activators. They do not bind specific DNA elements but potentiate transcriptional activation when associated with an activator. An attractive model has emerged in which sequence-specific transcriptional activators activate transcription by associating with HATs (Figure 2).

However, there is no direct evidence demonstrating that histone acetylation per se activates transcription. Recently many transcription factors have been shown to be acetylated, including p53 (54) as well as the basal transcription factors TFIIE and

TFIIF (75). It is possible that acetylation of transcription factors contributes to transcriptional activation (or repression), in addition to acetylation of the core histones. Recent studies, both biochemical and genetic, also suggest that core histone acetylation and chromatin remodeling act in concert to activate transcription (34,

12 101). However, the temporal sequence of these two biological activities is still under intense debate.

Histone deacetylases as co-repressors. Similar to the discovery that many transcriptional co-activators are HATs, many transcriptional co-repressors are found to possess histone deacetylase (HDAC) activity (171) (Figure 2). HDACs identified to date are classified into families. The Class I Rpd3 family of HDACs, including

HDAC1, HDAC2, and HDAC3, has been shown to be important in transcriptional repression (153, 171, 172). These HDACs are found in multi-protein complexes, including many co-repressor complexes (reviewed in reference 36). Moreover, they also associate with DNA-binding repressor proteins such as YY1 (171), Mad (93),

Ume6 (81), and nuclear hormone receptor co-repressors (3, 66, 121). Although association with HDAC complexes may not account for all cellular repression activities, more and more repressors appear to utilize this mode of transcriptional repression. It will be extremely informative to test whether HDACs as co-repressors only act in a gene-specific manner, or they also participate in epigenetic control of gene repression.

YY1 is a transcriptional regulator. Transcription factor YY1 (Yin Yang 1) represents a valuable system to study various aspects of eukaryotic transcriptional control. YY1 was first discovered in a biochemical assay analyzing the activity of the P5 promoter of the adeno-associated virus (AAV) (144). AAV is a defective parvovirus; it cannot replicate without co-infection of adenovirus. The P5 promoter of AAV is silent in the absence of adenovirus co-infection. In the presence of the adenoviral E1A protein, which is normally introduced as a result of adenovirus

13 infection, the P5 promoter is activated and the lytic cycle of AAV begins. Using this

P5 promoter element, a cellular protein was discovered as the target of E1A-directed promoter activation. This protein was named Yin Yang 1 for its dual transcriptional activity: in the absence of E1A, it represses transcription from P5. In the presence of

E1A, YY1 activates transcription from P5. Yin and Yang represent the repression and activation properties of YY1.

Independent of the analysis of the AAV P5 promoter, other experimental systems also discovered YY1 as a transcriptional regulator. δ, the mouse homolog of

YY1, was identified as an activator of certain ribosomal protein genes (61). YY1, also identified as NF-E1, represses transcription by binding to the immunoglobulin κ

3’enhanber (126). YY1 was also known as UCRBP, which binds to the upstream conserved regions of the Moloney murine leukemia virus (MuLV) and represses

MuLV promoter activity (41). Since then, YY1 has been shown to be instrumental in the regulation of many cellular and viral gene promoters, many of which have important functions in cell growth and differentiation (reviewed in reference 143).

General characteristics of YY1. YY1 binds a specific DNA sequence

(CGCCATNTT) in the promoters by 4 C2H2 zinc fingers, which are located at the C- terminus of the protein (reviewed in references 143, 154). Deletional and domain- swapping experiments (5, 23, 24, 97, 99, 100, 144, 171) show that the C-terminal zinc finger region of YY1 accounts for one of the two repression domains of YY1. The other repression domain resides in the middle glycine/alanine-rich segment of YY1.

The N-terminal region of YY1 is identified as the activation domain of YY1, suggesting that YY1 possesses transcriptional activation activity independent of its

14 repression activity. The human YY1 protein contains 414 amino acid residues with a predicted molecular weight of 44 kDa. However, YY1 has an apparent size of about

65 kDa on SDS-polyacrylamide gels, suggesting that YY1 might have a unusual structure. The amino acid sequence of YY1 is highly conserved among human, mouse, and Xenopus, and a Drosophila homologue of YY1 has also been discovered

(144, 18, 41, 61, 126, 130). Knockout studies show that deletion of YY1 results in peri-implantation lethality in mice (38), further demonstrating the importance of YY1 in fundamental biological processes such as development.

YY1 and transcriptional initiation. In addition to being a transcriptional regulator, YY1 has also been suggested to be a transcriptional initiator. In vitro studies show that YY1 binds directly to the initiator (Inr) element of the AAV P5 promoter (144), and YY1 binding to this Inr element is necessary for transcriptional initiation (142). In a reconstituted transcription assay, purified YY1, TBP, and Pol II are sufficient to initiate transcription from a supercoiled template (160). Crystal structure studies of the zinc finger domain of YY1 bound to the Inr element of P5 suggest intrinsic directionality of YY1-mediated transcriptional initiation: YY1 binds both the template strand and the non-template strand of DNA upstream of the Inr element but only the template strand downstream of Inr, providing structural basis for the correct direction of transcription (70).

In addition to the AAV P5 promoter, YY1 binds to the Inr elements of many gene promoters, including the cytochrome oxidase Vb subunit promoter (10), DNA polymerase β promoter (64), PCNA promoter (92), and the mouse Surf-1 promoter

(42, 43). However, the mechanistic basis for the initiator activity of YY1 is still

15 unclear. It has been shown that YY1 physically interact with TFIIB and Pol II both in vitro and in vivo (30, 161). YY1 also interacts with TBP and TAFII55 (5).

Sedimentation studies further confirm that YY1 co-purifies with components of the general transcription machinery (109, 139). These lines of evidence suggest that

YY1, when bound to the Inr element, recruits Pol II to the transcriptional initiation site, and this may account for the initiator activity of YY1.

16 OBJECTIVES

As we began to appreciate the unique properties of YY1, it became apparent that we knew very little about how the activity of YY1 is regulated. For example, when does YY1 function as a transcriptional activator and when as a repressor? How does the role of YY1 as a transcriptional initiator reconcile with that as a transcriptional regulator? Understanding how the activity of YY1 is regulated will help us answer those questions and tremendously enhance our knowledge about the basic mechanisms of transcription. Therefore, it is important that we understand how the activity of YY1 is regulated.

It has been shown that YY1 is a stable phosphorylated protein expressed ubiquitously regardless of cell cycle position or the differentiation status of the cell

(5). However, several lines of evidence also suggest that YY1 is regulated. For example, expression of YY1 mRNA in NIH3T3 cells is affected by cell density and growth factors such as insulin-like growth factor (IGF)-1 (40). The activity of YY1 also changes during myoblast differentiation and during aging (1, 98). Furthermore, the DNA-binding activity of YY1 decreases during differentiation in human teratocarcinoma cells (104).

A wide variety of transcription factors have been shown to associate with

YY1, suggesting that the activity of YY1 could be controlled by protein-protein interactions. These YY1-interacting proteins include proteins of the basal transcription machinery, such as TBP (5), TFIIB (160); sequence-specific DNA- 17 binding transcriptional activators, such as Sp1 (96, 141), c-Myc (145), ATF/CREB

(178), C/EBP (11); and various transcriptional co-regulators, such as E1A (100),

TAFII55 (30), p300/CBP (5, 95), and HDAC1, HDAC2, and HDAC3 (171, 172).

The YY1-p300/CBP and YY1-HDACs interactions are of particular interest. In certain circumstances, the transcriptional activation activity of YY1 directly depends on its association with p300/CBP (95). In contrast, it has been shown that the transcriptional repression activity of YY1 is mediated by association of HDAC2 with residues 170-200 of YY1, which corresponds to one of the repression domains of

YY1 (171). It is conceivable that by selectively associating with either HATs or

HDACs, YY1 becomes an activator or a repressor. However, it has not been shown definitively that such an active selection system exists for YY1. Recently p300, CBP, and another HAT, PCAF (p300/CBP associated factor), have been shown to acetylate transcription factors in addition to their histone substrates (reviewed in reference 150).

Importantly, acetylation was a key regulatory mechanism for the regulation of those transcription factors. Because YY1 interacts with both p300/CBP and HDACs, it is possible that the activity of YY1 is regulated by acetylation and deacetylation.

Association between YY1 and p300/CBP or HDACs also suggests that YY1 might interact with cellular proteins to form protein complexes. It has been discovered that many chromatin-modifying activities, including chromatin- remodeling and histone acetylation/deacetylation, exist in forms of multi-subunit protein complexes. For example, the yeast Gcn5 co-activator, which possesses HAT activity, exists in two protein complexes: SAGA (Spt-Ada-Gcn5 acetyltransferase) and ADA (48). HDAC1 and HDAC2 also exist in two major histone deacetylase

18 complexes: NuRD and SIN3 (reviewed in reference 2). The formation and recruitment of these protein complexes have important influence on the biological activities of the constituent proteins. It is possible that YY1 is also regulated in the context of a protein complex in vivo.

Taken these lines of evidence together, this dissertation study was initiated to test the hypothesis that the activity of YY1 is regulated by multiple mechanisms. Three aims have been proposed:

Aim 1 is focused on regulation of YY1 at the genomic level, which includes cloning and analysis of the human YY1 promoter.

Aim 2 is devoted to regulation of YY1 at the polypeptide level, which is regulation of YY1 by acetylation and deacetylation.

Aim 3 is intended to study YY1 in a context of protein complexes, which involves purification of a YY1 protein complex.

19 MATERIALS AND METHODS

Isolation of YY1 genomic clones. A human liver genomic library (ATCC

37333) in Charon 4A was screened with a 32P-labeled human YY1 cDNA fragment

(nt 1-315) using a standard protocol (136). λ phage DNA was purified from two positive clones, digested with restriction enzymes, and analyzed by Southern blotting

(136). A 4.5 kb EcoRI fragment was subcloned into a pGEM7zf(+) vector (Promega) for subsequent analyses.

Plasmids. An EcoRI/NcoI fragment was isolated from the 4.5 kb human YY1

λ clone described above, treated with Klenow to blunt ends, and ligated into pGL2-

Basic vector to create p-3600Luc. pGL2-Basic (Promega) contains a firefly luciferase gene as a reporter and lacks eukaryotic promoter and enhancer sequences. p-3600Luc was subsequently digested with NsiI/StuI and subjected to exonuclease III digestion to create 5’ progressive deletions of the YY1 promoter linked to the luciferase reporter gene. pRL-TK (Promega) was used as a control for normalization in co-transfection experiments. pRL-TK contains a Renilla luciferase genes under control of the herpes simplex virus thymidine kinase promoter.

Glutathione S-transferase was expressed from pGSTag (133). GST-YY1 (1-

414) was expressed from pGST-YY1 (171), and deletion constructs of GST-YY1 were generated by restriction enzyme digestion and re-ligations of pGST-YY1. GST- p53 expression plasmid has been described (72). GST-p300 and GST-PCAF were

20 expressed from plasmids pGEX2T-p300 (aa 1195 to 1810) and pGEX5X-PCAF (aa

352 to 832), respectively (26).

Gal4-YY1 was expressed from pM1-YY1, which was constructed by inserting the full-length YY1 cDNA in-frame with the Gal4 DNA-binding domain in pM1

(134). pM1-YY1 (K170-200R) was prepared using adapter oligonucleotides containing AAG (lysine) to AGG (arginine) mutations within YY1 aa 170 to 200 of pM1-YY1. pG5CAT-Control was constructed by inserting five Gal4 DNA-binding sites into the BglII site of pCAT-Control (Promega), which contains the chloramphenicol acetyltransferase (CAT) gene downstream of the SV40 promoter and enhancer sequences. Flag-YY1 was expressed from pCEP4F-YY1, which was generated by inserting the full-length YY1 cDNA into the pCEP4F vector (179).

Serial Flag-YY1 deletion constructs were made by restriction enzyme digestion and re-ligations of pCEP4F-YY1. pET15b-YY1, which expressed non-tagged full-length

YY1 in E. coli in an inducible system, was constructed by cloning the full-length YY1 cDNA into pET15b (Novagen). pGEM7Zf3X-HD1, which was used to generate in vitro translated HDAC1, was made by subcloning full length HDAC1 into the pGEM7Zf3X vector.

Plasmids pCMV12S, pCMV13S, and pCMV-YY1 have been described previously (7, 171). pCMV12S directs expression of the E1A 243R protein, and pCMV13S expresses the E1A 289R protein. The following plasmids have also been previously described: pBJ5-HD1F (153), which expresses HDAC1 C-terminally tagged with a Flag epitope; pBJ5.1-HD1F (H199F) HDAC1 point mutant (63); pME18S-FLAG-HDAC2, which expresses Flag-tagged HDAC2 (93).

21 Sequencing of the human YY1 promoter. The dideoxy chain-termination sequencing method was employed to obtain the complete sequence of one strand of the human YY1 promoter using p-3600Luc and its deletion derivatives as templates and GLprimer 1 (Promega) as primer. Custom-designed oligodeoxynuclotide primers and GLprimer 2 (Promega) were used to obtain the sequence of the complementary strand.

Primer extension. Primer extension was performed essentially as described previously with minor modifications (136). An antisense oligonucleotide corresponding to the human YY1 promoter sequence from position +76 to +100 was synthesized and end-labeled with [γ-32P]ATP and T4 polynucleotide kinase. HeLa total RNA was isolated using the acid phenol-guanidinium thiocyanate method (31).

10 µg of the HeLa total RNA or yeast total RNA was mixed with 105 cpm of the labeled oligonucleotide primer and the mixture was ethanol-precipitated. The DNA-

RNA mixture was then re-dissolved in 30 µl of hybridization buffer [40 mM PIPES

(pH 6.4), 1 mM EDTA (pH 8.0), 0.4 M NaCl and 80% formamide], denatured at 85oC for 10 min, and annealed at 30oC overnight. The annealed hybridization mixture was then ethanol-precipitated, washed, and re-dissolved in 20 µl of reverse transcriptase buffer [50 mM Tris-HCl (pH 7.6), 60 mM KCl, 10 mM MgCl2, 1 mM each of dATP, dCTP, dGTP and dTTP, 1 mM dithiothreitol (DTT), 1 U/µl RNase inhibitor and 50

µg/ml actinomycin D]. 50 U of avian myeloblastosis (AMV) reverse transcriptase was then added, and the reactions were incubated at 37oC for 2 h. At the end of incubation, the reactions were stopped with EDTA, treated with DNase-free RNase, and phenol-chloroform extracted. Single-stranded DNA was recovered by ethanol 22 precipitation, washed, and dissolved in 4 µl of TE (pH 7.4). Samples were added with

6 µl of formamide loading buffer [80% formamide, 10 mM EDTA (pH 8.0), 1 mg/ml xylene cyanol and 1 mg/ml bromophenol blue], heated at 95oC for 5 min, and resolved on a 6% polyacrylamide/7 M urea gel. The gel was then dried and images were obtained by autoradiography.

Cell line, transfection, luciferase assays, and CAT assays. HeLa cells were maintained in Dulbecco’s modified Eagle’s media supplemented with 10% fetal bovine serum and 100 mg/ml penicillin and streptomycin. For each transfection reaction, 3x105 cells were seeded into a 60-mm tissue culture dish. Sixteen h later,

10 µg plasmids were transfected using the calcium phosphate co-precipitation method

(47). Forty-eight h after transfection, cells were harvested. For luciferase assays, luciferase activity was determined using the Dual Luciferase Reporter Assay system

(Promega). For CAT assays, cells were harvested by scraping and lysed by repeated freezing/thawing, and extracts were assayed for CAT activity by thin-layer chromatography (46).

Recombinant proteins. The GST fusion constructs of p300, PCAF, p53, and

YY1 deletion mutants were expressed in E. coli DH5α, bound to glutathione-agarose beads (Sigma), washed extensively in phosphate-buffered saline (PBS), and eluted with 25 mM reduced glutathione. The eluate was then dialyzed against a buffer containing 20 mM Tris-HCl (pH 8), 0.5 mM EDTA, 100 mM KCl, 20% glycerol, 0.5 mM dithiothreitol (DTT), and 1 mM phenylmethylsulfonyl fluoride (PMSF).

Non-tagged YY1 was expressed in E. coli BL21 (DE3), induced with 0.2 mM

IPTG, and captured by Ni2+ resin (ProBond, Invitrogen). Unbound bacterial proteins

23 were removed with 50 mM imidazole, and bound YY1 was eluted with 500 mM imidazole. Flag-tagged YY1 used in electrophoretic mobility shift assays (EMSA) was purified on an anti-Flag column (Sigma) under stringent conditions following the manufacturer’s suggestions.

In vitro acetylation reactions. Purified GST-YY1 and serial deletion proteins were incubated at 30oC for 30 min with 0.25 µCi [3H]acetyl coenzyme A (CoA)

(Amersham) and purified GST-p300 (0.2 µg) or GST-PCAF (1 µg) in 30 µl of acetylation buffer containing 50 mM Tris-HCl (pH 8.0), 5% glycerol, 0.1 mM EDTA,

50 mM KCl, 1 mM DTT, 1 mM PMSF, and 10 mM sodium butyrate. Proteins were resolved by SDS-polyacrylamide gel electrophoresis (SDS-PAGE). SDS- polyacrylamide gels were fixed by Coomassie blue staining and subjected to signal amplification (Amplify, Amersham) prior to exposing to X-ray film.

For subsequent mass spec analyses, 0.5 pmol of the YY1 peptide

(GRVKKGGGKKSGKKSYLSGGAGAAGGRGADP) was acetylated in acetylation buffer for 2 hr with CAT-assay grade acetyl CoA (Amersham).

Immunoprecipitation and western blot analysis. Immunoprecipitation of endogenous YY1 from HeLa cell extract was performed with H-10 anti-YY1 mAb

(Santa Cruz) and GammaBind protein G Sepharose (Amersham). Endogenous Max and 14-3-3 were immunoprecipitated using anti-Max mAb (Pharmingen) and anti-14-

3-3 H-8 mAb (Santa Cruz), respectively. Immunoprecipitation of Flag-YY1 deletion proteins was done using anti-Flag M2 affinity gel (Sigma) following the manufacturer’s suggestions.

24 Western blot analyses were performed using standard protocols (62).

Immunoprecipitated proteins were detected with diluted primary antibodies [1:1000 of anti-acetyl lysine (Upstate), 1:5000 of H-10, 1:500 of anti-Max, 1:1000 of H-8,

1:5000 of anti-Flag M2 (Sigma), 1:1000 of anti-HDAC1, HDAC2, or HDAC3 rabbit anti-serum (93, 158, 168)] followed by 1:7500 diluted alkaline phosphatase- conjugated secondary antibodies (Promega). The blots were subsequently developed with 5-bromo-4-chloro-3-indolyl phosphate and nitro blue tetrazolium (Promega).

In vitro protein-protein interaction assays. 35S-labeled HDAC1 was generated from pGEM7Zf3X-HD1 using T7 RNA polymerase and the TNT

Reticulocyte Lysate System (Promega). GST-YY1 (170-200) was either acetylated with cold acetyl CoA or mock acetylated and was then captured onto glutathione- agarose beads. 5 µl of in vitro translated HDAC1 was mixed with the beads in the presence of PBS plus 0.2% NP-40 at room temperature for 1 h. Beads were washed extensively in PBS plus 0.2% NP-40. Bound proteins were eluted by boiling in

Laemmli sample buffer, separated by SDS-PAGE, and detected by Coomassie blue staining and autoradiography.

Histone deacetylation assays. HeLa cells were transfected with 10 µg of pCEP4F-YY1 deletion plasmids by the calcium phosphate co-precipitation method

(47). Forty-eight h after transfection, cells were harvested, lysed in PBS plus 0.1%

NP-40, and immunoprecipitated with anti-FLAG M2 affinity gel (Sigma). Histone deacetylase activities of the immunoprecipitated Flag-YY1 were determined using a peptide corresponding to residues 2 to 24 of histone H4 as described (153) except that incubation was performed at room temperature overnight. 400 nM (final

25 concentration) of TSA (Sigma) or a 5 column-volume (cv) of Flag peptide (Sigma) was added to the immunoprecipitate 30 min prior to addition of the H4 substrate peptide, if appropriate. Histone deacetylation assays on chromatographic fractions were performed using the same H4 peptide as substrate.

Immunofluorescence analysis. HeLa cells were grown on chamber slides

(Nalge Nunc International) for about twenty-four h and transfected with 10 µg of F-

YY1 deletion constructs. Two days later, cells were washed with ice-cold PBS, fixed with 4% paraformaldehyde for 10 min, rinsed again with PBS, covered with 400 µl of

1% bovine serum albumin (BSA) in PBS for 1 h at room temperature, washed again in PBS, and then treated with 1:200 dilution of anti-Flag FITC conjugate antibody

(Upstate) for 1 h at room temperature. Subsequently, cells were subjected to extensive washing with PBS and cover slips were applied with one drop of anti-fade mounting medium with DAPI (Vector) before analysis under a fluorescence microscope.

Electrophoretic mobility shift assays. Single-stranded oligodeoxynucleotides corresponding to a consensus YY1-binding site (142) or a p53 cognate sequence (54) were labeled individually with [γ32P]ATP and T4 polynucleotide kinase, heated together at 65oC, and allowed to anneal by slow cooling to room temperature. Binding reactions were performed in a 12 µl reaction volume containing 12 mM Hepes (pH 7.9), 10% glycerol, 5 mM MgCl2, 60 mM KCl, 1 mM

DTT, 0.5 mM EDTA, 50 mg/ml BSA, 0.05% NP-40, 0.1 mg poly(dI-dC), approximately 1 ng of purified proteins or 5 µl of chromatographic fractions, and 5 fmol radiolabeled DNA. Reactions were incubated for 10 min at room temperature 26 and separated on 4% non-denaturing polyacrylamide gels. The gels were then dried and exposed to film.

Gel filtration analysis of YY1. HeLa nuclear extract was prepared according to the Dignam method and dialyzed into TM buffer [50 mM Tris-HCl (pH 7.9), 122.5 mM MgCl2, 1 mM EDTA, 10% glycerol, 1 mM DTT, 0.1 mM PMSF] plus 0.1 M

KCl. 2.5 mg of dialyzed HeLa nuclear extract was applied to a calibrated Superdex

200 HR 10/30 column (Pharmacia) and fractions were collected.

Purification of a YY1 complex by anion exchange and immobilized-metal affinity chromatography (IMAC). Nuclear extract derived from 6 L of HeLa cells was loaded on a Q Sepharose column (Pharmacia). Bound proteins were eluted in buffer A [20 mM Hepes (pH 7.8), 5 mM MgCl2, 20% glycerol, 0.5 mM DTT, 0.2 mM

EDTA, 0.1 mM PMSF] with a linear gradient (5 cv) of KCl from 150 mM to 1 M.

The presence of YY1 was monitored with western blotting and EMSA. Fractions containing YY1 were pooled, dialyzed into PBS (pH 7.4) containing 10% glycerol, 5 mM β-mercaptoethanol, and 1 mM PMSF, and loaded on a column with 1 mL bed volume of Ni2+ resin (ProBond, Invitrogen). The column was washed extensively with wash buffer [PBS (pH 7.4), 50 mM imidazole, 10% glycerol, 5 mM β- mercaptoethanol, and 1 mM PMSF]. Bound YY1 complex was eluted with elution buffer [PBS (pH 7.4), 10% glycerol, 5 mM β-mercaptoethanol, and 1 mM PMSF] containing 300 mM imidazole.

Coomassie staining and silver staining. Detection of YY1 protein complexes with Coomassie staining and silver staining was performed using standard protocols (6).

27 Purification of a YY1 complex by anion exchange and antibody-affinity chromatography. Nuclear extract derived from 6 L of HeLa cells was loaded on a Q

Sepharose column (Pharmacia). Bound proteins were eluted in buffer A [20 mM

HEPES (pH 7.8), 5 mM MgCl2, 20% glycerol, 0.5 mM DTT, 0.2 mM EDTA, 0.1 mM

PMSF] with a linear gradient (5 cv) of KCl from 150 mM to 1 M. The presence of

YY1 was monitored with western blotting and EMSA. Fractions containing YY1 were pooled, dialyzed into PBS (pH 7.4) containing 10% glycerol and 1 mM PMSF, and loaded on a protein G column (GammaBind, Amersham). The flowthrough fraction was collected and loaded onto an antibody column made by coupling H-10 anti-YY1 mAb (Santa Cruz) to protein G beads. The antibody column was then washed extensively with PBS (pH 7.4) containing 10% glycerol, 100 mM KCl, and 1 mM PMSF. Bound proteins were either used directly in histone deacetylation assays or eluted with 100 mM glycine (pH 2.5).

Purification of a Flag-tagged YY1 complex. 1.5x109 HeLa cells were transiently transfected with plasmid pCEP4F-YY1 using the calcium phosphate co- precipitation method (19). Cells were harvested, pooled, and lysed by sonication in

PBS (pH 7.4) plus 1 mM PMSF. Cell lysate was applied to an anti-Flag M2 column

(Sigma) and the adsorbed protein complex was washed extensively with PBS (pH 7.4) containing 10% glycerol and 1 mM PMSF. Bound proteins were eluted with excess

Flag peptide (100 µg/ml) in 5 cv of PBS (pH 7.4) containing 10% glycerol and 1 mM

PMSF.

Radioimmunoprecipitation analysis (RIPA) of F-YY1. HeLa cells were transiently transfected with full-length F-YY1 (pCEP4F-YY1) and its serial deletion

28 plasmids using the calcium phosphate co-precipitation method (47). Sixteen h later, cells were labeled with [35S]methionine and cysteine (11.0 mCi/ml, NEN) for four h.

Labeled cells were harvested and lysed by sonication in PBS (pH 7.4) containing

0.1% NP-40 and 1 mM PMSF. Anti-Flag M2 agarose beads (Sigma) were added to the cell lysates and washed extensively with PBS (pH 7.4) containing 0.1% NP-40 and 1 mM PMSF. The beads were boiled in Laemmli sample buffer and proteins were separated by SDS-PAGE. Gels were then dried and exposed X-ray film.

Accession number. The nucleotide sequence data of the human YY1 promoter reported in this dissertation appears in GenBank, EMBL, and DDBJ

Nucleotide Sequence Databases under the accession number AF047455.

29 RESULTS

Determination of the transcriptional start site of the human YY1 gene.

To determine the transcriptional initiation site of the YY1 gene, primer extension was

performed using primers spanning the putative transcriptional start site and total HeLa

RNA. Identical reactions using yeast tRNA were performed side by side as negative

controls. One primer consistently yielded a strong signal indicating one strong

transcriptional start site. Alignment with a dideoxynucleotide sequence ladder from

.

C T A G HeLa totalyeast RNA tRNA FIG. 3. Determination of the 5’ end 5' of the human YY1 transcript.

G A Purified total RNA from HeLa cells A T (lane 5) or tRNA from yeast (lane 6) C G A were used as templates in primer G A +1 32 G extension analysis using a 25 bp P- G G C labeled antisense oligonucleotide G A probe and AMV reverse transcriptase. A C G A sequencing ladder of the YY1 G G C promoter was created in parallel and

3' is shown on the left with radiolabeled nucleotides (lanes 1-4). The arrow indicates the most likely start site of transcription.

1 2 3 4 5 6

30 the same primer showed that the strong signal corresponds to a G within a GC-rich region of the YY1 promoter (Fig. 3) However, due to the cap structure of the mRNA, the true transcription initiation site might be the A immediately preceding this G.

Transcriptional analysis of the human YY1 promoter. A 3.6 kb

EcoRI/NcoI fragment of the genomic clone containing sequences upstream of the

ATG codon in the YY1 cDNA was subcloned into pGL2-Basic and the resulting plasmid was named p-3600Luc. The pGL2-Basic vector contains a firefly luciferase gene but no eukaryotic promoter or enhancer sequences.

When transiently transfected into HeLa cells, p-3600Luc resulted in a 180-fold increase in luciferase activity compared to pGL2-Basic alone (Fig. 4). To determine the 5’ boundary of the YY1 promoter, serial deletion constructs of p-3600Luc were generated and assayed for luciferase activities in HeLa cells after transient transfection. As shown in Figure 4, deletion constructs p-2100Luc, p-1729Luc, p-

1514Luc, p-1248Luc, p-1110Luc, p-917Luc, p-478Luc, and p-277Luc exhibited similar levels of luciferase activities to p-3600Luc. Deletion of the promoter to +54 drastically reduced the luciferase activity, suggesting the presence of a positive cis- acting element between positions -277 and +54. However, a significant increase in luciferase activity was observed between p-1514Luc and p-1248Luc, indicating a negative cis-acting element was present between nt -1514 and -1248 of the YY1 promoter. Further deletions of the YY1 promoter to position +379 completely abolished the luciferase activity to the background level (compared to pGL2-Basic).

These results suggest that a minimal sequence of 54 bp located downstream of the

31 transcriptional initiation site of the YY1 gene contains significant levels of the promoter activity, and this activity is enhanced by the sequence between positions

-277 and +54.

relative luciferase activity 0 100 200 300

≈ -3600 Luciferase p-3600Luc +475

≈ -2100 p-2100Luc

-1729 p-1729Luc

-1514 p-1514Luc

-1248 p-1248Luc

-1110 p-1110Luc

-917 p-917Luc

-478 p-478Luc

-277 p-277Luc

+54 p+54Luc

+379 p+379Luc

pGL2-Basic

FIG. 4. Expression of luciferase enzymatic activity driven by the human YY1 promoter in transiently transfected cells. The left panel shows schematic drawings of various fragments of the human YY1 gene 5’ sequence subclones upstream of a luciferase reporter gene. A bent arrow indicates the direction of transcription. Reporter constructs were transfected into HeLa cells by the calcium phosphate co- precipitation method, harvested, and assayed for luciferase activity. All relative luciferase activities, as shown in the right panel, are normalized with control Renilla luciferase expressions. Data shown represent the average of three independent experiments with standard deviations.

32 Sequence analysis of the human YY1 promoter. p-3600Luc and its serial deletion derivatives were utilized to determine the promoter sequence of the human

YY1 gene. The complete DNA sequence of the human YY1 gene is shown in Figure

5A, which exhibits remarkable similarity to the mouse YY1 promoter (Fig. 5B). The

-1717 CCTCATTTCTCTTGCTCTCACAATTGGTGTTTATGGG -1681

-1680 GAAGTATCAACTACTTGCAGTGCCATTTCCCCATCAATTACTAGAGAGTGGGGAAAGTGAAATTTAAAAAGCATTAAGAC -1601 MZF1 -1600 ATGTAAAAGTTCTCCCACAACTGGTTTCCATTCATGAAATATTTATGCAGAGTTTATAAGCTATAAAGCCAGAGATGACT -1521

-1520 TAATTCAACAGATTTGACTTTTCCAAACTGAGTGGGTGCAGTACTCCAAGGGGAATTATTCAGGTTTCAAAGCTCAGATT -1441 Nkx-2 -1440 CAAAGAGAAAACGATCTAATTTGTCACTCCTTACACTAATATTCTCAAAAGTCAAGTCCAATGCGATTTAGCAATAAGAA -1361

-1360 GGGACTAGGATTTATAAAGTTGCCTTTTAATGAGAATGTATAGTCTACTTGTTTTAACAAGTTGAGCCTAAGATTAATGT -1281

-1280 ATTGCGTACAGTTCAGAAAATCATGGGCCTCAACTGCATGAACACTATTACAAAACAGTAAATGTTGATAATATTTAAGT -1201

-1200 TGAACAAATTCACAGAGGCGTTAAATCGGCCAAACGAGTACAACAAAGACACACCTTTCCAACTCTTCAATTTGTCATAG -1121

-1120 TTTCCTTAAAAATCAGGAAATCTTTGTTTTGCTTTAAGGCAAATTGTCAGGTCGACCAAAAGGACAGATAAGAGCAGAAA -1041

-1040 CACTTCGCTGCAATGTAACTCATTCAGGAAGGTTTAACTTGCCGCTAATCCGTGCCACAAAAAAAAATCTAGGCTCTGTT -961

-960 GCAGGTACAATGGAGGACACGGCTGAAAAAATTTGGAATTTTAAATGAGACAAATGCAAAACC TGGTGGGCGTAAAAAGG -881

-880 AGCACCTATGAAAGTGACAAATAGGGGGAAAGGGTGGGCAAGGGAAACAATGGCTGACTGGAG AGCAAAGAAGGGGAAGC -801

-800 TCAGGAGAAAATTTTAGAAAGCCGCCAGGACCCTGTAGTTCTAAGATCTACGGGGAAACAGGC ACCCAACGGCTGCGTCT -721 v-myb/c-myb -720 CAGGTTTCCGCGGGTCACTAAAGAATAACGGACATCCTCCCAACGGTGGCCCTGGGGCTCCGC GGGCGCTTCCGCCGAGC -641 v-myb -640 TCGCGCCGACCCCGCGCTCGGCCCCGCACCCCGCCGGGCGCTCGCGGCGAGATACCGGACGCT GCCCGCGTCGCCCGATT -561

-560 TTGTCCGTTCGGTCCTCCACACTCACCCCGCGGCCATCGCTCGCCCGAAGCCAGGCGACAAGA ACAAACACCTCCCGACG -481

-480 CGAAAAAGGAAGCACAGGCGATTCTCGTCAAAGCAGACTTTATTGGGGCGACAGGGCCGCCCC GCACGCGCCAGCCGCTC -401

-400 CCCGCGCCGCCGGGCCGCCCACCCGCCTCAACCCCGCTCCCGGCCGGCCCCTCCCTCCCTTCT CCTCAGCTCCCGCCCCC -321

-320 GTGGTGCCCGGGGCCGCGCGGACCGCTCACCGGCTCCCAAGGCAGCGGCTGTAGCGGCGACGC CCGTTCCCGAGTGCGGC -241

-240 CCCGGCCCGAGGCGGCGGGTTTTGTGGCTGTGGCACCGCGAAGGGCGGCACGGCGCGACACCG GGAAGCGGGAGGCGGTG -161

-160 GCGGCGGCGGCGGCGCGCTGACGTCACGCGCCGGGCCAGCCAGGGCGCGTGCGAGCCGCCCCGCCCCCGGTCCCATCGGC -81 CREB/ATF -80 CCCAATCCGGGAGGAGCCCGGCGAGTGGGCGGGGCCGCGGAGGCCAGCGGACAGATCGATTGGCCGAGAGGAGAATCGAG -1 Sp1 CDP/Cut 1 AGGGCGAACGGGCGAGTGGCAGCGAGGCGGGGCGGGCTGAGGCCAGCGCGGAAGTCTCGCGAGGCCGGGCCCGAGCAGAG 80 Sp1 81 TGTGGCGGCGGCGGCGAGATCTGGGCTCGGGTTGAGGAGTTGGTATTTGTGTGGAAGGAGGCGGAGGCGCAGGAGGAGGA 160

161 AGGGGGAAGCGGAGCGCGGCCCGGACGGGAGGAGGCGCGGCCAGGGCGGGCGGTTGCGGCGAGGCGAGGCGAGGCGGGGA 240 Sp1 241 GCCGAGACGAGCAGCGGCCGAGCGAGCGCGGGCGCGGGCGCACCGAGGCGAGGGAGGCGGGAAGCCCCGCGCCGCCGCGG 320

321 CGCCCGCCCCTTCCCCCGCCGCCCGCCCCCTCTCCCCCCGCCCGCTCGCCGCCTTCCTCCCTCTGCCTTCCTTCCCCACG 400

401 GCCGGCCGCCTCCTCGCCCGCCCGCCCGCAGCCGAGGAGCCGAGGCCGCCGCGGCCGTGGCGGCGGAGCCCTCAGCATG 476

FIG. 5A. DNA sequences upstream of the translational start codon of the human YY1 gene. The major transcriptional initiation site (+1) is indicated by a bent arrow. Transcription factor binding sites are underlined and indicated below each binding site sequence.

33 10 20 30 40 50 60 650 660 670 680 690 700 hYY1 - AGGCACCCAACGGCTGCGTCTCAGGTTTCCGCGGGTCACTAAAGAATAACGGACATCCTC hYY1 - CGGTCCCATCGG-----CCCCAATCCGGGAGGAGCCCGGC---GAGTGGGCGGGGCCGCG ::::::::::: : : : ::: ::::::::::::::: ::::::::::::::: :: : : ::: ::: :::::::: ::::::: :: :: :::: ::::::::: :: mYY1 - AGGCACCCAACCGGCGGGGCTCCGGTTTCCGCGGGTCATAAAAGAATAACGGACACACTT mYY1 - C--TACCAGCGGGGGCCCCCCAATC-GGGAGGACCCTGGTTGGGAGTAGGCGGGGCCCCG 10 20 30 40 50 60 580 590 600 610 620 630 70 80 90 100 110 710 720 730 740 750 hYY1 - CCAACGGTGGCCCTGGGGCTCCGCGGGC-GCTTCCGCCGAGCTCGCGCCGACCCCGCGCT hYY1 - GAGGCCAGCGGACAGAT-CGATTGGCCGAGAGG-AGAATCGAGAGGGCGAACGGGCGAGT ::::::::: :: :::: :::: :: :::::::: : :: :::: : : : : : :: : ::::::: : :::: :: : :::::: :::: : ::::: mYY1 - CCAACGGTGAACCCTAGGCTGCGCGCGCCGCTTCCGC-----TTGC------CGCGGT mYY1 - GCGCCTCGAGGGGCCCTGCGATTGGTAGCGAGGGAGGAGCGAGAGCCGGAACAG-CGAGT 70 80 90 100 640 650 660 670 680

120 130 140 150 160 170 760 770 780 790 800 810 hYY1 - CGGCCCCGCACCCCGCCGGGCGCTCGCGGCGAGATACCGGACGCTGCCCGCGTCGCCCGA hYY1 - GGC--AGCGAGG-CGGGGCGGGCTGAGGCCAGCGCGGAAGTCTCGCGAGGCCGGGCCCGA :: : :: :::::: :: :::: : : : : ::::: : :: : :: : :: :: ::::::::: ::: : ::::::::::::::::::::: ::: :: mYY1 - CGCCTTCGGCGCCCGCCACCGGCACGCGACCAAAGA------GCCCGTGGAGCACA- mYY1 - GGGGAATCGGGGACGGGGCGGGGCGAGAGCCCCGCGGAAGTCTCGCGAGGCCGAGCCGGA 110 120 130 140 150 690 700 710 720 730 740 180 190 200 210 220 230 820 830 840 850 860 hYY1 - TTTTGTCCGTTCGGTCCTCCACACTCACCCCGCGGCCATCGCTCG---CCCGAAGCCAGG hYY1 - GCAGAGTGTGGCGGCGGCGGCG------AGATCTGGGCTCGGG-TTGAGGAGTTGGTATT ::::: : :: ::: : : :: : ::: :: ::: :: : : :::::::::::::::::::::: ::::::::::::::: :::::::::::::::: mYY1 ------CGGTCGGCTACGCTC---CGTCCGCTACCGCACGAGACCCCGAGTAACG mYY1 - GCAGAGTGTGGCGGCGGCGGCGGCGGCGAGATCTGGGCTCGGGGTTGAGGAGTTGGTATT 160 170 180 190 200 750 760 770 780 790 800

240 250 260 270 280 290 870 880 890 900 910 920 hYY1 - CGACAAGAACAAACACCTCCCGACGCGAAAAAGGAAGCACAGGCGATTCTCGTCAAAGCA hYY1 - TGTGTGGAAGGAGGCGGAGGCGCAGGAGGAGGAAGGGGGAAGCGGAGCGC-GGCCCGGA- : ::: :::: : :: : ::::: ::::::::::: ::::::::: :::: ::::::::::::::::::::::::::::: :::::: :::: : ::: :::::::: mYY1 - AGTAAAGG-CAAAACGAACGGGAAACCAAAAATCAAGCACAGGCGTTTCTCGTCAGAGCA mYY1 - TGTGTGGAAGGAGGCGGAGGCGCAGGAGGC---AGGGGGCAGCGTAACGCCGGCCCGGAG 210 220 230 240 250 260 810 820 830 840 850 860 300 310 320 330 340 350 930 940 950 960 970 hYY1 - GACTTTATTGGGGCGACAGGGCCGCCCCGCACGCGCCAGCCGCTCCCCGCGCCGCCGGGC hYY1 - --CGGGAGGAGGCGCGGCCA------GGGCGGGCGGTTGCGGCGAGGCGAGGCGAGGCGG :::::::::: ::: ::::::: :: : : ::: ::::::: : :::::::::::::::::: :::: ::: : : :::::::::: : :::::: mYY1 - GACTTTATTGCGGC------CACGCGC--GCGGTCGCACGCCCCGCCGG-C mYY1 - GGCGGGAGGAGGCGCGGCCACAGCCAGGGCAGGCAGCCGAGGCGAGGCGAAGGCAGGCGG 270 280 290 300 870 880 890 900 910 920

360 370 380 390 400 410 980 990 1000 1010 1020 1030 hYY1 - CGCCCACCCGCCTCAACCCCGCTCCCGGCCGGCCCCTCCCTCCCTTCTCCTCAGCTCCCG hYY1 - GGAGCCGAGACGAGCAGCGGCCGAGCGAGCGCGGG-CGC----GGGCGCACCGAGGCGAG :: : :: ::: :: : ::: ::: :::::: :: :::::: : ::: : ::: :::::::::::::::::: : : ::: ::::::::::: : : mYY1 - AGCACGCCAGCCCCAGGCGCGCGCCC------CCCTTCACCCCAGCTC--G mYY1 - GGAAGCAGGACAGGCAGCGGCCGAGCGAGCGAGCGACGCAGCGGGGCGCACCGAT-CTCG 310 320 330 340 930 940 950 960 970 980

420 430 440 450 460 470 1040 1050 1060 1070 1080 1090 hYY1 - CCCCCGTGGTGCCCGGGGCCGCGCGGACCGCTCACCGGCTCCCAAGGCAGCGGCTGTAGC hYY1 - GGAGGCGGG-AAGCCCCGCGCCGCCGCGGCGCCCGCCCCTTCCCCCGCCGCCCGCCCCCT ::::: :: ::: :::::::: : :: ::::::::: :::: : : : ::::::::: :::::::: ::::: :::::::::::::::::::::::::::::::: mYY1 - TTACCGTGC--GCCTGGGTCGCGCGGAAAGTTCGCCGGCTCCCGAGGCGTAAGGCGCACG mYY1 - GGAGGCGGGGAAGCCCCG----GCCGCCGCGCCCGCCCCTTCCCCCGCCGCCCGCCCCCT 350 360 370 380 390 400 990 1000 1010 1020 1030 1040 480 490 500 510 520 530 1100 1110 1120 1130 1140 1150 hYY1 - GGCGACGCCCGT-TCCCGAGTGCGGCCCCGGCCC--GAGGCGGCGGGTTTTGTGGCTGTG hYY1 - CTCCCCCCGCCCGCTCGCCGCCTTCCTCCCTCTGCCTTCCTTCCCCACGGCCGGCCGCCT : :::::::: ::: : ::: : ::::: ::: : : :::::: :::: :::::::::::::: ::: ::::::::::::::::::::::::::::::::::::::::: mYY1 - GCCGACGCCCCACTCCTGTCAGCGACTGGGGCCCCGGAGACCGGCACTTTTGTCACTGTT mYY1 - CTCCCCCCGCCCGCCCGCTGCCTTCCTCCCTCTGCCTTCCTTCCCCACGGCCGGCCGCCT 410 420 430 440 450 460 1050 1060 1070 1080 1090 1100

540 550 560 570 580 590 1160 1170 1180 1190 hYY1 - GCACCGCGAAGGGCGGCACG--GCGCGACACCGGGAAGCGGGAGGCGGTGGCGGCGGCGG hYY1 - CCTCGCCCGCCCGCCC------GCAGCCGAGGAGCCGAGGCCGCC------GCGGCC :::::::: : : ::: ::::::: ::: ::: : :: ::: :::: :::::::::::::::: :::::: ::::::::: :::::: :::::: mYY1 - GCACCGCGGACGCCGGGGATTCGCGCGACGCCG---AGC----GCCGTAAGCGACGGC-- mYY1 - CCTCGCCCGCCCGCCCTCCCTCCCGCAGCCCAGGAGCCGACGCCGCCTGCCGCGGCGGCC 470 480 490 500 510 1110 1120 1130 1140 1150 1160 600 610 620 630 640 1200 1210 hYY1 - CGGCGCGCTGACGTCACGCGCCGGG---CCAGCCAGGGCGCGTGCGAGCCGCCCCGCCCC hYY1 - GTGGCGGCGGAGCCCTCAGC---- :: ::::::::::::::::::: :::::::: ::::::::: :::::: :::::: :::::::::::::::::::: mYY1 - --ACGAGCTGACGTCACGCGCCGGGGGGCCAGCCAGCGCGCGTGCG-GCCGCCACGCCCC mYY1 - GTGGCGGCGGAGCCCTCAGCCATG 520 530 540 550 560 570 1170 1180

FIG. 5B. Comparison of the YY1 promoter DNA sequences between mouse and human. The human YY1 promoter sequence [hYY1 (-74 to +476)] is aligned with the mouse YY1 sequence [mYY1 (-751 to +434)] (135). Identical nucleotide positions are indicated by double dots. human YY1 promoter possesses a region rich in GC nucleotides (80% GC from -427 to +96) and lacks a TATA box, which is typical of the 5’ untranslated regions of many transcription factors. Multiple GC boxes are located at positions -57, +29 and

+231, which are binding sites for the Sp1 family transcription factors (80). In addition to the GC boxes, the human YY1 promoter also contains putative binding sites for several ubiquitous and lineage-specific transcription factors. A binding site for CDP/CUT, which functions as a transcriptional repressor (60), is found just 20 bp upstream from the transcriptional start site. Further upstream is a binding site for

34 CREB/ATF (position -142) (57) as well as three Myb binding sites (51) in tandem

(positions -736 to -673). Far upstream at position -1522, a consensus binding site for the mouse tinman homeodomain factor Nkx-2 is found. Nkx-2 has been shown to antagonize the transcriptional repression activity of YY1 in the cardiac α-actin promoter through competitive binding during myogenesis (28). There is a binding site for MZF-1, a myeloid zinc finger transcription factor (116), at position -1640 close to the Nkx-2 site. Interestingly, the three Sp1 binding sites (GC boxes), the

CREB/ATF binding site, and the three Myb binding sties are conserved between the mouse and the human YY1 promoters, suggesting that transcription factors that bind to those sites might play an important role in the regulation of the mRNA level of

YY1.

E1A-mediated repression of the human YY1 promoter. YY1 is an important regulator of the cardiac α-actin promoter, and the adenovirus E1A protein blocks myogenesis as well as cardiac-specific gene transcription (119). It has also been shown that E1A relieves YY1-mediated transcriptional repression of the AAV

P5 promoter (144). It is possible that E1A directly affects transcription of the YY1 gene. To test this possibility, E1A expression plasmids (pCMV12S or pCMV13S) and a YY1 promoter construct (p-3600Luc) were transiently transfected into HeLa cells to examine the effect of E1A on YY1 transcription. Transcription initiated from the human YY1 promoter was significantly down-regulated by over-expressed E1A

12S and 13S proteins as measured in luciferase assays (Fig. 6A).

To further examine whether E1A represses YY1 promoter expression through upstream cis-acting sequences or through basal transcriptional machinery, a minimal

35 .

A B

120 120

100 100

80 80

60 60

40 40 relative luciferase activity relative luciferase activity

20 20

0 0 p-277 luc p-277 luc p-277 luc p-3600 luc p-3600 luc p-3600 luc + + + + E1A 12S E1A 13S E1A 12S E1A 13S

FIG. 6. Adenovirus E1A proteins repress the YY1 promoter. Luciferase assays were performed after transient transfections into HeLa cells with p-3600Luc or p-277Luc and pRL-TK plasmids in the presence or absence of plasmids encoding the adenovirus 12S or 13S proteins. Results were presented as the mean of three independent transfections with standard deviations and normalized with control Renilla luciferase expressions.

YY1 promoter, p-277Luc, was utilized in co-transfection/reporter assays. Figure 6B shows that the luciferase activity of p-277Luc was repressed by both E1A 12S and

13S proteins, suggesting that the mechanism of YY1 repression by E1A does not involve upstream sequence-specific DNA binding factors. This E1A-mediated

36 repression of the YY1 promoter most likely results from E1A modulating the activity

of the basal transcription elements surrounding the YY1 transcriptional initiation site.

YY1 does not autoregulate its own promoter. It is known that many

transcription factor autoregulate their own promoters. Some transcription factors bind

directly to DNA elements located in their own promoters and regulate their own

expression, while others activate or repress expression of a separate set of

transcription factors, which in turn modulate transcription from their gene promoters.

Although the human YY1 promoter does not appear to contain a YY1-binding

.

FIG. 7. The YY1 protein does

120 not autoregulate the YY1 promoter. Luciferase assays 100 were performed after transient

80 transfections into HeLa cells with p-3600Luc and pRL-TK 60 plasmids in the presence or absence of a plasmid encoding

relative luciferase activity 40 the YY1 protein. Results are

20 presented as the mean of three independent transfections with 0 p-3600Luc p-3600Luc standard deviations and + pCMV-YY1 normalized with control Renilla luciferase expressions.

37 consensus sequence, YY1 might alter expression levels of other transcription factors which are capable of binding the YY1 promoter and regulate expression of YY1.

Therefore, a YY1 expression plasmid (pCMV-YY1) was transfected into HeLa cells to test if over-expression of YY1 had any effect on its own promoter (p-3600Luc).

Figure 7 shows that YY1 had no significant effects on the activity of its own promoter. It is possible that the concentration of endogenously-expressed YY1 is sufficiently high to negate any effects from over-expressed YY1 introduced by transfection. However, our data suggest that YY1 most likely does not autoregulate its own promoter.

YY1 is acetylated by p300 and PCAF. Acetylation has been shown to

transcriptional transcriptional transcriptional activation repression repression domain domain domain

54 80 154 170 200 295 414

Acidic His Acidic GA GK Spacer Zn Fingers

DNA-binding domain

GRVKKGGGKKSGKKSYLSGGAGAAGGRGADP

FIG. 8. Multiple functional domains of transcription factor YY1. YY1 has one transcriptional activation domain at the N-terminus and two repression domains, one encompassing residues 170 to 200 and the other one residing at the C- terminus. The amino acid sequence of the central repression domain (residues 170 to 200) is given with lysine residues underlined. His, histidine-rich domain; GA, glycine/alanine-rich domain; GK, glycine/lysine-rich domain; Zn fingers, zinc fingers.

38 regulate the activity of many transcription factors including sequence-specific DNA-

binding factors p53 (54), GATA-1 (15, 73), E2F (110, 111), and MyoD (137).

Analysis of the YY1 amino acid sequence reveals that YY1 contains multiple lysine

residues that are potential substrates for acetylation. Interestingly, within YY1’s

histone deacetylase interaction domain (residues 170-200), there are 6 lysines

arranged in pairs (Fig. 8). As described previously, YY1 interacts with the HAT p300

(5, 95) which interacts with another HAT, PCAF (173). Remarkably, both p300 and

PCAF catalyze the acetylation of transcription factors (reviewed in reference 150).

.

MW MW MW (kD) (kD) ∆ 170-200 1-414 398-414333-414260-414 (kD) 1-414 1-396 1-3331-2611-2001-1701-122 261-333 170-2001-414 GST GST 97 97 97 68 68

68 43 43

43 29 29 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17

FIG. 9A. Acetylation of YY1 by PCAF. Serial GST-YY1 deletion proteins were incubated with GST-PCAF and separated by SDS-PAGE. The gels were then exposed to X- ray film to detect acetylated proteins. Arrows indicate acetylated YY1 proteins. Auto-acetylated forms of PCAF were detected as three bands around 68 kD.

To determine if p300 or PCAF acetylated YY1, we performed in vitro acetylation

reactions using GST-tagged p300 and PCAF purified from E. coli as enzymes. YY1

serial deletion constructs were similarly purified from E. coli as GST-fusion proteins 39 .

and used as substrates. GST-PCAF acetylated various deletion constructs of YY1

(Fig. 9A, lanes 1-5, 8-11, 13, 15, 16) but not GST alone (lanes 12, 17). Unlike PCAF,

MW MW MW (kD) (kD) (kD) GST ∆ 170-200261-333∆ 261-333 97 1-414 170-200 97 1-414 398-414333-414260-414200-261170-200 97 1-122 1-170 1-200 1-261 1-333 1-396 1-414 68 68 68 43 43 43

29 29 29

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19

FIG. 9B. Acetylation of YY1 by p300. Serial GST-YY1 deletion proteins were incubated with GST-p300. Arrows indicate YY1 proteins acetylated by p300.

GST-p300 efficiently acetylated GST-YY1 (170-200) as well as GST-YY1 (1-200)

(Fig. 9B, lanes 3, 12, 15). GST alone was not acetylated by p300, showing that the in

vitro acetylation was specific to YY1 (Fig. 9B, lane 1). Moreover, acetylation of YY1

was dependent on p300 or PCAF and was not due to YY1 auto-acetylation (Fig. 9C).

Taken together, we found that PCAF acetylated YY1 at residues 170-200 and at its C-

terminus. p300, in contrast, efficiently acetylated YY1 only at residues 170-200 and

only when YY1 was in a C-terminal truncated form, implying that p300-mediated

acetylation of YY1 is dependent on the conformation of YY1.

40 To determine if YY1 was acetylated in vivo, we immunoprecipitated endogenous YY1 from HeLa cells and then western blotted the precipitated material

YY1 (170-200) + + - - - YY1 (1-414) - - + + - p300 - + - - - PCAF - - - + + FIG. 9C. Acetylation of YY1 is Acetyl-CoA + + + + + MW (kD) dependent on p300 or PCAF. In 200 vitro acetylation reactions were 97 68 performed in the presence or

43 absence of p300 or PCAF. Arrows indicate that YY1 was 29 acetylated only in the presence of p300 or PCAF. 18

1 2 3 4 5

with anti-acetyl lysine antibody (Fig. 9D, lanes 2 and 3). Neither YY1 nor acetylated

YY1 was seen in experiments in which YY1 antibody was omitted from the immunoprecipitation reaction (mock IP, lane 1). Unlike YY1, the transcription factors Max and 14-3-3 were not acetylated in vivo (lanes 4 and 5). This finding indicates that YY1 is acetylated in vivo, and protein acetylation is restricted to specific proteins such as YY1.

To determine which region of YY1 was acetylated in vivo, we performed similar IP-western experiments, this time using YY1 serial deletion constructs fused to a Flag epitope. Flag-tagged YY1 (F-YY1) deletion constructs were transiently transfected into HeLa cells and immunoprecipitated with anti-Flag antibody.

41 MW -YY1 α α-Maxα-14-3-3 (kD) IP IP IP FIG. 9D. YY1 is acetylated in vivo. 200 Endogenous YY1 (lanes 2 and 3), Max MW 97 (kD) α-YY1 68 Western (lane 4), and 14-3-3 (lane 5) were 200 mock IP α-YY1 α-Max immunoprecipitated from HeLa cells 97 43 α-14-3-3 68 and analyzed for acetylation by western

43 29 blotting using anti-acetyl lysine antibody (bottom panels) or for 29 1 2 3 4 5 expression using their perspective antibodies (top panels). "Mock IP" indicates that no primary antibody was Western α-acetyl lysine used in immunoprecipitation reactions. Arrows indicate highlighted protein bands.

Acetylated forms of F-YY1 were detected by western blotting with anti-acetyl lysine

antibody (Fig. 9E, top panel). To ensure that all F-YY1 deletions were expressed,

blots were also probed with anti-Flag antibody (Fig. 9E, bottom panel). The results of

these experiments show that YY1 is acetylated in vivo at residues 170-200 as well as

in the C-terminal residues 261-414. Taken together, our in vitro and in vivo

acetylation results suggest that there are two acetylation domains on YY1: residues

170-200, which are acetylated by both p300 and PCAF, and the C-terminus, which is

acetylated by PCAF only.

Because both p300 and PCAF acetylate YY1 at residues 170-200, we were

interested in determining the specificity of acetylation by these two enzymes. Using

GST-p300 or GST-PCAF, we in vitro acetylated a synthetic peptide corresponding to

42 YY1 residues 170-200. We then compared the mass spectra produced by mass spectrometry. Figure 9F shows that mock-acetylated YY1 peptide had a Mr of 2861

(panel A, 2861 m/z). When this peptide was acetylated with PCAF, another peak

kD MW 170-200 261-333 ∆261-333 1-122 1-170 1-200 1-261 1-333 1-396 1-414 55-414 ∆ ∆261-300∆ 333-414 261-414170-414 1-414 261-3331-170 200 97 68 43

29 α-acetyl-lysine

18

14 200 97 68 43

29 α-Flag

18

14 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18

FIG. 9E. Identification of regions of YY1 acetylated in vivo. Flag-tagged YY1 serial deletion proteins were transiently expressed in HeLa cells, immunoprecipitated with anti-Flag antibody, and analyzed by western blotting using anti-acetyl lysine antibody and anti-Flag antibody. Arrows indicate immunoprecipitated YY1 proteins that were acetylated. emerged with a Mr of 2903 (panel B, 2903 m/z). Compared to the mock-acetylated peptide, this additional peak had a mass corresponding to one additional acetyl group

(2903-2861=42), suggesting that the YY1 peptide was acetylated once by PCAF.

Interestingly, when we compared the spectrum from the p300-acetylated peptide with

43 that of the mock-acetylated peptide, we found 3 additional peaks at 2903, 2945, and

2987 m/z, which contained one, two, and three additional acetyl groups, respectively

(Fig.. 9G). This result strongly suggests that YY1 can be acetylated by p300 at three different lysines between residues 170 and 200. F

unmodified unmodified

YY1 (170-200) PCAF acetylated YY1 (170-200)

monoacetylated counts

2800 2900 3000 3100 2800 2900 3000 3100 Mass (m/z)

G

diacetylated

monoacetylated triacetylated unmodified unmodified counts

p300 acetylated YY1 (170-200) YY1 (170-200)

2800 2900 3000 3100 2900 3000 3100 3200 Mass (m/z)

FIG. 9F, G. Determination of the number of acetylated lysines by mass spectrometry. A YY1 peptide containing residues 170 to 200 was in vitro acetylated by PCAF or p300 and subjected to mass spec analysis. Left panels are spectra from mock-acetylated peptides. Right panels contain spectra from acetylated as well as unacetylated peptides. 44 Lysine-to-arginine mutations within YY1 residues 170-200 significantly reduce the transcriptional repression activity of YY1. To understand the effect of acetylation on the transcriptional activity of YY1, we mutated the six lysines within

YY1 residues 170-200 to arginines. Arginine substitutions preserve the charges of the affected amino acid residues but prevent acetylation in vivo by HATs. Both wild-type and mutant YY1 were fused to a Gal4 DNA-binding domain and transfected into

HeLa cells in combination with a CAT reporter driven by the SV40 promoter

1 2 3 4 5 6

Gal4 + - - + - - Gal4-YY1 - + - - + - Gal4-YY1 (K170-200R) - - + - - +

Western α-YY1 Gal4-YY1 Gal4-YY1 (K170-200R)

YY1 1 2 3 4 5 6

FIG. 10. The effect of acetylation of YY1 residues 170-200 on the transcriptional repressor activity of YY1. HeLa cells were transfected with Gal4 DNA-binding domain alone (Gal4), Gal4-YY1 fusion construct (Gal4-YY1), or Gal4- YY1 mutant with the 6 lysines mutated to arginines (Gal4- YY1 (K170-200R)). Transcriptional activities were analyzed by CAT assays using a CAT reporter containing five Gal4 binding sequences in tandem, and a representative autoradiogram is shown. Western blot analyses were performed to verify the expression levels of the effector proteins.

45 containing five Gal4 binding sites. Consistent with previous findings (144, 171), wild-type Gal4-YY1 was a potent transcriptional repressor (Fig. 10, top panel, lanes 2 and 5). However, when the six lysines were mutated and no longer able to be acetylated, YY1 lost much of its repression activity (Fig. 10, top panel, lanes 3 and 6).

This finding suggests that acetylation of YY1 is necessary for the maximum transcriptional repression activity of YY1. Western blot analysis showed that the loss of repression was not due to lack of expression of the mutant YY1 proteins (Fig. 10, bottom panel, compare lane 3 to lane 2, lane 6 to lane 5).

Acetylation of YY1 residues 170-200 increases YY1 binding to HDACs.

Using GST pull-down assays, we previously demonstrated that HDACs interact with

YY1 residues 170-200 (79). Therefore, we asked if acetylation of YY1 in this region would affect YY1’s interaction with HDACs. Figure 11 shows that [35S] methionine- labeled HDAC1 bound more efficiently to PCAF-acetylated and p300-acetylated

GST-YY1 (170-200) than to unacetylated GST-YY1 (170-200) (compare lane 1 to lane 2, lane 3 to lane 4). The same amount of GST-YY1 (170-200) was used in all reactions as shown by Coomassie staining. Similar results were obtained using in vitro transcribed and translated HDAC2 (data not shown). In short, our data suggest that acetylation of YY1 at residues 170-200 significantly increases the binding of

YY1 to HDACs.

HDAC1 and HDAC2 deacetylate YY1 170-200 but not the C-terminal region of YY1. It is possible that the binding of HDACs to acetylated YY1 (170-

200) results in the subsequent deacetylation of YY1 (170-200). To test this hypothesis, a synthetic peptide corresponding to YY1 residues 170-200 was

46 .

FIG. 11. Increased HDAC-binding GST-YY1(170-200) to YY1 residues 170-200 by acetylation. A representative autoradiogram of in vitro translated

PCAF acetylatedp300 acetylated mock PCAFmock acetylated p300 inputacetylatedMW HDAC1 captured by acetylated or (kD) 200 mock-acetylated GST-YY1 (170- 97 HDAC1 68 200) is shown here. "Input" 43 represents one-tenth the amount of HDAC1 used in each binding 29 reaction. Reaction mixtures were 18 separated by SDS-PAGE, and the 1 2 3 4 gels were stained with Coomassie blue prior to exposure to film to GST-YY1(170-200) confirm that equal amounts of GST-YY1 (170-200) were used in Coomassie the binding reactions.

chemically labeled with [3H]sodium acetate and used as a substrate in deacetylation

assays. Figure 13A shows that immunopurified Flag-tagged HDAC1 and HDAC2 (F-

HDAC1 and F-HDAC2) deacetylated the YY1 (170-200) peptide. Deacetylation of

YY1 (170-200) by F-HDAC1 and F-HDAC2 was abolished by treatment with

tricostatin A (TSA), a potent inhibitor of HDAC1 and HDAC2. Furthermore, if F-

HDAC1 and F-HDAC2 were immunoprecipitated in the presence of an excess

competitor, Flag peptide, deacetylase activity was not observed on the YY1 peptide.

Similarly, endogenous HDAC1 and HDAC2 immunopurified from HeLa cells

47 (HDAC1 and HDAC2) also deacetylated the YY1 (170-200) peptide, and

deacetylation by endogenous HDAC1 and HDAC2 was also TSA-sensitive (Fig.

. 12A).

1600

1400

1200

1000

800 YY1 (170-200) 600 deacetylase activity (CPM)

400

200

Flag - + + ------F-HDAC1 - - - + + + - - - - - F-HDAC2 ------+ + + - - HDAC1 ------+ - HDAC2 ------+ competitor - - - - + - - + - - - TSA - - + - - + - - + - -

FIG. 12A. YY1 peptide deacetylation by HDACs. Endogenous HDAC1 and HDAC2 and over-expressed Flag-tagged HDAC1 and HDAC2 (F-HDAC1, F- HDAC2) were immunoprecipitated from HeLa cells. A YY1 (residues 170-200) peptide was labeled with [3H]acetate and 20,000 cpm of the labeled peptide was used in deacetylation reactions.

48 .

3000 PCAF acetylated YY1 (170-200) p300 acetylated YY1 (170-200) HDAC1 HDAC1(H199F) MW (kD) 97 68 2000 43

29 1 2 3 4 5 6 7 8

MW 1000 (kD)

97 histone deacetylase activity (cpm) 68

43

29 Flag F-HDAC1 F-HDAC1 1 2 3 4 5 6 7 8 H199F Coomassie

FIG. 12B. YY1 protein deacetylation by HDACs. Left panels: GST- YY1 (170-200) was in vitro acetylated by p300 or PCAF. Half of the acetylated GST-YY1 (170-200) was mixed with protein G beads alone and the other half was mixed with immunoprecipitated wild type or mutant (H199F) HDAC1. Samples were then separated by SDS-PAGE, and the gels were subsequently stained with Coomassie blue and exposed to film. Arrows indicate the position of GST-YY1 (170-200). Right panel: Transiently expressed wild type and H199F mutant HDAC1 were immunoprecipitated from HeLa cells and tested for their histone deacetylase activity against a H4 peptide.

To provide further evidence that HDACs deacetylated YY1, we used an F-

HDAC1 immunoprecipitate to deacetylate full-length GST-YY1 and GST-YY1 (170-

200), both of which were in vitro acetylated with PCAF. As expected, YY1 (170-

49 200) was efficiently deacetylated by HDAC1 (Fig. 12B, top panel, compare lane 1 to lane 2). As a control, YY1 (170-200) was not deacetylated by an HDAC1 mutant that was devoid of deacetylation activity ((24), Fig. 12B, right panel and top panel, lane

FIG. 12C. Deacetylation of YY1 (1-414) + + ------YY1 (170-200) - - + + - - - - YY1 serial deletion proteins by YY1 (261-333) - - - - + + - - YY1 (261-414) ------+ + HDAC1. Serial deletion HDAC1 + - + - + - + - MW (kD) 200 proteins of GST-YY1 were in 97 vitro acetylated by PCAF. Half 68 of the GST-YY1 proteins were 43 mixed with protein G beads and

29 the other half mixed with 1 2 3 4 5 6 7 8 HDAC1 immunoprecipitate.

MW (kD) Samples were then separated by 200 SDS-PAGE, and the gels were 97 68 subsequently stained with

43 Coomassie blue and exposed to film. Arrows indicate the 29 positions of GST-YY1 deletion 1 2 3 4 5 6 7 8 Coomassie proteins.

3). A Coomassie-stained gel (bottom panel) showed that the same amount of YY1

(170-200) was present in each reaction. Similarly, YY1 (170-200) acetylated by p300 was also deacetylated by HDAC1 (Fig. 12B, compare lane 5 to lane 6). To our surprise, and in contrast to YY1 (170-200), full-length YY1 was not appreciably deacetylated by HDAC1 (Fig. 12C, lane 1). This observation suggests that

50 deacetylases only target specific regions of YY1. In support, we also found that

HDAC1 did not deacetylate two additional PCAF-acetylated GST-YY1 proteins, YY1

(261-333) and YY1 (261-414) (Fig. 12C, lanes 5 and 7). We conclude that only . residues 170-200 of YY1, and not the C-terminal zinc finger region of YY1, can be deacetylated by HDAC1. MW (kD) Flag ∆ 170-20055-414170-414261-414333-4141-414 261-333 97 1-414 ∆ 170-20055-4141-396 1-333 1-261 1-200 1-170 HDAC1 68 α-HDAC2 HDAC2 α-HDAC3 HDAC3 IgH 1 2 3 4 5 6 7 8 43

9 10 11 12 13 14 15 16

Flag - 1-170 - 1-200 + 1-261 + 1-333 + 1-396 + ∆170-200 + 56-414 + 170-414 + 261-333 + 261-414 + 333-414 - 1-414 +

HDAC-binding domains 170 200 261 333

FIG. 13. Mapping of the HDAC-interaction domains of YY1. Serial Flag-tagged YY1 deletion constructs were transfected into HeLa cells, immunoprecipitated with anti-Flag antibody, and analyzed by western blotting for the presence of HDAC1, HDAC2, and HDAC3 (lanes 1-8) or HDAC2 and HDAC3 only (lanes 9-16). The bottom panel summarizes the HDAC-binding domains of YY1. "+" indicates positive interactions between YY1 and HDACs; "-" denotes the absence of YY1-HDAC interactions.

51 HDACs bind YY1 at multiple regions. Based on our previous result that

YY1 interacts with HDACs at residues 170-200 in vitro (171), the inability of

. HDAC1 to deacetylate the C-terminal zinc finger region of YY1 may arise from a

general failure of HDACs to interact with YY1 in the zinc finger region. To test this

possibility, we performed co-immunoprecipitation analyses to map the interaction

domain of YY1 with HDACs in vivo (Fig. 13). Surprisingly, our results showed that

in addition to residues 170-200, YY1 also interacted with HDACs at residues 261-333

in vivo. These results, together with those of our previous in vitro acetylation-

deacetylation experiment, suggest that YY1 interacts with HDACs at two domains:

residues 170-200, where bound HDACs deacetylate YY1, and the C-terminal residues

261-333, where bound HDACs do not result in deacetylation of YY1.

YY1 contains associated histone deacetylase activity, which localizes to C-

terminal residues 261-333 of YY1. After we precisely mapped the HDAC-binding

800 FIG. 14A. Histone deacetylase activity of endogenous YY1 in HeLa

600 cells. Endogenous YY1 was immunoprecipitated from HeLa cells and assayed for deacetylase activity 400 against the H4 peptide. "+ TSA" indicates addition of TSA to 400 nM

histone deacetylase 200 prior to addition of the peptide activity (cpm) substrate.

α-YY1 - + + TSA - - + 52 domains in YY1, we sought to determine the functional effect of this interaction. We

found that immunoprecipitated endogenous YY1 from HeLa cells also contained

histone deacetylase activity, which was inhibited by TSA (Fig. 14A). Using serial F-

YY1 deletions, we determined the histone deacetylase activity domain of YY1, which

localized to residues 261-333 (Figs. 14B and 14C). This region of YY1 was

. necessary and sufficient for the histone deacetylase activity associated with YY1

(Figs. 14B and 14C). Most strikingly, the YY1 histone deacetylase activity

B C

histone deacetylase activity (cpm) 200 400 600 800 1000 1200 1400 vector YY1(1-414) 1-122 1-170 2000 1-200 1-261

1-333 1-396 1000 56-414 ∆ histone deacetylase 170-200 activity (cpm) ∆ 261-333

261-333 Flag + + ------333-414 Flag-YY1 (1-414) - - + + + - - - Flag-YY1 (261-333) - - - - - + + + 261-414 TSA - + - - + - - + 170-414 competitor - - - + - - + -

histone deacetylase activity domain 261 333 HDAC-binding domains 170 200 261 333

FIG. 14B, C. Identification of amino acid 261-333 as the histone deacetylase

activity domain of YY1. Flag-tagged YY1 deletion constructs were transfected

into HeLa cells, immunoprecipitated with anti-Flag antibody, and assayed for

deacetylase activity against the H4 peptide. "+ TSA" indicates addition of TSA

to 400 nM prior to addition of the peptide substrate. "+ competitor" indicates

addition of excess Flag peptides prior to addition of the peptide substrate.

domain completely overlapped with one of the HDAC-interacting domains of YY1.

Furthermore, the histone deacetylase activity associated with YY1 residues 261-333

53 was highly specific, because the activity was sensitive to TSA (Fig. 14B) and competed by excess Flag peptide (Fig. 14B). A representative western blot shows that different F-YY1 deletion mutants expressed equally well (Fig. 14D). These results strongly suggest that stable interaction between HDACs and YY1 contributes to YY1’s histone deacetylase activity. Immunofluorescence analysis confirmed that

F-YY1 deletion proteins that did not exhibit histone deacetylase activity localized to

FIG. 14D. Expression of F-YY1 deletion mutants. Overexpressed F-YY1 deletion MW (kD) Flag 1-122 1-1701-200 1-261 1-333 1-396 constructs and Flag alone from the 68 parental vector were immunoprecipitated

43 from HeLa cells using anti-Flag antibody, separated by SDS-PAGE, and

29 analyzed by western blotting using anti- Flag antibody. Arrows indicate the positions of F-YY1 deletion proteins.

either the nucleus or both the nucleus and cytoplasm, ruling out the possibility that the lack of histone deacetylase activity was due to abnormal localization of the mutants

(Fig 14E).

Acetylation of YY1 at the C-terminal zinc finger domain decreases the

DNA-binding activity of YY1 . Because the C-terminal acetylation domain (residues

261-333) of YY1 overlaps with the zinc finger DNA-binding domain (residues 261-

414) of YY1, we tested whether acetylation of YY1 at the zinc finger domain would affect the DNA binding activity of YY1 . Indeed, when in vitro acetylated by PCAF,

GST-YY1 bound less avidly than did unacetylated GST-YY1 to the Inr element of the 54 FIG. 14E. Sub-cellular localization of F-YY1 deletion F-YY1 FITC DAPI merge constructs. Various F-YY1

(1-122) deletion constructs were transiently transfected into HeLa cells. Transfected HeLa (1-170) cells were then fixed and probed with anti-Flag FITC (1-200) conjugate antibody. The nuclei were stained with DAPI.

(1-261) Images were obtained from a fluorescence microscope. Merged images from FITC and (1-414) DAPI stains indicate sub- cellular localization of F-YY1 deletion constructs.

AAV P5 promoter, which contains a consensus YY1 binding site (Fig. 15A, compare lane 7 to lane 8). Similar results were obtained when a GST-YY1 deletion construct that contained only the zinc finger domain of YY1 was tested for its DNA binding properties (Fig. 15A, compare lane 5 to lane 6). In contrast, and consistent with earlier reports, acetylated GST-p53 bound to its recognition sequence better than unacetylated GST-p53 (Fig. 15A, compare lane 3 to lane 2). Thus, the decrease in

DNA binding activity caused by acetylation is specific to YY1. To rule out the

55 .

possibility that this decrease in DNA binding activity was associated with the GST

fusion constructs, we tested non-tagged YY1 purified from E. coli, as well as Flag-

tagged YY1 purified from HeLa cells. Both forms of YY1 exhibited decreased DNA

binding activity upon acetylation (Fig. 15B), proving that the DNA-binding activity of

YY1 decreases when the zinc finger domain of YY1 is acetylated.

B E. coli HeLa A YY1 Flag-YY1 acetylated + - + -

YY1 probeacetylatedmock alone YY1 acetylated (261-414)mock YY1 acetylated (1-414)(261-414) YY1 (1-414) p53 probemock alone acetylated p53

free probe free probe 1 2 3 4 5 6 7 8 1 2 3 4

FIG. 15A, B. The effect of acetylation on YY1’s sequence-specific DNA- binding activity. Representative EMSAs of GST-tagged YY1, bacterially expressed non-tagged YY1 and HeLa cell-expressed Flag-tagged YY1.. Purified proteins were in vitro acetylated or mock acetylated with PCAF and mixed with 32P-labeled probes containing either a YY1 or p53 binding sequence. Protein-DNA complexes were resolved on non-denaturing polyacrylamide gels. Black arrows indicate the positions of full-length YY1- and p53-DNA complexes. The empty arrow indicates the position of the complex between DNA and the zinc finger domain of YY1.

56 YY1 exists in a high molecular weight protein complex. To determine if

YY1 exists in a protein complex in the cell, gel filtration chromatography was employed. Nuclear extract from HeLa cells was applied to a Superdex 200 column.

Proteins were fractionated and differentially eluted according to their molecular weights, and the presence of YY1 was demonstrated by western blot analysis. Figure

16 shows that YY1, which normally runs at about 68 kD on SDS-polyacrylamide gels, eluted at about 150 kD, suggesting that YY1 associated with other proteins in

HeLa nuclear extract. YY1 could also be detected in earlier fractions (Fig. 16, fractions 1 and 3); however, because those fractions were outside the fractionation range of this column, the precise molecular weight of the higher molecular weight

YY1 complex could not be determined.

200kD 150kD 66kD 29kD 12.4kD

kD M Input 1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 fractions 97

68 YY1

43

FIG. 16. Gel filtration analysis of YY1 in HeLa cells. HeLa nuclear extract was fractionated on a Superdex 200 column. Eluted fractions were analyzed for the presence of YY1 by western blot analysis. Calibrated molecular weights are indicated above the fraction numbers.

Purification of native YY1 complexes. To purify a YY1 complex active in transcription from HeLa nuclear extract, anion exchange chromatography was chosen

57 .

A

kD M W 11 12 13 14 17 18 19 20 21 23 fractions Input 200 97 68 43

29

18 B

kD M W 11 12 13 14 17 18 19 20 21 23 25 27 fractions Input 200

. 97 68 YY1 43

FIG. 17. Purification of a native YY1 complex from HeLa cells using anion exchange chromatography and IMAC. (A) A Coomassie-stained SDS-polyacrylamide gel of the Q Sepharose fractions. (B) Western blot analysis of the Q Sepharose fractions. An arrow indicates the position of YY1.

as the initial purification step. The DNA-binding activity of the YY1 complex was

monitored using EMSA, and the histone deacetylase activity associated with YY1 was

determined using histone deacetylation assay against a labeled H4 peptide. Figures

17A and 17B show that YY1 was eluted from a Q Sepharose column at 200 mM to

58 C

Input 11 12 13 14 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 fractions

free probe

D

1500

1000

500 histone deacetyalse activity (cpm) 0 Input 11 12 13 14 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 fractions

FIG. 17. Purification of a native YY1 complex from HeLa cells using anion exchange chromatography and IMAC. (C) EMSA of the Q Sepharose fractions using the AAV P5+1 YY1 binding sequence as a probe. (D) Histone deacetylation assay of the Q Sepharose fractions. Fractions from the Q Sepharose column were assayed for histone deacetylase activity against the H4 peptide.

500 mM of salt concentrations. Fractions containing YY1 also exhibited strong DNA binding activity (Fig. 17C) and histone deacetylase activity (Fig. 17D). Q Sepharose

59 E

FT Wash 300mM kD M input 1 2 3 1 2 1 2 3 4 5 6 7 8 9 10 fractions

68 YY1

43

F 300mM

1 2 3 4 5 6 7 8 9 10 fractions

free probe

FIG. 17. Purification of a native YY1 complex from HeLa cells using anion exchange chromatography and IMAC. (E) Western blot analysis of the Ni2+ column fractions. An arrow indicates the position of YY1. FT, flowthrough fractions; Wash, wash fractions; 300 mM, 300 mM imidazole-eluted fractions. (F) EMSA of the 300 mM imidazole-eluted fractions using the AAV P5+1 YY1 binding sequence as a probe.

60 fractions 13 to 17 were pooled and further fractionated using a Ni2+ column. YY1 contains a stretch of histidines at the N-terminus, which potentially serve as binding moieties to the Ni2+ column. Bound YY1 and the YY1-associated proteins were

G

kD M 300 mM

200 *

FIG. 17. Purification of a native YY1 97 * complex from HeLa cells using anion exchange chromatography and IMAC. 68 * YY1 (G) Silver-staining analysis of the second fraction from the 300 mM imidazole-eluted fractions. A black 43 * arrow indicates the YY1 protein band. Empty arrows with stars indicate the positions of protein bands that are present in YY1 complexes purified by

29 other methods presented in this dissertation.

18

eluted with 300 mM imidazole. Figure 17E and 17F show that the eluted fractions containing YY1 were still active in sequence-specific DNA-binding; however, they did not contain significant histone deacetylase activity (data not shown). Several

61 protein bands from fraction 2 of the 300 mM imidazole fractions were stained with silver, suggesting that those proteins associate with YY1 after both anion exchange and immobilized metal affinity chromatography steps.

A

kD M 2 4 6 8 10 1214 16 1820 22 24 26 2830 fractions Input 200

97

68

43

29

18

B

kD M W 2 4 6 8 10 12 14 16 18 20 22 24 26 fractions Input 200 97 68 YY1 43

FIG. 18. Purification of a native YY1 complex from HeLa cells using anion exchange chromatography and antibody-affinity chromatography. (A) A Coomassie-stained SDS-polyacrylamide gel of the Q Sepharose fractions. (B) Western blot analysis of the Q Sepharose fractions. An arrow indicates the position of YY1.

Because the final fractions from the Ni2+ column lost their histone deacetylase activity, a different purification scheme was employed to purify a YY1 complex

62 C

Input 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 fractions

free probe

D 3000

2000

1000

histone deacetylase activity (cpm) 0 Input 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 fractions

FIG. 18. Purification of a native YY1 complex from HeLa cells using anion exchange chromatography and antibody-affinity chromatography. (C) EMSA of the Q Sepharose fractions using the AAV P5+1 YY1 binding sequence as a probe. (D) Histone deacetylation assay of the Q Sepharose fractions. Fractions from the Q Sepharose column were assayed for histone deacetylase activity against the H4 peptide.

63 retaining histone deacetylase activity. HeLa nuclear extract was first fractionated on the Q Sepharose column as described above, and fractions containing YY1 (Fig. 18A and 18B, fractions 8 to 18) were pooled. These fractions still possessed sequence- specific DNA-binding activity and histone deacetylase activity (Fig. 18C and 18D).

E FIG. 18. Purification of a native YY1 kD protein H-10G complex from HeLa cells using anion * 200 exchange chromatography and antibody-

97 affinity chromatography. (E) Silver-staining * analysis of fractions from the anti-YY1 H- 68 * YY1 10 column (lane 2) and the protein G control

column (lane 1). A black arrow indicates 43 * the position of the YY1 protein band.

Empty arrows show the presence of multiple

protein bands that exist in the fractions from

29 the H-10 column but not in those from the protein G column. Stars indicate the

positions of protein bands that are present in

18 YY1 complexes purified by other methods

1 2 presented in this dissertation.

Pooled Q Sepharose fractions were passed through a protein G column and the flowthrough fraction re-loaded on an antibody affinity column containing protein G resin coupled to the H-10 mAb against YY1. Bound protein complexes were eluted

64 from both columns with acidic glycine. The protein components of the eluted YY1 complex were compared to those from the protein G column (Fig. 18E). The YY1 complex from the H-10 column still retained histone deacetylase activity (Fig. 18F).

F

6000

5000

4000

3000

2000 histone deacetyalse activity (cpm)

1000

Protein G H-10

FIG. 18. Purification of a native YY1 complex from HeLa cells using anion

exchange chromatography and antibody-affinity chromatography. (F)

Histone deacetylation assay from the protein G control column (protein G)

and the anti-YY1 H-10 column (H-10) against the H4 peptide.

Purification of a Flag-tagged YY1 complex. To purify a YY1 complex using a different method, Flag-tagged YY1 (F-YY1) was over-expressed in HeLa

65 kD Flag F-YY1 * 200 FIG. 19A. Silver-staining analysis of the second fractions from the Flag-alone (lane 1) column and the F-YY1 column (lane 2).

97 Black arrows indicate the positions of the * full-length F-YY1 (F-YY1) and a degradation product of F-YY1 (F-YY1’). 68 * F-YY1 Empty arrows show the presence of multiple protein bands that exist in the fractions from the F-YY1 column but not 43 * in those from the Flag alone column. Stars F-YY1' indicate the positions of protein bands that are present in YY1 complexes purified by other methods presented in this dissertation. 29

1 2

cells, and the proteins associated with F-YY1 were purified from whole cell lysates on an antibody column against the Flag epitope. As a control, empty Flag vector was transiently transfected into HeLa cells and the whole cell lysate purified on an anti-

Flag column. The protein components of the F-YY1 complex and the proteins eluted from the Flag alone control were compared on silver-stained SDS-polyacrylamide gels (Fig. 19A). Protein bands that are present in the F-YY1 lane but not in the Flag lane represent proteins specifically associate with YY1, including the over-expressed

F-YY1 as well as a degradation product of F-YY1, F-YY1’. Fractions from the F-

66 YY1 column contained significant histone deacetylase activity after concentration

. through ultrafiltration (Fig. 19B).

500

400 FIG. 19B. Histone deacetylation

300 analysis of the second fractions from the Flag alone column and the 200 F-YY1 column against the H4 peptide.

histone deacetyalse activity (cpm) 100

Flag F-YY1

Proteins specifically associate with F-YY1 were also visualized by

radioimmunoprecipitation analysis (RIPA) (Fig. 20A). HeLa cells were transiently

transfected with F-YY1 or Flag alone and the proteins within the cells metabolically

labeled with 35S-containing amino acids. Proteins were subsequently

immunoprecipitated from cell lysates with anti-Flag beads. Several protein bands

specific to F-YY1 were visible upon comparison to the Flag control. RIPA was also

used as a tool to analyze patterns of protein association specific to different regions of

YY1. Amino acid residues 261-333 were shown to be involved in YY1-associated

histone deacetylase activity. Therefore, F-YY1 (261-333) and F-YY1 (∆261-333)

were transiently transfected into HeLa cells and subjected to RIPA. However, despite

numerous attempts, comparisons among immunoprecipitated proteins from Flag, F-

67 YY1, F-YY1 (261-333), and F-YY1 (∆261-333) failed to suggest proteins that were specifically associated with constructs that had been shown to contain associated histone deacetylase activity [F-YY1 and F-YY1 (261-333)] (Fig. 20B).

kD Flag F-YY1 * Fig. 20A. A representative autoradiograph 200 showing proteins bound to Flag alone or F- YY1. Black arrows indicate the positions of the full-length F-YY1 (F-YY1) and a 97 * degradation product of F-YY1 (F-YY1’).

68 * Empty arrows show the presence of multiple F-YY1 protein bands that were present in the F- YY1 immunoprecipitate (lane 2) but not in the Flag alone immunoprecipitate (lane 1). 43 * F-YY1' Stars indicate the positions of protein bands that are present in YY1 complexes purified by other methods presented in this dissertation. 29 1 2

68 .

261-333)∆ kD Flag F-YY1 F-YY1F-YY1 ( ( 261-333)

200

97

68

F-YY1

F-YY1 (∆ 261-333) 43

F-YY1'

29

FIG. 20B. A representative autoradiograph showing proteins bound to different F-YY1 deletion mutants. Black arrows indicate the positions of the full-length F- YY1 (F-YY1), a degradation product of F-YY1 (F- YY1’), and one of the F-YY1 deletion mutants [F-YY1 (∆261-333)].

69 DISCUSSION

In this dissertation, the isolation and characterization of a genomic clone of human YY1 is presented. Deletional analysis reveal that the human YY1 promoter possesses many characteristics typical of housekeeping genes. For example, the YY1 gene does not contain a TATA box, and the elements critical for basal transcription reside within a small region around the transcriptional start site. One unusual observation is that plasmid p+54Luc, which contains sequences downstream of the transcriptional initiation site, still possesses significant activity compared to the wild- type YY1 promoter. Only one transcriptional start site of the human YY1 gene has been detected by primer extension, and no other start sites were found around or downstream of position +54. It is possible that minor transcription initiation sites exist downstream of the mapped +1 site, but they are too weak to be detected by primer extension analysis. It is also possible that the YY1 gene contains alternative start sites that are utilized only when the natural start site is not present.

A notable feature of the human YY1 promoter is its similarity to the mouse

YY1 promoter (135). The proximal promoter region between positions -741 and

+476 in the human gene and that between positions -751 and +434 in the mouse gene share a remarkable 70% identity. The human YY1 promoter is quite active with a small sequence of position -277 to position +475. Similarly, the mouse YY1 promoter only requires a region as short as from position -58 to position +32 for activity. Moreover, many transcription factor binding sites that are present in the 70 human YY1 promoter are also present in the mouse promoter. An Sp1 binding site plays an important role in the expression of the mouse YY1 gene (135), and three Sp1 sites are found within the region critical for the activity of the human YY1 promoter.

These observations suggest that the human and the mouse YY1 promoter are controlled by a similar regulatory mechanism.

The adenovirus E1A protein can convert YY1 from a repressor to an activator.

Many studies have been devoted to the mechanistic details of this interesting phenomenon. It was elegantly demonstrated that physical interactions among E1A,

YY1, and p300 are critical in this conversion from repression to activation (95). Our study shows here that E1A down-regulates the YY1 promoter and that a minimal

YY1 promoter is sufficient for E1A-mediated repression. These findings suggest an alternate, albeit non-mutually exclusive, model of how the transcriptional activity of

YY1 is affected by E1A. Under physiological concentrations of YY1, YY1 represses transcription in certain cell types. However, the presence of the E1A protein decreases the expression level of YY1, which results in activation of genes normally repressed by YY1. In this model, the activity of YY1 is similar to that of the

Drosophila Krüpple transcription factor, which activates or represses target genes depending on its cellular concentrations (138). It will be interesting to study if the expression of YY1 could be regulated by other viral and cellular transcription factors.

At the polypeptide level, the activity of the multifunctional transcription factor

YY1 is shown to be regulated by acetylation and deacetylation. Acetylation and deacetylation of YY1 represents a novel and complex means of regulating the activity of a DNA-binding transcription factor (Fig. 21). YY1 is acetylated in two regions:

71 one at the previously identified HDAC-interacting domain of residues 170-200, and the other at the C-terminal DNA-binding zinc finger domain. Residues 170-200 of

YY1 are acetylated by p300 and PCAF, while the C-terminal zinc finger domain is acetylated only by PCAF (Fig. 21). Acetylation of these two regions results in

transcriptional transcriptional transcriptional activation repression repression domain domain domain histones

HDAC

? HDAC

Acidic His Acidic GA GK Spacer Zn Fingers

54 80 154 170 200 295 414

DNA-binding domain in vitro HDAC-binding domain 170 200 in vivo HDAC-binding domains 170 200 261 333 histone deacetylase activity domain 261 333 p300 acetylated domain 170 200 PCAF acetylated domains 170 200 261 398 in vivo acetylated domains 170 200 261 414 deacetylated domain 170 200

FIG. 21. Summary of regulation of YY1 by acetylation and deacetylation. YY1 is acetylated in two regions: residues 170-200 and the C-terminal DNA-binding domain. Acetylation of residues 170-200 targets YY1 for deacetylation. Acetylation of the C-terminus of YY1 results in stable association of histone deacetylase activity with YY1 as well as decreased DNA-binding activity. The in vivo association between YY1 and HDACs at the C-terminal region is probably mediated through an unidentified protein (depicted as a question mark in an oblong circle).

72 dramatically different outcomes: First, when residues 170-200 of YY1 are acetylated,

YY1 becomes a more effective transcriptional repressor and binds HDACs more efficiently. However, upon binding to acetylated YY1 residues 170-200, HDACs also actively deacetylate this region, possibly resulting in a negative feedback loop.

Second, YY1 possesses histone deacetylase activity toward histone H4 by associating with HDACs using the C-terminal zinc finger region. This is most likely a result of active targeting of acetylated YY1 zinc finger domains by HDACs. However, our data do not indicate that association of the YY1 C-terminus with HDACs brings about deacetylation of YY1 in this region. In contrast, the interaction between YY1 and

HDACs at residue 170-200 is likely to be a dynamic and highly regulated process and does not result in associated histone deacetylase activity stable enough to be detected in our experimental system. Finally, acetylation of YY1 zinc fingers decreases YY1’s

DNA-binding activity, which will have further impact on YY1’s activity as a transcription factor.

This differential regulation of YY1 by acetylation and deacetylation suggests a complex regulatory system unlike that of any other transcription factors known to date. In cells where YY1 functions primarily as a transcriptional repressor, acetylation of YY1 at the central HDAC-binding region and the C-terminal DNA- binding region most likely will result in an intricate network of negative-feedback regulation: Acetylation of YY1 at residues 170-200 augments YY1’s repressor activity, but acetylation of this region also targets YY1 for deacetylation. In the mean time, acetylation of the C-terminal DNA-binding region of YY1 most likely stabilizes interaction between YY1 and HDACs, but acetylation of this region in turn decreases

73 YY1’s DNA binding activity. To date, we have not been able to determine the relative levels of acetylation between the central region and the C-terminus of YY1 under physiological conditions; therefore, the relative contribution of acetylating these two regions is unknown. Interestingly, we also found that TSA had little effect on the acetylation status of YY1 (data not shown), suggesting that regulation of YY1 by acetylation is more prominent than by deacetylation. This finding is also in agreement with our discovery that deacetylation of YY1 only occurs at residues 170-

200, while acetylation of YY1 can happen at the C-terminal DNA-binding domain as well.

In many experimental systems, YY1 can also activate transcription, and it is still uncertain how this is accomplished. Different models, including bending of

DNA, the relative distance between the YY1 binding site and the transcriptional initiation site, as well as protein-protein interactions have been proposed (reviewed in references 143, 154). Increasingly more evidence shows that interactions with other proteins are probably the most important factors in YY1-mediated transcriptional activation. It has been suggested that interactions of YY1 with other cellular proteins or viral proteins can either disrupt the quenching activity of YY1 on other transcriptional activators or stimulate transcription with associated enzymatic activities such as HATs (95, 144, 154). Our findings here provide an additional speculation that on promoters activated by YY1, YY1-associated p300 and PCAF can activate transcription by both acetylating core histones and acetylating YY1 at the C- terminal zinc finger domain (PCAF only), which in turn decreases the overall histone deacetylation activity at the promoter.

74 In addition to histones and several non-histone chromatin proteins, many transcription factors have been shown to be regulated by acetylation. These transcription factors include p53 (54), HIV Tat (84), E1A (176), GATA-1 (15, 73),

EKLF (177), MyoD ((131, 137), E2F (110), TFIIE, TFIIF (75), CIITA (149), TCF

(167), HNF-4 (147), UBF (128), TAL1/SCL (71), and nuclear receptor co-activators

ACTR, SRC-1, and TIF2 (29). Many of these factors are acetylated by both p300/CBP and PCAF; therefore, it is not surprising that YY1 is also acetylated by both p300 and PCAF. The p300-interaction domain of YY1 has been mapped to the

C-terminal 17 residues (95, 97), which were not acetylated by p300 in our study. This finding is reminiscent of acetylation of p53 by p300/CBP, where the N-terminus of p53 interacts with CBP (55, 102) while the region acetylated by p300 is at the C- terminus of p53 (54). Moreover, the arrangement of the 6 lysines within the p300- acetylation domain of YY1 closely resembles the sequence of the p300-acetylated region of histone H2B (150), indicating that YY1 contains an authentic p300- acetylation domain. Interestingly, the PCAF-interacting domain of p300 overlaps with its YY1-interacting domain (5, 173), which suggests that acetylation of YY1 by

PCAF versus by p300 might be either cooperative or mutually exclusive in vivo, depending on whether or not YY1 binding to p300 can be competed by PCAF.

Furthermore, in our in vitro acetylation studies, full-length GST-YY1 was acetylated by PCAF and not by p300, which further suggests that the conformation of YY1, perhaps affected by selective interaction with p300 and PCAF, is important to YY1 acetylation. We also found that in HeLa cells, overexpression of PCAF, but not p300, partially alleviated the transcriptional repressor activity of a Gal4 DNA-binding

75 domain-YY1 fusion protein. However, in NIH3T3 cells, overexpression of p300, but not PCAF, relieved repression from Gal4-YY1 (data not shown). In this regard, it will be important to identify the in vivo triggers directing PCAF versus p300 acetylation. p53 is particularly interesting among acetylated transcription factors because it has been elegantly demonstrated that DNA damage (UV and ionizing radiation) causes p53 acetylation at two distinct lysines, one by p300 and the other by

PCAF (103). To date, this is the only report linking specific environmental cues to acetylation of transcription factors by HATs, and yet it is still uncertain why acetylation would require two HATs. It is interesting to note that while an increase in

DNA-binding activity has been observed for most acetylated DNA-binding transcription factors, HMG I(Y) binds DNA less when it is acetylated (117). The most striking observation is that only when HMG I(Y) is acetylated by CBP, not by

PCAF, is there a decrease in its DNA-binding activity (117). This phenomenon is reminiscent of YY1 acetylation in its zinc finger domain by PCAF but not by p300, and the consequent reduction in the DNA-binding activity of YY1.

We were also interested in finding out if acetylation of YY1 also contributes to cellular events other than transcriptional control. So far, we have no evidence to suggest that acetylation changes the sub-cellular localization of YY1 (data not shown). YY1 has been shown to be a rather stable protein expressed at comparable levels in both growing and differentiating cells (5). Interestingly, acetylation affects the conformation of HNF-4 (147), the half-live of E2F (110), and promotes protein- protein interactions between Rch1 and importin-β (9). Therefore, it will be informative to test whether acetylation of YY1 may have similar consequences.

76 Recently it was demonstrated that YY1 null mutations resulted in peri- implantation lethality in mice (38). In Drosophila, lack of a maternally derived YY1 homolog results in severe defects in pattern formation (16, 45). This Drosophila homolog of YY1 was identified as PHO, which is encoded by pleiohomeotic, a member of the Polycomb group (PcG) genes (18). PcG genes encode proteins necessary for maintaining the repression state of homeotic genes in Drosophila, which is absolutely essential for patterning (127, 146, 152). It has been proposed that the

Drosophila YY1 homolog, PHO, binds to PcG response elements and interacts with other proteins to form a repressor complex (18). A Drosophila protein, dMi-2, has been found to participate in PcG-mediated repression (82). dMi-2 shares high sequence homology to the human autoantigen Mi-2. Xenopus Mi-2 homolog was recently shown to be a subunit of a histone deacetylase complex with nucleosome remodeling activity (164, 165). Incidentally, repression mediated by PcG proteins resembles that of mating-type silencing in yeast and position-effect variegation in

Drosophila, both of which contain transcriptionally silent chromatin structures (112).

Therefore, it is possible that dMi-2 also forms a complex containing histone deacetylase activity and nucleosome remodeling activity, and the interaction between dMi-2 and PcG proteins like PHO is important in proper expression of homeotic genes. Our study showing stable interactions between HDACs and YY1 also suggests that association with chromatin-modifying activities is central to the functions of

YY1. YY1, PHO, and the Xenopus YY1 homolog FIII are almost completely identical in the zinc finger region in amino acid sequence, reinforcing the role of YY1 as a DNA-targeting factor in nucleating a repressor complex capable of modulating

77 chromatin structures. Our data demonstrating that YY1 interacts with HDACs at two different regions open the possibility that these two HDAC-interacting regions might have distinct effects on YY1's role in transcriptional control. Perhaps the stable association of YY1 with HDACs at the C-terminal zinc finger region represents an ancient mode of the functions of YY1, which is to form a repressor complex associated with the promoter. However, regulation of the affinity of the central region of YY1 for HDACs by acetylation might have evolved as a more sophisticated means of control, which defines a novel functional consequence of non-histone factor acetylation.

In this dissertation, four different methods of purifying the YY1 complex are presented: anion exchange chromatography followed by IMAC, anion exchange chromatography followed by antibody-affinity chromatography, antibody-affinity chromatography directly against a Flag-epitope, and RIPA. Upon comparison of the

YY1 complexes purified with different methods, it became apparent that four protein bands exist in YY1 complexes purified by all four methods. These proteins most likely represent genuine YY1-associated proteins.

Among the four candidate YY1 complex constituents, only one appears to have a molecular weight higher than 200 kD. Gel filtration analysis of HeLa nuclear extract suggests that YY1 exists in potentially two protein complexes, one with a very high molecular weight, and the other one with a molecular weight of 150 kD. This high molecular weight YY1-associated protein very likely represents a component of the higher molecular weight YY1 complex. Other YY1-associated proteins with molecular weights lower than 97 kD may or may not exist exclusively in the 150 kD

78 YY1 complex. Because the apparent molecular weight of YY1 on SDS- polyacrylamide gels is different from the predicted molecular weight of YY1 based on amino acid composition, it is difficult to estimate the stoichiometric composition of the YY1 complex(s).

IMAC using Ni2+ resin following anion exchange chromatography may not be an ideal method to purify a YY1 complex. First, this method intrinsically lacks a proper control. As a result, without comparison to the YY1 complexes purified by other methods, it would have been extremely difficult, if not impossible, to identify true YY1-associated protein. Second, the amounts of proteins bound to the Ni2+ column, except for YY1 itself, appear to be quite low. This might account for the lack of histone deacetylase activity from the eluate of this column. However, it is not to exclude the possible application of Ni2+ resin in purifying other protein complexes.

Because the Flag epitope of the F-YY1 construct provides a strong epitope for the anti-Flag beads, and the YY1 part of the F-YY1 construct is free to interact with other proteins, purification of the F-YY1 complex might be the best method to purify a YY1 complex based on its ease and true representation of the protein-protein interactions. This method can be easily scaled up to facilitate large quantity purification and subsequent micro-sequencing using a recombinant adenovirus expressing F-YY1. Similarly, a recombinant adenovirus expressing F-YY1 (261-333) can be made to infect HeLa cells and to purify a protein complex specifically associated with residue 261-333 of YY1. This will provide valuable information about the critical protein components involved in the histone deacetylase activity associated with YY1.

79 REFERENCES

1. Adrian, G. S., E. Seto, K. S. Fischbach, E. V. Rivera, E. K. Adrian, D. C.

Herbert, C. A. Walter, F. J. Weaker, and B. H. Bowman. 1996. YY1 and

Sp1 transcription factors bind the human transferrin gene in an age-related

manner. J. Geront. 51A:B66-B75.

2. Ahringer, J. 2000. NuRD and SIN3 histone deacetylase complexes in

development. Trends Genet. 16:351-356.

3. Alland, L., R. Muhle, H. Hou, J. Potes, L. Chin, N. Schreiber-Agus, and

R. A. DePinho. 1997. Role for N-CoR and histone deacetylase in Sin3-

mediated transcriptional repression. Nature 387:49-55.

4. Allfrey, V. G., R. M. Faulkner, and A. E. Mirsky. 1964. Acetylation and

methylation of histones and their possible role in the regulation of RNA

synthesis. Proc. Natl. Acad. Sci. USA 51:786-794.

5. Austen, M., B. Luscher, and F. J. Luscher. 1997. Characterization of the

transcriptional regulator YY1. The bipartite transactivation domain is

independent of interaction with the TATA box-binding protein, transcription

factor IIB, TAFII55, or cAMP-responsive element-binding protein (CPB)-

binding protein. J. Biol. Chem. 272:1709-1917.

6. Ausubel, F. M. 1994. Current protocols in molecular biology. John Wiley &

Sons, New York.

80 7. Bagchi, S., P. Raychaudhuri, and J. R. Nevins. 1990. Adenovirus E1A

proteins can dissociate heteromeric complexes involving the E2F transcription

factor: a novel mechanism for E1A trans-activation. Cell 62:659-669.

8. Bannister, A. J., and T. Kouzarides. 1996. The CBP co-activator is a histone

acetyltransferase. Nature 384:641-643.

9. Bannister, A. J., E. A. Miska, D. Gorlich, and T. Kouzarides. 2000.

Acetylation of importin-alpha nuclear import factors by CBP/p300. Curr. Biol.

10:467-470.

10. Basu, A., K. Park, M. L. Atchison, R. S. Carter, and N. G. Avadhani.

1993. Identification of a transcriptional initiator element in the cytochrome c

oxidase subunit Vb promoter which binds to transcription factors NF- E1

(YY-1, delta) and Sp1. J. Biol. Chem. 268:4188-4196.

11. Bauknecht, T., R. H. See, and Y. Shi. 1996. A novel C/EBP beta-YY1

complex controls the cell-type-specific activity of the human papillomavirus

type 18 upstream regulatory region. J. Virol. 70:7695-7705.

12. Benezra, R., R. L. Davis, D. Lockshon, D. L. Turner, and H. Weintraub.

1990. The protein Id: a negative regulator of helix-loop-helix DNA binding

proteins. Cell 61:49-59.

13. Bjorklund, S., G. Almouzni, I. Davidson, K. P. Nightingale, and K. Weiss.

1999. Global transcription regulators of eukaryotes. Cell 96:759-767.

14. Bjorklund, S., and Y. J. Kim. 1996. Mediator of transcriptional regulation.

Trends Biochem. Sci. 21:335-337.

81 15. Boyes, J., P. Byfield, Y. Nakatani, and V. Ogryzko. 1998. Regulation of

activity of the transcription factor GATA-1 by acetylation. Nature 396:594-

598.

16. Breen, T. R., and I. M. Duncan. 1986. Maternal expression of genes that

regulate the bithorax complex of Drosophila melanogaster. Dev. Biol.

118:442-456.

17. Brenner, S., F. Jacob, and M. Meselson. 1961. An unsable intermediate

carrying informatin from genes to ribosomes for protein synthesis. Nature

190:576-581.

18. Brown, J. L., D. Mucci, M. Whiteley, M. L. Dirksen, and J. A. Kassis.

1998. The Drosophila Polycomb group gene pleiohomeotic encodes a DNA

binding protein with homology to the transcription factor YY1. Mol. Cell

1:1057-1064.

19. Brownell, J. E., J. Zhou, T. Ranalli, R. Kobayashi, D. G. Edmondson, S.

Y. Roth, and C. D. Allis. 1996. Tetrahymena histone acetyltransferase A: a

homolog to yeast Gcn5p linking histone acetylation to gene activation. Cell

84:843-851.

20. Buratowski, S. 1994. The basics of basal transcription by RNA polymerase II.

Cell 77:1-3.

21. Burgess, S. M., M. Ajimura, and N. Kleckner. 1999. GCN5-dependent

histone H3 acetylation and RPD3-dependent histone H4 deacetylation have

distinct, opposing effects on IME2 transcription, during meiosis and during

82 vegetative growth, in budding yeast. Proc. Natl. Acad. Sci. USA 96:6835-

6840.

22. Burns, L. G., and C. L. Peterson. 1997. Protein complexes for remodeling

chromatin. Biochim. Biophys. Acta 1350:159-168.

23. Bushmeyer, S., K. Park, and M. L. Atchison. 1995. Characterization of

functional domains within the multifunctional transcription factor, YY1. J.

Biol. Chem. 270:30213-30220.

24. Bushmeyer, S. M., and M. L. Atchison. 1998. Identification of YY1

sequences necessary for association with the nuclear matrix and for

transcriptional repression functions. J. Cell. Biochem. 68:484-499.

25. Cairns, B. R., Y. J. Kim, M. H. Sayre, B. C. Laurent, and R. D. Kornberg.

1994. A multisubunit complex containing the SWI1/ADR6, SWI2/SNF2,

SWI3, SNF5, and SNF6 gene products isolated from yeast. Proc. Natl. Acad.

Sci. USA 91:1950-1954.

26. Candau, R., J. X. Zhou, C. D. Allis, and S. L. Berger. 1997. Histone

acetyltransferase activity and interaction with ADA2 are critical for GCN5

function in vivo. EMBO J. 16:555-565.

27. Carey, M. F. 1995. Transcriptional activation. A holistic view of the complex.

Curr. Biol. 5:1003-1005.

28. Chen, C. Y., and R. J. Schwartz. 1997. Competition between negative acting

YY1 versus positive acting serum response factor and tinman homologue

Nkx-2.5 regulates cardiac alpha- actin promoter activity. Mol. Endocrinol.

11:812-822.

83 29. Chen, H., R. J. Lin, W. Xie, D. Wilpitz, and R. M. Evans. 1999. Regulation

of hormone-induced histone hyperacetylation and gene activation via

acetylation of an acetylase. Cell 98:675-686.

30. Chiang, C. M., and R. G. Roeder. 1995. Cloning of an intrinsic human

TFIID subunit that interacts with multiple transcriptional activators. Science

267:531-536.

31. Chomczynski, P., and N. Sacchi. 1987. Single-step method of RNA isolation

by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal.

Biochem. 162:156-159.

32. Conaway, R. C., and J. W. Conaway. 1997. General transcription factors for

RNA polymerase II. Prog. Nucleic Acid Res. Mol. Biol. 56:327-346.

33. Corona, D. F., G. Langst, C. R. Clapier, E. J. Bonte, S. Ferrari, J. W.

Tamkun, and P. B. Becker. 1999. ISWI is an ATP-dependent nucleosome

remodeling factor. Mol. Cell 3:239-245.

34. Cosma, M. P., T. Tanaka, and K. Nasmyth. 1999. Ordered recruitment of

transcription and chromatin remodeling factors to a cell cycle- and

developmentally regulated promoter. Cell 97:299-311.

35. Cote, J., J. Quinn, J. L. Workman, and C. L. Peterson. 1994. Stimulation

of GAL4 derivative binding to nucleosomal DNA by the yeast SWI/SNF

complex. Science 265:53-60.

36. Cress, W. D., and E. Seto. 2000. Histone deacetylases, transcriptional

control, and cancer. J. Cell. Physiol. 184:1-16.

84 37. Cress, W. D., and S. J. Triezenberg. 1991. Critical structural elements of the

VP16 transcriptional activation domain. Science 251:87-90.

38. Donohoe, M. E., X. Zhang, L. McGinnis, J. Biggers, E. Li, and Y. Shi.

1999. Targeted disruption of mouse Yin Yang 1 transcription factor results in

peri-implantation lethality. Mol. Cell. Biol. 19:7237-7244.

39. Ebralidse, K. K., T. R. Hebbes, A. L. Clayton, A. W. Thorne, and C.

Crane-Robinson. 1993. Nucleosomal structure at hyperacetylated loci probed

in nuclei by DNA- histone crosslinking. Nucleic Acids Res. 21:4734-4738.

40. Flanagan, J. R. 1995. Autologous stimulation of YY1 transcription factor

expression: role of an insulin-like growth factor. Cell Growth Differ. 6:185-

190.

41. Flanagan, J. R., K. G. Becker, D. L. Ennist, S. L. Gleason, P. H. Driggers,

B. Z. Levi, E. Appella, and K. Ozato. 1992. Cloning of a negative

transcription factor that binds to the upstream conserved region of Moloney

murine leukemia virus. Mol. Cell. Biol. 12:38-44.

42. Gaston, K., and M. Fried. 1995. CpG methylation and the binding of YY1

and ETS proteins to the Surf-1/Surf-2 bidirectional promoter. Gene 157:257-

259.

43. Gaston, K., and M. Fried. 1994. YY1 is involved in the regulation of the bi-

directional promoter of the Surf-1 and Surf-2 genes. FEBS Lett. 347:289-294.

44. Gill, G., E. Pascal, Z. H. Tseng, and R. Tjian. 1994. A glutamine-rich

hydrophobic patch in transcription factor Sp1 contacts the dTAFII110

85 component of the Drosophila TFIID complex and mediates transcriptional

activation. Proc. Natl. Acad. Sci. USA 91:192-196.

45. Girton, J. R., and S. H. Jeon. 1994. Novel embryonic and adult homeotic

phenotypes are produced by pleiohomeotic mutations in Drosophila. Dev.

Biol. 161:393-407.

46. Gorman, C. M., L. F. Moffat, and B. H. Howard. 1982. Recombinant

genomes which express chloramphenicol acetyltransferase in mammalian

cells. Mol. Cell. Biol. 2:1044-1051.

47. Graham, F. L., and A. J. v. d. Eb. 1973. A new technique for the assay of

infectivity of human adenovirus 5 DNA. Virology 52:456-467.

48. Grant, P. A., L. Duggan, J. Cote, S. M. Roberts, J. E. Brownell, R.

Candau, R. Ohba, T. Owen-Hughes, C. D. Allis, F. Winston, S. L. Berger,

and J. L. Workman. 1997. Yeast Gcn5 functions in two multisubunit

complexes to acetylate nucleosomal histones: characterization of an Ada

complex and the SAGA (Spt/Ada) complex. Genes Dev. 11:1640-1650.

49. Green, M. R. 1989. Pre-mRNA processing and mRNA nuclear export. Curr.

Opin. Cell Biol. 1:519-525.

50. Gros, F., H. Hiatt, W. Gilbert, C. G. Kurland, R. W. Risebrough, and J.

D. Watson. 1961. Unstable ribonucleic acid revealed by pulse labelling of

Escherichia coli. Nature 190:581-585.

51. Grotewold, E., B. J. Drummond, B. Bowen, and T. Peterson. 1994. The

myb-homologous P gene controls phlobaphene pigmentation in maize floral

86 organs by directly activating a flavonoid biosynthetic gene subset. Cell

76:543-553.

52. Grustein, M., L. K. Durrin, R. K. Mann, G. Fisher-Adams, and L. M.

Johnson 1992. In Transcriptional Regulation. Cold Spring Harbot Laboratory

Press, Cold Spring Harbor, New York.

53. Gu, W., S. Malik, M. Ito, C. X. Yuan, J. D. Fondell, X. Zhang, E.

Martinez, J. Qin, and R. G. Roeder. 1999. A novel human SRB/MED-

containing cofactor complex, SMCC, involved in transcription regulation.

Mol. Cell 3:97-108.

54. Gu, W., and R. G. Roeder. 1997. Activation of p53 sequence-specific DNA

binding by acetylation of the p53 C-terminal domain. Cell 90:595-606.

55. Gu, W., X. L. Shi, and R. G. Roeder. 1997. Synergistic activation of

transcription by CBP and p53. Nature 387:819-823.

56. Hahn, S. 1993. Structure and function of acidic transcription activators. Cell

72:481-483.

57. Hai, T. W., F. Liu, W. J. Coukos, and M. R. Green. 1989. Transcription

factor ATF cDNA clones: an extensive family of leucine zipper proteins able

to selectively form DNA-binding heterodimers. Genes Dev. 3:2083-2090.

58. Hamiche, A., R. Sandaltzopoulos, D. A. Gdula, and C. Wu. 1999. ATP-

dependent histone octamer sliding mediated by the chromatin remodeling

complex NURF. Cell 97:833-842.

59. Hampsey, M., and D. Reinberg. 1999. RNA polymerase II as a control panel

for multiple coactivator complexes. Curr. Opin. Genet. Dev. 9:132-139.

87 60. Harada, R., G. Berube, O. J. Tamplin, C. Denis-Larose, and A. Nepveu.

1995. DNA-binding specificity of the cut repeats from the human cut-like

protein. Mol. Cell. Biol. 15:129-140.

61. Hariharan, N., D. E. Kelley, and R. P. Perry. 1991. Delta, a transcription

factor that binds to downstream elements in several polymerase II promoters,

is a functionally versatile zinc finger protein. Proc. Natl. Acad. Sci. USA

88:9799-9803.

62. Harlow, E., and D. Lane 1999. Using Antibodies: A Laboratory Manual, 2nd

ed. ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

63. Hassig, C. A., J. K. Tong, T. C. Fleischer, T. Owa, P. G. Grable, D. E.

Ayer, and S. L. Schreiber. 1998. A role for histone deacetylase activity in

HDAC1-mediated transcriptional repression. Proc. Natl. Acad. Sci. USA

95:3519-3524.

64. He, F., S. Narayan, and S. H. Wilson. 1996. Purification and characterization

of a DNA polymerase beta promoter initiator element-binding transcription

factor from bovine testis. Biochemistry 35:1775-1782.

65. Hebbes, T. R., A. W. Thorne, and C. Crane-Robinson. 1988. A direct link

between core histone acetylation and transcriptionally active chromatin.

EMBO J. 7:1395-1402.

66. Heinzel, T., R. M. Lavinsky, T. M. Mullen, M. Soderstrom, C. D. Laherty,

J. Torchia, W. M. Yang, G. Brard, S. D. Ngo, J. R. Davie, E. Seto, R. N.

Eisenman, D. W. Rose, C. K. Glass, and M. G. Rosenfeld. 1997. A complex

88 containing N-CoR, mSin3 and histone deacetylase mediates transcriptional

repression. Nature 387:43-48.

67. Herskowitz, I., B. Andrews, W. Kruger, J. Ogas, A. Sil, C. Coburn, and C.

Peterson 1992. In Transcriptional Regulation. Cold Spring Harbot Laboratory

Press, Cold Spring Harbor, New York.

68. Hirschhorn, J. N., S. A. Brown, C. D. Clark, and F. Winston. 1992.

Evidence that SNF2/SWI2 and SNF5 activate transcription in yeast by altering

chromatin structure. Genes Dev. 6:2288-2298.

69. Hong, L., G. P. Schroth, H. R. Matthews, P. Yau, and E. M. Bradbury.

1993. Studies of the DNA binding properties of histone H4 amino terminus.

Thermal denaturation studies reveal that acetylation markedly reduces the

binding constant of the H4 "tail" to DNA. J. Biol. Chem. 268:305-314.

70. Houbaviy, H. B., A. Usheva, T. Shenk, and S. K. Burley. 1996. Cocrystal

structure of YY1 bound to the adeno-associated virus P5 initiator. Proc. Natl.

Acad. Sci. USA 93:13577-13582.

71. Huang, S., Y. Qiu, Y. Shi, Z. Xu, and S. J. Brandt. 2000. P/CAF-mediated

acetylation regulates the function of the basic helix- loop-helix transcription

factor TAL1/SCL. EMBO J. 19:6792-6803.

72. Huibregtse, J. M., M. Scheffner, and P. M. Howley. 1991. A cellular

protein mediates association of p53 with the E6 oncoprotein of human

papillomavirus types 16 or 18. EMBO J. 10:4129-4135.

89 73. Hung, H. L., J. Lau, A. Y. Kim, M. J. Weiss, and G. A. Blobel. 1999.

CREB-Binding protein acetylates hematopoietic transcription factor GATA- 1

at functionally important sites. Mol. Cell. Biol. 19:3496-3505.

74. Imbalzano, A. N., H. Kwon, M. R. Green, and R. E. Kingston. 1994.

Facilitated binding of TATA-binding protein to nucleosomal DNA. Nature

370:481-485.

75. Imhof, A., X. J. Yang, V. V. Ogryzko, Y. Nakatani, A. P. Wolffe, and H.

Ge. 1997. Acetylation of general transcription factors by histone

acetyltransferases. Curr. Biol. 7:689-692.

76. Ito, T., M. Bulger, M. J. Pazin, R. Kobayashi, and J. T. Kadonaga. 1997.

ACF, an ISWI-containing and ATP-utilizing chromatin assembly and

remodeling factor. Cell 90:145-155.

77. Jacob, F., and J. Monod. 1961. Genetic and regulatory mechanisms in the

synthesis of proteins. J. Mol. Biol. 3:318-356.

78. Jacob, F., and J. Monod. 1962. On the regulation of gene activity. Cold

Spring Harb. Symp. Quant. Biol. 26:193-211.

79. Jimenez-Garcia, L. F., and D. L. Spector. 1993. In vivo evidence that

transcription and splicing are coordinated by a recruiting mechanism. Cell

73:47-59.

80. Kadonaga, J. T., and R. Tjian. 1986. Affinity purification of sequence-

specific DNA binding proteins. Proc. Natl. Acad. Sci. USA 83:5889-5893.

90 81. Kadosh, D., and K. Struhl. 1997. Repression by Ume6 involves recruitment

of a complex containing Sin3 corepressor and Rpd3 histone deacetylase to

target promoters. Cell 89:365-371.

82. Kehle, J., D. Beuchle, S. Treuheit, B. Christen, J. A. Kennison, M. Bienz,

and J. Muller. 1998. dMi-2, a hunchback-interacting protein that functions in

polycomb repression. Science 282:1897-1900.

83. Kelley, R. I. 1973. Isolation of a histone IIb1-IIb2 complex. Biochem.

Biophys. Res. Commun. 54:1588-1594.

84. Kiernan, R. E., C. Vanhulle, L. Schiltz, E. Adam, H. Xiao, F. Maudoux, C.

Calomme, A. Burny, Y. Nakatani, K. T. Jeang, M. Benkirane, and C. Van

Lint. 1999. HIV-1 tat transcriptional activity is regulated by acetylation.

EMBO J. 18:6106-6118.

85. Kim, Y. J., S. Bjorklund, Y. Li, M. H. Sayre, and R. D. Kornberg. 1994. A

multiprotein mediator of transcriptional activation and its interaction with the

C-terminal repeat domain of RNA polymerase II. Cell 77:599-608.

86. Knezetic, J. A., and D. S. Luse. 1986. The presence of nucleosomes on a

DNA template prevents initiation by RNA polymerase II in vitro. Cell 45:95-

104.

87. Koleske, A. J., and R. A. Young. 1995. The RNA polymerase II holoenzyme

and its implications for gene regulation. Trends Biochem. Sci. 20:113-116.

88. Kornberg, R. D. 1974. Chromatin structure: a repeating unit of histones and

DNA. Science 184:868-871.

91 89. Kornberg, R. D., and Y. Lorch. 1999. Twenty-five years of the nucleosome,

fundamental particle of the eukaryote chromosome. Cell 98:285-294.

90. Kornberg, R. D., and J. O. Thomas. 1974. Chromatin structure; oligomers

of the histones. Science 184:865-868.

91. Kuo, M. H., J. Zhou, P. Jambeck, M. E. Churchill, and C. D. Allis. 1998.

Histone acetyltransferase activity of yeast Gcn5p is required for the activation

of target genes in vivo. Genes Dev. 12:627-639.

92. Labrie, C., B. H. Lee, and M. B. Mathews. 1995. Transcription factors

RFX1/EF-C and ATF-1 associate with the adenovirus E1A-responsive

element of the human proliferating cell nuclear antigen promoter. Nucleic

Acids Res. 23:3732-3741.

93. Laherty, C. D., W. M. Yang, J. M. Sun, J. R. Davie, E. Seto, and R. N.

Eisenman. 1997. Histone deacetylases associated with the mSin3 corepressor

mediate mad transcriptional repression. Cell 89:349-356.

94. Langst, G., E. J. Bonte, D. F. Corona, and P. B. Becker. 1999. Nucleosome

movement by CHRAC and ISWI without disruption or trans- displacement of

the histone octamer. Cell 97:843-852.

95. Lee, J. S., K. M. Galvin, R. H. See, R. Eckner, D. Livingston, E. Moran,

and Y. Shi. 1995. Relief of YY1 transcriptional repression by adenovirus E1A

is mediated by E1A-associated protein p300. Genes Dev. 9:1188-1198.

96. Lee, J. S., K. M. Galvin, and Y. Shi. 1993. Evidence for physical interaction

between the zinc-finger transcription factors YY1 and Sp1. Proc. Natl. Acad.

Sci. USA 90:6145-6149.

92 97. Lee, J. S., R. H. See, K. M. Galvin, J. Wang, and Y. Shi. 1995. Functional

interactions between YY1 and adenovirus E1A. Nucleic Acids Res. 23:925-

931.

98. Lee, T. C., Y. Shi, and R. J. Schwartz. 1992. Displacement of BrdUrd-

induced YY1 by serum response factor activates skeletal alpha-actin

transcription in embryonic myoblasts. Proc. Natl. Acad. Sci. USA 89:9814-

9818.

99. Lee, T. C., Y. Zhang, and R. J. Schwartz. 1994. Bifunctional transcriptional

properties of YY1 in regulating muscle actin and c-myc gene expression

during myogenesis. Oncogene 9:1047-1052.

100. Lewis, B. A., G. Tullis, E. Seto, N. Horikoshi, R. Weinmann, and T.

Shenk. 1995. Adenovirus E1A proteins interact with the cellular YY1

transcription factor. J. Virol. 69:1628-1636.

101. Li, Q., A. Imhof, T. N. Collingwood, F. D. Urnov, and A. P. Wolffe. 1999.

p300 stimulates transcription instigated by ligand-bound thyroid hormone

receptor at a step subsequent to chromatin disruption. EMBO J. 18:5634-5652.

102. Lill, N. L., S. R. Grossman, D. Ginsberg, J. DeCaprio, and D. M.

Livingston. 1997. Binding and modulation of p53 by p300/CBP coactivators.

Nature 387:823-827.

103. Liu, L., D. M. Scolnick, R. C. Trievel, H. B. Zhang, R. Marmorstein, T. D.

Halazonetis, and S. L. Berger. 1999. p53 sites acetylated in vitro by PCAF

and p300 are acetylated in vivo in response to DNA damage. Mol. Cell. Biol.

19:1202-1209.

93 104. Liu, R., J. Baillie, J. G. Sissons, and J. H. Sinclair. 1994. The transcription

factor YY1 binds to negative regulatory elements in the human

cytomegalovirus major immediate early enhancer/promoter and mediates

repression in non-permissive cells. Nucleic Acids Res. 22:2453-2459.

105. Lorch, Y., B. R. Cairns, M. Zhang, and R. D. Kornberg. 1998. Activated

RSC-nucleosome complex and persistently altered form of the nucleosome.

Cell 94:29-34.

106. Lorch, Y., J. W. LaPointe, and R. D. Kornberg. 1987. Nucleosomes inhibit

the initiation of transcription but allow chain elongation with the displacement

of histones. Cell 49:203-210.

107. Losick, R., and M. Chamberlin 1976. RNA polymerase. Cold Spring Harbor

Laboratory, Cold Spring Harbor, N.Y.

108. Luger, K., A. W. Mader, R. K. Richmond, D. F. Sargent, and T. J.

Richmond. 1997. Crystal structure of the nucleosome core particle at 2.8 A

resolution. Nature 389:251-260.

109. Maldonado, E., R. Shiekhattar, M. Sheldon, H. Cho, R. Drapkin, P.

Rickert, E. Lees, C. W. Anderson, S. Linn, and D. Reinberg. 1996. A

human RNA polymerase II complex associated with SRB and DNA-repair

proteins. Nature 381:86-89.

110. Martinez-Balbas, M. A., U. M. Bauer, S. J. Nielsen, A. Brehm, and T.

Kouzarides. 2000. Regulation of E2F1 activity by acetylation. EMBO J.

19:662-671.

94 111. Marzio, G., C. Wagener, M. I. Gutierrez, P. Cartwright, K. Helin, and M.

Giacca. 2000. E2F family members are differentially regulated by reversible

acetylation. J. Biol. Chem. 275:10887-10892.

112. McCall, K., and W. Bender. 1996. Probes of chromatin accessibility in the

Drosophila bithorax complex respond differently to Polycomb-mediated

repression. EMBO J. 15:569-580.

113. Mitchell, P. J., and R. Tjian. 1989. Transcriptional regulation in mammalian

cells by sequence-specific DNA binding proteins. Science 245:371-378.

114. Mizzen, C. A., X. J. Yang, T. Kokubo, J. E. Brownell, A. J. Bannister, T.

Owen-Hughes, J. Workman, L. Wang, S. L. Berger, T. Kouzarides, Y.

Nakatani, and C. D. Allis. 1996. The TAF(II)250 subunit of TFIID has

histone acetyltransferase activity. Cell 87:1261-1270.

115. Momand, J., G. P. Zambetti, D. C. Olson, D. George, and A. J. Levine.

1992. The mdm-2 oncogene product forms a complex with the p53 protein and

inhibits p53-mediated transactivation. Cell 69:1237-1245.

116. Morris, J. F., R. Hromas, and F. J. Rauscher. 1994. Characterization of the

DNA-binding properties of the myeloid zinc finger protein MZF1: two

independent DNA-binding domains recognize two DNA consensus sequences

with a common G-rich core. Mol. Cell. Biol. 14:1786-1795.

117. Munshi, N., M. Merika, J. Yie, K. Senger, G. Chen, and D. Thanos. 1998.

Acetylation of HMG I(Y) by CBP turns off IFN beta expression by disrupting

the enhanceosome. Mol. Cell 2:457-467.

95 118. Myers, L. C., C. M. Gustafsson, D. A. Bushnell, M. Lui, H. Erdjument-

Bromage, P. Tempst, and R. D. Kornberg. 1998. The Med proteins of yeast

and their function through the RNA polymerase II carboxy-terminal domain.

Genes Dev. 12:45-54.

119. Mymryk, J. S., R. W. Lee, and S. T. Bayley. 1992. Ability of adenovirus 5

E1A proteins to suppress differentiation of BC3H1 myoblasts correlates with

their binding to a 300 kDa cellular protein. Mol. Biol. Cell 3:1107-1115.

120. Nacheva, G. A., D. Y. Guschin, O. V. Preobrazhenskaya, V. L. Karpov, K.

K. Ebralidse, and A. D. Mirzabekov. 1989. Change in the pattern of histone

binding to DNA upon transcriptional activation. Cell 58:27-36.

121. Nagy, L., H. Y. Kao, D. Chakravarti, R. J. Lin, C. A. Hassig, D. E. Ayer,

S. L. Schreiber, and R. M. Evans. 1997. Nuclear receptor repression

mediated by a complex containing SMRT, mSin3A, and histone deacetylase.

Cell 89:373-380.

122. Neigeborn, L., and M. Carlson. 1984. Genes affecting the regulation of

SUC2 gene expression by glucose repression in Saccharomyces cerevisiae.

Genetics 108:845-858.

123. Noll, M., and R. D. Kornberg. 1977. Action of micrococcal nuclease on

chromatin and the location of histone H1. J. Mol. Biol. 109:393-404.

124. Ogryzko, V. V., R. L. Schiltz, V. Russanova, B. H. Howard, and Y.

Nakatani. 1996. The transcriptional coactivators p300 and CBP are histone

acetyltransferases. Cell 87:953-959.

96 125. Orphanides, G., T. Lagrange, and D. Reinberg. 1996. The general

transcription factors of RNA polymerase II. Genes Dev. 10:2657-2683.

126. Park, K., and M. L. Atchison. 1991. Isolation of a candidate

repressor/activator, NF-E1 (YY-1, delta), that binds to the immunoglobulin

kappa 3' enhancer and the immunoglobulin heavy-chain mu E1 site. Proc.

Natl. Acad. Sci. USA 88:9804-9808.

127. Paro, R. 1993. Mechanisms of heritable gene repression during development

of Drosophila. Curr. Opin. Cell Biol. 5:999-1005.

128. Pelletier, G., V. Y. Stefanovsky, M. Faubladier, I. Hirschler-Laszkiewicz,

J. Savard, L. I. Rothblum, J. Cote, and T. Moss. 2000. Competitive

recruitment of CBP and Rb-HDAC regulates UBF acetylation and ribosomal

transcription. Mol. Cell 6:1059-1066.

129. Peterson, C. L., and I. Herskowitz. 1992. Characterization of the yeast

SWI1, SWI2, and SWI3 genes, which encode a global activator of

transcription. Cell 68:573-583.

130. Pisaneschi, G., S. Ceccotti, M. L. Falchetti, S. Fiumicino, F. Carnevali,

and E. Beccari. 1994. Characterization of FIII/YY1, a Xenopus laevis

conserved zinc-finger protein binding to the first exon of L1 and L14

ribosomal protein genes. Biochem. Biophys. Res. Commun. 205:1236-1242.

131. Polesskaya, A., A. Duquet, I. Naguibneva, C. Weise, A. Vervisch, E.

Bengal, F. Hucho, P. Robin, and A. Harel-Bellan. 2000. CREB-binding

Protein/p300 activates MyoD by acetylation. J. Biol. Chem. 275:34359-34364.

97 132. Roark, D. E., T. E. Geoghegan, and G. H. Keller. 1974. A two-subunit

histone complex from calf thymus. Biochem. Biophys. Res. Commun. 59:542-

547.

133. Ron, D., and H. Dressler. 1992. pGSTag--a versatile bacterial expression

plasmid for enzymatic labeling of recombinant proteins. Biotechniques

13:866-869.

134. Sadowski, I., B. Bell, P. Broad, and M. Hollis. 1992. GAL4 fusion vectors

for expression in yeast or mammalian cells. Gene 118:137-141.

135. Safrany, G., and R. P. Perry. 1993. Characterization of the mouse gene that

encodes the delta/YY1/NF-E1/UCRBP transcription factor. Proc. Natl. Acad.

Sci. USA 90:5559-5563.

136. Sambrook, J., T. Maniatis, and E. F. Fritsch 1989. Molecular cloning : a

laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring

Harbor, N.Y.

137. Sartorelli, V., P. L. Puri, Y. Hamamori, V. Ogryzko, G. Chung, Y.

Nakatani, J. Y. Wang, and L. Kedes. 1999. Acetylation of MyoD directed

by PCAF is necessary for the execution of the muscle program. Mol. Cell

4:725-734.

138. Sauer, F., and H. Jackle. 1991. Concentration-dependent transcriptional

activation or repression by Kruppel from a single binding site. Nature

353:563-566.

98 139. Scully, R., S. F. Anderson, D. M. Chao, W. Wei, L. Ye, R. A. Young, D. M.

Livingston, and J. D. Parvin. 1997. BRCA1 is a component of the RNA

polymerase II holoenzyme. Proc. Natl. Acad. Sci. USA 94:5605-5610.

140. Sealy, L., and R. Chalkley. 1978. DNA associated with hyperacetylated

histone is preferentially digested by DNase I. Nucleic Acids Res. 5:1863-

1876.

141. Seto, E., B. Lewis, and T. Shenk. 1993. Interaction between transcription

factors Sp1 and YY1. Nature 365:462-464.

142. Seto, E., Y. Shi, and T. Shenk. 1991. YY1 is an initiator sequence-binding

protein that directs and activates transcription in vitro. Nature 354:241-245.

143. Shi, Y., J. S. Lee, and K. M. Galvin. 1997. Everything you have ever wanted

to know about Yin Yang 1. Biochim. Biophys. Acta 1332:F49-66.

144. Shi, Y., E. Seto, L. S. Chang, and T. Shenk. 1991. Transcriptional repression

by YY1, a human GLI-Kruppel-related protein, and relief of repression by

adenovirus E1A protein. Cell 67:377-388.

145. Shrivastava, A., S. Saleque, G. V. Kalpana, S. Artandi, S. P. Goff, and K.

Calame. 1993. Inhibition of transcriptional regulator Yin-Yang-1 by

association with c-Myc. Science 262:1889-1892.

146. Simon, J., A. Chiang, and W. Bender. 1992. Ten different Polycomb group

genes are required for spatial control of the abdA and AbdB homeotic

products. Development 114:493-505.

147. Soutoglou, E., N. Katrakili, and I. Talianidis. 2000. Acetylation regulates

transcription factor activity at multiple levels. Mol. Cell 5:745-751.

99 148. Spencer, T. E., G. Jenster, M. M. Burcin, C. D. Allis, J. Zhou, C. A.

Mizzen, N. J. McKenna, S. A. Onate, S. Y. Tsai, M. J. Tsai, and B. W.

O'Malley. 1997. Steroid receptor coactivator-1 is a histone acetyltransferase.

Nature 389:194-198.

149. Spilianakis, C., J. Papamatheakis, and A. Kretsovali. 2000. Acetylation by

PCAF enhances CIITA nuclear accumulation and transactivation of major

histocompatibility complex class II genes. Mol. Cell. Biol. 20:8489-8498.

150. Sterner, D. E., and S. L. Berger. 2000. Acetylation of histones and

transcription-related factors. Microbiol. Mol. Biol. Rev. 64:435-459.

151. Stewart, A. 1990. The functional organization of chromosomes and the

nucleus--a special issue. Trends Genet. 6:377-379.

152. Struhl, G., and M. Akam. 1985. Altered distributions of Ultrabithorax

transcripts in extra sex combs mutant embryos of Drosophila. EMBO J.

4:3259-3264.

153. Taunton, J., C. A. Hassig, and S. L. Schreiber. 1996. A mammalian histone

deacetylase related to the yeast transcriptional regulator Rpd3p. Science

272:408-411.

154. Thomas, M. J., and E. Seto. 1999. Unlocking the mechanisms of

transcription factor YY1: are chromatin modifying enzymes the key? Gene

236:197-208.

155. Thompson, C. M., A. J. Koleske, D. M. Chao, and R. A. Young. 1993. A

multisubunit complex associated with the RNA polymerase II CTD and

TATA-binding protein in yeast. Cell 73:1361-1375.

100 156. Thompson, C. M., and R. A. Young. 1995. General requirement for RNA

polymerase II holoenzymes in vivo. Proc. Natl. Acad. Sci. USA 92:4587-

4590.

157. Tjian, R., and T. Maniatis. 1994. Transcriptional activation: a complex

puzzle with few easy pieces. Cell 77:5-8.

158. Tsai, S. C., N. Valkov, W. M. Yang, J. Gump, D. Sullivan, and E. Seto.

2000. Histone deacetylase interacts directly with DNA topoisomerase II. Nat.

Genet. 26:349-353.

159. Tsukiyama, T., J. Palmer, C. C. Landel, J. Shiloach, and C. Wu. 1999.

Characterization of the imitation switch subfamily of ATP-dependent

chromatin-remodeling factors in Saccharomyces cerevisiae. Genes Dev.

13:686-697.

160. Usheva, A., and T. Shenk. 1994. TATA-binding protein-independent

initiation: YY1, TFIIB, and RNA polymerase II direct basal transcription on

supercoiled template DNA. Cell 76:1115-1121.

161. Usheva, A., and T. Shenk. 1996. YY1 transcriptional initiator: protein

interactions and association with a DNA site containing unpaired strands.

Proc. Natl. Acad. Sci. USA 93:13571-13576.

162. Varga-Weisz, P. D., M. Wilm, E. Bonte, K. Dumas, M. Mann, and P. B.

Becker. 1997. Chromatin-remodelling factor CHRAC contains the ATPases

ISWI and topoisomerase II. Nature 388:598-602.

163. Vidali, G., L. C. Boffa, E. M. Bradbury, and V. G. Allfrey. 1978. Butyrate

suppression of histone deacetylation leads to accumulation of multiacetylated

101 forms of histones H3 and H4 and increased DNase I sensitivity of the

associated DNA sequences. Proc. Natl. Acad. Sci. USA 75:2239-2243.

164. Wade, P. A., P. L. Jones, D. Vermaak, G. J. Veenstra, A. Imhof, T. Sera,

C. Tse, H. Ge, Y. B. Shi, J. C. Hansen, and A. P. Wolffe. 1998. Histone

deacetylase directs the dominant silencing of transcription in chromatin:

association with MeCP2 and the Mi-2 chromodomain SWI/SNF ATPase. Cold

Spring Harb. Symp. Quant. Biol. 63:435-445.

165. Wade, P. A., P. L. Jones, D. Vermaak, and A. P. Wolffe. 1998. A multiple

subunit Mi-2 histone deacetylase from Xenopus laevis cofractionates with an

associated Snf2 superfamily ATPase. Curr. Biol. 8:843-846.

166. Walker, I. O. 1984. Differential dissociation of histone tails from core

chromatin. Biochemistry 23:5622-5628.

167. Waltzer, L., and M. Bienz. 1998. Drosophila CBP represses the transcription

factor TCF to antagonize Wingless signalling. Nature 395:521-525.

168. Wen, Y. D., V. Perissi, L. M. Staszewski, W. M. Yang, A. Krones, C. K.

Glass, M. G. Rosenfeld, and E. Seto. 2000. The histone deacetylase-3

complex contains nuclear receptor corepressors. Proc. Natl. Acad. Sci. USA

97:7202-7207.

169. Wilson, C. J., D. M. Chao, A. N. Imbalzano, G. R. Schnitzler, R. E.

Kingston, and R. A. Young. 1996. RNA polymerase II holoenzyme contains

SWI/SNF regulators involved in chromatin remodeling. Cell 84:235-244.

170. Winston, F., and M. Carlson. 1992. Yeast SNF/SWI transcriptional

activators and the SPT/SIN chromatin connection. Trends Genet. 8:387-391.

102 171. Yang, W. M., C. Inouye, Y. Zeng, D. Bearss, and E. Seto. 1996.

Transcriptional repression by YY1 is mediated by interaction with a

mammalian homolog of the yeast global regulator RPD3. Proc Natl Acad Sci

USA 93:12845-12850.

172. Yang, W. M., Y. L. Yao, J. M. Sun, J. R. Davie, and E. Seto. 1997.

Isolation and characterization of cDNAs corresponding to an additional

member of the human histone deacetylase gene family. J. Biol. Chem.

272:28001-28007.

173. Yang, X. J., V. V. Ogryzko, J. Nishikawa, B. H. Howard, and Y.

Nakatani. 1996. A p300/CBP-associated factor that competes with the

adenoviral oncoprotein E1A. Nature 382:319-324.

174. Young, R. A. 1991. RNA polymerase II. Annu. Rev. Biochem. 60:689-715.

175. Zawel, L., and D. Reinberg. 1993. Initiation of transcription by RNA

polymerase II: a multi-step process. Prog. Nucleic Acid Res. Mol. Biol. 44:67-

108.

176. Zhang, Q., H. Yao, N. Vo, and R. H. Goodman. 2000. Acetylation of

adenovirus E1A regulates binding of the transcriptional corepressor CtBP.

Proc. Natl. Acad. Sci. USA 97:14323-14328.

177. Zhang, W., and J. J. Bieker. 1998. Acetylation and modulation of erythroid

Kruppel-like factor (EKLF) activity by interaction with histone

acetyltransferases. Proc. Natl. Acad. Sci. USA 95:9855-9860.

103 178. Zhou, Q., R. W. Gedrich, and D. A. Engel. 1995. Transcriptional repression

of the c-fos gene by YY1 is mediated by a direct interaction with ATF/CREB.

J. Virol. 69:4323-4330.

179. Zhu, X., M. A. Mancini, K. H. Chang, C. Y. Liu, C. F. Chen, B. Shan, D.

Jones, T. L. Yang-Feng, and W. H. Lee. 1995. Characterization of a novel

350-kilodalton nuclear phosphoprotein that is specifically involved in mitotic-

phase progression. Mol. Cell. Biol. 15:5017-5029.

104 ABOUT THE AUTHOR

Ya-Li Yao received a Bachelor's degree in Biological Sciences from University of

California, Davis in 1995. She enrolled in the Ph.D program of Molecular Medicine at the University of Texas, Health Sciences Center at San Antonio in 1996. Subsequently, she transferred to the Ph.D. program in the Department of Medical Microbiology and

Immunology at the University of South Florida. She was awarded a Master's degree in

Medical Sciences in 1999 and a Ph.D. degree in 2001.

While in the Ph.D. program at the University of South Florida, Ya-Li Yao received a graduate student fellowship from the American Heart Association as well as a travel award from the University. She co-authored several publications in peer-reviewed journals and received the Time Warner Road Runner ETD (Electronic Thesis and

Dissertation) Award in 2001.