DOCSLIB.ORG

Cloning and Expression of Deoxyribonuclease II from Chicken

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Cloning and Expression of Deoxyribonuclease II from Chicken Gene 373 (2006) 44–51 www.elsevier.com/locate/gene Cloning and expression of deoxyribonuclease II1 from chicken☆ ⁎ Kyle S. MacLea, Hans H. Cheng United States Department of Agriculture, Agricultural Research Service, Avian Disease and Oncology Laboratory, 3606 East Mount Hope Road, East Lansing, Michigan 48823, USA Received 21 November 2005; received in revised form 27 December 2005; accepted 28 December 2005 Available online 24 February 2006 Received by M. Batzer Abstract Acid endonucleases of the deoxyribonuclease II (DNase II, EC 3.1.22.1) family have been implicated in the degradation of DNA from apoptotic cell corpses formed in the process of normal mammalian development. Although a predicted DNase II has been detected in the chicken through expressed sequence tag (EST) analysis, to date no homolog of these important enzymes has been identified in vivo in any avian species. Here we report the cloning and expression of DNase II from the chicken, Gallus gallus. When expressed, the 363 amino acid glycoprotein is observed to be approximately 45 kDa in size and to exhibit DNA hydrolytic activity at pH 5 consistent with DNase II in other species. Furthermore, chicken DNase II sequence is compared with an identified partial sequence from the zebra finch, Taeniopygia guttata, as well as the previously identified homologs found in the fowlpox and canarypox viruses and the previously cloned mammalian DNases II. Through analysis of its amino acid sequence, comparative gene structure, and conserved synteny, chicken DNase II appears to represent a member of the DNase IIβ subfamily and the apparent lack of a DNase IIα homolog in the chicken has important evolutionary implications for the study of this gene family. Published by Elsevier B.V. Keywords: DNase II; DNase IIβ; DLAD; Chicken; Fowlpox; Canarypox 1. Introduction have been identified: DNase IIα (Krieser and Eastman, 1998; Baker et al., 1998) and DNase IIβ (also known as DNase II-like DNase II (EC 3.1.22.1) is an endonuclease with an acidic Acid DNase or DLAD) (Shiokawa and Tanuma, 1999; Krieser pH optimum, which has been reported in lysosomes and et al., 2001). Though in these studies DNase IIα was secretions from cells of many organisms (MacLea et al., 2003b; ubiquitously expressed in all the tissues examined, DNase Evans and Aguilera, 2003). In humans and rodents, the IIβ has a more restricted pattern of expression that varies by mammalian organisms in which DNase II has been studied the organism. Both family members play a critical role in most extensively, two members of the DNase II enzyme family degradation of undigested apoptotic cell DNA that normally accumulates during development (Kawane et al., 2001; Krieser Abbreviations: BLAST, basic local alignment search tool; EST, expressed et al., 2002; Nishimoto et al., 2003). In particular, the activities sequence tag; EGFP, enhanced green fluorescent protein; ECL, enhanced encoded by these enzymes are critical steps in the processes of chemiluminescence; βME, β-mercaptoethanol; SRED, single radial enzyme definitive erythropoiesis (DNase IIα) and lens cell differenti- diffusion; SD, standard deviation; TM, tunicamycin; RACE, rapid amplification ation (DNase IIβ). of cDNA ends. ☆ The use of trade, firm, or corporation names in this publication is for the Acid endonuclease activity has also been reported in the information and convenience of the reader. Such use does not constitute an chicken (Torriglia et al., 2001). However, despite the cloning of official endorsement or approval by the United States Department of Agriculture DNase II family members in several mammalian organisms, no or the Agricultural Research Service of any product or service to the exclusion of DNase II homolog has been cloned or purified from an avian others that may be suitable. species. Although our previous work had identified a likely ⁎ Corresponding author. Tel.: +1 517 337 6758; fax: +1 517 337 6776. E-mail address: [email protected] (H.H. Cheng). chicken DNase II in expressed sequence tag (EST) sequences 1 The nucleotide sequence of chicken DNase II reported in this paper is (MacLea et al., 2003a), it had never been identified in vivo available from GenBank, accession number DQ272298. before. Here we report the first cloning and expression of an 0378-1119/$ - see front matter. Published by Elsevier B.V. doi:10.1016/j.gene.2005.12.019 K.S. MacLea, H.H. Cheng / Gene 373 (2006) 44–51 45 active avian DNase II. Isolated from the chicken, Gallus gallus, the full-length cDNA (including some sequence from the 5′ and the study of this avian DNase II has potentially important 3′ untranslated regions) and clone it into a eukaryotic expres- implications for understanding the evolutionary history of the sion vector (Fig. 1). DNase II protein family, especially in light of the recently To perform the PCR amplifications, custom oligonucleotides completed genome draft sequence of the chicken (Hillier et al., were synthesized, desalted, and lyophilized, by Operon Bio- 2004). technologies (Huntsville, Alabama). As shown in the schematic diagram (Fig. 1), these primers were used: 2. Materials and methods KM-D2B-F2 (5′-CGCTCACTGTGCCACGCCGAGATG-3′) 2.1. Database searches KM-D2B-R2 (5′-GCTGTTTGGGAGGAACAGTCC-3′) Using human DNase IIα (AAC77366) and fowlpox Cel1/ DNase II (CAA07012) protein sequences as the query sequences for BLAST (Basic Local Alignment Search Tool), tblastn searches were conducted of GenBank at the National Center for Biotechnology Information (NCBI) website (http:// www.ncbi.nlm.nih.gov/). Further searches for expressed se- quence tags (ESTs) were undertaken using the BBSRC ChickEST Database (http://www.chick.umist.ac.uk/), the Uni- versity of Delaware Chick EST Project (http://www.chickest. udel.edu/), and the Songbird Neurogenomics Initiative EST Project (http://titan.biotec.uiuc.edu/songbird/). Later, to look for further homologues from chicken, the cloned chicken DNase II sequence was also employed as the query sequence for searches of each of these databases and the chicken genome draft sequence (http://www.ensembl.org/Gallus_gallus/). 2.2. Sequence analysis and multiple sequence alignment Sequence analysis and multiple sequence alignments were undertaken using the ClustalW webserver (http://www.ebi.ac. uk/clustalw/)(Chenna et al., 2003). BOXSHADE 3.21 (http:// www.ch.embnet.org/software/BOX_form.html) was used to create and shade the sequence alignment image. To improve clarity in alignments, Adobe Photoshop CS and Adobe Illustrator CS (Adobe Systems, Inc., San Jose, CA) were used to delineate important protein sequence features. Signal peptide predictions used the SignalP 3.0 webserver (http://www.cbs.dtu. dk/services/SignalP/). Gene structure was determined using data from superimposition of the cDNA on the chicken genome draft sequence and illustrated using Adobe Photoshop and Illustrator. 2.3. Cloning of chicken DNase II and plasmid vector construction Fig. 1. Schematic diagram of chicken DNase II cloning and subsequent EST sequences from earlier studies (MacLea et al., 2003a) eukaryotic expression plasmid construction. Briefly, total cellular mRNA from and new database searches (see Section 2.1 above) were line 0 embryos was purified, reverse transcribed, and amplified using specific assembled using Sequencher 4.5 software (Gene Codes, Ann primers (KM-D2B-F2 and -R2) to isolate the chicken DNase II cDNA. This cDNA was introduced into the pCR4 plasmid vector using the TOPO TA kit Arbor, Michigan). These sequence tags contained DNase II (Invitrogen), creating pcD2B-TOPO. A second round of PCR amplification with sequence: BI392355, BG625517, AJ398432, BI066323, different primers (KM-D2B-F1 and -R1) was used to introduce a Kozak BM440623, BM426634, BI064835, CR386219, BU241744, consensus sequence, 3′ Gly–Ala–Gly linker and FLAG (Asp–Tyr–Lys–Asp– BU248722, BU397546, BU240892, CK607806, CK608165, Asp–Asp–Lys) tag sequence, and restriction sites for cloning, creating the BU241430, CV040649, BU299065, BU240964, CV889510, pcD2B-Ex2 vector. To facilitate cloning into a eukaryotic expression vector, pSELECT (InvivoGen), a third set of primers (D2B-pSEL-F1 and -R1) were BU235150, BU457064, BU215085, CF255243, BU473125, used to introduce BamHI and NheI sites for cloning. Two stop codons were CK610893, BU420073, and BU338155. The assembled pre- added at the 3′ end of the FLAG tag as well. The final expression vector was dicted DNase II sequence was used to design primers to amplify named pSELECT-D2B. 46 K.S. MacLea, H.H. Cheng / Gene 373 (2006) 44–51 KM-D2B-F1 (5′-GCGGCCGCACCATGACTGCGAGCTC Rockford, IL) and standardized by serial dilution of bovine TGTGTGGTGC-3′) serum albumen. KM-D2B-R1 (5′-CTCGAGCTTGTCGTCGTCGTCCTTGT AGTCTCCGGCTCCTATC CACGTGGAAGCATCATT-3′). 2.5. Western blot analysis D2B-pSEL-F1 (5′-TATAGGATCCACCATGACTGCGA GCTCTGTGTGGTGC-3′) Cell lysates were examined using the NuPAGE gel D2B-pSEL-R1 (5′-TATAGCTAGCTCAATCACTTGT electrophoresis system (Invitrogen). Lysates were boiled in CGTCGTCGTCCTTGTAGTCT CCGGC-3′). NuPAGE LDS buffer in the presence of β-mercaptoethanol (βME; Sigma) and electrophoresed on a 12% NuPAGE Bis– RNA was prepared using the RNAqueous kit (Ambion, Tris gel using NuPAGE 1× MOPS buffer. Proteins were Austin, Texas) with tissue from 11-day old ADOL Line 0 chick transferred to Immobilon-P polyvinylidene fluoride membrane embryos (Bacon et al., 2000). RACE-ready cDNA was (Millipore, Bedford, Massachusetts) and blocked in TBSTM prepared using the BD SMART RACE cDNA kit (BD [25mM Tris, pH 8, 125mM NaCl, 0.05% tween 20 (v/v), 5%
Load more

Recommended publications
  • Ribonuclease and Deoxyribonuclease Activities in Experimental and Human Tumors by the Histochemical Substrate Film Method*
    Ribonuclease and Deoxyribonuclease Activities in Experimental and Human Tumors by the Histochemical Substrate Film Method* R. DAOUSTJANDHARUKOAMANOÕ (Laboratoires de Recherche, Institut du Cancer de Montréal,Hôpital Notre-Dame et Universitéde Montréal,Montréal,Canada) SUMMARY The ribonuclease and deoxyribonuclease activities of 65 experimental and human tu mors (32 different types) have been examined by histochemical substrate film methods. A same general pattern was obtained for the distribution of both nucleases in the various types of experimental and human tumors. The connective tissue stroma and the necrotic regions of the tumor masses showed various levels of nuclease activity, whereas the neoplastic cells showed no demonstrable activity. It appears that deficien cies in ribonuclease and deoxyribonuclease activities represent general properties of cancer cells. The possible significance of the losses of nuclease activities in carcinogenesis is dis cussed. Studies on nucleases by histochemical methods MATERIALS AND METHODS have shown that losses of ribonuclease (RNase) The experimental tumors used in the present and deoxyribonuclease (DNase) activities take study were mostly rat, mouse, and hamster trans- place in rat liver during azo-dye carcinogenesis (1, plantable tumors (see Table 1). The tumor-bearing 6). The loss of RNase activity is progressive and animals were obtained from commercial or private occurs before parenchymal cells become cancerous, sources, and the tumors were used as supplied or whereas the loss of DNase activity is abrupt and closely associated with the neoplastic transforma TABLE1 tion of parenchymal cells. EXPERIMENTALTUMORS If a loss of RNase or DNase activity plays an important role in tumor formation, the lack of SpeciesRat"""MouseHamsterTumorPrimary demonstrable nuclease activity observed in rat hepatomaNovikoff primary hepatomas should also be observed in a hepatomaWalker variety of tumors.
    [Show full text]
  • HOXB6 Homeo Box B6 HOXB5 Homeo Box B5 WNT5A Wingless-Type
    5 6 6 5 . 4 2 1 1 1 2 4 6 4 3 2 9 9 7 0 5 7 5 8 6 4 0 8 2 3 1 8 3 7 1 0 0 4 0 2 5 0 8 7 5 4 1 1 0 3 6 0 4 8 3 7 4 7 6 9 6 7 1 5 0 8 1 4 1 1 7 1 0 0 4 2 0 8 1 1 1 2 5 3 5 0 7 2 6 9 1 2 1 8 3 5 2 9 8 0 6 0 9 5 1 9 9 2 1 1 6 0 2 3 0 3 6 9 1 6 5 5 7 1 1 2 1 1 7 5 4 6 6 4 1 1 2 8 4 7 1 6 2 7 7 5 4 3 2 4 3 6 9 4 1 7 1 3 4 1 2 1 3 1 1 4 7 3 1 1 1 1 5 3 2 6 1 5 1 3 5 4 5 2 3 1 1 6 1 7 3 2 5 4 3 1 6 1 5 3 1 7 6 5 1 1 1 4 6 1 6 2 7 2 1 2 e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a a S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S HOXB6 homeo box B6 HOXB5 homeo box B5 WNT5A wingless-type MMTV integration site family, member 5A WNT5A wingless-type MMTV integration site family, member 5A FKBP11 FK506 binding protein 11, 19 kDa EPOR erythropoietin receptor SLC5A6 solute carrier family 5 sodium-dependent vitamin transporter, member 6 SLC5A6 solute carrier family 5 sodium-dependent vitamin transporter, member 6 RAD52 RAD52 homolog S.
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2003/0082511 A1 Brown Et Al
    US 20030082511A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2003/0082511 A1 Brown et al. (43) Pub. Date: May 1, 2003 (54) IDENTIFICATION OF MODULATORY Publication Classification MOLECULES USING INDUCIBLE PROMOTERS (51) Int. Cl." ............................... C12O 1/00; C12O 1/68 (52) U.S. Cl. ..................................................... 435/4; 435/6 (76) Inventors: Steven J. Brown, San Diego, CA (US); Damien J. Dunnington, San Diego, CA (US); Imran Clark, San Diego, CA (57) ABSTRACT (US) Correspondence Address: Methods for identifying an ion channel modulator, a target David B. Waller & Associates membrane receptor modulator molecule, and other modula 5677 Oberlin Drive tory molecules are disclosed, as well as cells and vectors for Suit 214 use in those methods. A polynucleotide encoding target is San Diego, CA 92121 (US) provided in a cell under control of an inducible promoter, and candidate modulatory molecules are contacted with the (21) Appl. No.: 09/965,201 cell after induction of the promoter to ascertain whether a change in a measurable physiological parameter occurs as a (22) Filed: Sep. 25, 2001 result of the candidate modulatory molecule. Patent Application Publication May 1, 2003 Sheet 1 of 8 US 2003/0082511 A1 KCNC1 cDNA F.G. 1 Patent Application Publication May 1, 2003 Sheet 2 of 8 US 2003/0082511 A1 49 - -9 G C EH H EH N t R M h so as se W M M MP N FIG.2 Patent Application Publication May 1, 2003 Sheet 3 of 8 US 2003/0082511 A1 FG. 3 Patent Application Publication May 1, 2003 Sheet 4 of 8 US 2003/0082511 A1 KCNC1 ITREXCHO KC 150 mM KC 2000000 so 100 mM induced Uninduced Steady state O 100 200 300 400 500 600 700 Time (seconds) FIG.
    [Show full text]
  • In TCR-Stimulated Thymocytes Induction of Chromosomal DNA Degradation Caspase-Activated Deoxyribonuclease in the Possible Involv
    Possible Involvement of Cyclophilin B and Caspase-Activated Deoxyribonuclease in the Induction of Chromosomal DNA Degradation in TCR-Stimulated Thymocytes This information is current as of September 28, 2021. Takuya Nagata, Hiroyuki Kishi, Qing Li Liu, Tomoyasu Yoshino, Tadashi Matsuda, Zhe Xiong Jin, Kimie Murayama, Kazuhiro Tsukada and Atsushi Muraguchi J Immunol 2000; 165:4281-4289; ; doi: 10.4049/jimmunol.165.8.4281 Downloaded from http://www.jimmunol.org/content/165/8/4281 References This article cites 42 articles, 23 of which you can access for free at: http://www.jimmunol.org/ http://www.jimmunol.org/content/165/8/4281.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on September 28, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2000 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Possible Involvement of Cyclophilin B and Caspase-Activated Deoxyribonuclease in the Induction of Chromosomal DNA Degradation in TCR-Stimulated Thymocytes1 Takuya Nagata,* Hiroyuki Kishi,* Qing Li Liu,* Tomoyasu Yoshino,* Tadashi Matsuda,* Zhe Xiong Jin,* Kimie Murayama,‡ Kazuhiro Tsukada,† and Atsushi Muraguchi2* TCR engagement of immature CD4؉CD8؉ thymocytes induces clonal maturation (positive selection) as well as clonal deletion (negative selection) in the thymus.
    [Show full text]
  • Curcumin Alters Gene Expression-Associated DNA Damage, Cell Cycle, Cell Survival and Cell Migration and Invasion in NCI-H460 Human Lung Cancer Cells in Vitro
    ONCOLOGY REPORTS 34: 1853-1874, 2015 Curcumin alters gene expression-associated DNA damage, cell cycle, cell survival and cell migration and invasion in NCI-H460 human lung cancer cells in vitro I-TSANG CHIANG1,2, WEI-SHU WANG3, HSIN-CHUNG LIU4, SU-TSO YANG5, NOU-YING TANG6 and JING-GUNG CHUNG4,7 1Department of Radiation Oncology, National Yang‑Ming University Hospital, Yilan 260; 2Department of Radiological Technology, Central Taiwan University of Science and Technology, Taichung 40601; 3Department of Internal Medicine, National Yang‑Ming University Hospital, Yilan 260; 4Department of Biological Science and Technology, China Medical University, Taichung 404; 5Department of Radiology, China Medical University Hospital, Taichung 404; 6Graduate Institute of Chinese Medicine, China Medical University, Taichung 404; 7Department of Biotechnology, Asia University, Taichung 404, Taiwan, R.O.C. Received March 31, 2015; Accepted June 26, 2015 DOI: 10.3892/or.2015.4159 Abstract. Lung cancer is the most common cause of cancer CARD6, ID1 and ID2 genes, associated with cell survival and mortality and new cases are on the increase worldwide. the BRMS1L, associated with cell migration and invasion. However, the treatment of lung cancer remains unsatisfactory. Additionally, 59 downregulated genes exhibited a >4-fold Curcumin has been shown to induce cell death in many human change, including the DDIT3 gene, associated with DNA cancer cells, including human lung cancer cells. However, the damage; while 97 genes had a >3- to 4-fold change including the effects of curcumin on genetic mechanisms associated with DDIT4 gene, associated with DNA damage; the CCPG1 gene, these actions remain unclear. Curcumin (2 µM) was added associated with cell cycle and 321 genes with a >2- to 3-fold to NCI-H460 human lung cancer cells and the cells were including the GADD45A and CGREF1 genes, associated with incubated for 24 h.
    [Show full text]
  • Datasheet for T7 Exonuclease (M0263; Lot 0031212)
    Source: Purified from an E. coli strain containing a Unit Assay Conditions: 50 mM potassium Physical Purity: Purified to > 95% homogeneity TYB12 intein fusion acetate, 20 mM Tris-acetate, 10 mM magnesium as determined by SDS-PAGE analysis using T7 Exonuclease acetate, 1mM dithiothreitol (pH 7.9) and 0.15 mM Coomassie Blue detection. Supplied in: 10 mM Tris-HCl (pH 8.0), sonicated duplex [3H] DNA. 0.1 mM EDTA, 5 mM DTT and 50% glycerol. RNase Activity (Extended Digestion): A 10 µl Quality Control Assays 1-800-632-7799 reaction in NEBuffer 4 containing 40 ng of [email protected] Reagents Supplied with Enzyme: Single Stranded Deoxyribonuclease Activity flourescein labeled RNA transcript and 10 units www.neb.com 10X NEBuffer 4. (FAM Labeled Oligo): A 50 µl reaction in of T7 Exonuclease incubated at 37°C. After M0263S 003121214121 NEBuffer 4 containing a 20 nM solution of a incubation for 4 hours, > 90% of the substrate Reaction Conditions: fluorescent internal labeled oligonucleotide and a RNA remains intact as determined by gel minimum of 50 units of T7 Exonuclease incubated 1X NEBuffer 4. electrophoresis using fluorescence detection. M0263S Incubate at 25°C. for 16 hours at 37°C yields < 5% degradation as determined by capillary electrophoresis. 1,000 units 10,000 U/ml Lot: 0031212 Heat Inactivation: No 1X NEBuffer 4: RECOMBINANT Store at –20°C Exp: 12/14 50 mM potassium acetate Endonuclease Activity: Incubation of a 50 µl References: reaction containing 100 units of T7 Exonuclease Description: T7 Exonuclease acts in the 5´ to 20 mM Tris-acetate 1.
    [Show full text]
  • Cleavage and Nuclear Translocation of the Caspase 3 Substrate Rho GDP-Dissociation Inhibitor, D4-GDI, During Apoptosis
    Cell Death and Differentiation (1999) 6, 412 ± 419 ã 1999 Stockton Press All rights reserved 13509047/99 $12.00 http://www.stockton-press.co.uk/cdd Cleavage and nuclear translocation of the caspase 3 substrate Rho GDP-dissociation inhibitor, D4-GDI, during apoptosis 1 ,1 Ronald J Krieser and Alan Eastman* Introduction 1 Department of Pharmacology and Toxicology, Dartmouth Medical School, Apoptosis plays a central role in such processes as Hanover, New Hampshire 03755, USA development, tissue homeostasis, and thymic selection, as * corresponding author: tel: (603)-650-1501; fax: (603)-650-1129; well as pathologies ranging from neurodegenerative disease, e-mail: [email protected] autoimmune disorders, and viral infection, to cancer. Much research on apoptosis has focused on determining proteins involved in decisions of cell fate, and regulation of the Received 17.11.98; revised 15.2.99; accepted 2.3.99 execution phase of cell death involving protease and Edited by G. Salvesen endonuclease activation. A great deal of this information has been gained from the study of small organisms such as Abstract the nematode C. elegans, which has a well-defined developmental program during which specific cells die. The While investigating endonucleases potentially involved in characterization of nematodes with mutations in the cell death apoptosis, an antisera was raised to bovine deoxyribonu- process has led to identification of genes which regulate clease II, but it recognized a smaller protein of 26 kDa protein apoptosis.1 The mammalian homologs have been identified in a variety of cell lines. The 26 kDa protein underwent for many of these regulatory genes.
    [Show full text]
  • Structural Characterization and Subunit Communication Of
    STRUCTURAL CHARACTERIZATION AND SUBUNIT COMMUNICATION OF ESCHERICHIA COLI PYRUVATE DEHYDROGENASE MULTIENZYME COMPLEX By Jaeyoung Song A dissertation submitted to the Graduate School-Newark Rutgers, The State University of New Jersey In partial fulfillment of requirements for the degree of Doctor of Philosophy Graduate Program in Chemistry Written under the direction of Professor Frank Jordan and approved by Newark, New Jersey May, 2011 ABSTRACT OF THE THESIS Structural Characterization and Subunit Communication of Escherichia coli Pyruvate Dehydrogenase Multienzyme Complex By Jaeyoung Song Thesis Director: Professor Frank Jordan The pyruvate dehydrogenase multienzyme complex (PDHc) from Escherichia coli (E. coli) is the best characterized of the 2-oxoacid dehydrogenase complexes. The complex plays a role as catalyst for the conversion of pyruvate to acetyl Coenzyme A (acetylCoA) by three enzyme components in the complex. The complex is comprised of 24 copies of the dimeric pyruvate dehydrogenase (E1ec; 99,474 Da), a cubic core of 24 copies of dihydrolipoamide acetyltransferase (E2ec; 65,959 Da), and 12 copies of dihydrolipoamide dehydrogenase (E3ec; 50,554 Da) (1-3). The crystal structure of the E. coli pyruvate dehydrogenase complex E1 subunit (E1ec) has been deterimined, and there were three missing regions (residues 1-55, 401-413, and 541-557) remaining absent in the model due to high flexibilities of these regions (4). Most bacterial pyruvate dehydrogenase complexes from either Gram-positive or Gram-negative bacteria have E1 components with an 2 homodimeric quaternary structure. In a sequel to our previous publications (5-8), the first NMR study on the flexible regions of the E1 component from Escherichia coli and its biological relevance ii was presented.
    [Show full text]
  • Q 297 Suppl USE
    The following supplement accompanies the article Atlantic salmon raised with diets low in long-chain polyunsaturated n-3 fatty acids in freshwater have a Mycoplasma dominated gut microbiota at sea Yang Jin, Inga Leena Angell, Simen Rød Sandve, Lars Gustav Snipen, Yngvar Olsen, Knut Rudi* *Corresponding author: [email protected] Aquaculture Environment Interactions 11: 31–39 (2019) Table S1. Composition of high- and low LC-PUFA diets. Stage Fresh water Sea water Feed type High LC-PUFA Low LC-PUFA Fish oil Initial fish weight (g) 0.2 0.4 1 5 15 30 50 0.2 0.4 1 5 15 30 50 80 200 Feed size (mm) 0.6 0.9 1.3 1.7 2.2 2.8 3.5 0.6 0.9 1.3 1.7 2.2 2.8 3.5 3.5 4.9 North Atlantic fishmeal (%) 41 40 40 40 40 30 30 41 40 40 40 40 30 30 35 25 Plant meals (%) 46 45 45 42 40 49 48 46 45 45 42 40 49 48 39 46 Additives (%) 3.3 3.2 3.2 3.5 3.3 3.4 3.9 3.3 3.2 3.2 3.5 3.3 3.4 3.9 2.6 3.3 North Atlantic fish oil (%) 9.9 12 12 15 16 17 18 0 0 0 0 0 1.2 1.2 23 26 Linseed oil (%) 0 0 0 0 0 0 0 6.8 8.1 8.1 9.7 11 10 11 0 0 Palm oil (%) 0 0 0 0 0 0 0 3.2 3.8 3.8 5.4 5.9 5.8 5.9 0 0 Protein (%) 56 55 55 51 49 47 47 56 55 55 51 49 47 47 44 41 Fat (%) 16 18 18 21 22 22 22 16 18 18 21 22 22 22 28 31 EPA+DHA (% diet) 2.2 2.4 2.4 2.9 3.1 3.1 3.1 0.7 0.7 0.7 0.7 0.7 0.7 0.7 4 4.2 Table S2.
    [Show full text]
  • Identification of Oxidative Stress-Related Proteins for Predictive Screening of Hepatotoxicity Using a Proteomic Approach
    The Journal of Toxicological Sciences, 213 Vol.30, No.3, 213-227, 2005 IDENTIFICATION OF OXIDATIVE STRESS-RELATED PROTEINS FOR PREDICTIVE SCREENING OF HEPATOTOXICITY USING A PROTEOMIC APPROACH Toshinori YAMAMOTO, Rie KIKKAWA, Hiroshi YAMADA and Ikuo HORII Worldwide Safety Sciences, Pfizer Global Research & Development, Nagoya Laboratories, Pfizer Inc., 5-2 Taketoyo, Aichi 470-2393, Japan (Received January 15, 2005; Accepted April 19, 2005) ABSTRACT — We investigated the effects of three hepatotoxicants, acetaminophen (APAP), amio- darone (AD) and tetracycline (TC), on protein expression in primary cultured rat hepatocytes with toxi- coproteomic approach, which is two-dimensional gel electrophoresis (2DE) and mass spectrometry. The objectives of this study were to search for alternative toxicity biomarkers which could be detected with high sensitivity prior to the appearance of morphological changes or alterations of analytical conventional biomarkers. The related proteins in the process of cell degeneration/necrosis such as cell death, lipid metabolism and lipid/carbohydrate metabolism were mainly affected under exposure to APAP, AD and TC, respectively. Among the differentially expressed proteins, several oxidative stress-related proteins were clearly identified after 24-hr exposure, even though they were not affected for 6-hr exposure. They were glutathione peroxidase (GPX) as a down-regulated protein as well as peroxiredoxin 1 (PRX1) and peroxiredoxin 2 (PRX2) as up-regulated proteins, which are known to serve as antioxidative enzymes in cells. These findings suggested that the focused proteins, GPX and PRXs, could be utilized as biomarkers of hepatotoxicity, and they were useful for setting high throughput screening methods to assess hepato- toxicity in the early stage of drug discovery.
    [Show full text]
  • Supplementary Material Toxicological Impacts and Likely Protein Targets Of
    Supplementary Material Toxicological impacts and likely protein targets of bisphenol A in Paramecium caudatum Marcus V. X. Senra† & Ana Lúcia Fonseca Instituto de Recursos Naturais, Universidade Federal de Itajubá, 37500-903, Itajubá, Minas Gerais – Brazil †To whom correspondence should be addressed – [email protected]; Orcid - 0000-0002-3866- 8837 Table S1. Annotation data on the P. caudatum 3D modelled proteins and their binding energies to BPA. BINDING ID DESCRIPTION CHROMOSOME NT_START NT_END ENERGIES (kcal/mol) PCAU.43c3d.1.P00010012 Tryptophan synthase beta subunit-like PLP-dependent enzyme scaffold_0001 23197 24853 -7.4 PCAU.43c3d.1.P00010015 Ribosomal protein L32e scaffold_0001 26373 26859 -6.2 PCAU.43c3d.1.P00010044 Catalase, mono-functional, haem-containing scaffold_0001 71821 73367 -6.5 PCAU.43c3d.1.P00010050 Dihydroorotate dehydrogenase, class 1/ 2 scaffold_0001 76614 79650 -6.6 PCAU.43c3d.1.P00010054 Serine/threonine/dual specificity protein kinase, catalytic domain scaffold_0001 83399 84653 -6.7 PCAU.43c3d.1.P00010070 Peptidyl-prolyl cis-trans isomerase, FKBP-type scaffold_0001 104909 105387 -5.9 PCAU.43c3d.1.P00010103 V-ATPase proteolipid subunit C-like domain scaffold_0001 168736 169346 -5.6 PCAU.43c3d.1.P00010112 DNA-directed RNA polymerase, RBP11-like dimerisation domain scaffold_0001 180310 181372 -6.0 PCAU.43c3d.1.P00010165 Vacuolar (H+)-ATPase G subunit scaffold_0001 252653 253112 -5.6 PCAU.43c3d.1.P00010176 Coproporphyrinogen III oxidase, aerobic scaffold_0001 262051 263168 -6.7 PCAU.43c3d.1.P00010205 Metalloenzyme,
    [Show full text]
  • However, There Was Substantial Falloff in Terms Of
    446 Technical Briefs accuracy; however, there was substantial falloff in terms disease, myocardial infarction, and ischemic cerebrovascular disease. Six case-control studies from the Copenhagen City Heart Study. Ann Intern Med of performance with new vs used chips. This lowers the 2001;134:941–54. cost per SNP to almost one-third of the cost of using a new 5. Twyman RM, Primrose SB. Techniques patents for SNP genotyping. Pharma- microelectronic chip and more lowers the cost compared cogenomics 2003;4:67–79. 6. Thistlethwaite WA. Rapid genotyping of common MeCP2 mutations with an with RFLP analysis by more than one-half. This is approx- electronic DNA microchip using serial differential hybridization. J Mol Diagn imately the same cost reported by others for detecting 2003;5:121–6. eight SNPs on one test site simultaneously (€1.62 per SNP) 7. Gilles PN, Wu DJ, Foster CB, Dillon PJ, Chanock SJ. Single nucleotide polymorphic discrimination by an electronic dot blot assay on semiconductor (6). It should be noted, however, that purchase of the microchips. Nat Biotechnol 1999;17:365–70. Nanogen NMW 1000 Nanochip Molecular Biology Work- 8. Nagan N, O’Kane DJ. Validation of a single nucleotide polymorphism station is not included in these calculations. genotyping assay for the human serum paraoxonase gene using electroni- cally active customized microarrays. Clin Biochem 2001;34:589–92. The microelectronic chip examined in this study was 9. Sohni YR, Dukek B, Taylor W, Ricart E, Sandborn WJ, O’Kane DJ. Active limited by the number of test sites per chip. Increasing the electronic arrays for genotyping of NAT2 polymorphisms.
    [Show full text]