Oestrogen Receptor Β Regulates Epigenetic Patterns at Specific
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
BER and Folate Deficiency: a Comprehensive Overview of DNA Base Excision Repair and the Effect of Dietary Folate Lydia Lanni [email protected]
Wayne State University Honors College Theses Irvin D. Reid Honors College Winter 5-7-2012 BER and Folate Deficiency: A comprehensive overview of DNA base excision repair and the effect of dietary folate Lydia Lanni [email protected] Follow this and additional works at: https://digitalcommons.wayne.edu/honorstheses Part of the Human and Clinical Nutrition Commons Recommended Citation Lanni, Lydia, "BER and Folate Deficiency: A comprehensive overview of DNA base excision repair and the effect of dietary folate" (2012). Honors College Theses. 2. https://digitalcommons.wayne.edu/honorstheses/2 This Honors Thesis is brought to you for free and open access by the Irvin D. Reid Honors College at DigitalCommons@WayneState. It has been accepted for inclusion in Honors College Theses by an authorized administrator of DigitalCommons@WayneState. Running head: BER AND FOLATE DEFICIENCY 1 BER and Folate Deficiency: A comprehensive overview of DNA base excision repair and the effect of dietary folate Lydia Lanni Wayne State University Honors Thesis Winter 2012 Author Note A special thank you to Dr. Diane Cabelof and all those in her lab for their instruction and support. BER AND FOLATE DEFICIENCY 2 Abstract Folate is the naturally occurring form of water-soluble B vitamin that is found in foods such as leafy vegetables, fruits, legumes, etc. Dietary supplementation of folate has shown to be protective against neural tube defects and other congenital disorders, and of recent, its role in carcinogenesis has been of special interest. Though mechanistically unclear, a positive correlation has been observed between folate deficiency in the diet and decrease function of DNA base excision repair pathways. -
PAX5 Expression in Acute Leukemias: Higher B-Lineage Specificity Than Cd79a and Selective Association with T(8;21)-Acute Myelogenous Leukemia
[CANCER RESEARCH 64, 7399–7404, October 15, 2004] PAX5 Expression in Acute Leukemias: Higher B-Lineage Specificity Than CD79a and Selective Association with t(8;21)-Acute Myelogenous Leukemia Enrico Tiacci,1 Stefano Pileri,2 Annette Orleth,1 Roberta Pacini,1 Alessia Tabarrini,1 Federica Frenguelli,1 Arcangelo Liso,3 Daniela Diverio,4 Francesco Lo-Coco,5 and Brunangelo Falini1 1Institutes of Hematology and Internal Medicine, University of Perugia, Perugia, Italy; 2Unit of Hematopathology, University of Bologne, Bologne, Italy; 3Section of Hematology, University of Foggia, Foggia, Italy; 4Department of Cellular Biotechnologies and Hematology, University La Sapienza of Rome, Rome, Italy; and 5Department of Biopathology, University Tor Vergata of Rome, Rome, Italy ABSTRACT (13, 16). PAX5 expression also occurs in the adult testis and in the mesencephalon and spinal cord during embryogenesis (17), suggesting an The transcription factor PAX5 plays a key role in the commitment of important role in the development of these tissues. hematopoietic precursors to the B-cell lineage, but its expression in acute Rearrangement of the PAX5 gene through reciprocal chromosomal leukemias has not been thoroughly investigated. Hereby, we analyzed routine biopsies from 360 acute leukemias of lymphoid (ALLs) and mye- translocations has been described in different types of B-cell malig- loid (AMLs) origin with a specific anti-PAX5 monoclonal antibody. Blasts nancies (18–23), and, more recently, PAX5 has also been shown to be from 150 B-cell ALLs showed strong PAX5 nuclear expression, paralleling targeted by aberrant hypermutation in Ͼ50% of diffuse large B-cell that of CD79a in the cytoplasm. Conversely, PAX5 was not detected in 50 lymphomas (24). -
Oxidative Stress in Sperm Affects the Epigenetic Reprogramming in Early
Wyck et al. Epigenetics & Chromatin (2018) 11:60 https://doi.org/10.1186/s13072-018-0224-y Epigenetics & Chromatin RESEARCH Open Access Oxidative stress in sperm afects the epigenetic reprogramming in early embryonic development Sarah Wyck1,2,3, Carolina Herrera1, Cristina E. Requena4,5, Lilli Bittner1, Petra Hajkova4,5, Heinrich Bollwein1* and Rafaella Santoro2* Abstract Background: Reactive oxygen species (ROS)-induced oxidative stress is well known to play a major role in male infer- tility. Sperm are sensitive to ROS damaging efects because as male germ cells form mature sperm they progressively lose the ability to repair DNA damage. However, how oxidative DNA lesions in sperm afect early embryonic develop- ment remains elusive. Results: Using cattle as model, we show that fertilization using sperm exposed to oxidative stress caused a major developmental arrest at the time of embryonic genome activation. The levels of DNA damage response did not directly correlate with the degree of developmental defects. The early cellular response for DNA damage, γH2AX, is already present at high levels in zygotes that progress normally in development and did not signifcantly increase at the paternal genome containing oxidative DNA lesions. Moreover, XRCC1, a factor implicated in the last step of base excision repair (BER) pathway, was recruited to the damaged paternal genome, indicating that the maternal BER machinery can repair these DNA lesions induced in sperm. Remarkably, the paternal genome with oxidative DNA lesions showed an impairment of zygotic active DNA demethylation, a process that previous studies linked to BER. Quantitative immunofuorescence analysis and ultrasensitive LC–MS-based measurements revealed that oxidative DNA lesions in sperm impair active DNA demethylation at paternal pronuclei, without afecting 5-hydroxymethyl- cytosine (5hmC), a 5-methylcytosine modifcation that has been implicated in paternal active DNA demethylation in mouse zygotes. -
Further Delineation of Chromosomal Consensus Regions in Primary
Leukemia (2007) 21, 2463–2469 & 2007 Nature Publishing Group All rights reserved 0887-6924/07 $30.00 www.nature.com/leu ORIGINAL ARTICLE Further delineation of chromosomal consensus regions in primary mediastinal B-cell lymphomas: an analysis of 37 tumor samples using high-resolution genomic profiling (array-CGH) S Wessendorf1,6, TFE Barth2,6, A Viardot1, A Mueller3, HA Kestler3, H Kohlhammer1, P Lichter4, M Bentz5,HDo¨hner1,PMo¨ller2 and C Schwaenen1 1Klinik fu¨r Innere Medizin III, Zentrum fu¨r Innere Medizin der Universita¨t Ulm, Ulm, Germany; 2Institut fu¨r Pathologie, Universita¨t Ulm, Ulm, Germany; 3Forschungsdozentur Bioinformatik, Universita¨t Ulm, Ulm, Germany; 4Abt. Molekulare Genetik, Deutsches Krebsforschungszentrum, Heidelberg, Germany and 5Sta¨dtisches Klinikum Karlsruhe, Karlsruhe, Germany Primary mediastinal B-cell lymphoma (PMBL) is an aggressive the expression of BSAP, BOB1, OCT2, PAX5 and PU1 was extranodal B-cell non-Hodgkin’s lymphoma with specific clin- added to the spectrum typical of PMBL features.9 ical, histopathological and genomic features. To characterize Genetically, a pattern of highly recurrent karyotype alterations further the genotype of PMBL, we analyzed 37 tumor samples and PMBL cell lines Med-B1 and Karpas1106P using array- with the hallmark of chromosomal gains of the subtelomeric based comparative genomic hybridization (matrix- or array- region of chromosome 9 supported the concept of a unique CGH) to a 2.8k genomic microarray. Due to a higher genomic disease entity that distinguishes PMBL from other B-cell non- resolution, we identified altered chromosomal regions in much Hodgkin’s lymphomas.10,11 Together with less specific gains on higher frequencies compared with standard CGH: for example, 2p15 and frequent mutations of the SOCS1 gene, a notable þ 9p24 (68%), þ 2p15 (51%), þ 7q22 (32%), þ 9q34 (32%), genomic similarity to classical Hodgkin’s lymphoma was þ 11q23 (18%), þ 12q (30%) and þ 18q21 (24%). -
2017.08.28 Anne Barry-Reidy Thesis Final.Pdf
REGULATION OF BOVINE β-DEFENSIN EXPRESSION THIS THESIS IS SUBMITTED TO THE UNIVERSITY OF DUBLIN FOR THE DEGREE OF DOCTOR OF PHILOSOPHY 2017 ANNE BARRY-REIDY SCHOOL OF BIOCHEMISTRY & IMMUNOLOGY TRINITY COLLEGE DUBLIN SUPERVISORS: PROF. CLIONA O’FARRELLY & DR. KIERAN MEADE TABLE OF CONTENTS DECLARATION ................................................................................................................................. vii ACKNOWLEDGEMENTS ................................................................................................................... viii ABBREVIATIONS ................................................................................................................................ix LIST OF FIGURES............................................................................................................................. xiii LIST OF TABLES .............................................................................................................................. xvii ABSTRACT ........................................................................................................................................xix Chapter 1 Introduction ........................................................................................................ 1 1.1 Antimicrobial/Host-defence peptides ..................................................................... 1 1.2 Defensins................................................................................................................. 1 1.3 β-defensins ............................................................................................................. -
Genomic Profiling of Adult Acute Lymphoblastic Leukemia by Single
SUPPLEMENTARY APPENDIX Genomic profiling of adult acute lymphoblastic leukemia by single nucleotide polymorphism oligonucleotide microarray and comparison to pediatric acute lymphoblastic leukemia Ryoko Okamoto,1 Seishi Ogawa,2 Daniel Nowak,1 Norihiko Kawamata,1 Tadayuki Akagi,1,3 Motohiro Kato,2 Masashi Sanada,2 Tamara Weiss,4 Claudia Haferlach,4 Martin Dugas,5 Christian Ruckert,5 Torsten Haferlach,4 and H. Phillip Koeffler1,6 1Division of Hematology and Oncology, Cedars-Sinai Medical Center, UCLA School of Medicine, Los Angeles, CA, USA; 2Cancer Genomics Project, Graduate School of Medicine, University of Tokyo, Tokyo, Japan; 3Department of Stem Cell Biology, Graduate School of Medical Science, Kanazawa University 4MLL Munich Leukemia Laboratory, Munich, Germany; 5Department of Medical Informatics and Biomathematics, University of Münster, Münster, Germany; 6Cancer Science Institute of Singapore, National University of Singapore, Singapore Citation: Okamoto R, Ogawa S, Nowak D, Kawamata N, Akagi T, Kato M, Sanada M, Weiss T, Haferlach C, Dugas M, Ruckert C, Haferlach T, and Koeffler HP. Genomic profiling of adult acute lymphoblastic leukemia by single nucleotide polymorphism oligonu- cleotide microarray and comparison to pediatric acute lymphoblastic leukemia. Haematologica 2010;95(9):1481-1488. doi:10.3324/haematol.2009.011114 Online Supplementary Data ed by PCR of genomic DNA and subsequent direct sequencing of SNP in a region of CNN-LOH in an ALL sample versus the corresponding Design and Methods matched normal sample (Online Supplementary -
Homeobox Gene Expression Profile in Human Hematopoietic Multipotent
Leukemia (2003) 17, 1157–1163 & 2003 Nature Publishing Group All rights reserved 0887-6924/03 $25.00 www.nature.com/leu Homeobox gene expression profile in human hematopoietic multipotent stem cells and T-cell progenitors: implications for human T-cell development T Taghon1, K Thys1, M De Smedt1, F Weerkamp2, FJT Staal2, J Plum1 and G Leclercq1 1Department of Clinical Chemistry, Microbiology and Immunology, Ghent University Hospital, Ghent, Belgium; and 2Department of Immunology, Erasmus Medical Center, Rotterdam, The Netherlands Class I homeobox (HOX) genes comprise a large family of implicated in this transformation proces.14 The HOX-C locus transcription factors that have been implicated in normal and has been primarily implicated in lymphomas.15 malignant hematopoiesis. However, data on their expression or function during T-cell development is limited. Using degener- Hematopoietic cells are derived from stem cells that reside in ated RT-PCR and Affymetrix microarray analysis, we analyzed fetal liver (FL) in the embryo and in the adult bone marrow the expression pattern of this gene family in human multipotent (ABM), which have the unique ability to self-renew and thereby stem cells from fetal liver (FL) and adult bone marrow (ABM), provide a life-long supply of blood cells. T lymphocytes are a and in T-cell progenitors from child thymus. We show that FL specific type of hematopoietic cells that play a major role in the and ABM stem cells are similar in terms of HOX gene immune system. They develop through a well-defined order of expression, but significant differences were observed between differentiation steps in the thymus.16 Several transcription these two cell types and child thymocytes. -
Bioinformatics Studies Provide Insight Into Possible Target and Mechanisms of Action of Nobiletin Against Cancer Stem Cells
DOI:10.31557/APJCP.2020.21.3.611 Bioinformatics Studies Provide Insight into Possible Target and Mechanisms of Action of Nobiletin against Cancer Stem Cells RESEARCH ARTICLE Editorial Process: Submission:05/08/2019 Acceptance:03/06/2020 Bioinformatics Studies Provide Insight into Possible Target and Mechanisms of Action of Nobiletin against Cancer Stem Cells Adam Hermawan1*, Herwandhani Putri2 Abstract Objective: Nobiletin treatment on MDA-MB 231 cells reduces the expression of CXC chemokine receptor type 4 (CXCR4), which is highly expressed in cancer stem cell populations in tumor patients. However, the mechanisms of nobiletin in cancer stem cells (CSCs) remain elusive. This study was aimed to explore the potential target and mechanisms of nobiletin in cancer stem cells using bioinformatics approaches. Methods: Gene expression profiles by public COMPARE predicting the sensitivity of tumor cells to nobiletin. Functional annotations on gene lists are carried out with The Database for Annotation, Visualization and Integrated Discovery (DAVID) v6.8, and WEB-based GEne SeT Analysis Toolkit (WebGestalt). The protein-protein interaction (PPI) network was analyzed by STRING-DB and visualized by Cytoscape. Results: Microarray analyses reveal many genes involved in protein binding, transcriptional and translational activity. Pathway enrichment analysis revealed breast cancer regulation of estrogen signaling and Wnt/ß-catenin by nobiletin. Moreover, three hub genes, i.e. ESR1, NCOA3, and RPS6KB1 and one significant module were filtered out and selected from the PPI network. Conclusion: Nobiletin might serve as a lead compound for the development of CSCs-targeted drugs by targeting estrogen and Wnt/ß-catenin signaling. Further studies are needed to explore the full therapeutic potential of nobiletin in cancer stem cells. -
DNA Damage in Neurodegenerative Diseases
Mutation Research 776 (2015) 84–97 Contents lists available at ScienceDirect Mutation Research/Fundamental and Molecular Mechanisms of Mutagenesis j ournal homepage: www.elsevier.com/locate/molmut Comm unity address: www.elsevier.com/locate/mutres Review DNA damage in neurodegenerative diseases ∗ ∗∗ Fabio Coppedè , Lucia Migliore Department of Translational Research and New Technologies in Medicine and Surgery, University of Pisa, Pisa, Italy a r t i c l e i n f o a b s t r a c t Article history: Following the observation of increased oxidative DNA damage in nuclear and mitochondrial DNA Available online 9 December 2014 extracted from post-mortem brain regions of patients affected by neurodegenerative diseases, the last years of the previous century and the first decade of the present one have been largely dedicated to Keywords: the search of markers of DNA damage in neuronal samples and peripheral tissues of patients in early, Alzheimer’s disease intermediate or late stages of neurodegeneration. Those studies allowed to demonstrate that oxidative Parkinson’s disease DNA damage is one of the earliest detectable events in neurodegeneration, but also revealed cytoge- Amyotrophic Lateral Sclerosis netic damage in neurodegenerative conditions, such as for example a tendency towards chromosome DNA damage 21 malsegregation in Alzheimer’s disease. As it happens for many neurodegenerative risk factors the Chromosome damage Epigenetics question of whether DNA damage is cause or consequence of the neurodegenerative process is still open, and probably both is true. The research interest in markers of oxidative stress was shifted, in recent years, towards the search of epigenetic biomarkers of neurodegenerative disorders, following the accu- mulating evidence of a substantial contribution of epigenetic mechanisms to learning, memory processes, behavioural disorders and neurodegeneration. -
SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line -
(12) Patent Application Publication (10) Pub. No.: US 2006/0068395 A1 Wood Et Al
US 2006.0068395A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2006/0068395 A1 Wood et al. (43) Pub. Date: Mar. 30, 2006 (54) SYNTHETIC NUCLEIC ACID MOLECULE (21) Appl. No.: 10/943,508 COMPOSITIONS AND METHODS OF PREPARATION (22) Filed: Sep. 17, 2004 (76) Inventors: Keith V. Wood, Mt. Horeb, WI (US); Publication Classification Monika G. Wood, Mt. Horeb, WI (US); Brian Almond, Fitchburg, WI (51) Int. Cl. (US); Aileen Paguio, Madison, WI CI2O I/68 (2006.01) (US); Frank Fan, Madison, WI (US) C7H 2L/04 (2006.01) (52) U.S. Cl. ........................... 435/6: 435/320.1; 536/23.1 Correspondence Address: SCHWEGMAN, LUNDBERG, WOESSNER & (57) ABSTRACT KLUTH 1600 TCF TOWER A method to prepare synthetic nucleic acid molecules having 121 SOUTHEIGHT STREET reduced inappropriate or unintended transcriptional charac MINNEAPOLIS, MN 55402 (US) teristics when expressed in a particular host cell. Patent Application Publication Mar. 30, 2006 Sheet 1 of 2 US 2006/0068395 A1 Figure 1 Amino Acid Codon Phe UUU, UUC Ser UCU, UCC, UCA, UCG, AGU, AGC Tyr UAU, UAC Cys UGU, UGC Leu UUA, UUG, CUU, CUC, CUA, CUG Trp UGG Pro CCU, CCC, CCA, CCG His CAU, CAC Arg CGU, CGC, CGA, CGG, AGA, AGG Gln CAA, CAG Ile AUU, AUC, AUA Thr ACU, ACC, ACA, ACG ASn AAU, AAC LyS AAA, AAG Met AUG Val GUU, GUC, GUA, GUG Ala GCU, GCC, GCA, GCG Asp GAU, GAC Gly GGU, GGC, GGA, GGG Glu GAA, GAG Patent Application Publication Mar. 30, 2006 Sheet 2 of 2 US 2006/0068395 A1 Spd Sequence pGL4B-4NN3. -
Geminin Deletion Increases the Number of Fetal Hematopoietic Stem Cells by Affecting the Expression of Key Transcription Factors Dimitris Karamitros1,*, Alexandra L
© 2015. Published by The Company of Biologists Ltd | Development (2015) 142, 70-81 doi:10.1242/dev.109454 RESEARCH ARTICLE STEM CELLS AND REGENERATION Geminin deletion increases the number of fetal hematopoietic stem cells by affecting the expression of key transcription factors Dimitris Karamitros1,*, Alexandra L. Patmanidi1,*, Panoraia Kotantaki1, Alexandre J. Potocnik2, Tomi Bähr-Ivacevic3, Vladimir Benes3, Zoi Lygerou4, Dimitris Kioussis2,‡ and Stavros Taraviras1,‡ ABSTRACT hematological stress and challenges (Beerman et al., 2010; Balancing stem cell self-renewal and initiation of lineage specification Cheshier et al., 2007). The prevailing model of hematopoiesis programs is essential for the development and homeostasis of the supports the existence of long-term hematopoietic stem cells (LT- hematopoietic system. We have specifically ablated geminin in the HSCs), which can provide long-term multipotent reconstitution of developing murine hematopoietic system and observed profound the hematopoietic system, and of short-term hematopoietic stem defects in the generation of mature blood cells, leading to embryonic cells (ST-HSCs) or multipotent progenitors (MPPs), with the lethality. Hematopoietic stem cells (HSCs) accumulated in the fetal potential to generate all blood lineages but with reduced self- liver following geminin ablation, while committed progenitors were renewal capacity (Luc et al., 2007; Mebius et al., 2001; Morrison reduced. Genome-wide transcriptome analysis identified key HSC et al., 1995; Randall et al., 1996; Traver et al., 2001). transcription factors as being upregulated upon geminin deletion, Even though it remains unclear how the balance between self- revealing a gene network linked with geminin that controls fetal renewal of HSCs and fate commitment is controlled and how a hematopoiesis.