DOCSLIB.ORG

Gene Expression in Sheep Carotid Arteries: Major Changes with Maturational Development

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Gene Expression in Sheep Carotid Arteries: Major Changes with Maturational Development nature publishing group Basic Science Investigation Articles Gene expression in sheep carotid arteries: major changes with maturational development Ravi Goyal1 and Lawrence D. Longo1 BACKGROUND: With development from immature fetus to individual. In these few moments of parturition, the central near-term fetus, newborn, and adult, the cerebral vasculature circulatory pattern must change from one based on placental undergoes a number of fundamental changes. Although the transfer of respiratory gases to one based on pulmonary ven- near-term fetus is prepared for a transition from an intra- to tilation. Systemic vascular resistance increases dramatically, as extra-uterine existence, this is not necessarily the case with the does arterial blood pressure, while pulmonary vascular resis- premature fetus, which is more susceptible to cerebrovascu- tance and pressure fall. Cardiac (i.e., left-ventricular) output lar dysregulation. In this study, we tested the hypothesis that initially increases and then slowly decreases over succeeding the profound developmental and age-related differences in days. Despite these dramatic changes in cardiac function and cerebral blood flow are associated with significant underlying vascular resistance, blood flow to the brain increases only changes in gene expression. slightly to maintain optimal cerebral oxygenation and metabo- METHODS: With the use of oligonucleotide microarray and lism (4). In addition to the cerebral vasculature, per se, carotid pathway analysis, we elucidated significant changes in the arteries (CAs) play a crucial role in maintaining optimal CBF transcriptome with development in sheep carotid arteries. (5). Studies have demonstrated a significant pressure gradi- RESULTS: As compared with adult, we demonstrate a ent from CAs to cerebral arteries (6), probably to minimize U-shaped relationship of gene expression in major cerebro- the exposure of high pressure to delicate cerebral arteries, and vascular network/pathways during early life, e.g., the level of underscore the importance of CAs in the regulation of CBF. gene expression in the premature fetus and newborn is con- Of note, studies suggest that much of the change in systemic siderably greater than that of the near-term fetus. Specifically, pressure results in dilation/contraction of the large arteries cell proliferation, growth, and assembly pathway genes were that supply the brain (7). Therefore, failure of CAs to effectively upregulated during early life. In turn, as compared with adult, regulate the pressure of the blood reaching delicate cerebral mitogen-activated protein kinase–extracellular regulated arteries may result in their hemorrhagic rupture. Yet other evi- kinase, actin cytoskeleton, and integrin-signaling pathways dence in premature infants suggests that larger arteries are not were downregulated during early life. able to regulate CBF effectively as in near-term babies (5). CONCLUSION: In cranial vascular smooth muscle, highly In general, in an infant born at 37 wk gestation or thereafter, significant changes occur in important cellular and signaling the cerebrovascular physiologic transitions usually occur in a pathways with maturational development. well orchestrated fashion. At younger ages (<37 wk, preterm; <28 wk, extremely preterm), however, they may not occur eurological impairments such as cerebrovascular accidents properly, with resultant CBF dysregulation (8). In addition to Nand transient ischemic attacks are far too common and the changes in cardiovascular dynamics, birth also is associ- increase in prevalence with aging (1). Moreover, in newborn ated with a large number of major changes in circulating con- infants hemorrhage into the germinal matrix and periventric- centrations of a number of vasoactive hormones and metabo- ular region occurs in 2 to 5 per 1,000 live births and is asso- lites (9). These include marked increases in norepinephrine ciated with the development of severe neurological sequelae and epinephrine, cortisol, the prostaglandins (PGF2α, PGI2, such as cerebral palsy, convulsive disorders, and other diseases and PGD2), angiotensin II, thyroid-stimulating hormone, and (2). Among very preterm low birth weight (<32 wk gestation; triiodothyronine, as well as increases in bradykinin, free fatty ≤1,500 g) and particularly among extremely low birth weight acids, and glycerol. In contrast, the concentrations of circulat- (<28 wk gestation; <1000 g) infants, the prevalence of brain ing adenosine, growth hormone, and PGE2 decrease dramati- damage is particularly high (3). These conditions underscore cally (9). Each of these compounds plays an important role in the importance of a well-regulated cerebral blood flow (CBF) the regulation of vascular reactivity, as well as circulation to the during perinatal development. Moreover, the physiologic and brain and other organs. biochemical transitions that occur at the time of birth consti- Of importance, the cerebral vasculature also undergoes a tute the single most dramatic series of events in the life of an number of changes with maturational development. During 1Center for Perinatal Biology, School of Medicine, Loma Linda University, Loma Linda, California. Correspondence: Lawrence D. Longo ([email protected]) Received 27 October 2011; accepted 29 March 2012; advance online publication 20 June 2012. doi:10.1038/pr.2012.57 Copyright © 2012 International Pediatric Research Foundation, Inc. Volume 72 | Number 2 | August 2012 Pediatric RESEarCH 137 Articles Goyal and Longo the past several decades, the studies of others and our stud- As compared with those of adults, in the near-term fetal CAs ies have revealed important aspects in the fundamental sig- fewer genes showed differential regulation. A similar pattern of naling mechanisms that regulate cerebrovascular contractility increased changes in CA gene expression in premature fetus and with maturational development in the fetus and newborn, as newborn lamb with far fewer changes in near-term fetus also was compared with the adult (10,11). Nonetheless, the fundamen- observed in several functional (Figure 1) as well as canonical tal, biochemical, and molecular mechanisms responsible for (Figure 2) gene pathways/networks. Striking is the “U” shaped these developmental changes are poorly understood. Some of pattern of these gene expression responses. The main canoni- the most important mechanistic differences include unique cal pathways altered in early life (premature fetus, near-term features of calcium (Ca2+)-dependent receptor–second mes- fetus, and newborn) as compared with adult were cell-cycle senger coupling with plasma membrane potassium (K+)- and G2/M DNA damage checkpoint regulation, mitotic roles of polo- Ca2+-channels, and the virtual dependence of the immature like kinases, and cyclins and cell-cycle regulation pathways. Of organism on extracellular Ca2+ (as opposed to intracellular relevance, these pathways regulate a number of aspects of cellular Ca2+ stores in the adult) for Ca2+-dependent thick (myosin) growth, proliferation, assembly, DNA replication, cell develop- filament regulation (12). In addition, many elements of the ment, maintenance, and so forth. To validate the relative protein non-Ca2+-dependent pathway of protein kinase C to specific expression as development proceeds, Figure 3 demonstrates that enzymes such as extracellular regulated kinases (ERK1/2) and the CA expression of the proteins stathmin 1, filamin A (FLNA), their downstream effectors differ in the fetus, as compared and myosin light chain kinase in premature fetus, near-term with the adult (13). Taken together, these and differences in fetus, and newborn follows the trend of the microarray analysis. other enzymes and kinases account for the significantly greater Tables 2–4 enumerate the top 20 genes with upregulated Ca2+ sensitivity of the cerebrovascular contractile mechanisms expression in CAs from premature fetus (Table 2), near-term of the fetus and newborn, as compared with the adult. These fetus (Table 3), and newborn lamb (Table 4). Tables 5–7 list the studies also emphasize the need to understand the molecular top 10–20 genes downregulated in CAs from premature fetus basis of these changes. Unfortunately, and of critical impor- (Table 5), near-term fetus (Table 6), and newborn lamb (Table 7), tance, our current understanding of the role of gene expression as compared with adult sheep. Table 8 lists the major genes that underlies cerebrovascular homeostatic mechanisms dur- involved in cellular growth, proliferation, and assembly pathways ing maturational development is extremely limited. that were significantly upregulated during early life. Similarly, To address this vital issue, by use of oligonucleotide microar- Table 9 lists those pathway genes downregulated in early life, as rays and signal pathway analysis, we tested the hypothesis that compared with adult. The downregulated genes belonged to the the profound age-related differences in the cerebral artery integrin, actin cytoskeleton, and protein kinase C-Rho Kinase- reactivity are associated with significant underlying changes in mitogen activated protein kinase (MAPK) pathways. the gene expression. We examined changes in gene expression in the CAs from four age groups of sheep: premature fetus, DIscussION near-term fetus, newborn, and adult. In comparison with those genes in the adult, this study demon- strates the important changes in gene regulation in ovine CAs REsulTs Our results demonstrate profound changes in ovine carotid 15 artery
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • Recombinant MAP2K2 Protein
    Recombinant MAP2K2 protein Catalog No: 81332, 81632 Quantity: 20, 1000 µg Expressed In: Baculovirus Concentration: 0.3 µg/µl Source: Human Buffer Contents: Recombinant MAP2K2 protein is supplied in 25 mM HEPES-NaOH pH 7.5, 300 mM NaCl, 10% glycerol, 0.04% Triton X-100, and 0.5 mM TCEP. Background: MAP2K2 (Mitogen-Activated Protein Kinase Kinase Kinase 2) is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase plays a critical role in mitogen growth factor signal transduction. It phosphorylates and activates MAPK1/ERK2 and MAPK2/ERK3. The activation of this kinase itself is dependent on the Ser/Thr phosphorylation by MAP kinase kinase kinases. Mutations in this gene cause cardiofaciocutaneous syndrome (CFC syndrome), a disease characterized by heart defects, cognitive disability, and distinctive facial features similar to those found in Noonan syndrome. Protein Details: Recombinant MAP2K2 protein was expressed in baculovirus expression system as the full length protein (accession number NP_109587.1) with a N-terminal FLAG Tag. The molecular weight of the protein is 45.7 kDa. Application Notes: This product was manufactured as described in Protein Details. Where possible, Active Motif has developed functional or activity assays for Recombinant MAP2K2 protein gel recombinant proteins. Additional characterization such as enzyme kinetic activity 10% SDS-PAGE with Coomassie blue assays, inhibitor screening or other biological activity assays may not have been staining MW: 45.7 kDa performed for every product. All available data for a given product is shown on the lot- Purity: >90% specific Technical Data Sheet. Storage and Guarantee: Recombinant proteins in solution are temperature sensitive and must be stored at -80°C to prevent degradation.
    [Show full text]
  • Adrenocortical Tumors Have a Distinct Long Non-Coding RNA Expression Profile and LINC00271 Is Downregulated in Malignancy
    Edinburgh Research Explorer Adrenocortical tumors have a distinct long non-coding RNA expression profile and LINC00271 is downregulated in malignancy Citation for published version: Buishand, F, Liu-Chittenden, Y, Fan, Y, Tirosh, A, Gara, S, Patel, D, Meerzaman, D & Kebebew, E 2019, 'Adrenocortical tumors have a distinct long non-coding RNA expression profile and LINC00271 is downregulated in malignancy', Surgery. https://doi.org/10.1016/j.surg.2019.04.067 Digital Object Identifier (DOI): 10.1016/j.surg.2019.04.067 Link: Link to publication record in Edinburgh Research Explorer Document Version: Peer reviewed version Published In: Surgery General rights Copyright for the publications made accessible via the Edinburgh Research Explorer is retained by the author(s) and / or other copyright owners and it is a condition of accessing these publications that users recognise and abide by the legal requirements associated with these rights. Take down policy The University of Edinburgh has made every reasonable effort to ensure that Edinburgh Research Explorer content complies with UK legislation. If you believe that the public display of this file breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. Download date: 07. Oct. 2021 Elsevier Editorial System(tm) for Surgery Manuscript Draft Manuscript Number: 19-AAES-22R2 Title: Adrenocortical tumors have a distinct long non-coding RNA expression profile and LINC00271 is downregulated in malignancy Article Type: AAES Society Paper Section/Category: Basic Research Keywords: LINC00271; adrenocortical; long noncoding RNA; microarray; prognostic marker; gene signaling pathway. Corresponding Author: Dr.
    [Show full text]
  • Identification of Novel Pathways That Promote Anoikis Through Genome-Wide Screens
    University of Massachusetts Medical School eScholarship@UMMS GSBS Dissertations and Theses Graduate School of Biomedical Sciences 2016-10-14 Identification of Novel Pathways that Promote Anoikis through Genome-wide Screens Victoria E. Pedanou University of Massachusetts Medical School Let us know how access to this document benefits ou.y Follow this and additional works at: https://escholarship.umassmed.edu/gsbs_diss Part of the Biology Commons, and the Cancer Biology Commons Repository Citation Pedanou VE. (2016). Identification of Novel Pathways that Promote Anoikis through Genome-wide Screens. GSBS Dissertations and Theses. https://doi.org/10.13028/M27G6D. Retrieved from https://escholarship.umassmed.edu/gsbs_diss/889 This material is brought to you by eScholarship@UMMS. It has been accepted for inclusion in GSBS Dissertations and Theses by an authorized administrator of eScholarship@UMMS. For more information, please contact [email protected]. i TITLE PAGE IDENTIFICATION OF NOVEL PATHWAYS THAT PROMOTE ANOIKIS THROUGH GENOME-WIDE SCREENS A Dissertation Presented By VICTORIA ELIZABETH PEDANOU Submitted to the Faculty of the University of Massachusetts Graduate School of Biomedical Sciences, Worcester in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY OCTOBER 14TH, 2016 CANCER BIOLOGY ii SIGNATURE PAGE IDENTIFICATION OF NOVEL PATHWAYS THAT PROMOTE ANOIKIS THROUGH GENOME-WIDE SCREENS A Dissertation Presented By VICTORIA ELIZABETH PEDANOU This work was undertaken in the Graduate School of Biomedical Sciences Cancer Biology The signature of the Thesis Advisor signifies validation of Dissertation content ___________________________ Michael R. Green, Thesis Advisor The signatures of the Dissertation Defense Committee signify completion and approval as to style and content of the Dissertation __________________________________ Eric H.
    [Show full text]
  • Defining Functional Interactions During Biogenesis of Epithelial Junctions
    ARTICLE Received 11 Dec 2015 | Accepted 13 Oct 2016 | Published 6 Dec 2016 | Updated 5 Jan 2017 DOI: 10.1038/ncomms13542 OPEN Defining functional interactions during biogenesis of epithelial junctions J.C. Erasmus1,*, S. Bruche1,*,w, L. Pizarro1,2,*, N. Maimari1,3,*, T. Poggioli1,w, C. Tomlinson4,J.Lees5, I. Zalivina1,w, A. Wheeler1,w, A. Alberts6, A. Russo2 & V.M.M. Braga1 In spite of extensive recent progress, a comprehensive understanding of how actin cytoskeleton remodelling supports stable junctions remains to be established. Here we design a platform that integrates actin functions with optimized phenotypic clustering and identify new cytoskeletal proteins, their functional hierarchy and pathways that modulate E-cadherin adhesion. Depletion of EEF1A, an actin bundling protein, increases E-cadherin levels at junctions without a corresponding reinforcement of cell–cell contacts. This unexpected result reflects a more dynamic and mobile junctional actin in EEF1A-depleted cells. A partner for EEF1A in cadherin contact maintenance is the formin DIAPH2, which interacts with EEF1A. In contrast, depletion of either the endocytic regulator TRIP10 or the Rho GTPase activator VAV2 reduces E-cadherin levels at junctions. TRIP10 binds to and requires VAV2 function for its junctional localization. Overall, we present new conceptual insights on junction stabilization, which integrate known and novel pathways with impact for epithelial morphogenesis, homeostasis and diseases. 1 National Heart and Lung Institute, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK. 2 Computing Department, Imperial College London, London SW7 2AZ, UK. 3 Bioengineering Department, Faculty of Engineering, Imperial College London, London SW7 2AZ, UK. 4 Department of Surgery & Cancer, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • 1 Metabolic Dysfunction Is Restricted to the Sciatic Nerve in Experimental
    Page 1 of 255 Diabetes Metabolic dysfunction is restricted to the sciatic nerve in experimental diabetic neuropathy Oliver J. Freeman1,2, Richard D. Unwin2,3, Andrew W. Dowsey2,3, Paul Begley2,3, Sumia Ali1, Katherine A. Hollywood2,3, Nitin Rustogi2,3, Rasmus S. Petersen1, Warwick B. Dunn2,3†, Garth J.S. Cooper2,3,4,5* & Natalie J. Gardiner1* 1 Faculty of Life Sciences, University of Manchester, UK 2 Centre for Advanced Discovery and Experimental Therapeutics (CADET), Central Manchester University Hospitals NHS Foundation Trust, Manchester Academic Health Sciences Centre, Manchester, UK 3 Centre for Endocrinology and Diabetes, Institute of Human Development, Faculty of Medical and Human Sciences, University of Manchester, UK 4 School of Biological Sciences, University of Auckland, New Zealand 5 Department of Pharmacology, Medical Sciences Division, University of Oxford, UK † Present address: School of Biosciences, University of Birmingham, UK *Joint corresponding authors: Natalie J. Gardiner and Garth J.S. Cooper Email: [email protected]; [email protected] Address: University of Manchester, AV Hill Building, Oxford Road, Manchester, M13 9PT, United Kingdom Telephone: +44 161 275 5768; +44 161 701 0240 Word count: 4,490 Number of tables: 1, Number of figures: 6 Running title: Metabolic dysfunction in diabetic neuropathy 1 Diabetes Publish Ahead of Print, published online October 15, 2015 Diabetes Page 2 of 255 Abstract High glucose levels in the peripheral nervous system (PNS) have been implicated in the pathogenesis of diabetic neuropathy (DN). However our understanding of the molecular mechanisms which cause the marked distal pathology is incomplete. Here we performed a comprehensive, system-wide analysis of the PNS of a rodent model of DN.
    [Show full text]
  • Identifying Novel Actionable Targets in Colon Cancer
    biomedicines Review Identifying Novel Actionable Targets in Colon Cancer Maria Grazia Cerrito and Emanuela Grassilli * Department of Medicine and Surgery, University of Milano-Bicocca, Via Cadore 48, 20900 Monza, Italy; [email protected] * Correspondence: [email protected] Abstract: Colorectal cancer is the fourth cause of death from cancer worldwide, mainly due to the high incidence of drug-resistance toward classic chemotherapeutic and newly targeted drugs. In the last decade or so, the development of novel high-throughput approaches, both genome-wide and chemical, allowed the identification of novel actionable targets and the development of the relative specific inhibitors to be used either to re-sensitize drug-resistant tumors (in combination with chemotherapy) or to be synthetic lethal for tumors with specific oncogenic mutations. Finally, high- throughput screening using FDA-approved libraries of “known” drugs uncovered new therapeutic applications of drugs (used alone or in combination) that have been in the clinic for decades for treating non-cancerous diseases (re-positioning or re-purposing approach). Thus, several novel actionable targets have been identified and some of them are already being tested in clinical trials, indicating that high-throughput approaches, especially those involving drug re-positioning, may lead in a near future to significant improvement of the therapy for colon cancer patients, especially in the context of a personalized approach, i.e., in defined subgroups of patients whose tumors carry certain mutations. Keywords: colon cancer; drug resistance; target therapy; high-throughput screen; si/sh-RNA screen; CRISPR/Cas9 knockout screen; drug re-purposing; drug re-positioning Citation: Cerrito, M.G.; Grassilli, E.
    [Show full text]
  • Developing Biomarkers for Livestock Science
    Developing biomarkers for livestock Science Ongoing research and future developments Marinus te Pas Outline . Introduction ● What are biomarkers ● Why do we need them . Examples ● omics levels . The future ● Big data ● Systems biology / Synthetic biology 2 Introduction: What are biomarkers? . Biological processes underlie all livestock (production) traits ● Measure the status of a biological process = know the trait! . Can be any molecule in a cell ● No need to know the causal factor for a trait . Well known example: blood glucose level for diabetes Introduction: Why do we need biomarkers? . The mission of WageningenUR: Sustainably produce enough high quality food for all people on the planet with an ecological footprint as low as possible 4 What can the industry do with biomarkers? . Diagnostic tool ● What is the biological mechanism underlying a trait? . Prediction tool ● What outcome can I expect from an intervention? . Monitoring tool ● What is the actual status of a process? . Speed up your process, improve your traits Some examples * Transcriptomics * Proteomics * Metabolomics Why Biomarkers for meat quality? . Meat quality has low heritability (h2=0.1-0.2) ● Predictive capacity of genetic markers low . High environmental influence ● Feed, animal handling (stress), management (housing), ... Meat quality can only be measured after 1-several days post slaughter . Need to differentiate between retail, processing industry, restaurants, .... Biomarkers can do all that and more faster, predictive, .. Example Transcriptomics biomarkers for meat quality . Pork production chain . Biomarkers for traits . High quality fresh pork . Meat colour N production chain ● A* 14 . German Pietrain ● L* 4 (microarray) ● Reflection 10 . Verification: Danish . Drip loss 2 Yorkshire (PCR) . Ultimate pH 6 .
    [Show full text]
  • Research Article Characterization of the Equine Skeletal Muscle
    McGivney et al. BMC Genomics 2010, 11:398 http://www.biomedcentral.com/1471-2164/11/398 RESEARCH ARTICLE Open Access CharacterizationResearch article of the equine skeletal muscle transcriptome identifies novel functional responses to exercise training Beatrice A McGivney1, Paul A McGettigan1, John A Browne1, Alexander CO Evans1,3, Rita G Fonseca2, Brendan J Loftus3, Amanda Lohan3, David E MacHugh1,3, Barbara A Murphy1, Lisa M Katz2 and Emmeline W Hill*1 Abstract Background: Digital gene expression profiling was used to characterize the assembly of genes expressed in equine skeletal muscle and to identify the subset of genes that were differentially expressed following a ten-month period of exercise training. The study cohort comprised seven Thoroughbred racehorses from a single training yard. Skeletal muscle biopsies were collected at rest from the gluteus medius at two time points: T1 - untrained, (9 ± 0.5 months old) and T2 - trained (20 ± 0.7 months old). Results: The most abundant mRNA transcripts in the muscle transcriptome were those involved in muscle contraction, aerobic respiration and mitochondrial function. A previously unreported over-representation of genes related to RNA processing, the stress response and proteolysis was observed. Following training 92 tags were differentially expressed of which 74 were annotated. Sixteen genes showed increased expression, including the mitochondrial genes ACADVL, MRPS21 and SLC25A29 encoded by the nuclear genome. Among the 58 genes with decreased expression, MSTN, a negative regulator of muscle growth, had the greatest decrease. Functional analysis of all expressed genes using FatiScan revealed an asymmetric distribution of 482 Gene Ontology (GO) groups and 18 KEGG pathways.
    [Show full text]
  • Kinetochore Kinesin CENP-E Is a Processive Bi-Directional Tracker of Dynamic Microtubule Tips
    ARTICLES Kinetochore kinesin CENP-E is a processive bi-directional tracker of dynamic microtubule tips Nikita Gudimchuk1,5, Benjamin Vitre2,5, Yumi Kim2,6, Anatoly Kiyatkin1, Don W. Cleveland2, Fazly I. Ataullakhanov3,4 and Ekaterina L. Grishchuk1,7 During vertebrate mitosis, the centromere-associated kinesin CENP-E (centromere protein E) transports misaligned chromosomes to the plus ends of spindle microtubules. Subsequently, the kinetochores that form at the centromeres establish stable associations with microtubule ends, which assemble and disassemble dynamically. Here we provide evidence that after chromosomes have congressed and bi-oriented, the CENP-E motor continues to play an active role at kinetochores, enhancing their links with dynamic microtubule ends. Using a combination of single-molecule approaches and laser trapping in vitro, we demonstrate that once reaching microtubule ends, CENP-E converts from a lateral transporter into a microtubule tip-tracker that maintains association with both assembling and disassembling microtubule tips. Computational modelling of this behaviour supports our proposal that CENP-E tip-tracks bi-directionally through a tethered motor mechanism, which relies on both the motor and tail domains of CENP-E. Our results provide a molecular framework for the contribution of CENP-E to the stability of attachments between kinetochores and dynamic microtubule ends. Accurate chromosome segregation depends on interactions between proportion of lagging chromosomes in anaphase in mouse liver microtubules and the kinetochore, a protein structure localized at cells and embryonic fibroblasts11,17. Fourth, after CENP-E-mediated each centromere1. Initially, kinetochores often attach to the walls congression, CENP-E-dependent localization of protein phosphatase of microtubules with the chromosomes then moving towards a 1 (PP1) to kinetochores is still required for stable microtubule spindle pole in a dynein-dependent manner2,3.
    [Show full text]