Structural Characterization and Subunit Communication Of

STRUCTURAL CHARACTERIZATION AND SUBUNIT

COMMUNICATION OF ESCHERICHIA COLI PYRUVATE

DEHYDROGENASE MULTIENZYME COMPLEX

Jaeyoung Song

A dissertation submitted to the Graduate School-Newark

Rutgers, The State University of New Jersey

In partial fulfillment of requirements

for the degree of

Doctor of Philosophy

Graduate Program in Chemistry

Written under the direction of

Professor Frank Jordan

and approved by

Newark, New Jersey

May, 2011

ABSTRACT OF THE THESIS

Structural Characterization and Subunit Communication of

Escherichia coli Pyruvate Dehydrogenase Multienzyme Complex

By Jaeyoung Song

Thesis Director: Professor Frank Jordan

The pyruvate dehydrogenase multienzyme complex (PDHc) from Escherichia coli (E. coli) is the best characterized of the 2-oxoacid dehydrogenase complexes. The complex plays a role as catalyst for the conversion of pyruvate to acetyl Coenzyme A

(acetylCoA) by three enzyme components in the complex. The complex is comprised of

24 copies of the dimeric pyruvate dehydrogenase (E1ec; 99,474 Da), a cubic core of 24 copies of dihydrolipoamide acetyltransferase (E2ec; 65,959 Da), and 12 copies of dihydrolipoamide dehydrogenase (E3ec; 50,554 Da) (1-3). The crystal structure of the E. coli pyruvate dehydrogenase complex E1 subunit (E1ec) has been deterimined, and there were three missing regions (residues 1-55, 401-413, and 541-557) remaining absent in the model due to high flexibilities of these regions (4).

Most bacterial pyruvate dehydrogenase complexes from either Gram-positive or

Gram-negative bacteria have E1 components with an 2 homodimeric quaternary structure. In a sequel to our previous publications (5-8), the first NMR study on the flexible regions of the E1 component from Escherichia coli and its biological relevance ii

was presented. In the study, sequence-specific NMR assignments for six residues in the

N-terminal 1-55 region, and for a glycine in each of the two mobile active center loops of the E1 component, a 200 kDa homodimer was made. This was accomplished by using site-specific substitutions and appropriate labeling patterns, along with a peptide with the sequence corresponding to the N-terminal 1-35 amino acids of the E1 component. To study the functions of these mobile regions, the spectra were also examined in the presence of: (a) a reaction intermediate analog known to affect the mobility of the active center loops, (b) an E2 component construct consisting of a lipoyl domain (LD) and peripheral subunit binding domain (PSBD) and (c) a peptide corresponding to the amino acid sequence of the E2 peripheral subunit binding domain. Deductions from the NMR studies are in excellent agreement with our functional finding, providing clear indication that the N-terminal region of the E1 interacts with the E2 peripheral subunit binding domain, and that this interaction precedes reductive acetylation. The results provide the first structural support to the notion that the N-terminal region of the E1 component of this entire class of bacterial pyruvate dehydrogenase complexes is responsible for binding the E2 component.

Among three components of PDHc, E2ec consists of 24 chains, and in the overall reaction, the lipoyl domain is reductively acetylated by E1ec and pyruvate, and S- acetyldihydrolipoyl domain transfers acetyl group to Coenzyme A leading acetylcoenzyme A production. Even though the precise number of E2 subunits is still ambiguous, in many cases including human PHDc (9), the sum is a multiple of three chains indicating that multiples of chains can affect the acetyl transfer to CoA by interchain acetyl transfer. To answer this question, the E2 component from E. coli

iii

specifically designed with only a single lipoyl domain (LD, 1-lip E2ec), rather than the three lipoyl domains found in the wild type enzyme (3-lip E2ec) was used. Earlier, it was shown that the activities of these two enzymes are virtually the same, while the 1-lip

E2ec provides obvious advantages for mechanistic studies (10). At the same time, it is also important to point out that there indeed are other sources of the E2 component with only a single domain, such as from Mycobacterium tuberculosis.

To study the question, two constructs of the 1-lip E2ec were prepared, one in which the lysine on the LD ordinarily carrying the lipoic acid is changed to alanine

(henceforth K41A), and a second one in which the histidine believed to catalyze the transacetylation in the catalytic domain (CD) is substituted to A or C, H399C and H399A.

The first is incompetent towards posttranslational ligation of the lipoic acid, hence towards reductive acetylation. The second one is incompetent towards acetylCoA formation, by virtue of the absence of the catalytic histidine residue. This is a biochemical version of a classical crossover experiment, as should the reaction proceed within one chain the two constructs should each be inactive either together or individually. On the other hand, should the reaction proceed by an interchain mechanism, addition of the two constructs should produce measurable activity. Both kinetic and mass spectrometric evidence supported the second scenario. Hence, plausible model/explanation for the multiples of three chains present in each E2 component as well as for their assembly was suggested.

ACKNOWLEDGEMENTS

First and foremost, I would like to express my sincere gratitude to my advisor Prof. Frank

Jordan for the continuous support, motivation, enthusiasm, and immense knowledge of my Ph.D study.

I would like to thank to Dr. Natalia Nemeria for the help and the contribution of didomain E2ec, thank to Dr. Yun-Hee Park for the contribution of human didomain and tridomain, and thank to Dr. Sachin Kale for the contribution of His6-tag E1ec.

Last but not least, I would like to thank to my thesis committees, Prof. Edgardo T.

Farinas, Prof. Richard Mendelsohn, and Prof. Darren Hansen for kind consideration of my thesis, to my family for the immense support, to Dr. Lazaros Kakalis for the help with

NMR, to Dr. Roman Brukh for the help with FTMS, and to Anand Balakrishnan for sharing of research interests and discussion.

TABLE OF CONTENTS

ABSTRACT OF THE THESIS ...... ii

ACKNOWLEDGEMENTS ...... v

LIST OF TABLES ...... xii

LIST OF FIGURES ...... xiii

LIST OF SCHEMES...... xvi

ABBREVIATIONS ...... xvii

CHAPTER 1. Structural and Functional Characterization of N-Terminal Region in the

E1ec Component of the Pyruvate Dehydrogenase Complex ...... 1

1.1. INTRODUCTION ...... 1

1.2. MATERIALS and METHODS ...... 6

1.2.1. Materials ...... 6

1.2.2. Plasmid purification ...... 7

1.2.3. Site directed mutagenesis ...... 9

1.2.4. Protein expression ...... 14

1.2.5. Protein purification ...... 16

1.2.6. 1-lip E2ec purification ...... 18

1.2.7. His6-tag didomain of 1-lip E2ec (E21-190) purification ...... 20

1.2.8. Purification of His6-tag lipoyl domain of 1-lip E2ec ...... 22

1.2.9. E3ec purification ...... 23

1.2.10. SDS-PAGE ...... 24

1.2.11. Concentrating protein using Millipore Centriprep Centrifugal Filter Units

1.2.12. Determination of protein concentration by Bradford assay ...... 27

1.2.13. Overall activity measurement ...... 29

1.2.14. Structural analysis of mobile regions of E1ec using Nuclear Magnetic

Resonance ...... 29

1.3. RESULTS ...... 31

1.3.1. Kinetic properties of the C-terminal His6-tag E1ec indicates an acceptable

surrogate for the non His6-tag version ...... 31

1.3.2. 1H-15N TROSY-HSQC spectrum shows well dispersed resonances, but only

a limited number from E1ec ...... 34

1.3.3. Glycine auxotroph assisted in the assignment of resonances to glycines ..... 36

1.3.4. 3D HNCO revealed Glycine 47 in N-terminal region ...... 39

1.3.5. Sequence-specific assignment of glutamine side chain resonances in the N-

terminal region of His6-tag E1ec...... 43

1.3.6. A synthetic peptide with sequence corresponding to the N-terminal 1-35

residues enabled assignment of Gly28 and confirmed that of Trp16...... 46

1.3.7. C-terminally truncated 1-lip E21-190 is competent for assembly with E1

component...... 50

vii

1.3.8. N-Terminal E1ec residues that interact with an N-terminal E2ec construct

according to NMR...... 54

1.3.9. N-Terminal E1ec residues that interact with PSBD and residues that interact

with independently expressed lipoyl domain...... 56

1.4. DISCUSSION ...... 59

1.5. CONCLUSION ...... 62

CHAPTER 2. Structural Evidence of Inner and Outer Dynamic Loops at Active Center of the E1 Component of the Pyruvate Dehydrogenase Complex ...... 65

2.1. INTRODUCTION ...... 65

2.2. MATERIALS and METHODS ...... 67

2.2.1. Materials ...... 67

2.2.2. Plasmid purification and site directed mutagenesis ...... 67

2.2.3. Protein expression and purification ...... 67

2.2.4. Preparation of Apo-His6-tag E1ec ...... 68

2.2.5. Overall activity measurement ...... 68

2.2.6. Circular dichroism (CD) spectroscopy ...... 68

2.2.7. Structural analysis of two loop regions of E1ec using Nuclear Magnetic

Resonance ...... 71

2.3. RESULTS ...... 72

2.3.1. Kinetic characteristics ...... 72

viii

2.3.2. Sequence-specific resonance assignments in the loop region of E1ec ...... 74

2.3.3. Circular dichroism of His6-tag E1ec in the presence of PLThDP ...... 78

2.3.4. Interaction of the flexible active center loops of E1ec with the stable

predecarboxylation intermediate PLThDP...... 81

2.3.5. The specificity of E1ec toward E2ec ...... 84

2.3.6. Quantification of residues identified in the flexible E1ec regions...... 86

2.4. DISCUSSION ...... 87

2.5. CONCLUSION ...... 90

CHAPTER 3. Interchain acetyl transfer in the E2 component of the E. coli pyruvate dehydrogenase complex ...... 91

3.1. INTRODUCTION ...... 91

3.2. MATERIALS and METHODS ...... 94

3.2.1. Materials ...... 94

3.2.2. Plasmid purification and site directed mutagenesis ...... 94

3.2.3. Creation of K41A/H339C, doubly substituted variant ...... 96

3.2.4. Protein expression and purification ...... 96

3.2.5. Measurement of the PDHc activity ...... 96

3.2.6. Mass spectrometric analysis using Fourier Transform Mass Spectrometry

(FTMS) ...... 97

3.2.7. Quantitative analysis of acetylCoA production using FTMS ...... 98

3.3. RESULTS ...... 99

3.3.1. Substitutions of lipoyl-bearing lysine and the putative catalytic histidine

affected the overall PDHc activities...... 99

3.3.2. Complementation of K41A E2ec and H399C E2ec produces overall PDHc

activity...... 99

3.3.3. Activity of the doubly substituted variant...... 100

3.3.4. Mass spectrometric data provide independent support for the production of

acetylCoA in the PDHc reaction by inter-subunit acetyl transfer...... 106

3.3.5. Inter-subunit acetyl transfer in the E2 component is confirmed by FTMS. 107

3.4. DISCUSSION and CONCLUSION ...... 115

CHAPTER 4. Preliminary Studies of Flexible Regions in Various ThDP Dependent

Enzyme...... 121

4.1. INTRODUCTION ...... 121

4.2. MATERIALS and METHODS ...... 123

4.2.1. Materials ...... 123

4.2.2. Plasmid purification ...... 123

4.2.3. Protein expression and purification ...... 123

4.2.4. NMR spectroscopy...... 128

4.3. RESULTS and DISCUSSIONS ...... 129

15 4.3.1. 2D TROSY-HSQC experiment of uniformly N labeled His6-tag y-PDC.129

15 4.3.2. 2D TROSY-HSQC experiment of uniformly N labeled His6-tag E1o ..... 132

15 4.3.3. 2D TROSY-HSQC experiment of uniformly N labeled His6-tag L1L2S and

L2S hE2 ...... 134

4.4. CONCLUSION ...... 140

APPENDIX ...... 141

REFERENCES...... 147

CURRICULUM VITAE………………………………………………………………..160

LIST OF TABLES

Table 1.1 List of the primers for creating variants of

N-terminal region residues...... 13

Table 1.2 Overall activity of N-terminal variants...... 45

Table 1.3 1HN and 15N chemical shifts of assigned residues of the flexible

regions of His6-tag E1ec compared with the reference

chemical shift of random coil...... 47

Table 1.4 Competition of the 1-lip E21-190 with E2-E3 sub-complex for

the E1 component in the assembly into the PDHc...... 52

Table 2.1 List of the primers for creating variants of inner and

outer loop residues...... 70

Table 2.2 Overall activity of loop variants...... 73

Table 2.3 1HN and 15N chemical shifts of assigned residues of the dynamic

active center loops in His6-tag E1ec compared with the reference

chemical shift of random coil...... 75

Table 2.4 Experimentally estimated and theoretical number of resonances

on E1ec in the three flexible regions in the 15N-1H HSQC spectra...... 89

Table 3.1 List of the primers for creating variants of 1-lip E2ec...... 95

Table 3.2 Overall PDHc activity of E2ec variants with various mass ratio...... 101

Table 3.3 Estimated quantity of acetylCoA obtained by single variants

and complemented variants according to FTMS...... 114

xii

LIST OF FIGURES

Figure 1.1 The crystal structure of E1ec...... 5

Figure 1.2 The formation of the pre-decarboxylation intermediate

on the E1ec from MAP...... 33

Figure 1.3 The 2D HSQC spectrum of uniformly 15N labeled type

His6-tag E1ec...... 35

Figure 1.4 The 2D HSQC spectrum of selectively labeled glycine region of

His6-tag E1ec...... 37

Figure 1.5 The superimpsed spectrum of His6-tag E1ec (Black) with only

15N labeled glycine region (red)...... 38

Figure 1.6 Amino acid sequence of the E. coli E1 component...... 40

Figure 1.7 The spectrum presenting sole glycine 47 assigned

by 3D HNCO NMR...... 41

Figure 1.8 The superimpsed spectrum of His6-tag E1ec (Black)

with the spectrum of glycine 47 (red)...... 42

Figure 1.9 Resonance assignment of three sets of Gln sidechains

in 1H-15N-TROSY-HSQC spectra...... 44

Figure 1.10 Far-UV CD spectrum of N-term peptide corresponding

to residues1-35 of E1ec at pH 7 and 5 at 0.10 mg/mL...... 48

Figure 1.11 Superimposed spectrum of His6-tag E1ec (blue)

with the N-terminal 1-35 synthetic peptide (red)...... 49

Figure 1.12 E21-190 (Didomain)...... 53

xiii

Figure 1.13 NMR identification of residues of E1ec interacting

with the E2ec1-190...... 55

Figure 1.14 N-Terminal E1ec residues that interact with PSBD...... 57

Figure 1.15 NMR experiments with independently expressed

lipoyl domain of E2ec...... 58

Figure 1.16 Secondary structure prediction of N-terminal region (1 to 55)...... 64

Figure 2.1 Sequence-specific resonance assignment of G402 on

inner loop region of E1ec...... 76

Figure 2.2 Sequence-specific resonance assignment of G542 on

outer loop region of E1ec...... 77

Figure 2.3 Formation of 1’4’-iminophosphonolactylThDP, a stable

LThDP analogue...... 79

Figure 2.4 CD spectrum of His6-tag E1ec on titration of PLThDP...... 80

Figure 2.5 2D HSQC-TROSY spectra of His6-tag E1ec...... 82

Figure 2.6 NMR spectra for His6-tag E1ec in the presence of PLThDP...... 83

Figure 2.7 The specificity of E1ec toward E2ec...... 85

Figure 3.1 Crossover experiment designed to test interchain acetyl transfer in

E2ec...... 102

Figure 3.2 Activity assay for E2ec variants reconstituted with E1ec and E3ec...... 103

Figure 3.3 Incubation of Lys41Ala with doubly substituted variant...... 104

Figure 3.4 Activity assay for doubly substituted, Lys41Ala/His399Cys, E2ec

variants reconstituted with E1ec and E3ec...... 105

Figure 3.5 ESI-detected FTMS specta of acetylCoA and CoA...... 109

xiv

Figure 3.6 ESI-detected FTMS spectra of acetylCoA at increasing

Concentrations...... 110

Figure 3.7 Standard curve for concentration of acetylCoA...... 111

Figure 3.8 AcetylCoA produced by E2ec variants detected by FTMS...... 112

Figure 3.9 AcetylCoA produced by complementation of K41A E2ec

and H399C E2ec...... 113

Figure 3.10 Activity assay for E2ec variants reconstituted with E1ec and E3ec...... 119

Figure 3.11 The model of three subunits of E2ec for the acetyl transfer

and oxidation of dihydrolipoyl E2ec by E3ec...... 120

Figure 4.1 2D 1H-15N-TROSY-HSQC spectrum of y-PDC...... 131

Figure 4.2 2D 1H-15N-TROSY-HSQC spectrum of E1o...... 133

Figure 4.3 2D 1H-15N-TROSY-HSQC spectrum of L2S hE2...... 136

Figure 4.4 2D 1H-15N-TROSY-HSQC spectrum of L1L2S hE2...... 137

Figure 4.5 Superimposed 2D 1H-15N-TROSY-HSQC spectrum of

L2S hE2 with L1L2S hE2...... 138

Figure 4.6 Superimposed 2D 1H-15N-TROSY-HSQC spectrum of

L2S hE2 with L2S hE2 in the presence of PDK2...... 139

LIST OF SCHEMES

Scheme 1 Mechanism of pyruvate dehydrogenase complex E1 subunit

from E. coli...... 5

Scheme 2 The mechanism of y-PDC...... 130

xvi

ABBREVIATIONS

1-lip E2ec Dihydrolipoamide EDTA Ethylenediamine acetyltrasferase tetraacetic acid (single lipoyl domain) ESI Electrospray ionization 3-lip E2ec Dihydrolipoamide acetyltrasferase (three FAD Flavin adenine lipoyl domain) dinucleotide

AcP- Sodium FPLC Fast protein liquid acetylphosphinate chromatography

AEBSF 4-(2-aminoetyl) FTMS Fourier Transform Mass Benzensulfonyl spectrometry fluoride hE1 E1 component of human AcetylCoA Acetylcoenzyme A pyruvate dehydrogenase multienzyme complex ATP Adenosine triphosphate HPLC High performance liquid CD Circular Dichroism chromatography

CoA Coenzyme A HSQC Heteronuclear single quantum coherence DEAE Dietylaminoetyl IPTG Isopropyl-β-D-1- DTT Dithiothreitol thiogalactopyranoside

E1ec E1 component of Kd Dissociation constant E. coli pyruvate dehydrogenase Kd(ThDP) Apparent coenzyme multienzyme complex dissociation constant

E1o E1 component of Km Michaelis constant E. coli 2-oxoglutarate dehydrogenase multienzyme complex Km(ThDP) Michaelis constant with respect to ThDP E2ec E. coli dihydrolipoamide acetyltrasferase L2S hE2 Human E2 didomain

E3ec E. coli dihydrolipo- LD Lipoyl domain of E. coli amide dehyrogenase dihydrolipoamide acetyltrasferase xvii

L1L2S hE2 Human E2 tridomain ThDP Thiamin diphosphate

LThDP C2α-lactylthiamin Tris Tris(hydroxymethyl) diphosphate aminomethane

MAP Methyl acetylphos- TROSY Transverse relaxation phonate optimized spectroscopy

MES 2-(N-morpholino) nH Hill coefficient ethanesulfonic acid y-PDC Yeast pyruvate NAD+ Nicotinamide adenine decarboxylase dinucleotide (oxidized)

NADH Nicotinamide adenine dinucleotide (reduced)

NMR Nuclear magnetic resonance

PCR Polymerase chain reaction

PDHc Pyruvate dehydrogenase multienzyme complex

PDK Pyruvate dehydrogenase kinase

PLThDP C2α-Phosphonolactyl

thiamin diphosphate

PMSF Phenylmethyl-

sulfonyl fluoride

PSBD Peripheral subunit binding domain

SDS Sodium dodecyl sulfate

SDS-PAGE SDS-polyacrylamide gel electrophoresis

xviii

CHAPTER 1. Structural and Functional Characterization of N-

Terminal Region in the E1ec Component of the Pyruvate

Dehydrogenase Complex

1.1. INTRODUCTION

The pyruvate dehydrogenase complex (PDHc) is a molecular machine consisting of multiple copies of three distinct proteins in bacteria (5MDa) (11, 12). In most bacteria

(both Gram negative and Gram positive), the complex has octahedral symmetry. The

PDHc catalyzes the oxidative decarboxylation of pyruvate according to equation 1:

+ + Pyruvate + CoenzymeA + NAD  AcetylcoenzymeA + CO2 +NADH + H (Eq.1)

The components of the Escherichia coli PDHc have the following roles (equations

2-6) (2, 3, 13). The thiamin diphosphate (ThDP)-dependent E1 component (E1ec, pyruvate dehydrogenase) is an 2 homodimer, and carries out consecutively pyruvate decarboxylation and reductive acetylation of the E2 component (Eq.3); E2 (E2ec, dihydrolipoamide acetyltransferase) has dual function, its covalently attached lipoamide is reductively acetylated by the E1 component and pyruvate, subsequently the acetyl group is transferred to coenzyme A (CoA) and the principal metabolic product acetylCoA is released (Eq.4); E3 (E3ec, dihydrolipoamide dehydrogenase) has tightly bound FAD and

NAD+, it regenerates the lipoamide from the reduced dihydrolipoamide form (Eq.5).

(Scheme 1)

Pyruvate + E1-ThDP-Mg(II)  E1-hydroxyethylidene-ThDP-Mg(II) + CO2 (Eq.2)

E1-hydroxyethylidene-ThDP-Mg(II) + E2-lipoamide  E1-ThDP-Mg(II)+ E2- acetyldihydrolipoamide (Eq.3)

E2-acetyldihydrolipoamide + CoA  E2-dihydrolipoamide + acetyl-CoA (Eq.4)

E2-dihydrolipoamide + E3-FAD  E2-lipoamide + E3-FADH2 (Eq.5)

E3-FADH2 + NAD+  E3-FAD + NADH (Eq.6)

Previously, in our laboratory, the PDHc from E. coli has been studied as a representative of this large class of enzymes (4, 8, 14-16). In the X-ray structure of E1ec with ThDP, there were identified three disordered regions, corresponding to the N- terminal 1-55 residues, to amino acids spanning residues 401-413 (inner active center loop) and 541-557 (outer active center loop) (Figure 1.1) (4). This study aims to show that all three of these regions have important function. To study the function of the amino terminal region of E1ec, earlier work of deKok and colleagues on the related enzyme from Azotobacter vinelandii (17, 18) has been followed, to elucidate the loci of binary interactions in the E1ec-E2ec complex. In an earlier study (5), with E1ec deletion variants (Δ16-25, Δ26-35, Δ36-45 and Δ46-55), single-site substituted variants in the region 7-15, and mass spectrometric analysis were used to confirm that the N-terminal region, while not seen in any X-ray structures of E1ec (4, 6, 19), is important for both overall activity of the complex and for interaction with the E2ec. This study has been extended to the entire N-terminal region of E1ec and here is reported the importance of this region in the interaction with E2ec. In a series of papers (6-8), (a) the functional importance of the two active center loops in the organization of the active center during the reaction sequence and (b) that loop movement is correlated with catalysis were

reported. This study gave structural insights into the possibility that regions too mobile to be seen in the X-ray structure may give rise to resolvable resonances in the NMR spectrum, notwithstanding the size of E1ec (2x886 residues for a Mr of 200,000) (2).

Indeed, these expectations were met. The sequence-specific NMR assignments for six amino acids in the N-terminal region of E1ec, which was made possible by the presence of some remarkably sharp resonances in the 2D HSQC spectra, were acquired. These

„reporters‟ were then examined in the presence of an E2ec construct comprising the lipoyl domain (LD), peripheral subunit-binding domain (PSBD) and hinge regions. The

NMR results provide strong and readily interpretable support for the interaction of the entire N-terminal region of E1ec with the E2ec. The results also clearly show that with such large proteins, the NMR and X-ray results are indeed complementary: what is not seen in the X-ray may be visible in the NMR spectrum and vice versa.

Scheme 1. Mechanism of pyruvate dehydrogenase complex E1 subunit from E. coli.

Figure 1.1. The crystal structure of E1ec (4). In X-ray structure, there are three missing regions, N-terminal (1-55), inner loop (401-413), and outer loop (541-557). These regions are highly disordered with the lack of interpretable electron density.

1.2. MATERIALS and METHODS

1.2.1. Materials

The Wizard® Plus Minipreps DNA purification system was used for purification of DNA

(Promega, Madison, WI). The QuikChange® site-directed mutagenesis kit was used for single-site substitution (Stratagene, La Jolla, CA). Thiamin diphosphate (ThDP), NAD+, coenzyme A, dithiothreitol (DTT), isopropyl β-D-1-thiogalactopyranoside (IPTG), micrococcal nuclease, Deoxyribonuclease I were from USB (Cleveland, OH). Protease inhibitor cocktail tablets supplied in glass vials was from Roche Applied Science

(Indianapolis, IN)

DNA sequencing was done at the Molecular Resource Facility of the New Jersey Medical

School (Newark, NJ). The E. coli AT2457 strain (glycine auxotroph) was from E. coli

Genetic Stock Center (Yale University). E. coli BL21(DE3) cells were from Novagen

(Novagen, EMD Chemicals, Gibbstown, NJ). The synthetic peptide corresponding to the

N-terminal 1-35 amino acids of the E1ec was from SynPep (Dublin, CA). The synthetic peptide with sequence H2N-ATPLIRRLAREFGVNLAKVKGTGRKGRILREDVQAY-

VKEAI-OH corresponding to the E2ec‟s PSBD was from CHI Scientific (Maynard, MA).

RbCa TXN SALTS used to make super-competent cells was from BIO101, Inc. (Vista,

CA). The 18 unlabeled L-amino acids used in the minimal medium were from Sigma-

Aldrich (St Louis, MO), with the exception of L-Lys from EMD Chemicals, Inc. (La

15 13 15 Jolla, CA). N-glycine, [1- C]glycine and NH4Cl were from Cambridge Isotope

Laboratories, Inc. (Andover, MA).

1.2.2. Plasmid purification

Plasmid purification was performed based on protocol of Wizard® Plus Minipreps DNA purification system from Promega (20).

1. Pellet 5-10 mL of cells by centrifugation at 1,400 × g for 10 min. Pour off the supernatant and blot the tube upside-down on a paper towel to remove excess media.

2. Completely resuspend the cell pellet in 400 µL of Cell Resuspension Solution.

Transfer the resuspended cells to a 1.5 mL microcentrifuge tube.

3. Add 400 µL of Cell Lysis Solution and mix by inverting the tube 4 times. The cell suspension should clear immediately.

4. Add 400 µL of Neutralization Solution and mix by inverting the tube several times.

Alternatively, if using an EndA+ strain, add 800 µL of Neutralization Solution, mix by inverting the tube 4 times and incubate at room temperature for 10 min.

5. Centrifuge the lysate at 10,000 × g in a microcentrifuge for 5 min. If a pellet has not formed by the end of the centrifugation, centrifuge an additional 15 min.

6. Pipet 1 mL of the resuspended resin into each barrel of the Minicolumn syringe assembly. (If crystals or aggregates are present, dissolve by warming the resin to 25-

37 °C for 10 min. Cool to 30 °C before use). Thoroughly mix the Wizard® Minipreps

DNA Purification Resin before removing an aliquot.

7. Carefully remove all the cleared lysate from each miniprep and transfer it to the barrel of the Minicolumn/syringe assembly containing the resin. No mixing is required at this stage. The resin and lysate should be in contact only for the time it takes to load the

Minicolumns.

8. Open the stopcocks and apply a vacuum of at least 15 inches of Hg to pull the resin/lysate mix into the Minicolumn. When the entire sample has completely passed through the column, break the vacuum at the source.

If using an EndA+ strain, add 2 mL of 40% isopropanol/4.2M guanidine hydrochloride solution to each column. Apply a vacuum and continue it for 30 s after all of the solution has flowed through the columns. Note that this solution will flow through the column more slowly than the standard Column Wash Solution. After this wash proceed with the standard column wash procedure (Step 9).

9. Add 2 mL of the Column Wash Solution (containing 95% ethanol) to the Syringe

Barrel and reapply the vacuum to draw the solution through the Minicolumn.

10. Dry the resin by continuing to draw a vacuum for 30 s after the solution has been pulled through the column. Do not dry the resin for more than 30 s. Remove the Syringe

Barrel and transfer the Minicolumn to a 1.5 mL microcentrifuge tube. Centrifuge the

Minicolumn at 10,000 × g in a microcentrifuge for 2 min to remove any residual Column

Wash Solution.

11. Transfer the Minicolumn to a new microcentrifuge tube. Add 50 µL of nuclease-free water to the Minicolumn and wait 1 min. Centrifuge the tube at 10,000 × g in a microcentrifuge for 20 s to elute the DNA. The DNA will remain intact on the

Minicolumn for up to 30 min; however, prompt elution will minimize nicking of plasmids in the range of 20kb. For elution of large plasmids (≥10kb), the use of water preheated to 65-70 °C may increase yields. For plasmids ≥20kb, use water preheated to

80 °C.

12. Remove and discard the Minicolumn. DNA is stable in water without addition of buffer if stored at -20 °C or below. DNA is stable at 4 °C in TE buffer. To store the DNA in TE buffer, add 5 µL of 10X TE buffer to the 50 µL of eluted DNA.

13. The concentration of plasmids was measured using ε = 0.050 at 260nm.

1.2.3. Site directed mutagenesis

[1] Primer design

Primers were designed using either DNA strider 1.2.1 or MutaPrimer (PREMIER Biosoft

International, CA)

1) Both mutagenic primers must contain the desired mutation and anneal to the same sequence on opposite strands of the plasmid.

2) Primers ideally should be between 25 and 45 bases in length, with a melting temperature (Tm) of ≥78 °C. Primers longer than 45 bases may be used, but using longer primers increases the likelihood of secondary structure formation, which may affect the efficiency of the mutagenesis reaction.

3) The desired mutation (deletion or insertion) should be in the middle of the primer with

~10–15 bases of correct sequence on both sides.

4) The primers optimally should have a minimum GC content of 40% and should terminate in one or more C or G bases.

5) Lyophilized primers were reconstituted in 25 µL of nuclease free water and the concentration was measured using molar extinction coefficient (ε) = 0.033 at 260nm.

[2] Mutagenesis

Mutagenesis was carried out using the QuikChange® site directed mutagenesis kit (21).

1. Synthesize two complimentary oligonucleotides containing the desired mutation, flanked by unmodified nucleotide sequence. Purify these oligonucleotide "primers" prior to use in the following steps.

2. Prepare the control reaction as indicated below:

5 µL of 10× reaction buffer

2 µL (10 ng) of pWhitescript 4.5-kb control plasmid (5 ng/µL)

1.25 µL (125 ng) of oligonucleotide control primer #1 [34-mer (100 ng/μL)]

1.25 µL (125 ng) of oligonucleotide control primer #2 [34-mer (100 ng/μL)]

1 µL of dNTP mix

39.5 µL of double-distilled water (ddH2O) to a final volume of 50 µL

Then add

1 µL of PfuTurbo DNA polymerase (2.5 U/µL)

3. Prepare the sample reaction(s) as indicated below:

5 µL of 10× reaction buffer

5–50 ng of dsDNA template

125 ng of oligonucleotide primer #1

125 ng of oligonucleotide primer #2

1 μl of dNTP mix

ddH2O to a final volume of 50 µL

Then add

1 µL of PfuTurbo DNA polymerase (2.5 U/µL)

4. If the thermal cycler to be used does not have a hot-top assembly, overlay each reaction with ~30 µL of mineral oil.

5. Set up cycling parameters for the site directed mutagenesis method

Segment 1: 1 cycle at 95ºC for 30 seconds

Segment 2: 16 cycles at 95ºC for 30 seconds, then 55ºC for 1 minute, finally 68ºC for 18 minute/kb of plasmid length

6. Cycle each reaction using the cycling parameter. For the control reaction, use a 5 minute extension time and run the reaction for 18 cycles.

7. Adjust segment 2 of the cycling parameters in accordance with the type of mutation desired. For single amino acid changes, 16 cycles can be used.

8. Following temperature cycling, place the reaction on ice for 2 minutes to cool the reaction ≤ 37 °C

9. Dpn I digestion of the amplification products

1) Add 1 µL of the Dpn I restriction enzyme (10 U/µL) directly to each amplification

reaction below the mineral oil overlay using a small, pointed pipet tip.

2) Gently and thoroughly mix each reaction mixture by pipetting the solution up and

down several times. Spin down the reaction mixtures in a microcentrifuge for 1 minute

and immediately incubate each reaction at 37ºC for 1 hour to digest the parental

supercoiled dsDNA

10. Transformation of XL1-Blue supercompetent cells

1) Gently thaw the XL1-Blue supercompetent cells on ice. For each control and sample

reaction to be transformed, aliquot 50 μl of the supercompetent cells to a prechilled 14 mL BD Falcon polypropylene round-bottom tube.

2) Transfer 1 µL of the Dpn I-treated DNA from each control and sample reaction to separate aliquots of the supercompetent cells. Carefully remove any residual mineral oil from the pipet tip before transferring the Dpn I-treated DNA to the transformation reaction. As an optional control, verify the transformation efficiency of the XL1-Blue supercompetent cells by adding 1 µL of the pUC18 control plasmid (0.1 ng/µL) to a 50

μl aliquot of the supercompetent cells. Swirl the transformation reactions gently to mix and incubate the reactions on ice for 30 minutes.

3) Heat pulse the transformation reactions for 45 seconds at 42 °C and then place the reactions on ice for 2 minutes. This heat pulse has been optimized for transformation in

14 mL BD Falcon polypropylene round-bottom tubes.

4) Add 0.5 mL of NZY+ broth preheated to 42 °C and incubate the transformation reactions at 37 °C for 1 hour with shaking at 225–250 rpm.

5) Plate the appropriate volume of each transformation reaction on agar plates containing the appropriate antibiotic for the plasmid vector. e. g. pWhitescript mutagenesis control: 250 µL, pUC18 transformation control: 5 µL in 200 µL of NZY+ broth, sample mutagenesis: 250 µL on each of two plates (entire transformation reaction). For the mutagenesis and transformation controls, spread cells on LB ampicillin agar plates containing 80 μg/mL X-gal and 20 mM IPTG.

6) Incubate the transformation plates at 37 °C for > 16 hours.

Variant Primer

Q18H 5'-CTCGCGACTGGCTCCATGCGATCGAATCG-3'

Q33H 5'-GGTGTTGAGCGTGCTCATTATCTGATCGACCAACT-3'

Q38H 5'-AGTATCTGATCGACCATCTGCTTGCTGAAGCCC-3'

Table 1.1 List of the primers for creating variants of N-terminal region residues. The substituted bases are underlined.

1.2.4. Protein expression

[1] E1ec

The cell was taken with loop into LB agar plate. After ~16 hours incubation at 37 °C, single colony was transferred into 10 mL of LB medium containing 2 mM sodium acetate,

0.1% glucose, and 50 µg/mL ampicillin and growing at 37 °C at 245 rpm. After overnight

(~16 hours) shaking incubation, 10 mL of cell culture was transferred into 700 mL of same LB medium above, and 700 mL of medium was inoculated up to OD600=0.6-0.8. At desired OD, the cultures were induced with 1.0 mM IPTG, and then the cell culture was harvested after ~16 hours growing, washed with 20 mM KH2PO4 (pH 7.0) and stored at -

20 oC until needed.

[2] His6-tag E1ec

The overnight culture from a single colony on the plate was inoculated into 5 flasks with

700 mL of LB medium in each, containing 50 µg/mL of ampicillin, and cells were grown

o o for 1-2 h to reach an OD650 = 0.6-0.8 at 37 C. The temperature was lowered to 20 C, and 0.50 mM IPTG was added to start protein expression. Cells were collected after ~16 hours growing, washed with 20 mM KH2PO4 (pH 7.0) containing 0.1 M NaCl, and stored at -20 oC.

15 [3] Uniform N labeling of His6-tag E1ec and its variants (22)

20 mL of the overnight culture from a single colony on the LB plate was centrifuged at

5,000 rpm for 10 min. The pellet was washed with minimal medium containing 47 mM

-1 15 Na2HPO4, 22 mM KH2PO4, 8.56 mM NaCl, 1g L N NH4Cl, 2 mM sodium acetate, 1 mM MgSO4, 1 mM CaCl2, 0.4% glucose, and 50 µg/mL ampicillin to exchange LB

medium to M9 minimal medium (23). After 3 times washing, this aliquot was used as an inoculum to inoculate 700 mL of the same minimal medium in 2000 mL Erlenmeyer

o flask at 37 C. After the culture had reached OD600=0.6-0.8, temperature was lowered to

20 oC, and the cultures were induced with 0.5 mM IPTG. After ~16 hours growing at 20 o C, the cells were harvested and washed with the same method as used for His6-tag E1ec wild type above.

15 13 15 [4] Selective N and C- N enrichment of glycine residues in His6-tag E1ec

15 13 15 Selective N and C- N enrichment of glycine residues in His6-tag E1ec was achieved by transformation of the pET-22(b)-E1ec plasmid into the E. coli strain AT2457 glycine auxotroph. The E. coli AT2457 super-competent cells were prepared using RbCa TXN

SALTS. Cells were grown on the minimal medium supplemented with 18 unlabeled L- amino acids (0.50 g alanine, 0.40 g arginine, 0.40 g aspartic acid, 0.05 g cystine, 0.40 g glutamine, 0.65 g glutamic acid, 0.10 g histidine, 0.23 g isoleucine, 0.23 g leucine, 0.42 g lysine hydrochloride, 0.25 g methionine, 0.13 g phenylalanine, 0.10 g proline, 2.10 g serine, 0.23 g threonine, 0.17g tyrosine, and 0.23 g valine) as well as 0.50 g adenine, 0.65 g guanosine, 0.20 g thymine, 0.50 g uracil, 0.20 g cytosine, 1.50 g sodium acetate, 1.50 g succinic acid, 0.50 g NH4Cl, 0.85 g NaOH, and 10.50 g K2HPO4 per 950 mL. After autoclaving, 50 mL of 40% glucose, 4 mL of 1 M MgSO4, 1.0 mL of 0.01 M FeCl3, and

10 mL of a filter-sterilized solution containing 2 mg CaCl2 · 2H2O, 2 mg ZnSO4 · 7H2O,

2 mg MnSO4 · H2O, 50 mg unlabeled L-tryptophan, 50 mg thiamin (B1), 50 mg niacin, 1 mg biotin, and 50 µg/mL ampicillin are added under sterile conditions. 0.35 g.L-1 of 15N- glycine for 15N selective labeling or 0.35 g. L-1 of 15N-glycine plus 0.35 g.L-1 of [1-13C]

glycine for 13C-15N double labeling of E1ec, similarly to that present above for uniform

15 N labeling of His6-tag E1ec (24, 25).

1.2.5. Protein purification

1.2.5.1. E1ec purification

[1] Cell disruption

The frozen pellet at -20 oC was thawed at room temperature for the sonication step. The thawed pellet was resuspended in 40 mL sonication buffer (Appendix 1.1.1 [A]) in a 100 mL beaker. Subsequently, 1.0 mM PMSF and 0.6 mg/mL of lysozyme were added and incubated on ice for 20 min. Then, 1000 Units of DNAse and 500 Units of RNAse were added to disrupt the cellular DNA if needed. After 30 min incubation on ice, the lysate was sonicated on ice with 10 s ON and 10 s OFF pulses for 4 min on the sonicator.

Another pulse cycle can be used if it is necessary. The lysate was then centrifuged for 20 min at 17,000 rpm at 0 oC. After centrifugation, the supernatant was collected and used for ammonium sulfate precipitation.

[B] Ammonium sulfate precipitation

The solution from cell disruption was used for ammonium sulfate precipitation.

Ammonium sulfate was added to lysate up to 30 % saturation slowly for ~10 min with gentle stirring by magnetic stirrer. After 20 min stirring, the precipitate was removed by centrifuging the suspension for 15 min at 17,000 rpm at 0 oC, and the supernatant was collected. Additional ammonium sulfate was added to the solution up to 65 % saturation, and the suspension was stirred for 15 min on ice. The precipitate was separated from

solution by centrifuging the suspension for 15 min at 17,000 rpm at 0 oC. The pellet containing the major fraction of E1ec was then dissolved in ice cold dialysis buffer

(Appendix 1.1.1 [B]) and dialyzed for ~16 hours using 12,000-14,000 MWCO membrane (Spectrapor). After dialysis, the protein fraction was centrifuged to remove unfolded protein and stored at -20 oC until needed for chromatography using FPLC.

[C] Anion exchange chromatography using FPLC

The frozen protein fraction from the above step was thawed for anion exchange chromatography. The thawed protein fraction was centrifuged at 17,000 rpm at 0 oC and filtered through 0.22 micron syringe filter (Millipore, MA) to remove precipitate, and about 15 mL (max total protein 1600 mg) was loaded on Hiload HQ 26/10 column containing a quaternary ammonium gel matrix on an AKTA FPLC (GE Healthcare, NJ).

The sample was then eluted with a linear gradient of 20 to 100 % of buffer (Appendix

1.1.1 [C]). The peaks of interest were then analyzed with SDS PAGE. Additional purification to homogeneity, if required, was performed by applying the protein on a TSK

DEAE-5PW HPLC column and eluting with a linear gradient (0.075-0.5 M) of NaCl in buffer (Appendix 1.1.2 [D]). The purity of protein was judged by SDS PAGE, and the purified protein was stored at -20 oC until needed.

1.2.5.2. His6-tag E1ec purification

[1] Cell disruption

The thawed pellet was dissolved in 30 mL of sonication buffer (Appendix 1.1.2 [A]), and cells were disrupted using the same method as for E1ec purification. Additionally, the

supernatant after cell disruption step was clarified by ultracentrifugation for 30 min at

46,000 rpm at 4 oC.

[2] Purification using Ni2+ Sepharose 6 fast flow column (GE Healthcare, NJ)

The 17-25 mL of the clarified supernatant from ultracentrifugation was applied to Ni2+ column (10 mL PD-2 column with 5 mL of Ni2+ agarose gel) equilibrated with binding buffer (Appendix 1.1.2 [C]) earlier. After the supernatant was applied to the column, 200 mL of the binding buffer was used for washing unbound or weakly bound proteins out from the column tested by Bio-Rad Protein Assay Dye Reagent (Bio-rad, CA).

Subsequently, His6-tag E1ec was eluted with elution buffer (Appendix 1.1.2 [D]).

Fractions from the column were analyzed by Bio-Rad Protein Assay Dye Reagent for protein presence and judged by SDS PAGE for purity of protein. The fractions containing

His6-tag E1ec were collected, concentrated, and dialyzed against the same dialysis buffer as used for E1ec purification. Additional purification, if required, was performed by applying the protein on a TSK DEAE-5PW HPLC column by the same method as used above. The purity of protein was judged by SDS PAGE, and the purified protein was stored at -20 oC until needed.

1.2.6. 1-lip E2ec purification

[A] Protein expression

A single colony from freshly plated cell bank was used to grow the inoculum at 37o C overnight (5-6 culture tubes each of 10 mL medium + 50 µg/mL ampicillin).

Subsequently, it was inoculated in 5-6 shake flasks containing 500 mL LB + 50 µg/mL

ampicillin fortified with 0.1 mM lipoic acid and incubated at 37 oC at 250 rpm until

OD650 reached 0.6-0.8. The cultures were then induced with 1.0 mM IPTG and incubated for additional 4 h. The induced cultures were then harvested by centrifugation (5000 rpm for 5 min) and washed with 20mM KH2PO4 (pH=7.5) containing 0.10 M NaCl and 0.25 mM EDTA. The washed pellet can be stored below -20 o C until used.

[B] Protein purification

1. Gently thaw and resuspend the cell pellet in 50 mL of sonication buffer (Appendix

1.1.3 [A]).

2. Add lysozyme (0.60 mg/mL) and incubate for 20 min on ice with intermittent stirring.

3. Sonicate the cell to disrupt the membrane (4 min total time, 10 s „ON‟ and 10 s „OFF‟).

4. Fractionate the lysate with ammonium sulfate (0-25% and 25-50%) and collect the 25-

50% pellet fraction.

5. Dissolve the pellet in dialysis buffer (Appendix 1.1.3 [B]) and dialyze overnight against 2.0 L of same buffer.

6. Centrifuge the dialyzed protein at 17,000 rpm for 20 min. Add 1000 U DNAse, 500 U

Nuclease and 5 mM MgCl2 and incubate for 1 h on ice.

7. Centrifuge this solution at 17,000 rpm for 20 min and proceed to column chromatography.

8. Apply the clarified protein fraction from step 7 to HiPrep 26 x 60 Sephacryl S-300

High Resolution gel-filtration column pre-equilibrated with three column volumes of

Buffer C (Appendix 1.1.3 [C]) at a flow rate of 1.5 mL/min. The recommended sample load is 0.5-4% of column volume (1.6- 12.8 mL). Store the excess protein at -20 oC.

9. Start the run at 0.2 mL/min and collect the fractions.

10. Check protein presence by UV-Vis and analyze purity with SDS-PAGE.

11. Combine the fractions which show pure E2ec and centrifuge them on the ultracentrifuge for 4 h at 46,000 rpm.

12. Resuspend the pellet in 1.0 mL of buffer C containing additional 0.30 M NaCl

(Appendix 1.1.3 [D]) and keep on ice in the cold room for 15 h.

13. Remove the undissolved protein by centrifugation (17,000 rpm for 20 min) and check for purity with SDS-PAGE.

14. Repeat the steps if purity is unacceptable. The pure protein should be stored at -80 oC.

1.2.7. His6-tag didomain of 1-lip E2ec (E21-190) purification

[1] Protein expression

15 tubes with 10 mL of LB medium containing 50 µg/mL of ampicillin, and single colonies from the plate were grown at 37oC. After ~16 hours, 17.5 mL of the overnight culture was inoculated into 700 mL of LB medium containing 0.2% glucose, 50 µg/mL of ampicillin and 0.30 mM lipoic acid (total 4 flasks volume of 2000 mL with 700 mL of

o LB medium in each). Cells were grown for about 2-2.5 hours at 37 C to OD600 = 0.60-

0.70. IPTG at 0.50 mM was added, and cells were grown for 5-6 hours at 37oC and were collected and washed with 0.050 M KH2PO4 (pH 7.0) containing 0.15 M NaCl. Cell pellets were stored at -20oC until needed.

[2] Cell disruption

Cells (19- 27 g) were dissolved in 40-50 mL of the sonication buffer containing 20 mM

KH2PO4 (pH 7.5), 1 mM benzamidine HCl, 1 mM AEBSF (alternatively, 1 mM PMSF can be used), and 0.30 M NaCl. Lysozyme was added to a final concentration of 0.60 mg/mL, and cells were incubated for 20 min on ice. To avoid DNA contamination, the

DNase (1,000 units) and nuclease (1,000 units) were added together with 5 mM MgCl2, and cells were incubated an additional 40-60 min on ice to digest the DNA. Next the cell was treated by sonication according to protocol, and cells debris were precipitated by centrifugation at 18,000 rpm for 30 min. Centrifugation can be repeated once or twice more to obtain the clear cells extract ready to be applied to the Ni column.

[3] Purification using Ni2+ Sepharose 6 fast flow column

His6-tag E2ec didomain was purified by a method similarly to His6-tag E1ec purification.

The column was washed using 10 column volume binding buffer (pH 7.4) containing 20 mM KH2PO4, 0.5 M NaCl, 1 mM benzamidine HCl, and 20 mM imidazole. Then, cell extract was applied in volume of 35-50 mL on the column, and the column was washed with 10 column volumes of the binding buffer. The bound proteins were eluted using elution buffer (pH 7.4) containing 20 mM KH2PO4, 0.50 M NaCl, 1.0 mM benzamidine

HCl and 150 mM imidazole. Dialysis buffer (pH 7.5) containing 20 mM KH2PO4, 1 mM

EDTA, 1 mM benzamidine HCl, 0.15 M NaCl, and AEBSF (0.1x10-4 M) was used to remove imidazole from purified protein. The didomain was concentrated using a

Centricon 3 (Fisher Scientific) concentration unit.

1.2.8. Purification of His6-tag lipoyl domain of 1-lip E2ec

[1] Protein expression

7-10 tubes (50 mL tube volume) containing 10 mL of LB medium in each plus 50 µg/mL of ampicillin, 0.30 mM lipoic acid, and a single colony on the plate were growth for 16 hours at 37oC. Four 2l flasks containing 800 mL of LB medium plus 50 µg/mL of ampicillin were inoculated with 16 mL of the overnight culture and cells were grown to

o OD650 = 0.6-0.70 at 37 C in about 2 hours. As soon as OD650=0.60-0.70, 0.5 mM of IPTG is added to start the expression of the lipoyl domain. Cells were grown at 37oC for 5 hours and were collected by centrifugation at 5,000-6,000 rpm for 5 min. Cells were washed with 20 mM KH2PO4 (pH 7.5) containing 0.10 M NaCl and stored in freezer.

[2] Cell disruption

Cells (15-26 g) were dissolved in the sonication buffer containing 20 mM KH2PO4 (pH

7.5), 1 mM benzamidine HCl, 0.30 M NaCl and AEBSF (0.25 mM final concentration).

Lysozyme (0.60 mg/mL final concentration) was added and cells were incubated about

20 min on ice. Cells were destroyed by sonication and supernatant was clarified by centrifugation at 17,000 rpm for 30 min. Nucleic acids were precipitated by addition of the streptomycin sulfate (0.6% final concentration) and solution was incubated an additional 20 min on ice. Supernatant was clarified by centrifugation at 17,000 rpm about

20 min.

[3] Purification using Ni2+ Sepharose 6 fast flow column

The purification was performed with the method for didomain E2ec purification with the same binding and eluting buffers above.

1.2.9. E3ec purification

[A] Protein expression

The cell growth and expression of E3ec were the same as described above for 1-lip E2, except the DL-α-lipoic acid was not included in the LB medium. After 4 hours growing, the induced cultures were harvested by centrifugation (5000 rpm for 5 min) and washed with 20mM KH2PO4 (pH=7.0) containing 1 mM EDTA. The washed pellet can be stored below -20 oC until needed.

[2] Protein purification

1. Gently thawed cells were resuspended in sonication buffer (Appendix 1.1.4 [A])

2. Add lysozyme (0.60 mg/mL) and 1 mM PMSF and then incubate for 20 min on ice with intermittent stirring.

3. Sonicate the cells to disrupt the membrane (4 min total time, 10 s „ON‟ and 10 s

„OFF‟).

4. Fractionate the lysate with 40 % ammonium sulfate and collect by centrifugation at

17,000 rpm for 20 min

5. Apply the clarified protein fraction from step 4 to a phenyl-Sepharose High

Performance hydrophobic column (Amersham Pharmacia Biotech, Piscataway, NJ) on the FPLC at room temperature pre-equilibrated with three column volumes of buffer A

(Appendix 1.1.4 [B]) at a flow rate of 4.0 mL/min.

6. A decreasing gradient of ammonium sulfate using buffer B (Appendix 1.1.4 [C]) was applied and E3ec was eluted at 15% saturation of ammonium sulfate.

7. Determination of the purity of protein fractions was performed using SDS-PAGE, and the collected fractions was dialyzed against buffer B. Anion exchange column on FPLC was used if the purity was unacceptable with buffer B and buffer C (Appendix 1.1.4 [C and D]). The pure protein should be stored at -20 oC.

1.2.10. SDS-PAGE

Determination of the purity of protein fractions from the FPLC, HPLC, gel-filtration and

Ni2+ Sepharose 6 fast flow columns was performed using SDS PAGE described in Mini-

PROTEAN® 3 Cell Instruction Manual (26).

[1] Sample preparation

Protein fractions from columns were diluted to less than 3 µg/mL concentration. 95 µL of sample buffer containing 3.8 mL of DI water, 0.5 M Tris-HCl (pH 6.8), 0.8 mL of glycerol, 10 % (w/v) SDS, 0.4 mL of 2-mercaptoethanol, and 1 % (w/v) bromophenol blue in total 8.0 mL was added to 5 µL of appropriately diluted samples, and this mixture was heated for 3 min in boiling water bath.

[2] The procedure for gel casting

1. For E1ec, 7.5 % Laemmli buffer was used. 2.50 mL of 30 % acrylamide/ Bis stock solution in 4.85 mL of deionized water, 2.50 mL of 1.5 M Tris-HCl (pH 8.8), 100 µL of

10 % SDS and 50 µL of 10% APS were combined for making resolving gel. For E2ec,

12 % Laemmli buffer was used. 4.0 mL of 30 % acrylamide/ Bis stock solution and 3.35 mL of DI water was used with same reagents for 7.5 % Laemmli buffer system.

2. 5.0 µL of TEMED was added into this mixture to initiate polymerization. This solution was added to the preassembled case immediately, and ~1 mL DI water was overlaid.

Then, the cast containing resolving gel solution was solidified for 30 min at room temperature.

3. After 30 min at room temperature, overlaid water was decanted from the cast, and 1.33 mL of 30 % acrylamide/ Bis stock solution in 6.10 mL of deionized water, 2.50 mL of

0.5 M Tris-HCl (pH 6.8), 100 µL of 10 % SDS and 50 µL of 10% APS was combined for making stocking gel.

4. 10.0 µL of TEMED was added into this mixture to initiate polymerization. This solution was poured on the top of solidified resolving gel, and sample combs were added on the stocking gel for making sample pockets. This cast containing stocking gel solution was solidified for 30 min at room temperature.

[3] Loading and running samples on SDS-PAGE

1. 30 µL of prepared samples were applied to the gel and allowed to run for 15 min at 80 volts and then for 40 min at 160 volts.

2. The gel was stained with staining solution containing 40 % methanol, 10 % acetic acid and 0.15 % (w/v) Cooamassie blue indicator for 20 min and destained with destaining solution containing 50 % methanol and 10 % acetic acid for 20 min. For better resolution, the destained gel was kept in storage solution containing 7 % acetic acid and 3 % methanol for overnight.

1.2.11. Concentrating protein using Millipore Centriprep Centrifugal Filter Units

Centriprep Centrifugal Filter Units was used for concentrating protein from Fisher described in Centrifugal filter devices user guide (www. millipore.com, Literature #

PR03222)

1. Turn twist-lock cap on sample container counterclockwise, but do not remove it completely. Then slide filtrate collector assembly out and set it aside. While filling the sample container, the membrane surface (on bottom of filtrate collector) is exposed.

When handling, be careful not to touch, scratch, or damage the membrane.

2. Add solution to the sample container up to the fill line on side of container. The maximum volume is 15 mL.

Note: For solutions with particulate material, such as cell suspensions, a starting volume over 5 mL will result in reduced flow rates. For best results when working with a sample having over 10% solids, limit the initial sample volume to 5 mL or less.

3. Make sure the twist-lock cap seats fully onto shoulder of filtrate collector. If necessary, slide cap downward until it stops at shoulder.

4. Carefully insert the capped filtrate collector into sample container, gently pushing down so collector displaces solution. Turn the twist-lock cap clockwise to seal the sample container. Finally, make sure air-seal cap is snug on twist-lock cap.

5. Insert the assembled centriprep device into centrifuge and counterbalance with a similar device. Inspect swinging-bucket rotors for proper clearance before centrifuging.

Any obstruction may result in damage to the centriprep device and possible loss of

sample. For added clearance, the centriprep device may be used in adaptors without rubber cushions.

6. Spin the centriprep device at the appropriate g-force until the fluid levels inside and outside the filtrate collector equilibrate. For concentration applications, see the guidelines for achieving various concentration volumes outlined in the following “Concentration

Times for Dilute Protein Solutions” section.

7. If further concentration is required after equilibration, remove the device from the centrifuge and take off the airseal cap. With vent groove oriented upward, decant the filtrate; replace cap and spin device a second time. For filtration applications, reserve the filtrate.

8. After second spin, decant the remaining filtrate. If further concentration is desired, spin device again; otherwise, proceed to step 9.

9. Loosen the twist-lock cap (turn counterclockwise) and remove filtrate collector.

Withdraw the sample using a pipette, or pour the concentrate into a suitable container.

1.2.12. Determination of protein concentration by Bradford assay

[1] The calibration of Bradford dye reagent

1. Prepare dye reagent by diluting 1 part Dye Reagent Concentrate (Bio-Rad catalog number 500-0006) with 4 parts distilled, deionized (DDI) water. Filter through Whatman

#1 filter (or equivalent) to remove particulates. This diluted reagent may be used for approximately 2 weeks when kept at room temperature.

2. Prepare three to five dilutions of a protein standard (BSA ~1mg/mL), which is representative of the protein solution to be tested. The linear range of the assay for BSA is 0.2 to 0.9 mg/mL.

3. Pipet 50 µL of each standard and sample solution into a clean, dry test tube. Protein solutions are normally assayed in duplicate or triplicate.

4. Add 2.5 mL of diluted dye reagent to each tube and vortex.

5. Incubate at room temperature for at least 5 min. Absorbance will increase over time6.

Measure absorbance at 595 nm.

7. Plot the absorbance as a function of standard (BSA) concentration to make a calibration curve from which concentration of similarly treated unknown could be determined.

[2] The determination of protein concentration

1. Appropriately dilute protein (usually 10x dilution) and pipet 5 µL and 10 µL of diluted protein into clean and dry test tubes to 50 µL of total volume with DI water. Protein solutions were normally assayed in triplicate.

2. Add 2.5 mL of diluted dye reagent to each tube and vortex.

3. Incubate at room temperature for at least 5 min. Absorbance will increase over time.

Measure absorbance at 595 nm.

4. Estimate protein concentration using the equation from the calibration of bradford dye reagent.

1.2.13. Overall activity measurement

Overall activity of wild type E1ec, His6-tag E1ec and its variants were measured by reconstitution with independently expressed E2ec and E3ec components (27). The mass ratio of E1ec: E2ec: E3ec complex was 1:1:1. The Varian DMS 300 spectrophotometer was used to monitor the pyruvate-dependent reduction of NAD+ at 340 nm. The reaction medium contained, in 1 mL buffer containing 0.1 M Tris-HCl, pH 8.0, 1 mM MgCl2, 2 mM sodium pyruvate, 2.5 mM NAD+, 0.1 mM CoA, 0.2 mM ThDP, and 2.6 mM DTT at

30 oC. The reaction was initiated by adding CoA. Steady-state velocities were taken from the linear portion of the progress curve. One unit of activity is defined as the amount of

NADH produced (µM/min/mg E1ec).

For His6-tag E1ec and its variants, protein was incubated with 5 mM ThDP and 10 mM

MgCl2 due to higher Km (Km(ThDP)=0.069 ± 0.005 mM) for ThDP than Km of E1ec

(Km(ThDP)=0.0046 ± 0.00016 mM) indicating His6-tag E1ec requires more substrate to reach half-maximal velocity.

1.2.14. Structural analysis of mobile regions of E1ec using Nuclear Magnetic

Resonance

1.2.14.1. Preparation of sample for NMR spectroscopy

For 2D 1H-15N hetero nuclear quantum coherence (HSQC) experiments, all purified proteins were prepared in shigemi tube (Shigemi Inc, PA). The concentration of His6.tag

E1ec and its variants in the NMR sample was measured using Bio-Rad Protein Assay

Dye Reagent Concentrate (Hercules, CA) described above and adjusted to 20 mg/mL

(subunit concentration = 211 µM) in 0.4 mL of dialysis buffer of E1ec (Appendix 1.1.1

[B]), then 0.15 M NaCl and 7% D2O were added. The pH of the NMR samples was adjusted to 7.0 by the addition of 0.15 M CH3COOH or 0.15 M NaHCO3 and the sample was clarified by centrifugation prior to the NMR experiment.

1.2.14.2. NMR Spectroscopy

All NMR experiments were performed on a Varian INOVA 600 MHz spectrometer at

20 °C. Transverse relaxation-optimized spectroscopy (TROSY) was employed for better resolution of the large molecule. The TROSY experiment is designed to select the component for which the different relaxation mechanisms have almost cancelled, leading to a single, sharp peak in the spectrum. This significantly increases both spectral resolution and sensitivity for the large and complex biomolecules. All data were processed by NMR Pipe (28) and NMR ViewJ (29).

[1] 2D 1H-15N-TROSY-HSQC and HSQC NMR experiments

1 15 15 2D H- N-TROSY-HSQC (30) spectra were recorded for N labeled His6-tag E1ec, all its singly substituted variants, and for the 15N glycine containing variant. 2D 1H-15N-

HSQC (31) spectra were recorded for the 1-35 14N synthetic peptide. TROSY function was removed for better sensitivity of small molecule.

[2] 3D 1H-13C-15N-HNCO NMR experiment

To identify glycine 47 in N-terminal region (1 to 55), 3D 1H-13C-15N-HNCO (32) experiment was performed. TROSY function was not used since 3D HNCO experiment has significant drawback of sensitivity with TROSY function. After acquiring spectrum,

only NH plane from acquired 3D data was processed. Also, non TRSOY-HSQC spectrum of His6-tag E1ec was recorded and it was shifted to TROSY-HSQC spectrum of His6-tag

E1ec to be superimposed with NH plane spectrum containing only one resonance to identify glycine 47.

1 15 [3] 2D H- N-TROSY-HSQC NMR to identify the region of E1ec interacting with E21-190, lipoyl domain and synthetic peptide corresponding peripheral subunit binding domain of

E2ec

For the TROSY-HSQC NMR experiment for complexation between E1ec and E2ec, the

15 N-labeled His6-tag E1ec (20 mg/mL, concentration of subunits = 211 µM) in 20 mM

KH2PO4 (pH 7.0), containing 0.20 mM ThDP, 2.0 mM MgCl2 1.0 mM DTT and 0.50 mM EDTA, was mixed with 1-lip E2ec1-190 (422 µM) in the presence of 0.10 M NaCl

o and 10 mM DTT in a total volume of 0.50 mL, then incubated for 1 h at 25 C. D2O (7%) was added before the NMR spectrum was recorded. Similar conditions and concentrations were used for the experiments on His6-tag E1ec in the presence of PSBD and lipoyl domain.

1.3. RESULTS

1.3.1. Kinetic properties of the C-terminal His6-tag E1ec indicates an acceptable

surrogate for the non His6-tag version

A maximum activity of 35 ± 0.53 µmol.min-1.mg-1 of E1ec (67% compared with

52.4 µmol.min-1.mg-1 E1ec for the non-His-tag E1ec) was detected in the overall PDHc reaction on reconstitution with E2ec and E3ec components in the presence of 5 mM

ThDP and 10 mM MgCl2. In the absence of ThDP and MgCl2 the activity was 12 ± 0.21 units/mg of E1 (34%). The same overall activity resulted with the His6-tag E1ec, E2ec and E3ec components assembled into the PDHc at a ratio of 1:1:1, 1:2:2, 1:3:3 or 1:4:4.

The Apo-His6-tag E1ec (free of ThDP) was reconstituted with ThDP with Km,ThDP = 69 ±

5 µM as compared with Km,ThDP = 1.6 ± 0.06 μM for non-His6-tagged E1ec, showing a significantly reduced affinity for ThDP.

Circular dichroism titration of the His6-tag E1ec with MAP (Figure 1.2) again revealed formation of the 1‟,4‟-iminophosphonolactyl-ThDP at 304 nm, with S0.5, MAP =

4.96 ±0.32 µM as compared with 0.159±0.05 µM with non-His6-tag E1ec. Formation of

1‟,4‟-iminophosphinolactyl-ThDP on titration of His6-tag E1ec with sodium

- - - acetylphosphinate (AcP ) gave a Kd,AcP = 1.59 ± 0.54 µM as compared with Kd,AcP =

0.062 µM for non-His6-tag E1ec (15). Using stopped-flow CD, the rates of 1‟,4‟- iminophosphinolactyl-ThDP formation of 3.0 ± 0.51 s-1 and 0.85 ± 0.10 s-1 were determined as compared with 4.44± 0.34 s-1 and 0.593 ± 0.064 s-1 reported from our lab for non-His6-tag E1ec (15). In summary, the C-terminal His6-tag affected Kd, but not the rates of formation of PLThDP. These results show that the C-terminal His6-tag E1ec is an acceptable surrogate for the non-His tag version and could be used for the NMR studies.

Figure 1.2. The formation of the pre-decarboxylation intermediate on the E1ec from

MAP. E1ec (concentration of active centers = 12.8 µM) was titrated with MAP (1-100

µM) in 20 mM KH2PO4 (pH 7.0) containing 0.20 mM ThDP and 1 mM MgCl2. CD spectra were obtained on subtraction of the spectrum of E1ec in the absence of MAP.

Inset: Dependence of the CD at 304 nm on the [MAP] / [E1ec active centers] ratio.

1.3.2. 1H-15N TROSY-HSQC spectrum shows well dispersed resonances, but only a

limited number from E1ec

The lack of interpretable electron density for residues 1-55, 401-413, and 541-557 in the high-resolution X-ray structure of E1ec (4) implied that these regions are highly disordered, at the same time suggesting that perhaps they could be sufficiently mobile to give rise to narrow NMR signals due to fast exchange phenomenon. Guided by this

1 15 15 hypothesis, the H- N-TROSY-HSQC spectrum of a uniformly N labeled His6-tag

E1ec was recorded and processed (Figure 1.3). In this spectrum, a tryptophan NH resonance was observed with 1H chemical shift of ~ 10.12 ppm and 15N chemical shift of

~ 130.55 ppm, assignable to the sole tryptophan Trp16 present in the three missing regions (4). Using the program NMRViewJ peak counting with the same noise filtration for all spectra, 103 and 101 resonances were observed with/without ThDP respectively which nearly corresponded to the 109 resonances expected from the three missing regions of the X-ray structure indicating the numbers anticipated in the three flexible regions account for all of the observations within experimental error.

15 Figure 1.3. The 2D HSQC spectrum of uniformly N labeled type His6-tag E1ec. The large protein (100 kDa x 2) displays a limited number of well dispersed and resolved peaks on the 2D HSQC spectrum. The number of resonances indicates that they may represent only mobile regions (N-terminal and two loop regions). The sole tryptophan in mobile regions is clearly seen. Overall peak region of 1H is narrow indicating that these regions of the protein are in random conformation.

1.3.3. Glycine auxotroph assisted in the assignment of resonances to glycines

There were well-resolved resonances observed at 1H 8–8.6 ppm, 15N 108–111 ppm, the region most often populated by glycines. This hypothesis was confirmed for

E1ec by the use of a glycine auxotroph, enabling us to label with 15N only the glycine backbone nitrogen atoms, but of no other amino acids as seen in Figure 1.4. The glycine auxotroph strain containing 6 mutations knocks down scrambling between glycine and serine using glyA genotype. To produce specifically 15N glycine labeled E1ec, 15N glycine was introduced to the supplemented medium. This spectrum when superimposed

15 on the spectrum of the uniformly N labeled His6-tag E1ec (Figure 1.5), enabled us to identify glycine residues in the mobile regions.

Figure 1.4. The 2D HSQC spectrum of selectively labeled glycine region of His6-tag

E1ec. Only 15N labeled glycines are present on the spectrum using glycine auxotrophic strain.

15 Figure 1.5. The superimpsed spectrum of His6-tag E1ec (Black) with only N labeled glycine region (red). Two spectra are superimposed, and the glycine region of His6-tag

E1ec is assigned.

1.3.4. 3D HNCO revealed Glycine 47 in N-terminal region

There are five adjacent Gly-Gly pairs (Figure 1.6) in the E1ec sequence (46-47,

104-105, 133-134, 362-363 and 625-626), of which only Gly46-Gly47 is located in the flexible regions according to crystallographic B factors (for the other Gly-Gly pairs there is well defined electron density). To identify the glycine resonance corresponding to position 47, a 1H-15N-13C triple resonance 3D HNCO NMR experiment was employed.

15 All glycines in His6-tag E1ec were labeled by having an equimolar concentration of N- labeled and [C1-13C] labeled glycine in the medium (see Experimental Procedures), and the NH plane was processed from the 3D data (Figure 1.7). The 1H-15N-TROSY-HSQC spectrum of His6-tag E1ec was compared to the non-TROSY spectrum of the same protein (Figure 1.8). Since there is only a single pair of adjacent glycines in the mobile regions, there should be only one 15N-1H (of Gly47) directly bonded to a 13CO (of Gly46) giving rise to a unique resonance in the 3D HNCO NMR experiment, as is indeed the case in Figure 1.7. This resonance was superimposed on the 1H-15N-TROSY-HSQC

15 spectrum of the uniformly N labeled His6-tag E1ec, and the NH corresponding to residue Gly47 was assigned (Figure 1.8).

1 SERFPNDVDP IETRDWLQAI ESVIREEGVE RAQYLIDQLL AEARKGGVNV AAGTGISNYI

61 NTIPVEEQPE YPGNLELERR IRSAIRWNAI MTVLRASKKD LELGGHMASF QSSATIYDVC

121 FNHFFRARNE QDGGDLVYFQ GHISPGVYAR AFLEGRLTQE QLDNFRQEVH GNGLSSYPHP

181 KLMPEFWQPT VSMGLGPIGA IYQAKFLKYL EHRGLKDTSK QTVYAFLGDG EMDEPESKGA

241 ITIATREKLD NLVFVINCNL QRLDGPVTGN GKIINELEGI FEGAGWNVIK VMWGSRWDEL

301 LRKDTSGKLI QLMNETVDGD YQTFKSKDGA YVREHFFGKY PETAALVADW TDEQIWALNR

361 GGHDPKKIYA AFKKAQETKG KATVILAHTI KGYGMGDAAE GKNIAHQVKK MNMDGVRHIR

421 DRFNVPVSDA DIEKLPYITF PEGSEEHTYL HAQRQKLHGY LPSRQPNFTE KLELPSLQDF

481 GALLEEQSKE ISTTIAFVRA LNVMLKNKSI KDRLVPIIAD EARTFGMEGL FRQIGIYSPN

541 GQQYTPQDRE QVAYYKEDEK GQILQEGINE LGAGCSWLAA ATSYSTNNLP MIPFYIYYSM

601 FGFQRIGDLC WAAGDQQARG FLIGGTSGRT TLNGEGLQHE DGHSHIQSLT IPNCISYDPA

661 YAYEVAVIMH DGLERMYGEK QENVYYYITT LNENYHMPAM PEGAEEGIRK GIYKLETIEG

721 SKGKVQLLGS GSILRHVREA AEILAKDYGV GSDVYSVTSF TELARDGQDC ERWNMLHPLE

781 TPRVPYIAQV MNDAPAVAST DYMKLFAEQV RTYVPADDYR VLGTDGFGRS DSRENLRHHF

841 EVDASYVVVA ALGELAKRGE IDKKVVADAI AKFNIDADKV NPRLA

Figure 1.6. Amino acid sequence of the E. coli E1 component. Five adjacent Gly-Gly pairs are highlighted in red.

Figure 1.7. The spectrum presenting sole glycine 47 assigned by 3D HNCO NMR. The adjacent Gly-Gly pairs could be indentified using 3D HNCO with equimolar concentration of 15N-labeled and [C1-13C] labeled glycine. Since only Gly46-Gly47 pair among five adjacent pairs is in a flexible region, sole glycine 47 is present on the spectrum.

Figure 1.8. The superimpsed spectrum of His6-tag E1ec (Black) with the spectrum of glycine 47 (red). The spectrum of NH plane of 3D HNCO is superimposed with E1ec, and glycine 47 in mobile region is assigned.

1.3.5. Sequence-specific assignment of glutamine side chain resonances in the N-

terminal region of His6-tag E1ec.

Glutamine and asparagine side chains are characterized by a pair of resonances with the same 15N but different 1H chemical shifts, due to slow rotation around the amide bond on the NMR time scale. The chemical shift regions are 6.6 – 7.7 ppm for 1H and

15 115 – 118 ppm for N in the spectrum of His6-tag E1ec. Site-directed mutagenesis was carried out, substituting glutamine with histidine at positions 18, 33 and 38, and uniformly 15N-labeled enzymes were prepared for each E1ec variant. The activities of the

PDHc-ec complex with these substitutions (Table 1.2) were (in parentheses is indicated the % compared to His6-tag E1ec): Gln18His (100%), Gln33His (55%) and Gln38His

(66%), indicating no significant effect on the activity since ThDP enzymes accelerate the rates by 1012-13 (33). The dispersion of the resonances was essentially superimposable on those for E1ec, confirming no change in secondary or tertiary structure with the substitutions. Next, a 1H-15N-TROSY-HSQC spectrum was acquired for each variant and compared with the E1ec spectrum. Each resonance could be assigned to a specific glutamine in the sequence from such comparisons (Figure 1.9); with each substitution a set of two peaks with the same 15N chemical shift but different 1H chemical shift were missing.

Figure 1.9. Resonance assignment of three sets of Gln sidechains in 1H-15N-TROSY-

HSQC spectra. (a,b) Superimposed spectra of His6-tag E1ec (black) and Q18H variant

(red); (c,d) Superimposed spectra of E1ec (black) and Q33H variant (red), and (e, f)

Superimposed spectra of E1ec (black) and Q38H variant (red).

Table 1.2. Overall activity of N-terminal variants. The production of NADH was monitored at 340 nm. 1u activity = 1µmol NAD+ reduced/min/mg E1ec.

1.3.6. A synthetic peptide with sequence corresponding to the N-terminal 1-35

residues enabled assignment of Gly28 and confirmed that of Trp16.

A peptide corresponding to the N-terminal 1-35 amino acids of E1ec was synthesized (SERFPNDVDPIETRDWLQAI ESVIREEGVERAQYL) (N-term peptide; mass 4161.4 Da, theory 4161.6 Da). The CD spectrum of N-term peptide exhibits the negative band at 200 nm at pH 7.0, characteristic of unfolded peptides. Two negative bands were observed at 222 nm and 206 nm at pH 5.0, characteristic of α-helix conformation (Figure 1.10). To determine if the synthesized peptide forms a functional binding domain, the E2ec-E3ec sub-complex was incubated with 0.050-1 mM concentrations of N-term peptide. On reconstitution of E2ec-E3ec sub-complex with

E1ec, approximately 40 % of activity was lost indicating that the N-term peptide competes with E1ec for binding to E2ec. The limited inhibition suggests that N-term peptide is insufficient in length to fully mimic the N-terminal region of E1ec.

Next, 2D 1H-15N-HSQC experiment (non-TROSY this time to provide better sensitivity) of the unlabeled N-term peptide (7.6 mM) was performed. The peptide gave an excellent 2D HSQC spectrum (Figure 1.11), notwithstanding the low 15N natural abundance (0.36%). The spectrum was aligned to the TROSY spectrum of His6-tag E1ec for comparison leading to several conclusions: (1) The narrow dispersion of the resonances suggest that both the synthetic peptide and the N-terminal region of E1ec (and dynamic regions in general) are in the random conformation; (2) Two residues are immediately assignable: Trp16 and Gly28 NH (Table 1.3), also providing 1H and 15N chemical shifts for the random coil form of the Trp16 side chain.

Random coli chemical shifts Observed chemical shifts

at pH 5a at pH 7

Residue 15N(ppm) Residue 1HN (ppm) 15N(ppm)

Gly28 8.454 110.9 Glycine 109.30 Gly47 8.294 110.3 6.785 Gln18 113.7 7.454 6.901 Glutamine 111.84 Gln33 114.1 7.596 7.030 Gln38 114.8 7.692 Tryptophan 129.38 Trp16 10.12 130.6 aRandom coil chemical shifts reported for glycine in ref 36, for Gln and Trp side chains from Biological Magnetic Resonance Data Bank at University of Wisconsin-Madison.

Table 1.3. 1HN and 15N chemical shifts of assigned residues of the flexible regions of

His6-tag E1ec compared with the reference chemical shift of random coil

Figure 1.10. Far-UV CD spectrum of N-term peptide corresponding to residues1-35 of

E1ec at pH 7 and 5 at 0.10 mg/mL.

Figure 1.11. Superimposed spectrum of His6-tag E1ec (blue) with the N-terminal 1-35 synthetic peptide (red). They are relatively matched on the spectrum enabling confirmation of the Trp16 NH and assignment of Gly28 since there is a sole glycine in among the N-terminal 1-35 residues.

1.3.7. C-terminally truncated 1-lip E21-190 is competent for assembly with E1

component.

Since the E. coli E2 component is difficult to deal with because of oligomerization, C-terminally truncated 1-lip E21-190 has been created (Figure 1.12) comprising the lipoyl domain, peripheral subunit-binding domain (PSBD), linkers and three amino acids extension into the N-terminal region of the catalytic domain (1-lip E21-

190, theoretical mass of 19,703 Da ) by Dr. Natalia Nemeria in our laboratory. The 1-lip

E21-190 migrates mostly as a trimer on the analytical size exclusion column with approximate molecular mass of 56,389 Da (the theoretical mass of 1-lip E2 1-190 = 19,703

Da). Both kinetic and analytical size exclusion experiments suggested that the 1-lip E21-

190 interacts with the E1ec component: 1). It was demonstrated that truncated 1-lip E21-190 successfully competes with E2-E3 sub-complex for the assembly with E1ec component into the PDHc (Table 1.4). About 43% of the inhibition of the overall PDHc activity was detected at a ratio of subunits of 1-lip E21-190:E1ec = 1:1, however even at 200:1 ratio, no complete inhibition was reached. It was also demonstrated that 1-lip E21-190 successfully competes with E2 already assembled in the PDHc. About 48% of inhibition was observed at a ratio of 1:1 of 1-lip E21-190 and E2 already assembled in the complex. 2) The His6-tag

E1 (the theoretical mass of a subunit = 100, 586 Da) was eluted on the analytical size exclusion column as a dimer with a molecular mass of 205, 589 Da similar to non-His6- tag E1ec. On mixing with 1-lip E21-190 at a ratio of His6-tag E1ec:1-lip E21-190 = 1:5, the peak corresponding to His6-tag E1 disappeared and a new peak corresponding to its complex with 1-lip E21-190 with the molecular mass of 517, 607 Da appeared. The

minimal stoichiometry of 2 His6-tag E1 (dimer): 2 1-lip E21-190 (trimer) (one His6-tag E1 dimer binds one 1-lip E21-190 trimer) was suggested. Similar stoichiometry was determined for non-His6-tag E1ec indicating that both proteins behave similar as on assembly with 1-lip E21-190.

1-lip E2 / E1 Overall activity 1-190 % Activity remaining ratio of subunits Unit/mg E1

1:1 22.37 42. 68 2:1 10.75 20 5:1 2.84 5.41 10:1 1.06 2.02 30:1 1.18 2.25 100:1 0.88 1.68 150:1 0.87 1.66 200:1 0.84 1.60

Table 1.4. Competition of the 1-lip E21-190 with E2-E3 sub-complex for the E1 component in the assembly into the PDHc. The E1 (0.005 mg, concentration of subunits

o = 0.5 M) was preincubated with 1-lip E21-190 (0.5-100 M) for one hour at 4 C. The E2-

E3 sub-complex (0.010 mg) was added and mixture was incubated for an additional 10 min at 25oC for reconstitution of the PDHc before the overall activity was measured. The

-1 -1 activity of 52.41 mol.min .mg E1 (100%) was determined in the absence of 1-lip E21-

190. The concentration of E2 subunits was 0.72 M.

Figure 1.12. E21-190 (Didomain). C-terminally truncated 1-lip E21-190 consists of the lipoyl domain, peripheral subunit-binding domain (PSBD), linkers and a three-amino acid extension into the N-terminal region of the catalytic domain. The didomain was prepared and kindly provided by Dr. Natalia Nemeria.

1.3.8. N-Terminal E1ec residues that interact with an N-terminal E2ec construct

according to NMR.

To circumvent the oligomerization issue, starting with the 1-lip E2ec, a construct consisting of the lipoyl domain and the PSBD for a total length of 190 amino acids from the N-terminal amino acid (E2ec1-190) was created. Such a construct is usually denoted as a „didomain‟. To gain insight to the residues of E1ec reacting with the didomain, the 2D

HSQC spectrum of E1ec on addition of E2ec1-190 was acquired and inspected. The premise of the experiment is that, should the N-terminal region become organized (less mobile or dynamic) on complexation with the E2ec1-190, the resonances pertinent to the

N-terminal region will lose much (or all) of their intensity. This expectation is indeed met in Figure 1.13: (1) the side chain NH resonance for Trp16; (2) the NH resonance for

Gly47, and (3) the pairs of resonances for the side chains of glutamines 18, 33, and 38 are all reduced/absent in the complex (red) compared to the E1ec spectrum per se. This result shows that these residues of E1ec are indeed interacting with the E2ec construct and their positions (16, 18, 33, 38 and 47) give us confidence that the entire N-terminal region does participate in the complex in a dramatic fashion. It is also important to point out that there are a significant number of mobile E1ec resonances unperturbed by the complexation with E2ec1-190, presumably located at other unstructured regions of the E1ec, but also providing excellent control for the interpretation that the observations do pertain selectively to the N-terminal region.

Figure 1.13. NMR identification of residues of E1ec interacting with the E2ec1-190. (a)

His6-tag E1ec in green is superimposed on the spectrum of His6-tag E1ec in the presence of E2ec1-190 (red); (b) expanded view of the glycine region; (c) expanded view of the glutamine region.

1.3.9. N-Terminal E1ec residues that interact with PSBD and residues that interact

with independently expressed lipoyl domain.

A 2D HSQC spectrum was recorded for His6-tag E1ec in the presence of two fold molar excess of a synthetic peptide with sequence corresponding to the E2ec‟s peripheral subunit binding domain (PSBD) (CHI Scientific, Maynard, MA). The spectrum (Figure

1.14) appeared very similar to that obtained with E2ec1-190, indicating that the PSBD of the didomain is mostly responsible for E1ec-E2ec recognition. When the experiment outlined in the previous paragraph was repeated in the presence of a two fold molar excess of independently expressed lipoyl domain over His6-tag E1ec, 106 resonances were detected of 109 total detected for His6 tag E1ec indication that the lipoyl domain

(LD) is not participating in the interaction with the N-terminal region of E1ec (Figure

1.15).

Figure 1.14. N-Terminal E1ec residues that interact with PSBD. 2D 1H-15N-TROSY-

HSQC spectrum (blue) of His6-tag E1ec with E2-PSBD (a) was superimposed on the spectrum (red) of His6-tag E1ec in the presence of E2ec1-190 (b).

Figure 1.15. NMR experiments with independently expressed lipoyl domain of E2ec.

1 15 2D H- N-TROSY-HSQC spectrum (green) of His6-tag E1ec with E2-LD (a) was superimposed on the spectrum (blue) of His6-tag E1ec in the presence of PSBD.

1.4. DISCUSSION

NMR is one of the experimental methods to provide detailed insights into the structure and dynamics of proteins as well as to complexation of proteins in solution state where proteins are stable (34, 35). In this study, pyruvate dehydrogenase complex E1 component (E1ec), a 200 kDa homodimer, has been studied by NMR methods. The results from NMR information revealed structural evidence to the loci of interaction of

E1ec and E2ec.

Previously, there was no structural information about where on E1ec interacts with E2ec. On the related enzyme from A. vinelandii (also forms an octahedral complex with an 2 E1 structure), it was suggested that E1 interacts with two regions of the E2 subunit, the peripheral subunit-binding domain and the catalytic domain (36). In contrast,

E1 from B. stearothermophilus (forms an icosahedral complex with E1 having an 22 structure) was suggested to bind only to the peripheral subunit-binding domain of E2 (37).

On the spectrum of His6-tag E1ec by HSQC-TROSY, only a limited number of resonances were visible from the 886 residues indicating that only residues in mobile regions could be seen on the spectrum. In the X-ray structure, there were found three regions with no interpretable electron density indicating that these regions are highly mobile (4). The theoretical number of resonances on E1ec in the three flexible regions is

109, and 103 resonances were present on the spectrum. This may provide proof for the above hypothesis.

To test the above hypothesis, several assignments in the glycine region were made since there were well-resolved resonances observed at 1H 8–8.6 ppm, 15N 108–111 ppm,

the region most often populated by glycines. Indeed, only glycines were present using glycine auxotrophic strain (Figure 1.4 and 1.5). An additional glycine resonance was assigned using 3D-HNCO experiment due to adjacent glycine pairs in N-terminal region,

Gly46-Gly47. Based on the amino acid sequence of the E. coli E1ec present in Figure 1.6, there are five Gly-Gly pairs (showed in red): G46-G47; G104-G105; G133-G134; G361-

G362; G624-G625. An average B factor (Å 2) =17.5 for E. coli E1 was reported from Dr.

W. Furey‟s lab, the cystallography group in University of Pittsburgh. To summarize the information on flexible E1ec loops so far: in E1ec-ThDP complex three disordered regions were identified corresponding to residues 1-55 (N-terminal region), 401-413

(inner active center loop) and 541-557 (outer active center loop) (4, 7, 38); in Apo-E1ec structure (no ThDP bound) the flexible loops corresponding to residues Asn260-Thr269 close to the active center and the second loop corresponding to residues Glu522-Gln534 were identified (39). In E1ec complex with inhibitor thiamin thiazolone diphosphate a large number of hydrogen bonds linking the ThTTDP to E1ec but no additional flexible loops were identified (19). These data indicate that only the G46-47 pair should be in the flexible region which can be seen on the spectrum when an equimolar concentration of

15N-labeled and [C1-13C] labeled glycine are in the medium by a 1H-15N-13C triple resonance 3D HNCO NMR experiment for detection.

Further sequential assignments include three glutamine variants in the 1-55 region.

The activities of the corresponding E1ec variants (Table 1.2) show no change (Q18H) or some reduction (Q33H and Q38H) indicating that at least two of them are important for interaction with E2ec but not crucial. They all reconstituted to PDHc and all three are

catalytically active. The resonance assignment was achieved based on histidine substitutions in E1ec by SDM but not on activity measurement indicating the reductions in activity of two glutamine variants make only insignificant changes in the structure since ThDP enzymes accelerate the rates by 1012-13 (33).

Using the synthetic peptide corresponding to 1-35 amino acid residues from N- terminal end of E1ec confirmed: 1) the 1-35 synthetic peptide can successfully compete with E1ec for the assembly with E2ec demonstrating that the N-terminal region of E1ec is involved in E1ec-E2ec interactions; 2) using the NMR spectra of 1-35 synthetic peptide the chemical shift for Trp16 was confirmed and the chemical shift for Gly28 was assigned. These results also indicate that this peptide is a mimic of the N-terminal region of E1ec.

The N-terminal region of E1ec is predicted to have a propensity for forming two

-helices (residues 11-26, and 29-45) and a small loop (residues 27 and 28) joining the two -helices (Figure 1.16, a „helix-turn-helix‟ motif), similar to the model suggested for the N-terminal region of the E1 component from the related bacterium Azotobacter vinelandii (18). According to the structural and functional analysis here presented, if this is the true secondary structure of the N-terminal region of the E1ec in the complex, both helices participate in the interaction with E2ec. Should assembly indeed require that the

N-terminal region assume a secondary structure modeled in Figure 1.16 and predicted, one could speculate that the residues „silent‟ to substitution do not participate in assembly.

1.5. CONCLUSION

The following could be concluded with NMR data in N-terminal residues 1-55.

(1) These NMR results provide the first structural support to the notion that the entire N- terminal region (residues 1-55) of the E1ec is responsible for binding the E2ec component. The N-terminal region of E1ec, while not seen in the X-ray structures, gives well-resolved resonances and permitted sequence specific assignment for six resonances

(Trp16, Gln18, Gly28, Gln33, Gln38 and Gly47). These assignments complement the biochemical findings on this region: Substitution of several residues in this region dramatically reduced the activity of the reconstituted complex, and affected inter- component assembly (interaction of E1ec with E2ec). It is also clear, however, that not all residues in this N-terminal region have a role in assembly. For example, the chemical shift of the resonance for Gly28 does not change under various conditions.

(2) The narrow dispersion of the NMR resonances observed both in N-terminal 1-35 synthetic peptide and in the N-terminal region of E1ec suggest that both are in the random conformation, i.e., they are disordered in the absence of E1-E2 assembly.

(3) Interaction of E1ec with either E2ec1-190, or PSBD, but not with the lipoyl domain, leads to reduction/absence of the side chain NH resonance for Trp16, the NH resonance for Gly47, and of three pairs of resonances for the side chains of glutamines 18, 33, and

38, informing that residues from the entire N-terminal region participate in the complex and that the PSBD, but not the lipoyl domain of E2ec is essential for E1-E2 interaction.

(4) The results here reported have broader significance/consequence to other members of this important class of multienzyme complexes.

(i) The N-terminal region of the E1 component of the Escherichia coli 2-oxoglutarate dehydrogenase complex was also suggested to interact with its E2 component (40).

(ii) For this class of bacterial 2-oxoacid dehydrogenase complexes, the PSBD is the most important domain for recognition of E1, rather than the lipoyl domain, as was suggested by others (41, 42). To our knowledge, our results here presented offer the first structural evidence for this conclusion.

(iii) The results also clearly show that with such large proteins, the NMR and X-ray results are indeed complementary: what is not seen in the X-ray may be visible in the

NMR spectrum and vice versa. In particular, the N-terminal 1-55 residues, and the two active center loops not seen in the X-ray structure have now been shown to provide resolvable resonances in the NMR spectrum of E1ec.

Figure 1.16. Secondary structure prediction of N-terminal region (1 to 55). (a) The Cα atoms were generated from ExPASy Proteomics server. Main chain and side chain atoms were generated with the program COOT (43), final figure with RIBBONS (44). (b)

Predicted secondary structure of the N-terminal 1-55 region (program from Protein

Homology/analogY Recognition Engine).

CHAPTER 2. Structural Evidence of Inner and Outer Dynamic Loops

at Active Center of the E1 Component of the Pyruvate Dehydrogenase

Complex

2.1. INTRODUCTION

Crystallographic studies of E. coli E1 component of pyruvate dehydrogenase multienzyme complex (E1ec) have shown that two active center loops (residues 401-413 for inner loop and residues 541-557 for outer loop) are not seen in the model, whereas they were shown to be in the crystals by mass spectrometric analysis indicating that they are disordered (4, 6, 19). Previously, in our laboratory, these regions have been studied to reveal the roles of dynamic loops mainly with kinetic approaches. The results suggested that these loops have an „open-close‟ conformational equilibrium and the substrate induces efficient coupling of catalysis and loop movement which lowers the transition state of covalent addition of substrate to ThDP by a combination of enthalpic and entropic components (8). In this study, 2D NMR data of the dynamics of the two loops in the presence of C2α-phosphonolactylThDP (PLThDP), a stable analogue of the first

ThDP-bound predecarboxylation covalent intermediate C2α-lactylThDP (LThDP) provided the structural evidence on the behavior of the two loop regions. Two disordered regions, 401-413 in the inner loop and 541-557 in the outer loop, have been shown to become ordered in the presence of PLThDP, a stable analogue of LThDP by crystallographic studies (45), and His407 plays a role to modulate disorder to order transition (6). On the two disordered regions, there is one glycine on each loop, G402 in

the inner and G542 in the outer loop, respectively. In the previous study of the N-terminal region in E1ec using 2D NMR in Chapter 1, the glycine region was shown to have a well dispersed spectrum and was confirmed using glycine auxotrophic strain. Hence, one variant on each loop was created using site-directed mutagenesis (Gly402Ala on the inner and Gly542Ala on the outer loop region) to provide a reporter for each dynamic loop.

The formation of positive circular dichroism (CD) band centered at 305 nm representing the 1‟,4‟-imino thiamin diphosphate tautomer on the enzyme (15, 45) was monitored when His6-tag E1ec was titrated with PLThDP. After the titration of His6-tag E1ec in the presence of PLThDP, 2D-HSQC-TROSY spectra were recorded and processed, and two glycines in active center loops disappeared on the NMR spectrum indicating that dynamic motions of loops are restricted by a stable analogue, PLThDP. These are the first sequence-specific 1H-15N NMR assignments for two residues in the dynamic loop regions of the E1 component, a 200 kDa homodimer. This result supports the dynamic loop motions of E1 component of E. coli pyruvate dehydrogenase multienzyme complex in conjunction with E1-ThDP and E1-PLThDP structures.

2.2. MATERIALS and METHODS

2.2.1. Materials

The Wizard® Plus Minipreps DNA purification system was used for purification of DNA

(Promega, Madison, WI). The QuikChange site-directed mutagenesis kit was used for single-site substitution (Stratagene, La Jolla, CA). Thiamin diphosphate (ThDP), NAD+, coenzyme A, dithiothreitol (DTT), isopropyl β-D-1-thiogalactopyranoside (IPTG), micrococcal nuclease, Deoxyribonuclease I were from USB (Cleveland, OH).

DNA sequencing was done at the Molecular Resource Facility of the New Jersey Medical

School (Newark, NJ). E. coli BL21(DE3) cells were from Novagen (Novagen, EMD

15 Chemicals, Gibbstown, NJ). NH4Cl was from Cambridge Isotope Laboratories, Inc.

(Andover, MA).

2.2.2. Plasmid purification and site directed mutagenesis

Plasmid purification was performed based on the protocol of Wizard® Plus Minipreps

DNA purification system from Promega. Mutagenic primers were from IDTdna

(Coralville, LA). Description of detailed procedure of plasmid purification and mutagenesis are in Chapter 1. The list of the primers for creating variants of inner and outer loop residues is shown in Table 2.1.

2.2.3. Protein expression and purification

Protein expression and purification of His6-tag E1ec and its variants, G402A and G542A, were as described in Chapter 1. If required, additional purification using TSK DEAE-

5PW HPLC column was performed. A linear gradient of 0.075 to 0.5M of NaCl in 20 mM KH2PO4 buffer (pH 7.5) was used and the purity was judged by SDS PAGE as described in Chapter 1. All proteins were more than 98 % pure after the additional purification.

2.2.4. Preparation of Apo-His6-tag E1ec

Apoenzyme was prepared using dialysis buffer as E1ec purification except no ThDP was added. The His6-tag E1ec was dialyzed against buffer for 4 hours at 4 ºC , and then the protein was again dialyzed against the same buffer for 4 hours to remove ThDP from the protein. The absence of ThDP in the protein was confirmed by overall activity measurement resulting in zero activity.

2.2.5. Overall activity measurement

Overall activity of wild type E1ec, His6-tag E1ec and its variants was measured by reconstitution with independently expressed E2ec and E3ec components as described in

Chapter 1.

2.2.6. Circular dichroism (CD) spectroscopy

Titration of His6-tag E1ec in the presence of phosphonolactylthiamin diphosphate

(PLThDP) were carried out on an Applied Photophysics Chirascan spectrometer

(Leatherhead, U.K.) at 30 ºC as reported earlier from our laboratories (46). The formation of a positive CD band centered at 305 nm representing the 1‟,4‟-iminopyrimidine ThDP

tautomer on the enzyme was monitored when His6-tag E1ec was in the presence of

PLThDP, a stable analogue of the covalent adduct formed between the substrate pyruvate and the C2 atom of thiamin diphosphate (45, 46). A 1-cm path length quartz cuvette was used for the near-UV region (250-400 nm). The instrument was calibrated using (+)-10- camphorsulfonic acid as a reference standard. ThDP was removed prior to the experiment by dialysis as mentioned above. Data were collected at a wavelength step of 1.0 nm, an integration time of 1 s, and a bandwidth of 1 nm. Data preparation, fitting and calculations were done using SigmaPlot (Systat Software, Inc. CA) as described previously (46).

Variant Primer

G402A 5'-CGACGCGGCTGAAGCTAAAAACATCGCGC-3'

G542A 5'-TTACAGCCCGAACGCTCAGCAGTACACCC-3'

Table 2.1 List of the primers for creating variants of inner and outer loop residues. The substituted bases are underlined.

2.2.7. Structural analysis of two loop regions of E1ec using Nuclear Magnetic

Resonance

2.2.7.1. Preparation of sample for NMR spectroscopy

The samples were prepared as described in Chapter 1. All purified proteins were prepared in a shigemi tube, and the concentration of His6.tag E1ec and its variants in the NMR sample was measured using Bio-Rad Protein Assay Dye Reagent Concentrate (Hercules,

CA) described above and adjusted to 20 mg/mL (subunit concentration = 211 µM) in 0.4 mL of dialysis buffer of E1ec (Appendix 1.1.1 [B]), then 0.15 M NaCl and 7% D2O were added. The pH of the NMR samples was adjusted to 7.0 by the addition of 0.15 M

CH3COOH or 0.15 M NaHCO3 and centrifuged to clarify the samples.

2.2.7.2. NMR Spectroscopy

All NMR experiments were performed on a Varian INOVA 600 MHz spectrometer at

20 °C. Transverse relaxation-optimized spectroscopy (TROSY) was employed for better resolution of large molecule. The TROSY experiment is designed to select the component for which the different relaxation mechanisms have almost cancelled, leading to a single, sharp peak in the spectrum. This significantly increases both spectral resolution and sensitivity for the large and complex biomolecules. All data were processed by NMR Pipe (28) and NMR ViewJ (29).

1 15 15 2D H- N-TROSY-HSQC (30) spectra were recorded for N labeled His6-tag E1ec, all its singly substituted variants, and His6-tag E1ec in the presence of PLThDP.

2.3. RESULTS

2.3.1. Kinetic characteristics

The resonance assignment was achieved based on alanine substitutions in E1ec by site-directed mutagenesis. Overall activities of the two loop variants, G402A and G542A, are shown in Table 2.2. The overall activities of the two loop variants were reduced, but they are still catalytically active. ThDP enzymes accelerate the rate by 1012-13 (33), hence the reductions of overall activities of two loop variants will not insignificantly affect the structure. Spectra (Figures 2.1 and 2.2) of G402A and G542A are superimposable with wild that of type His6-tag E1ec indicating that the single amino acid substitution in the loop regions resulted in little or no structural changes.

Table 2.2. Overall activity of loop variants. The production of NADH was monitored at

340 nm. 1u activity = 1µmol NAD+ reduced/min/mg E1ec.

2.3.2. Sequence-specific resonance assignments in the loop region of E1ec

There is one glycine in each of the two active center loops, G402 on the inner loop and G542 on the outer loop. Hence, each glycine was substituted to alanine for sequence-specific resonance assignment using site directed mutagenesis (Table 2.3). In

Table 2.3, the chemical shifts of the two assigned glycines in the active center loops are rather similar to the random coil chemical shift of glycine indicating that the two active center loops are disordered. Each variant was expressed and purified using the procedures

15 as used for uniformly N labeled wild type His6-tag E1ec in Chapter 1 and spectra were recorded by 2D HSQC-TROSY NMR. These spectra were superimposed with His6-tag

E1ec to identify G402 (Figure 2.1) and G542 (Figure 2.2). The two spectra were superimposable with spectrum of wild type except each glycine in each loop region which disappeared in the spectrum of each variant. In both spectra of two loop variants, the other assigned residues, W16, Q18, Q33, Q38, and G47 did not disappear. This observation confirms that the single substitution does not significantly affect the structure consistent with overall activity data.

Random coil chemical shifts Observed chemical shifts at pH 5a at pH 7

Residue 15N(ppm) Residue 1HN (ppm) 15N(ppm)

Gly402 8.389 110.4 Glycine 109.30 Gly542 8.208 109.9 aRandom coil chemical shifts reported for glycine in ref 36, for Gln and Trp side chains from Biological Magnetic Resonance Data Bank at University of Wisconsin-Madison.

Table 2.3. 1HN and 15N chemical shifts of assigned residues of the dynamic active center loops in His6-tag E1ec compared with the reference chemical shift of random coil

Figure 2.1. Sequence-specific resonance assignment of G402 on inner loop region of

15 15 E1ec. Uniformly N labeled wild type His6-tag E1ec in red was superimposed with N labeled G402 variant of His6-tag E1ec. G402 was assigned on the spectrum b.

Figure 2.2. Sequence-specific resonance assignment of G542 on loop region of E1ec.

15 15 Uniformly N labeled wild type His6-tag E1ec in red was superimposed with N labeled

G542A variant of His6-tag E1ec. G542 was assigned on the spectrum b.

2.3.3. Circular dichroism of His6-tag E1ec in the presence of PLThDP

Circular dichrosim (CD) was used to characterize the restriction of dynamic motion of two loop regions in conjunction with NMR experiments using the two assigned glycines on the inner and the outer loop regions. ThDP was removed from E1ec using dialysis, and the overall activity of Apoenzyme was zero after reconstitution with E2ec and E3ec. CD titration of Apo His6-tag E1ec in the presence PLThDP was carried out at

30 °C. Formation of the positive CD band centered at 305 nm representing the 1‟,4‟- iminopyrimidine tautomer of PLThDP was monitored when His6-tag E1ec was titrated with PLThDP, a stable analogue of the covalent adduct formed between the substrate pyruvate and the C2 atom of ThDP (Figure 2.3). The concentration of PLThDP was increased from 0.1 mM to 2.1 mM. 20 mg/mL E1ec (concentration of subunits = 211 µM) was used for CD titration since the concentration was appropriate for NMR experiment to confirm the dynamics of the two loop regions of E1ec using two assigned glycines. The saturation by PLThDP was observed at 305 nm (Figure 2.4 (a)). The enzyme was saturated by the addition of 2.1 mM PLThDP(Figure 2.4 (b)). To assure the saturation of enzyme, the enzyme was incubated until saturation was observed (up to 80 min) in the cuvette at 2.1 mM PLThDP leading to the maximum saturation of the enzyme (Figure

2.4 (c)). Protein and buffer background were subtracted from each spectrum while processing data.

Figure 2.3. Formation of 1’4’-iminophosphonolactylThDP, a stable LThDP analogue.

(a)

8 1', 4' imino-PLThDP

2 PLThDP 0.1 mM - 2.1 mM 0

Mean CD (301 - 305 nm) - 305 (301 CD Mean -2

-4

300 350 400 450 500

Wavelength (nm)

(b) (c)

2.5 6

5 2.0

4 1.5 3 1.0 [PLThDP] = 2.1 mM 2

0.5 1

Mean CD (301 - 305 nm) Mean CD

Mean CD (301 - 305 nm) Mean CD 0.0 0

0.0 0.5 1.0 1.5 2.0 2.5 0 20 40 60 80 100 PLThDP (mM) Time (min)

Figure 2.4. CD spectrum of His6-tag E1ec on titration of PLThDP. (a) The production of 1‟, 4‟-imino ThDP by addition of PLThDP was monitored at 30 oC. (b) 2.1 mM

PLThDP led to saturation of the enzyme. (c) Time dependent trend curve of saturation of the enzyme at 2.1 mM PLThDP.

2.3.4. Interaction of the flexible active center loops of E1ec with the stable

predecarboxylation intermediate PLThDP.

With assigned resonances that could act as reporters of each of the two active center loops (Gly402 and Gly542), the changes in mobility on addition of PLThDP, a stable predecarboxylation intermediate that resembles LThDP in Scheme 1 (k1, k2), were observed by 2D NMR. Previously, evidence from both X-ray and dynamic measurements

(6-8, 47) was reported by our laboratory that in the presence of PLThDP, these two loops become organized and are now observed in the X-ray structure. In fact, addition of

PLThDP to His6-tag E1ec, selectively broadens the NH resonances corresponding to

G402 and G542 but not those resonances assigned to the N-terminal residues (Figure 2.6).

E1ec without ThDP was recorded by 2D NMR to confirm any changes from E1ec with

ThDP which was used for sequential assignment. No changes were observed in the spectrum indicating that the mobility of the flexible regions of E1ec without ThDP is the same as of E1ec with ThDP (Figure 2.5). This result showed that the two active center loops become organized by the addition of PLThDP, and the mobility of the two active center loops is restricted. This experiment is not only important to support all of the previous data on this important dynamic property from both X-ray and dynamic measurement, but also serves as an outstanding control experiment indicating that the observations are indeed selective to the particular interaction loci; the PLThDP interacts with the active center loops but not with the N-terminal region.

Figure 2.5. 2D HSQC-TROSY spectra of His6-tag E1ec. E1ec without ThDP (a) is same as E1ec with ThDP (b).

Figure 2.6. NMR spectra for His6-tag E1ec in the presence of PLThDP. Two loop variants, G402 and G542, were assigned on Apo E1ec (a). The resonances of two loop variants disappeared in the presence of PLThDP, but assigned resonances in N-terminal region were still present (b).

2.3.5. The specificity of E1ec toward E2ec

The spectrum of His6-tag E1ec in the presence of PLThDP revealed that only one glycine in each of the active center loops (inner and outer) disappeared indicating that the two loop regions became organized by PLThDP selectively. In the overall reaction cycle of PDHc, E1ec and E2ec play the important role to transfer acetyl group to Coenzyme A which is used in the citric acid cycle. For acetyl transfer, it is expected that E1ec and

E2ec should recognize each other, and E1ec should bind to E2ec specifically in multienzymatic cycle.

To ascertain the specificity of E1ec toward E2ec, the spectrum of His6-tag E1ec in the presence of PLThDP was compared to the spectrum of His6-tag E1ec in the presence of didomain of E2ec (Figure 1.12) containing lipoyl domain, peripheral subunit binding domain, and three amino acids in catalytic core domain (Figure 2.7). In Figure

2.7, N-terminal resonances are still observed in the presence of PLThDP, and only one glycine in each of the two dynamic loops is not detected. On the other hand, resonances corresponding to the two glycines in the dynamic loops are still present on the spectrum of E1ec in the presence of E2ec1-190. This observation shows that E1ec specifically recognizes E2ec in the multienzyme reaction cycle indicating that the N-terminal region of E1ec specifically binds to PSBD of E2ec, and the dynamic active center loops in E1ec and the lipoyl domain in E2ec are not involved in E1ec-E2ec recognition.

Figure 2.7. The specificity of E1ec toward E2ec. The spectrum of E1ec in the presence of PLThDP (a) shows that only two glycines in active center loops are absent, but assigned residues in the N-terminal region are present. On the spectrum of E1ec in the presence of didomain of E2ec (b), only two glycines in active center loops are present, but the residues in the N-terminal region are absent.

2.3.6. Quantification of residues identified in the flexible E1ec regions.

Given that sequence specific resonance assignment to only eight (Trp 16, Gly 28,

Gln 18, Gln 33, Gln 38, Gly 47 in N-terminal region and Gly 402, Gly 542 in two active center loops) of the 886 amino acids present in E1ec was made, it is important to address the issue of specificity of the observations. First of all, several reporters spanning residues 1-47, and one in each of the two active center loops were assigned by site directed mutagenesis and 2D and 3D NMR in Chapters 1 and 2. A summary of the resonances observed under different conditions is given in Table 2.4. In the region of chemical shifts present in the 2D 1H-15N HSQC spectra, we expected to observe resonances pertinent to (a) main chain NHs, one for each peptide bond with the exception of those to proline, (b) two side chain NHs for each Asn and Gln, and one for each Trp.

The number of resonances accounting for these is 64 for the amino terminal 1-55 residues,

19 for the inner (401-413) and 26 for the outer (541-557) active center loops, for a total of 109. Using the program NMRViewJ peak counting with the same noise filtration for all spectra, the presence of 103 resonances for E1ec in the presence of saturating ThDP and 101 resonances in the absence of ThDP (i.e., apo-enzyme) were estimated.

Apparently, in terms of number of resonances observed, the numbers anticipated in the three flexible regions account for all of the observations within experimental error; coupled with the sequence specific assignments, there is strong evidence that these indeed are the regions observed in the spectra (Table 2.3).

For the complexes, the following could be concluded with NMR data: (i)

Addition of the E21-190 didomain results in the elimination of 44 resonances (of the 103

total observed, and of the 64 calculated for the amino terminal region), apparently, not all residues in the N-terminal region are highly ordered in the complex. (ii) Addition of the synthetic peptide corresponding to PSBD results in the elimination of 38 residues, the same ones as missing on addition of E21-190 in (i). (iii) Addition of independently expressed lipoyl domain results in no assigned resonance being eliminated within experimental error. These numbers strongly support the conclusion that the PSBD is the important moiety of the didomain that binds to the E1ec, specifically to its N-terminal regions, while the lipoyl domain binds very weakly at best. (iv) Addition of PLThDP results in the elimination of 33 resonances (of the 101 total observed, and of the 45 estimated for the inner and outer dynamic acitive center loops), and the specificity is confirmed by the elimination of the resonances assigned to Gly402 and Gly542, reporting on the inner and outer loops, respectively, but not any of those assigned to specific residues in the N-terminal region. These results confirm our series of studies on these loops, and equally importantly, point to the specificity of the NMR observations.

2.4. DISCUSSION

In many enzymes, dynamic loops are significant in catalysis and have been studied regarding their dynamic and biochemical roles. Previously, in our laboratory, it was confirmed that His 407 in the inner active site loop of the E1ec was important for reductive acetylation of the E2ec component and X-ray studies showed that this residue interacts with the intermediate analog, PLThDP, in the active-site thus facilitating ordering of the loops (6). Central to both of these functions is the acid-base functionality

of the His 407 residue (6, 38). These regions have also been studied with kinetic approaches suggesting that these loops have an „open-close‟ conformational equilibrium, and substrates induce efficient coupling of catalysis and dynamics (7, 8).

Substitution of glycine residues to alanine in the inner and outer active center loops was carried out to monitor dynamic motion of loops in this study. The overall activity and NMR spectra showed that the substitution of these residues does not cause any major structural changes. Concerning the effect of substitutions in the active center loop regions on individual reaction steps, the substitutions affected the rate of the E1- specific reaction, i.e., the reaction was unaffected through pyruvate decarboxylation.

Similarly, these substitutions do not affect formation of the first covalent intermediate

LThDP.

In the crystallographic study of E1ec in the presence of PLThDP, it was found that the two active center loops of E1ec which were not seen due to the mobility of loops could be observed in the presence of intermediate analog, PLThDP. Similar findings from solution NMR studies directly confirmed the dynamic nature of these loops and the coupling of loop motion to catalysis in the E1ec component. Addition of PLThDP to

E1ec selectively broadens the NH resonances corresponding to Gly402 and Gly542, consistent with its effect on the active center loops.

N-terminal region Inner loop Outer loop

Number of residuesa 55 (1 to 55) 13 (401 to 413) 17 (541 to 557)

Number of Gln 3 1 4

Number of Asn 2 2 1

Number of Pro 2 0 1

Number of Trp 1 0 0 Theoretical number of 64 19 26 resonances Number of resonances 103/109b estimated 101/109c (Experimental/Theoretical) Number of resonances undetected on 44d; 38e ; 33f complexation

Table 2.4. Experimentally estimated and theoretical number of resonances on E1ec in the three flexible regions in the 15N-1H HSQC spectra. (a) Each backbone NH contributes 1 resonance. The side chains of glutamine and asparagine give rise to two resonances on 2D-HSQC spectra. For each proline present, the total number of resonances was decreased by one. The Trp gives rise to the indole NH resonance. (b)

Spectrum of His6.tag E1ec. (c) Spectrum of His6.tag E1ec without ThDP. (d) Spectrum of

His6.tag E1ec in the presence of E2ec1-190. (e) Spectrum of His6.tag E1ec in the presence

of synthetic peptide corresponding to PSBD. (f) Spectrum of His6.tag E1ec in the presence of PLThDP.

2.5. CONCLUSION

The above studies have demonstrated that the mobility of the two active center loops consisting of inner and outer regions is modulated by the addition of PLThDP. Two loops in E1ec not seen in the X-ray structures were labeled for NMR studies to assign NH resonances to one glycine in each of the two loops, and we show that these flexible regions become ordered in the presence of PLThDP, indicating that the dynamics of loop regions are restricted by PLThDP. Interaction of E1ec only with PLThDP leads to absence of the side chain NH resonances for Gly402 and Gly542, and theses two glycines are still visible with either E2ec1-190, or PSBD or the LD. This result not only indicates that dynamic loops are responsible for substrate binding specifically, but also confirms that the N-terminal region has the specificity for PSBD of E2ec for complexation.

CHAPTER 3. Interchain acetyl transfer in the E2 component of the E.

coli pyruvate dehydrogenase complex

3.1. INTRODUCTION

The bacterial pyruvate dehydrogenase complex (PDHc) carries out conversion of pyruvate to acetylcoenzyme A with the assistance of several cofactors [thiamin diphosphate (ThDP), Mg(II), lipoic acid, flavin adenine dinucleotide (FAD) and nicotinamide adenine dinucleotide (NAD+)], and three principal protein components E1,

E2 and E3 (2). In the mammalian enzyme (48), there are three additional components mostly responsible for regulation: a kinase (49), a phosphatase (50, 51) and an E3- binding protein (E3BP) (52-54). Each component has multiple subunits with total molecular masses of ca. 4.5 MDa for the bacterial and 10 MDa for the mammalian complex. The multi-domain E2 component forms the core of the complexes (see domain structure in Scheme 1), and consists of variable numbers of lipoyl domains (LD, with covalently bound lipoic acid amidated onto the -amino group of a lysine residue), a peripheral subunit binding domain (PSBD), and the catalytic or core domain (CD). The reaction sequence starts with a ThDP-dependent decarboxylation of pyruvate on E1 to an enamine/C2-carbanion, followed by reductive acetylation of the lipoamide of the LD on the E2 component to S-acetyldihydrolipoamide-E2. The acetyl group is then transferred from the LD of E2 to coenzyme A on the CD also on E2. Finally, the dihydrolipoamide is reoxidized by the E3 component. In order to complete the overall reaction, lipoyl moieties should interact not only with the E2 component itself but also with the E1 and

E3 components (55). While the precise number of E2 subunits is still controversial in the mammalian enzyme, it appears that the sum (E2+E3BP) is a multiple of three, while the

E. coli E2 is comprised of 24 chains, again a multiple of three. For the octahedral PDHc from E. coli a stoichiometry of 12 E1ec dimers, 8 E2ec trimers and 6 E3ec dimers was proposed (3, 56, 57). All 24 subunits of E2ec have lipoyl domains and active sites, and it is plausible that inter-subunit acyl transfer would take place between an LD of one subunit and the CD of a different one due to the mobility of LD afforded by the flexible

Ala-Pro-rich linkers (3, 58). The swinging arm motion of the lipoyl domain was shown by scanning transmission electron microscopy with use of gold cluster labels (59).

Interactions among lipoyl and S-acetyldihydrolipoyl moieties have been proposed (60), and the communication of the lipoyl moieties in the complex as an interacting network through a relay mechanism to transfer acetyl groups and reducing equivalents from one to another over long distance have also been shown (61-65). Our main goal in this Chapter is to determine whether the acetyl group is passed from the LD to the CD in an intrachain

(intrasubunit) or interchain (intersubunit) reaction by using an E. coli E2 component designed with only a single LD (1-lip E2ec), rather than the three LDs in the wild type enzyme (3-lip E2ec). Earlier, it was shown that the activities of these two enzymes are virtually the same, while the 1-lip E2ec provides important advantages for mechanistic studies (10, 13, 66). At the same time, it is also important to point out that there indeed are other sources of the E2 component with only a single LD, such as E2 for the PDHc from Mycobacterium tuberculosis and the E2 in 2-oxoglutarate dehydrogenase complexes (67-69).

Two types of constructs of the 1-lip E2ec were prepared; one in which the lysine on the

LD ordinarily carrying the lipoic acid is changed to alanine (K41A), and two others in which the histidine believed to catalyze the transthiolacetylation in the CD is substituted to A or C, H399C and H399A. The first one is incompetent towards posttranslational ligation of the lipoic acid, hence towards reductive acetylation. The other two are incompetent towards acetylCoA formation by virtue of the absence of the catalytic histidine residue. These constructs then enable us to carry out a biochemical version of a classical crossover experiment: should the reaction proceed intra-subunit, the two types of constructs should each be inactive either together or individually; however, should the reaction proceed inter-subunit (complementation), addition of the two types of constructs should produce measurable activity. As a control, we also constructed the K41A/H399C doubly substituted variant, carrying neither a lipoylation site nor the active center His.

Mixing the K41A and H399C variants, then reconstitution with the E1ec and E3ec components enabled measurement of the activity of the PDHc (NADH production), with overall activity increasing to as high as 22.7% from the inactive state. This indicates that covalently acetylated LD of H399C shuttled to the active site on the CD of K41A by inter-subunit interactions, and then the acetyl group was transferred to Coenzyme A leading to the increase of overall activity. The kinetic study was confirmed by measuring the time-course of acetylCoA formation from CoA using mass spectrometric analysis.

The results not only suggest a plausible model/explanation for multiples of three subunits present in E2 components, but also for their assembly.

3.2. MATERIALS and METHODS

3.2.1. Materials

Thiamin diphosphate (ThDP), NAD+, dithiothreitol (DTT), isopropyl β-D-1- thiogalactopyranoside (IPTG), micrococcal nuclease, Deoxyribonuclease I, acetylcoenzyme A (acetylCoA), phenylmethanesulfonyl fluoride (PMSF), and coenzyme

A (CoA) were from USB (Cleveland, OH). E. coli BL21(DE3) cells were from Novagen

(Novagen, EMD Chemicals, Gibbstown, NJ). Lysozyme, formic acid and methanol for solvent of mass spectrometry were from Sigma-Aldrich (St. Louis, MO). Protease inhibitor cocktail tablets supplied in glass vials was from Roche Applied Science

(Indianapolis, IN)

DNA sequencing was done at the Molecular Resource Facility of the New Jersey Medical

School (Newark, NJ). E. coli BL21(DE3) cells were from Novagen (Novagen, EMD

Chemicals, Gibbstown, NJ).

3.2.2. Plasmid purification and site directed mutagenesis

The Wizard® Plus Minipreps DNA purification system was used for purification of DNA

(Promega, Madison, WI). The QuikChange site-directed mutagenesis kit was used for single-site substitution (Stratagene, La Jolla, CA). Mutagenic primers were from IDTdna

(Coralville, LA). Description of detailed procedure of plasmid purification and mutagenesis are in Chapter 1. The list of the primers for creating variants is shown in

Table 3.1.

Variant Primer

K41A 5'-GATCACCGTAGAAGGCGACGCAGCTTCTATGGAAGTTCCG -3'

H399A 5'- CTCTCTCCTTCGACGCCCGCGTGATCGACG -3'

H399C 5'- TCTCTCTCCTTCGACTGCCGCGTGATCGACGG -3'

Table 3.1 List of the primers for creating variants of 1-lip E2ec. The substituted bases are underlined.

3.2.3. Creation of K41A/H339C, doubly substituted variant

For a control experiment, the K41A/H399C doubly substituted variant was created. The plasmid of H399C was purified and used for the substitution of K41 to alanine (using the primer from above) to create K41A/H399C, which carries neither the lipoylation site nor the catalytic histidine.

3.2.4. Protein expression and purification

The protein expression and purification of 1-lip E2ec and its variants, K41A, H399A,

H399C and K41A/H399C, were as described in Chapter 1. Additional purification using a gel filteration column was performed if the purity is not acceptable after the first gel filtration. The purity was judged by SDS PAGE described in Chapter 1. The procedures were the same except for the Laemmli buffer. For 1-lip E2ec and its variants, 12 %

Laemmli buffer was used. 4.0 mL of 30 % acrylamide/Bis stock solution and 3.35 mL of

DI water was used with the same reagents used for 7.5 % Laemmli buffer system.

3.2.5. Measurement of the PDHc activity

Overall activity of the PDHc consisting of 1-lip E2ec and its variants was measured after reconstitution of the complex with independently expressed E1ec and E3ec components.

A Varian DMS 300 spectrophotometer was used to monitor the pyruvate-dependent reduction of NAD+ at 340 nm. The mass ratio of wild type E1ec: E2ec: E3ec complex was 1:1:1. The overall activities of K41A E2ec, H399A E2ec and H399C E2ec were monitored separately with the same mass ratio as used for the wild type complex. To test

for interchain acetyl transfer, K41A E2ec and H399C E2ec were incubated at various mass ratios for 30 min prior to the reconstitution with E1ec, E3ec, and pyruvate. Since

K41A E2ec carries a catalytic His, which may produce overall activity by acetyl transfer from lipoyl lysine on H399C E2ec, the concentration of K41A was fixed. The mass ratio of E2ec variants of K41A:H399C for incubation was 1:1, 1:1.5, and 1:2. After incubation for 30 min at room temperature, E1ec and E3ec were introduced in this mixture with a mass ratio of 1:1:1 for E1ec:K41A E2ec:E3ec. In a control experiment, the doubly substituted variant, K41A/H399C E2ec, was used, and the overall activity was again measured on reconstitution of complex with E1ec, E3ec, and pyruvate. Then, K41A E2ec and K41A/H399C E2ec were mixed and incubated in the same mass ratio as

K41A:H399C above. The concentration of K41A was fixed again to K41A:

K41A/H399C = 1:1, 1:1.5, 1:2.

3.2.6. Mass spectrometric analysis using Fourier Transform Mass Spectrometry

(FTMS)

As an independent measure of the activity of the variants, the formation of acetylCoA from CoA starting with pyruvate (Scheme 1) was measured using an Apex-ultra 7.0 T 70 hybrid FTMS from Bruker Daltonics (Billerica, MA) with an ESI source. The FTMS is equipped with a 7.0 T actively shielded, high-stability magnet, and an Apollo II dual

ESI/MALDI source to provide simultaneous operation in both modes. The ESI source has an ion funnel and a spray chamber with a grounded off-axis sprayer. Both positive and negative ion modes were tested, and the positive ion mode provided better separation and

resolution for acetylCoA. For detecting acetylCoA formation in the overall PDHc reaction, we used the mass ratios of wild type and variant enzyme as used in the activity measurements above.

[1] Sample preparation for FTMS experiments

For wild type overall reaction, 1 ng each of E2ec and E3ec was incubated in 20 mM

KH2PO4 buffer (pH 7.0) for 1 h. Sequentially, 1 ng of E1ec was added to the mixture of

E2ec and E3ec in 1 mL of 0.1 M Tris-HCl (pH 8.0) buffer containing 1 mM MgCl2, 2 mM sodium pyruvate, 2.5 mM NAD+, 0.1-0.2 mM CoA, 0.2 mM ThDP, and 2.6 mM

DTT and the mixture was incubated for 10 min. Then, the reaction was initiated by adding 100 µM CoA and incubated 10 minutes. All experiments were performed at 25 oC.

The reaction was quenched by a solution containing 12.5 % trichloroacetic acid in 1 M

HCl. After acid quench, proteins were removed by centrifugation at 9000 g for 20 min, and then 50 µL of clarified samples were mixed with 50 µL of MS running solvent containing 0.1 % (v/v) formic acid and 50 % MeOH (v/v) in deionized water. These samples were then injected into ESI-FTMS. 20 scans were acquired.

3.2.7. Quantitative analysis of acetylCoA production using FTMS

To quantify acetylCoA production by the variants, a standard curve was created at a variety of concentrations of acetylCoA. Samples were prepared as above.

[1] Standard curve for acetylCoA using ESI-detected FTMS

50 µL of samples were mixed with 50 µL of MS running solvent containing 0.1 % (v/v) formic acid and 50 % MeOH (v/v) in deionized water for FTMS-ESI yielding final

concentrations of 1, 5, 10, 20, 30, 40, 50, 100, and 200 µM. These samples were then injected into FTMS-ESI by syringe pump (rate = 2 µL/min). 20 scans were acquired.

After acquiring data, Sigma plot was used to calibrate and plot data collected.

3.3. RESULTS

3.3.1. Substitutions of lipoyl-bearing lysine and the putative catalytic histidine

affected the overall PDHc activities.

The overall PDHc activity of K41A E2ec was diminished to baseline, while surprisingly of H399A E2ec was not completely abolished (Table 3.2). In contrast to

H399A E2ec, the overall activity of H399C E2ec was reduced to baseline. The activity was never reduced to zero even with impairment of the lipoylation site and the catalytic

His, respectively. This could be the result of some endogenous wild type E2 component present in the E. coli cells (the gene for E2 was not knocked out), but the recombinant variants were all overproduced. It is also possible that during expression and purification of enzymes, endogenous substances are introduced from the expression host (70).

Nevertheless, the controls clearly eliminated this issue from consideration.

3.3.2. Complementation of K41A E2ec and H399C E2ec produces overall PDHc

activity.

The K41A E2ec and H399C E2ec displayed diminished activity compared to parental 1-lip E2ec: 2.5% and 2.8%, respectively, indicating they were nearly totally impaired for overall activities. Elsewhere, a series of mutagenesis studies on E2ec (5)

100

also indicated that 2-3% activity is the minimum we can achieve with the cell line used.

When K41A E2ec and H399C E2ec were mixed and incubated (Figure 3.1) at the mass ratios of K41A:H399C=1:1, 1:1.5, 1:2, reconstituted PDHc activities increased with increasing concentration of H399C E2ec up to a maximum of 22.7%, clearly well above the baseline activity measured with the individual variants (Table 3.2 and Figure 3.2).

3.3.3. Activity of the doubly substituted variant.

When the K41A/H399C E2ec was pre-incubated with K41A E2ec then reconstituted with E1ec and E3ec (Figure 3.3) in the same ratio as used for

K41A:H399C; i.e., K41A:K41A/H399C=1:1, 1:1.5, 1:2, the overall activity (Table 3.2 and Figure 3.4) did not increase significantly, indicating there is no inter-subunit acetyl transfer from the doubly-substituted variant, impaired in both lipoylation and catalytic sites, to the catalytic site of K41A E2ec and ultimately to Coenzyme A.

101

E1ec:E2ec:E3ec Overall Types E2ec variants on overall PDHc reaction activity (%)

Lys41Ala 1:1:1 2.50

His399Cys 1:1:1 2.80 Single variant His399Ala 1:1:1 5.57

Lys41Ala/His399Cys 1:1:1 0.90 (doubly substituted) 1:(1:1):1 10.3 Lys41Ala:His399Cys 1:(1:1.5):1 18.3 (separate variants) Mixtures of 1:(1:2):1 22.7 two variants 1:(1:1):1 2.09 Lys41Ala:Lys41Ala/His399Cys 1:(1:1.5):1 2.95 (single + doubly substituted) 1:(1:2):1 3.00

Table 3.2. Overall PDHc activity of E2ec variants with various mass ratios. The production of NADH was monitored at 340 nm. 1u activity = 1µmol NAD+ reduced/min/mg E1ec.

102

Figure 3.1. Crossover experiment designed to test interchain acetyl transfer in E2ec.

103

0.06

0.05

0.04

0.03

0.02

Abs (340nm) Abs

0.01

0.00

-0.01 0.0 0.2 0.4 0.6 0.8 1.0 Time (min)

Lys41Ala His399Cys Lys41Ala:His399Cys=1:1 Lys41Ala:His399Cys=1:1.5 Lys41Ala:His399Cys=1:2

Figure 3.2. Activity assay for E2ec variants reconstituted with E1ec and E3ec. Mixtures of K41A E2ec and H399C E2ec in various mass ratios were incubated and E1ec and

E3ec were added enabling use of the NADH production assay for overall activity of the complex.

104

Figure 3.3. Incubation of Lys41Ala with doubly substituted variant. Overall PDHc activity with E1ec and E3ec was observed for the control experiment. Doubly substituted variant was fully impaired indicating it can produce neither overall activity itself with

E1ec and E3ec nor acetyl transfer to Lys41Ala having catalytic center.

105

0.05

0.04

0.03

0.02

0.01

Abs (340nm) Abs

0.00

-0.01

-0.02

0.0 0.2 0.4 0.6 0.8 1.0 Time (min)

Doubly sustituted (D) Lys41Ala:D=1:1 Lys41Ala:D=1:1.5 Lys41Ala:D=1:2

Figure 3.4. Activity assay for doubly substituted, Lys41Ala/His399Cys, E2ec variants reconstituted with E1ec and E3ec. A fixed concentration of K41A E2ec was incubated with increasing concentrations of K41A/H399C E2ec. Next, E1ec and E3ec were added to enable measurement of the overall PDHc activity.

106

3.3.4. Mass spectrometric data provide independent support for the production of

acetylCoA in the PDHc reaction by inter-subunit acetyl transfer.

According to kinetic activity assay, considerably more NADH was produced on complementation of K41A E2ec and H399C E2ec, than with either variant alone, or with the K41A/H399C E2ec doubly substituted variant. We used direct mass spectral detection of acetylCoA to provide additional, independent support for our findings.

Standard solutions of CoA and acetylCoA were prepared and observed at 768.123 m/z and 810.133 m/z, respectively (Figure 3.5). Isotopic patterns of these standards also matched theoretical data. To quantify concentration of acetylCoA produced by E1ec,

E2ec, and pyruvate in the PDHc reaction by FTMS, a standard curve was constructed for acetylCoA (1, 5, 10, 20, and 30 µM), generating a linear plot of intensity vs. acetylCoA concentration (Figure 3.6 and 3.7). The goodness of fit of the linear regression was excellent, hence it could be used to quantify the acetylCoA being produced in the PDHc reaction of all single site variants (K41A, H399A, and H399C) and mixtures of two variants, K41A and H399C.

The 1-lip E2ec clearly produced acetylCoA at 810.13 m/z (Fig. 3.8a), while the acetylCoA produced by H399A E2ec (Fig. 3.8b), H399C E2ec (Fig. 3.8c), and K41A

E2ec (Fig. 3.8d) was much less. The scales of X and Y axes in Figures 3.8b-3.8d are the same to allow comparison of the acetylCoA being produced. Consistent with the NADH assay for PDHc, the H399A E2ec produced much more acetylCoA than H399C E2ec or

K41A E2ec.

107

Using the standard plot in Figure 3.7, the concentration of acetylCoA produced by

E1ec, E2ec (and its variants), E3ec, and pyruvate was quantified. The reaction was started with 100 µM of CoA yielding the following concentration of acetylCoA (in parentheses): 1-lip E2ec (25.97 µM), H399A (12.3 µM), H399C (0.47 µM), K41A (0.03

µM). Again, the results indicated that the H399A substitution did not abolish the activity, unlike the H399C substitution.

3.3.5. Inter-subunit acetyl transfer in the E2 component is confirmed by FTMS.

The production of acetylCoA with a fixed concentration of K41A E2ec complemented with increasing concentrations of H399C was quantified (Figure 3.9, X and Y axis of all spectra are the same) with mass ratio of K41A E2ec to H399C E2ec of

1:1 (c), 1:1.5 (d), 1:2 (e), 1:2.5 (f), 1:3 (g), 1:3.5 (h), 1:4 (i), 1:4.5 (j), and 1:5 (k). Up to ca. 14-15 % conversion to acetylCoA is in evidence, exceeding the amount produced by the respective variants by themselves by numbers well in excess of the experimental error

(Table 3.3).

The H399A E2ec provides a very good control and, of course raises a new mechanistic question. On the one hand, a comparison of the activities and acetylCoA production by the H399A E2ec and H399C E2ec, supports our use of the latter to demonstrate inter-subunit acetyl transfer within the E2ec component. On the other hand, the same comparison also points out our lack of understanding of the transthiolacetylation mechanism, transfer of the acetyl group from the acetyldihydrolipoylE2 to CoA at the E2 catalytic center. Should H399 be a crucial catalytic residue, say a general acid-base

108

catalyst, its substitution for alanine should abolish the activity, clearly not the case. On the other hand, the H399C E2ec substitution suggests that this cysteine is involved in the inactivation process.

These results strongly support our original hypothesis that inter-subunit communication between the lipoyllysine site on H399C and the catalytic site on K41A gave rise to the production of acetylCoA on reconstitution with E1ec, E3ec, and pyruvate.

The mechanism of acetyl transfer in the catalytic core of E2ec could be investigated further since H399A produced significant amount of acetylCoA compared to H399C and

K41A.

109

a. b.

Figure 3.5. ESI-detected FTMS specta of acetylCoA and CoA. (a) CoA was determined at 768.123 m/z and (b) acetylCoA was determined at 810.133 m/z, both with positive ion mode.

110

Figure 3.6. ESI-detected FTMS spectra of acetylCoA at increasing concentrations. The mass at 810.13 m/z was recorded by ESI-detected FTMS with positive ion mode for the following concentrations of acetylCoA: (a) 1 µM, (b) 5 µM, (c) 10 µM, (d) 20 µM, and (e)

30 µM. The scales of X and Y axes were the same for all concentrations.

111

7e+7

6e+7

5e+7

4e+7

Intensity 3e+7

2e+7

1e+7

0 0 5 10 15 20 25 30 35

Concentration ( M )

Figure 3.7. Standard curve for concentration of acetylCoA. Intensity of acetylCoA from

FTMS was plotted as a function of concentrations. Correlation coefficient (R2) was

0.9951 affirming a suitable goodness of fit to determine acetylCoA concentrations being produced in the enzymatic reaction.

112

Figure 3.8. AcetylCoA produced by E2ec variants detected by FTMS. AcetylCoA was observed at 810.13 m/z in different reactions; (a) 1-lip E2ec, (b) H399A E2ec, (c) H399C

E2ec, (d) K41A E2ec.

113

Figure 3.9. AcetylCoA produced by complementation of K41A E2ec and H399C E2ec.

The amount of acetylCoA detected at 810.13 m/z is clearly enhanced by complementation of fixed K41A E2ec concentration with increasing concentration of

H399C E2ec: (a) K41A, (b) H399C, and a mixture of K41A:H399C at the indicated mass ratios = (c) 1:1, (d) 1:1.5, (e) 1:2, (f) 1:2.5, (g) 1:3, (h) 1:3.5, (i) 1:4, (j) 1:4.5, (k) 1:5.

114

Quantity of Types Substitutions of E2ec E1ec:E2ec:E3ec aetylCoA (µM)

Wild N/A 1:1:1 25.97

Lys41Ala 1:1:1 0.03

Single variant His399Cys 1:1:1 0.47

His399Ala 1:1:1 12.3

1:(1:1):1 11.34

1:(1:1.5):1 11.84 1:(1:2):1 12.07 Mixtures of 1:(1:2.5):1 12.69 Lys41Ala:His399Cys* two variants (separated E2ec variants) 1:(1:3):1 13.05 1:(1:3.5):1 13.18 1:(1:4):1 13.25 1:(1:4.5):1 13.44 1:(1: 5):1 14.75

Table 3.3. Estimated quantity of acetylCoA obtained by single variants and complemented variants according to FTMS. In all experiments, 100 µM coenzyme A was used, and all reactions were incubated for 10 min. *Two variants of E2ec were mixed and incubated to monitor the production of acetylCoA.

115

3.4. DISCUSSION and CONCLUSION

The biochemical version of a crossover experiment (usually termed complementation in biochemical circles) was designed to test the hypothesis that acetyl transfer between acetyldihydrolipoyl-E2 on the LD and coenzyme A presumably at the

CD of E2, takes place by an inter-subunit, rather than an intra-subunit mechanism.

Previously, in our group, complementation experiments have been used effectively in two very different contexts: (a) the pro-sequence of the bacterial serine protease subtilisin could help refold inactive mature subtilisin in both an intermolecular and an intramolecular pathway (71, 72); (b) in yeast pyruvate decarboxylase, absence of one of two active center acidic groups (substitution of either D28 and E477 led to a > 100-fold decrease in steady-state kinetic constants) could be remedied by complementation of two inactive variants (73).

In this study, both activity assay and direct mass spectral measurement of the acetylCoA support this inter-subunit acetyl transfer hypothesis. A comparison of the behavior of the H399A E2ec with that of the H399C E2ec showed that on complementation with K41A E2ec, the H399A E2ec produced significantly higher activity and acetylCoA than did complementation with H399C E2ec. This is consistent with the report that the activity of H602A in 3-lip E2ec (corresponding to H399 in 1-lip

E2ec) retained detectable activity (13). The results suggest that our understanding of the transthiolesterification is incomplete.

The activity assay and mass spectroscopy showed that the communication between K41A E2ec and H399C E2ec resulted in inter-subunit acetyl transfer leading to

116

NADH and acetylCoA production. However, there is additional question whether interchain acetyl transfer takes place via E2 chain communication within one (holo)PDH molecule or communication between E2 chains located on different PDHc molecules.

To address this issue, we carried out reconstitution differently than before (in the data reported in earlier in this work, K41A E2ec and H399C E2ec were first pre- incubated, then reconstituted to complex by the addition of E1ec and E3ec). In this control experiment, two PDH complexes were prepared, one from K41A E2ec and the other from H399C E2ec. These two types of complexes were then mixed in a 1:1 molar ratio and NADH production was monitored for 30 min. The overall activity was nearly zero (2.6 % which is nearly same as K41A overall PDHc activity in Table 3.2) after this time, while the pre-incubated mixture of K41A E2ec with H399C E2ec in a 1:1 molar ratio once reconstituted with E1ec and E3ec displayed as much as 10 % from the inactive state (Figure 3.10). This result indicated that exchange of E2 chains between preformed

PDHc‟s, one formed exclusively with K41A E2ec and the other with H399C E2ec, is much slower than the exchange of chains between the two E2 oligomers, one formed from K41A E2ec and the other from H399C. Presumably, these 24-mers are produced as soon as the protein is released from the ribosome. Given the EM models for PDHc, and the central position of the E2 chains, this result is perhaps not surprising, but still needed to be experimentally demonstrated.

From these results, it is concluded that inter-subunit interaction of the lipoylation site from one subunit with the acetyltransferase active site from a second subunit is plausible. Our results provide a model for interchain acetyl transfer but do not necessarily

117

rule out intrachain transfer. The results, however, do prompt us to propose a tentative explanation for the fact that E2 components exist as multiples of three chains as follows.

Let us assume that of the three chains say A, B and C, chains A and C are in parallel (the same head to tail orientation), while B has a reversed orientation (Figure 3.11):

According to this model, chain A would be reductively acetylated (Fig 3.11 step 1), and chain B would accept then transfer the acetyl group to Coenzyme A, not using its lipoyl group at all, while chain A would not use its catalytic center (Fig 3.11 step 2). Chain C, with the same orientation as A would not use its catalytic center either, but it would communicate reducing equivalents between chain A and E3ec (Fig 3.11 step 3), and chain C would be re-oxidized by the E3 component leading to NADH as a final product of the catalytic cycle (Fig 3.11 step 4). One can also speculate regarding such chain assembly in the human enzyme. According to one school of thought (9), the stoichiometric ratio of E2 and E3BP in the human enzyme is 40:20, i.e., 2:1 forming the central core of PDHc to which are non-covalently bound the other components of the complex (74). In this case, the two E2 chains would have opposite orientation, as do chains A and B in E. coli, and these would be accompanied by a single E3BP, with the role and orientation suggested for chain C in the bacterial enzyme. An alternative interpretation of results for the human enzyme (75, 76) suggests 48 E2 + 12 E3BP chains.

In this scenario, one could speculate that 2 sets of two E2 chains each would generate acetylCoA (again analogously to chains A and B in the bacterial enzyme), while 1 E3BP chain would serve to re-oxidize both sets, as a bridge to E3. This last scenario is perhaps more consistent with symmetry considerations. These results should provide further

118

impetus to solving the structure of the intact E2 component from any source, not yet accomplished, but of great importance for further progress on these very important multienzyme complexes.

119

Figure 3.10. Activity assay for E2ec variants reconstituted with E1ec and E3ec. The overall activity of mixtures of two PDH complexes from K41A E2ec and H399C E2ec in a 1:1 molar ratio was 2.6 % which is nearly same as the overall activity of K41A E2ec with E1ec and E3ec, while pre-incubated mixture of K41A E2ec and H339C E2ec displayed 10 % overall activity in reconstitution with E1ec and E3ec.

120

Figure 3.11. The model of three subunits of E2ec for the acetyl transfer and oxidation of dihydrolipoyl E2ec by E3ec.

121

CHAPTER 4. Preliminary Studies of Flexible Regions in Various

ThDP Dependent Enzymes

4.1. INTRODUCTION

Previously, the flexible regions of the E1 component of the E. coli pyruvate dehydrogenase multienzyme complex (E1ec) have been investigated using multidimensional NMR in Chapters 1 and 2, and the results showed the structural and functional information of interaction between domains. Three missing regions in the crystal structure of E1ec inspired the hypothesis that these regions are highly mobile, and it might be evident by solution NMR, as was confirmed in Chapters 1 and 2. This notion has been extended to other ThDP dependent enzymes. The E1 component of E. coli 2- oxoglutarate dehydrogenase (E1o), and yeast pyruvate decarboxylase (y-PDC) were labeled with 15N ammonium chloride using the methods described in Chapter 1, and flexible regions were observed on NMR spectra. The human E2 didomain (L2S hE2) containing the second lipoyl domain, the second hinge region, subunit-binding domain, and the third hinge region of E2, and the human E2 tridomain (L1L2S hE2) containing the first and second lipoyl domains, the second hinge region, subunit-binding domain, and the third hinge region of E2 (77) were constructed by our collaborator, and the backbone amides were also labeled with 15N ammonium chloride and studied using 2D

NMR. Remarkably, all 2D spectra from various enzymes displayed good signal dispersion, and they are promising for further studies of interactions of enzymes. These preliminary data confirmed that flexible regions in various enzyme complexes can be further studied with NMR including three dimensional NMR which can be used for

122

labeling residues to precisely identify which regions or residues interact with other components such as kinase, E2 for E1, and E3 for E2, and so on.

123

4.2. MATERIALS and METHODS

4.2.1. Materials

The Wizard® Plus Minipreps DNA purification system was used for purification of DNA

(Promega, Madison, WI). Thiamin diphosphate (ThDP), NAD+, coenzyme A, dithiothreitol (DTT), isopropyl β-D-1-thiogalactopyranoside (IPTG), 2-(N- morpholino)ethanesulfonic acid (MES), micrococcal nuclease, Deoxyribonuclease I were from USB (Cleveland, OH). Thiamin hydrochloride was from Sigma-Aldrich (St Louis,

15 MO). NH4Cl were from Cambridge Isotope Laboratories, Inc. (Andover, MA).

4.2.2. Plasmid purification

Plasmid purification was performed based on the protocol of Wizard® Plus Minipreps

DNA purification system from Promega. Descriptions of detailed procedures of plasmid purification are in Chapter 1.

4.2.3. Protein expression and purification

15 4.2.3.1. Uniformly N labeled His6-tag y-PDC

[1] Protein expression

In 10 mL LB medium containing 50 μg/mL ampicillin, cultures consisting of the wild type y-PDC plasmid with His6-tag attached to its C-terminus, were grown overnight at 37 oC. In two 700 mL and one 250 mL flasks, M9 minimal medium containing 47 mM

-1 15 Na2HPO4, 22 mM KH2PO4, 8.56 mM NaCl, 1g L N NH4Cl, 2 mM sodium acetate,

100 μg/mL ampicillin, 1 mM MgSO4, 1 mM CaCl2, and 0.4 % glucose was prepared and

124

autoclaved. After overnight, the cells in LB medium were collected by centrifugation at

2236 × g for 10 min at 4 oC. The LB supernatant was discarded and the cells were washed with 25 mL M9 minimal medium containing 47 mM Na2HPO4, 22 mM KH2PO4,

-1 15 8.56 mM NaCl, 1g L N NH4Cl, 2 mM sodium acetate, 100 μg/mL ampicillin, 1 mM

MgSO4, 1 mM CaCl2, and 0.4% glucose. Cells were combined to make 50 mL cell suspension in two tubes each and centrifuged again at 2236 × g for 10 min at 4 oC. The

M9 supernatant was discarded, and cells were dissolved in 50 mL fresh M9 medium.

Cells from each tube were then transferred to each flask and grown to OD600=0.6-0.8 at

37 oC. The cultures of y-PDC were induced with 0.5 mM IPTG, 0.5 mM thiamin chloride and 1 mM MgCl2. After overnight, the cells were centrifuged and collected at 2236 × g at

4 ºC for 10 min. The supernatant was discarded and the pellets were washed with washing 20 mM KH2PO4 buffer (pH 7.0) containing 0.25 mM EDTA, and 0.10 M NaCl to remove the minimal medium and stored at -20 oC.

[2] Cell disruption

The cell pellet was resuspended in the 200 mL sonication 50 mM NaH2PO4 buffer (pH

7.5) containing 100 mM NaCl, 2 mM MgCl2, and 1 mM ThDP. The cells were disrupted at 20 kHz at 4 ºC for 4 min (10 sec on, 10 sec off) on Sonic Dismembrator Model 550 from Fisher Scientific. The yellow suspension was then centrifuged at 28978 × g at 4ºC for 30 min to remove the lysed cell pellet.

[3] Protein purification

The supernatant was applied to Ni2+ Sepharose 6 fast flow column pre-equilibrated with sonication buffer. The His6-tag y-PDC protein bound to the column was then washed with

125

50 mL sonication buffer and 50 mL washing buffer (pH 6.0) containing 5 mM imidazole,

200 mM MES, 100 mM NaCl, 2 mM MgCl2, and 1 mM ThDP, consecutively. y-PDC was eluted using 50 mL elution buffer (pH 7.5) containing 200 mM imidazole, 50 mM

NaH2PO4, 2 mM MgCl2, and 1 mM ThDP. 1 mL fractions were collected and checked for protein content using the Bradford reagent. 5 μL from each fraction was tested against the red Coomassie dye which changes to blue upon addition of a small protein sample. 50 μL samples from the desired range of tubes were mixed with 50 μL SDS buffer to check for protein purity by SDS-PAGE. 12 % Separating Gel was used as described in Chapter 1.

The fractions from the respective tubes were combined and dialyzed against 2 L dialysis buffer (pH 6.0) containing 20 mM MES, 20 mM NaH2PO4, 5 mM MgCl2, 1 mM ThDP, and 0.1 mM EDTA. After dialysis, the protein was concentrated to about 1 mL by using an Amicon centriprep-30 centrifugal concentration device. Glycerol was added to a final concentration of 30-50 % for long-term storage at -20 oC.

15 4.2.3.2. Uniformly N labeled His6-tag E1o

[1] Transformation on BL21 (DE3)

The plasmid of E1o was purified and transformed on BL21 (DE3) using the same methods described in Chapter 1.

[2] Protein expression

E. coli frozen stock harboring the plasmid was streaked on LB agar plates containing chloramphenicol (100 g/mL) and incubated at 37 °C overnight. The procedure for

15 labeling backbone amides using N NH4Cl was similar to His6-tag y-PDC procedure

126

above. 100 g/mL chloramphenicol, 1.0 mM thiamin hydrochloride, and 2.0 mM MgCl2 were added to M9 minimal medium. The cultures were induced with 1.0 mM IPTG and incubated at 20 °C with shaking overnight. The cells were harvested by centrifugation at

2236 × g at 4 °C and the cell pellets were stored at -20 °C until purification.

[3] Cell disruption

All subsequent steps were carried out at 4 °C. The cell pellets were resuspended in sonication buffer (pH 7.0) containing 20 mM KH2PO4, 0.1 M NaCl, 2.0 mM MgCl2, 1.0 mM ThDP, 1.0 mM benzamidine hydrochloride, and 1.0 mM PMSF. 0.6 mg/mL lysozyme was added into the resuspended cell solution, and the solution was incubated on ice for 20 min. The cells were disrupted for 4 min (10 s pulsar “on” and 10 s pulsar “off”) using the Sonic Dismembrator Model 550 from Fisher Scientific. The lysate was centrifuged at 28978 × g at 4 °C for 30 min until clear supernatant resulted.

[4] Protein purification

The supernatant was applied to Ni2+ Sepharose 6 fast flow column pre-equilibrated with sonication buffer. The enzyme was eluted with 20 mM KH2PO4 buffer (pH 7.4) containing 0.5 M NaCl, 150 mM imidazole, 2.0 mM MgCl2, and 1.0 mM ThDP.

Fractions with enzyme were combined, dialyzed against 20 mM KH2PO4 buffer (pH 7.4) containing 2.0 mM MgCl2, 1.0 mM ThDP, and 1.0 mM benzamidine hydrochloride. The enzyme was concentrated by ultrafiltration with a cutoff of 30 kDa. Enzymatic purity was confirmed by a single band on SDS-PAGE (7.5 %) at 100 kDA.

127

15 4.2.3.3. Uniformly N labeled His6-tag L2S hE2 and L1L2S hE2

Human L2S and L1L2S were kindly supplied by Yun-Hee Park in Dr. Patels laboratory at State University of New York at Buffalo. Human L2S cells (second lipoyl domain, the second hinge region, E1 binding domain and third hinge region) were grown at 37 °C in

LB medium including 35 μg/mL of kanamycin (25 mL x 4 tubes) overnight. After overnight, 25 mL cells of each tube were centrifuged at 6000 × g for 10 min at 4 °C to precipitate the cells. The supernatant was removed and cells of each tube were dissolved in 25 mL of the M9 minimal medium including 35 μg/mL of kanamycin. Cells were collected by centrifugation, and supernatant was removed. Cells were again dissolved in

25 mL of the M9 minimal medium, and then 25 mL cultures in M9 minimal media were inoculated in (1 l x 4, total volume 4 L) M9 minimal medium including 0.2 mM lipoic acid and 35 μg/mL of kanamycin. Cultures were grown to OD600 = 0.5-0.7 and induced at

25 °C with 200 µg/mL IPTG overnight. Cultures were harvested by centrifugation at

6000 × g for 30 min at 4 °C and washed once with buffer A (50 mM KH2PO4 buffer, pH

7.5, 300 mM KCl, 5 mM mercaptoethanol, containing protease inhibitors: 0.1 mM PMSF,

0.1 mM benzamidine, 1 µg/mL leupeptin). The washed pellet was resuspended in Buffer

A and incubated with 1 mg/mL lysozyme for 30 min. The cells were broken by three passes through a French press (500 psi). The suspension was centrifuged at 20000 × g for

30 min at 4 °C and supernatant was applied to the Ni-nitriloacetate-agarose column. The column was washed with buffer A for 20 times column volume and with 10 % of buffer

B (buffer A + 250 mM imidazole). L2S was eluted with a linear gradient of 25-125 mM imidazole in buffer A. Fractions containing L2S proteins were dialyzed against 50 mM

128

KH2PO4 buffer (pH 7.5) containing 0.5 mM DTT. L2S proteins were concentrated and loaded on Superose 200 gel-filtration column. L2S proteins were eluted with 50 mM

KH2PO4 buffer, pH 7.5, 150 mM NaCl, concentrated, dialyzed against 20 mM KH2PO4 buffer (pH 7.2) including 0.15 M NaCl and 0.02 % NaN3, and stored at -80 °C. The purification of 15N labeled L1L2S is the same as the purification of 15N L2S.

4.2.4. NMR spectroscopy

4.2.4.1. Preparation of sample for NMR spectroscopy

For 2D 1H-15N-TROSY-HSQC experiments, all purified proteins were prepared in a shigemi tube (Shigemi Inc, PA). The concentration of His6.tag E1ec and its variants in the NMR sample was measured using Bio-Rad Protein Assay Dye Reagent Concentrate

(Hercules, CA) described in Chapter 1 and adjusted to 20 mg/mL in 0.4 mL of dialysis buffer for E1o, L1L2S hE2, and L2S hE2. For y-PDC, 33 mg/mL of protein was used for

NMR. 0.15 M NaCl and 7% D2O were added to all proteins. The pH of the NMR samples was adjusted to 7.0 for E1o, 6.8 for y-PDC, and 7.2 for L1L2S hE2, and L2S hE2 by the addition of 0.15 M CH3COOH or 0.15 M NaHCO3 and samples were clarified by centrifugation.

4.2.4.2. NMR Spectroscopy

All NMR experiments were performed on a Varian INOVA 600 MHz spectrometer.

TROSY was employed for better resolution of all proteins. All data were processed by

NMR Pipe (28) and NMR ViewJ (29).

129

4.3. RESULTS and DISCUSSIONS

15 4.3.1. 2D TROSY-HSQC experiment of uniformly N labeled His6-tag y-PDC y-PDC is homotetrameric assembly (4 x 61 495 Da) containing two dimers. The crystal structure of this enzyme has been reported elsewhere (78). y-PDC catalyzes the decarboxylation of pyruvate to acetaldehyde and carbon dioxide in the presence of ThDP cofactor (Scheme 2). 2D 1H-15N-TROSY-HSQC of y-PDC was acquired at 25 °C for 21 hours (Figure 4.1). The spectrum was well dispersed, and asparagine and glutamine regions were observed. Among 562 amino acids in y-PDC, there are 22 glutamines and

29 asparagines. On the spectrum, not all glutamines and asparagines were present indicating that only flexible residues could be observed by NMR.

130

Scheme 2. The mechanism of y-PDC.

131

Figure 4.1. 2D 1H-15N-TROSY-HSQC spectrum of y-PDC. Well dispersed spectrum was present by 2D NMR including asparagine and glutamine regions and some glycines.

132

15 4.3.2. 2D TROSY-HSQC experiment of uniformly N labeled His6-tag E1o

The 2-oxoglutarate dehydrogenase complex catalyzes the overall conversion of 2- oxoglutarate to succinyl-CoA and CO2. It contains multiple copies of three enzymatic components; 2-oxoglutarate dehydrogenase (E1o), dihydrolipoamide succinyltransferase

(E2o) and dihydrolipoamide dehydrogenase (E3o). E1o which is a homodimer (2 x 105 kDa) catalyzes the decarboxylation of 2-oxoglutarate in the presence of ThDP (40). 2D

1H-15N-TROSY-HSQC was acquired at 20 °C for 61 hours. Among 933 amino acids in

E1o, there are 54 glutamines and 36 asparagines, and highly mobile residues were present on the spectrum (Figure 4.2). Previously, the crystal structure of E1o was studied, but the first 77 residues from its N-terminal region were removed by limited digestion with trypsin before crystallization since it was not crystallized with the N-terminal region (40).

Hence, the study of binding property of N-terminal region toward E2o was limited. In this result, intact E1o, not trimmed E1o (tE1o), was studied by NMR indicating that the binding property of the N-terminal region can be monitored by assigning reporter residues in this region. In the N-terminal region, there are 3 glycines and 7 glutamines, and all/some residues can be labeled with site directed mutagenesis as described in

Chapter 1 for E1p. The active site loops, residues 391-407 and 458-471, of E1o are disordered, and they are missing in the crystallographic data (40) same as in E1p in

Chapter 2. There is one glycine and glutamine in each of the two loop regions, and these are excellent potential reporters to study the dynamic property of the two loop regions.

133

Figure 4.2. 2D 1H-15N-TROSY-HSQC spectrum of E1o. Well dispersed spectrum was revealed by 2D NMR including the asparagine and glutamine regions and some glycines.

134

15 4.3.3. 2D TROSY-HSQC experiment of uniformly N labeled His6-tag L1L2S and

L2S hE2

Human dihydrolipoamide acetyltransferase (hE2) plays a role of acetyl transfer to CoA with pyruvate same as E2p. It contains 60 copies of E2 and 647 amino acids (70 kDa)

(79-81). To study this large protein, hE2 was trimmed to L2S (total 203 amino acids, 22 kDa) which consists of the second lipoyl domain, the second hinge region, and E1 binding domain, and L1L2S (total 312 amino acids, 34 kDa) which consists of the first lipoyl domain, the first hinge region, the second lipoyl domain, the second hinge region, and the E1 binding domain. 2D HSQC spectra of L2S (Figure 4.3) and L1L2S (Figure 4.4) were recorded. They were both well dispersed and at high resolution. Two spectra were superimposed to observe differences (Figure 4.5). Indeed, they were well differentiated due to the presence of the first lipoyl domain and hinge region in only L1L2S, and there are many overlapped residues due to the second lipoyl domain, the second hinge region, and the E1 binding domain being present on both trimmed E2 proteins.

Pyruvate dehydrogenase kinase (PDK) is an enzyme which acts to inactivate human pyruvate dehydrogenase E1 component by phosphorylating it using adenosine triphosphate (ATP). PDK participates in the regulation of the pyruvate dehydrogenase complex. Both PDK and the PDHc are located in the mitochondrial matrix of eukaryotes.

The complex acts to convert pyruvate which is a product of glycolysis in the cytosol to acetyl-CoA, which is then oxidized in the mitochondria to produce energy in the citric acid cycle. By downregulating the activity of this complex, PDK decreases the oxidation of pyruvate in mitochondria and increases the conversion of pyruvate to lactate in the

135

cytosol. To observe the interaction between L2S hE2 and PDK2, they were incubated and a spectrum was acquired at 25 °C by 2D NMR (Figure 4.6). Some residues were reduced/absent in intensity, and some residues were shifted due to the interaction between L2S and PDK2. This result shows that the interaction between L2S hE21 and

PDK2 can be revealed using triple resonance experiments to label amino acids, and interacting region/residues, therefore, can be identified.

136

Figure 4.3. 2D 1H-15N-TROSY-HSQC spectrum of L2S hE2. Well dispersed spectrum was present indicating triple resonance experiments are feasible for labeling 203 amino acids in L2S hE2.

137

Figure 4.4. 2D 1H-15N-TROSY-HSQC spectrum of L1L2S hE2. L1L2S hE2 (312 amino acids) was monitored by 2D HSQC. The resolution of this spectrum was quite high and well dispersed.

138

Figure 4.5. Superimposed 2D 1H-15N-TROSY-HSQC spectrum of L2S hE2 with L1L2S hE2. Superimposed spectrum shows that L2S (red) and L1L2S (blue) hE2 are clearly differentiated by 2D NMR due to the first lipoyl domain and hinge region present only in

L1L2S. Also, there are overlapped residues due to the second lipoyl domain, the second hinge region, and E1 binding domain which are present on both trimmed E2 proteins.

139

Figure 4.6. Superimposed 2D 1H-15N-TROSY-HSQC spectrum of L2S hE2 with L2S hE2 in the presence of PDK2. L2S hE2 (a, red) was superimposed with L2S hE2 in the presence of PDK2 (b, blue). Red peaks in spectrum b. correspond to L2S hE2 residues in contact with PDK2.

140

4.4. CONCLUSION

15 The backbone amides of various ThDP dependent enzymes were labeled with NH4Cl, and 2D HSQC was employed to observe flexible regions. Indeed, the flexible regions of y-PDC, E1o, L2S hE2, and L1L2S hE2 were observed with good signal dispersion and high resolution. The methods in Chapters 1 and 2 can be extended to these enzymes to study the properties of dynamic regions including N-terminal and active site loops.

Extending these studies of flexible regions of E. coli pyruvate dehydrogenase multienzyme complex to various other ThDP dependent enzyme complexes including the

E1 component of E. coli oxoglutarate dehydrogenase complex (E1o), and pyruvate decarboxylase (PDC) showed similar NMR findings. Particularly, trimmed versions of

L2S hE2 and L1L2S hE2 can be studied extensively since the 2D spectra provided sufficient information, and they reveal most residues for further triple resonance experiments such as HNCA, HNCO, HNCACB, HNCOCACB, and so on. In conclusion, these results confirm our initial notion and open promising avenues for further study of dynamics in ThDP dependent multi-enzyme complexes to study structural property of four binding domains of E1o, y-PDC, and trimmed hE2.

141

APPENDIX

1. Reagents and Buffers

1.1 Buffers

1.1.1 E1ec purification

[A] Cell lysis (Sonication) buffer

20mM KH2PO4 (pH 7.0), 2.0 mM ThDP, 5.0 mM MgCl2, 1.0 mM DTT, 1.0 mM EDTA and 1.0 mM benzamidine HCl

[B] Dialysis buffer (After ammonium sulphate precipitation and anion exchange column)

20mM KH2PO4 (pH 7.0), 0.2 mM ThDP, 2.0 mM MgCl2, 1.0 mM DTT, 0.50 mM EDTA and 1.0 mM benzamidine HCl

[C] Buffers for FPLC column

Buffer A: 20 mM KH2PO4 (pH 7.5)

Buffer B: 20 mM KH2PO4 (pH 7.5) + 1 M NaCl

[D] Buffers for HPLC column

Buffer A: 20 mM KH2PO4 (pH 7.5)

Buffer B: 20 mM KH2PO4 (pH 7.5) + 0.5 M NaCl

1.1.2 His6-tag E1ec purification

[A] Cell lysis (Sonication) buffer

20mM KH2PO4 (pH 7.0), 0.10 M NaCl, 1.0 mM ThDP, 2.0 mM MgCl2, and 1.0 mM benzamidine HCl

[B] Dialysis buffer

Note: Same as E1ec dialysis buffer

142

[C] Binding buffer for Ni2+ Sepharose 6 fast flow column

20mM KH2PO4 (pH 7.4), 1.0 mM ThDP, 2.0 mM MgCl2, 0.50 M NaCl, and 20 mM imidazole

[D] Elution buffer for Ni2+ Sepharose 6 fast flow column

20mM KH2PO4 (pH 7.4), 1.0 mM ThDP, 2.0 mM MgCl2, 0.50 M NaCl, and 100 mM imidazole

1.1.3 1-Lip E2ec purification

[A] Cell lysis (Sonication) buffer

20 mM KH2PO4 (pH 7.5), 0.10 M NaCl, 1.0 mM DTT and complete cocktail tablet

(Roche Diagnostics)

[B] Dialysis buffer

20 mM KH2PO4 (pH 7.5), 1.0 mM EDTA, 0.20 M NaCl, 1.0 mM DTT, 1.0 mM benzamidine HCl, 2 µM leupeptine, and 25 µM AEBSF

[C] Buffer C for gel filtration column

20 mM KH2PO4 (pH 7.2), 0.50 mM EDTA, 0.20 M NaCl, 1.0 mM DTT, and 1.0 mM benzamidine HCl

[D] E2ec storage buffer

Note: Additional 0.30 M NaCl in buffer C. Rest reagents are same.

1.1.4 E3ec purification

[A] Cell lysis (sonication) buffer

50 mM KH2PO4 (pH 8.0) and 1.0 mM EDTA

143

[B] Buffer A

50 mM KH2PO4, 1 mM EDTA, and 40 % ammonium sulphate (pH 8.0)

[C] Buffer B

50 mM KH2PO4 (pH 8.0) and 1 mM EDTA

[D] Buffer C

50 mM KH2PO4 (pH 8.0), 1 mM EDTA, and 1 M NaCl

1.2 SDS-PAGE (Laemmli) buffer

1.2.1 Acrylamide/Bis (30% T, 2.67% C)

87.6 g acrylamide (29.2 g/100 mL)

0.24 g N'N'-bis-methylene-acrylamide (0.8 g/100 mL)

Make to 300 mL with deionized water. Filter and store at 4 °C in the dark (30 days maximum.)

1.2.2 1.5 M Tris-HCl, pH 8.8

27.23 g Tris base (18.15 g/100 mL)

80 mL deionized water. Adjust to pH 8.8 with 6 N HCl. Make to 150 mL with deionized water and store at 4 °C.

1.2.3 0.5 M Tris-HCl, pH 6.8

6 g Tris base

60 mL deionized water

Adjust to pH 6.8 with 6 N HCl. Make to 100 mL with deionized water and store at 4 °C.

144

1.2.4 10% SDS

Dissolve 10 g SDS in 90 mL water with gentle stirring and bring to 100 mL with deionized water.

1.2.5 Sample Buffer (SDS Reducing Buffer)

Note: Store at room temperature

3.8 mL deionized water

1.0 mL 0.5 M Tris-HCl, pH 6.8

0.8 mL glycerol

1.6 mL 10% (w/v) SDS

0.4 mL 2- Mercaptoethanol

0.4 mL 1.0 % (w/v) bromophenol blue

8.0 mL Total Volume

Dilute the sample at least 1:4 with sample buffer, and heat at 95 °C for 4 minutes.

1.2.6 5X Electrode (Running) Buffer, pH 8.3

30.3 g Tris base

144.0 g Glycine

10.0 g SDS

Dissolve and bring total volume up to 1,000 mL with deionized water. Do not adjust pH with acid or base. Store at 4 °C. If precipitation occurs, warm to room temperature before use. Use: Dilute 50 mL of 10x stock with 450 mL deionized water for each electrophoresis run. Mix thoroughly before use.

145

1.2.7 10% APS (fresh daily)

Dissolve 100 mg ammonium persulfate in 1 mL of deionized water.

1.3 Reaction buffer for overall PDHc activity measurement

1.3.1 Stock solutions

0.1 M pyruvate in 20 mM KH2PO4 (pH 8.0)

0.1 M ThDP in 20 mM KH2PO4 (pH 8.0)

1.0 M MgCl2 in deionized water

0.2 M DTT in deionized water

+ 0.1 M NAD in 20 mM KH2PO4 (pH 8.0)

5 mM CoA in deionized water

1.3.2 Reaction buffer

Note: Reagents are taken from stock solutions above.

+ 2.0 mM pyruvate + 0.2 mM ThDP + 1.0 mM MgCl2 + 2.6 mM DTT + 2.5 mM NAD in

20 mM Tris buffer (pH 8.0)

Important: Overall PDHc reactions are initiated by the addition of 100 µM of CoA to reaction mixtures.

2. Growth medium

2.1 LB Medium

10 g Bacto Tryptone (Difco #0123-17-3)

5 g Bacto Yeast Extract (Difco #0127-17-9)

146

10 g NaCl (Fisher)

Add water to 1 L. Autoclave for 20 min at 121 oC in an autoclave.

2.2 LB Medium + ampicillin for E2ec and E3ec

LB medium + 50 µg/mL ampicillin (Fisher)

2.3 LB Medium + sodium acetate + ampicillin for E1ec and His6-tag E1ec

LB medium + 0.10 mM sodium acetate + 50 µg/mL ampicillin (Fisher)

2.4 Minimal medium (M9)

8.96 g Na2HPO4 · 7H2O (Fisher)

2.10 g KH2PO4 (Fisher)

0.50 g NaCl (Fisher)

0.115 g Sodium acetate (Sigma-Aldrich)

15 0.70 g NH4Cl (Cambridge isotope)

Add water to 700 mL. Autoclave for 20 min at 121 oC. After autoclaving, add 1 mM

MgSo4 (Fisher), 1 mM CaCl2 (Fisher), 0.40 % Glucose (Sigma-Aldrich), and 50 µg/mL ampicillin (Fisher).

147

REFERENCES

1. Stephens, P. E., Lewis, H. M., Darlison, M. G., and Guest, J. R. (1983)

Nucleotide sequence of the lipoamide dehydrogenase gene of Escherichia coli

K12, Eur J Biochem 135, 519-527.

2. Stephens, P. E., Darlison, M. G., Lewis, H. M., and Guest, J. R. (1983) The

pyruvate dehydrogenase complex of Escherichia coli K12. Nucleotide sequence

encoding the pyruvate dehydrogenase component, Eur J Biochem 133, 155-162.

3. Stephens, P. E., Darlison, M. G., Lewis, H. M., and Guest, J. R. (1983) The

pyruvate dehydrogenase complex of Escherichia coli K12. Nucleotide sequence

encoding the dihydrolipoamide acetyltransferase component, Eur J Biochem 133,

481-489.

4. Arjunan, P., Nemeria, N., Brunskill, A., Chandrasekhar, K., Sax, M., Yan, Y.,

Jordan, F., Guest, J. R., and Furey, W. (2002) Structure of the pyruvate

dehydrogenase multienzyme complex E1 component from Escherichia coli at

1.85 angstrom resolution, Biochemistry 41, 5213-5221.

5. Park, Y. H., Wei, W., Zhou, L., Nemeria, N., and Jordan, F. (2004) Amino-

terminal residues 1-45 of the Escherichia coli pyruvate dehydrogenase complex

E1 subunit interact with the E2 subunit and are required for activity of the

complex but not for reductive acetylation of the E2 subunit, Biochemistry 43,

14037-14046.

6. Arjunan, P., Sax, M., Brunskill, A., Chandrasekhar, K., Nemeria, N., Zhang, S.,

Jordan, F., and Furey, W. (2006) A thiamin-bound, pre-decarboxylation reaction

148

intermediate analogue in the pyruvate dehydrogenase E1 subunit induces large

scale disorder-to-order transformations in the enzyme and reveals novel structural

features in the covalently bound adduct, J. Biol. Chem. 281, 15296-15303.

7. Kale, S., Arjunan, P., Furey, W., and Jordan, F. (2007) A dynamic loop at the

active center of the Escherichio coli pyruvate dehydrogenase complex E1

component modulates substrate utilization and chemical communication with the

E2 component, J. Biol. Chem. 282, 28106-28116.

8. Kale, S., Ulast, G., Song, J. Y., Brudvig, G. W., Furey, W., and Jordan, F. (2008)

Efficient coupling of catalysis and dynamics in the E1 component of Escherichia

coli pyruvate dehydrogenase multienzyme complex, Proc. Natl. Acad. Sci. U. S. A.

105, 1158-1163.

9. Brautigam, C. A., Wynn, R. M., Chuang, J. L., and Chuang, D. T. (2009) Subunit

and catalytic component stoichiometries of an in vitro reconstituted human

pyruvate dehydrogenase complex, J Biol Chem 284, 13086-13098.

10. Wei, W., Li, H., Nemeria, N., and Jordan, F. (2003) Expression and purification

of the dihydrolipoamide acetyltransferase and dihydrolipoamide dehydrogenase

subunits of the Escherichia coli pyruvate dehydrogenase multienzyme complex: a

mass spectrometric assay for reductive acetylation of dihydrolipoamide

acetyltransferase, Protein Expr. Purif. 28, 140-150.

11. Reed, L. J. (1974) Multienzyme complexes, Accounts of Chemical Research 7,

40-46.

149

12. Perham, R. N. (2000) Swinging arms and swinging domains in multifunctional

enzymes: catalytic machines for multistep reactions, Annu Rev Biochem 69, 961-

1004.

13. Russell, G. C., Machado, R. S., and Guest, J. R. (1992) Overproduction of the

pyruvate dehydrogenase multienzyme complex of Escherichia coli and site-

directed substitutions in the E1p and E2p subunits, Biochem J 287 ( Pt 2), 611-

619.

14. Jordan, F. (2003) Current mechanistic understanding of thiamin

diphosphatedependent enzymatic reactions, Nat. Prod. Rep. 20, 184-201.

15. Nemeria, N., Chakraborty, S., Baykal, A., Korotchkina, L. G., Patel, M. S., and

Jordan, F. (2007) The 1 ',4 '-iminopyrimidine tautomer of thiamin diphosphate is

poised for catalysis in asymmetric active centers on enzymes, Proc. Natl. Acad.

Sci. U. S. A. 104, 78-82.

16. Nemeria, N. S., Chakraborty, S., Balakrishnan, A., and Jordan, F. (2009) Reaction

mechanisms of thiamin diphosphate enzymes: defining states of ionization and

tautomerization of the cofactor at individual steps, Febs Journal 276, 2432-2446.

17. Hengeveld, A. F., and de Kok, A. (2002) Identification of the E2-binding residues

in the N-terminal domain of E1 of a prokaryotic pyruvate dehydrogenase complex,

FEBS Lett 522, 173-176.

18. Hengeveld, A. F., van Mierlo, C. P., van den Hooven, H. W., Visser, A. J., and de

Kok, A. (2002) Functional and structural characterization of a synthetic peptide

150

representing the N-terminal domain of prokaryotic pyruvate dehydrogenase,

Biochemistry 41, 7490-7500.

19. Arjunan, P., Chandrasekhar, K., Sax, M., Brunskill, A., Nemeria, N., Jordan, F.,

and Furey, W. (2004) Structural determinants of enzyme binding affinity: The E1

component of pyruvate dehydrogenase from Escherichia coli in complex with the

inhibitor thiamin thiazolone diphosphate, Biochemistry 43, 2405-2411.

20. Promega technical bulletin TB117 (2005).

21. Stratagene Instruction manual Revision B (2007).

22. Muchmore, D. C., McIntosh, L. P., Russell, C. B., Anderson, D. E., and Dahlquist,

F. W. (1989) Expression and nitrogen-15 labeling of proteins for proton and

nitrogen-15 nuclear magnetic resonance, Methods Enzymol 177, 44-73.

23. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular cloning: A

laboratory manual, 2nd Ed., Cold spring harbor laboratory, Cold spring harbor,

NY.

24. Cheng, H., Westler, W. M., Xia, B., Oh, B. H., and Markley, J. L. (1995) Protein

expression, selective isotopic labeling, and analysis of hyperfine-shifted NMR

signals of Anabaena 7120 vegetative [2Fe-2S]ferredoxin, Arch Biochem Biophys

316, 619-634.

25. Rodriguez, J. C., Wilks, A., and Rivera, M. (2006) Backbone NMR assignments

and H/D exchange studies on the ferric azide- and cyanide-inhibited forms of

Pseudomonas aeruginosa heme oxygenase, Biochemistry 45, 4578-4592.

26. Instruction Manual, Mini-PROTEAN 3 Cell, Rev B

151

27. Nemeria, N., Volkov, A., Brown, A., Yi, J. Z., Zipper, L., Guest, J. R., and Jordan,

F. (1998) Systematic study of the six cysteines of the E1 subunit of the pyruvate

dehydrogenase multienzyme complex from Escherichia coli: None is essential for

activity, Biochemistry 37, 911-922.

28. Delaglio, F., Grzesiek, S., Vuister, G. W., Zhu, G., Pfeifer, J., and Bax, A. (1995)

NMRPipe: a multidimensional spectral processing system based on UNIX pipes,

J Biomol NMR 6, 277-293.

29. Johnson, B. A. (2004) Using NMRView to Visualize and Analyze the NMR

Spectra of Macromolecules, In Protein NMR Techniques, pp 313-352.

30. Weigelt, J. (1998) Single Scan, Sensitivity- and Gradient-Enhanced TROSY for

Multidimensional NMR Experiments, Journal of the American Chemical Society

120, 10778-10779.

31. Kay, L., Keifer, P., and Saarinen, T. (1992) Pure absorption gradient enhanced

heteronuclear single quantum correlation spectroscopy with improved sensitivity,

Journal of the American Chemical Society 114, 10663-10665.

32. Ikura, M., Kay, L. E., and Bax, A. (1990) A novel approach for sequential

assignment of 1H, 13C, and 15N spectra of proteins: heteronuclear triple-

resonance three-dimensional NMR spectroscopy. Application to calmodulin,

Biochemistry 29, 4659-4667.

33. Hong, J., Sun, S., Derrick, T., Larive, C., Schowen, K. B., and Schowen, R. L.

(1998) Transition-state theoretical interpretation of the catalytic power of

152

pyruvate decarboxylases: the roles of static and dynamical considerations,

Biochim Biophys Acta 1385, 187-200.

34. Dyson, H. J., and Wright, P. E. (2001) Nuclear magnetic resonance methods for

elucidation of structure and dynamics in disordered states, In Methods in

Enzymology (Thomas L. James, V. D., and Uli, S., Eds.), pp 258-270, Academic

Press.

35. Dyson, H. J., and Wright, P. E. (2005) Elucidation of the Protein Folding

Landscape by NMR, In Methods in Enzymology (Thomas, L. J., Ed.), pp 299-321,

Academic Press.

36. Schulze, E., Westphal, A. H., Hanemaaijer, R., and de Kok, A. (1993)

Structure/function relationships in the pyruvate dehydrogenase complex form

Azotobacter vinelandii, European Journal of Biochemistry 211, 591-599.

37. Mande, S. S., Sarfaty, S., Allen, M. D., Perham, R. N., and Hol, W. G. (1996)

Protein-protein interactions in the pyruvate dehydrogenase multienzyme complex:

dihydrolipoamide dehydrogenase complexed with the binding domain of

dihydrolipoamide acetyltransferase, Structure 4, 277-286.

38. Nemeria, N., Arjunan, P., Brunskill, A., Sheibani, F., Wei, W., Yan, Y., Zhang, S.,

Jordan, F., and Furey, W. (2002) Histidine 407, a phantom residue in the E1

subunit of the Escherichia coli pyruvate dehydrogenase complex, activates

reductive acetylation of lipoamide on the E2 subunit. An explanation for

conservation of active sites between the E1 subunit and transketolase,

Biochemistry 41, 15459-15467.

153

39. Chandrasekhar, K., Arjunan, P., Sax, M., Nemeria, N., Jordan, F., and Furey, W.

(2006) Active-site changes in the pyruvate dehydrogenase multienzyme complex

E1 apoenzyme component from Escherichia coli observed at 2.32 angstrom

resolution, Acta Crystallogr. Sect. D-Biol. Crystallogr. 62, 1382-1386.

40. Frank, R. A., Price, A. J., Northrop, F. D., Perham, R. N., and Luisi, B. F. (2007)

Crystal structure of the E1 component of the Escherichia coli 2-oxoglutarate

dehydrogenase multienzyme complex, J Mol Biol 368, 639-651.

41. Wallis, N. G., Allen, M. D., Broadhurst, R. W., Lessard, I. A., and Perham, R. N.

(1996) Recognition of a surface loop of the lipoyl domain underlies substrate

channelling in the pyruvate dehydrogenase multienzyme complex, J Mol Biol 263,

463-474.

42. Jones, D. D., and Perham, R. N. (2008) The role of loop and β-turn residues as

structural and functional determinants for the lipoyl domain from the Escherichia

coli 2-oxoglutarate dehydrogenase complex, Biochem J 409, 357-366.

43. Emsley, P., and Cowtan, K. (2004) Coot: model-building tools for molecular

graphics, Acta Crystallographica Section D 60, 2126-2132.

44. Carson, M. (1991) RIBBONS 2.0, Journal of Applied Crystallography 24, 958-

961.

45. Jordan, F., Nemeria, N. S., Zhang, S., Yan, Y., Arjunan, P., and Furey, W. (2003)

Dual catalytic apparatus of the thiamin diphosphate coenzyme: Acid-base via the

1 ',4 '-iminopyrimidine tautomer along with its electrophilic role, Journal of the

American Chemical Society 125, 12732-12738.

154

46. Nemeria, N., Yan, Y., Zhang, Z., Brown, A. M., Arjunan, P., Furey, W., Guest, J.

R., and Jordan, F. (2001) Inhibition of the Escherichia coli pyruvate

dehydrogenase complex E1 subunit and its tyrosine 177 variants by thiamin 2-

thiazolone and thiamin 2-thiothiazolone diphosphates - Evidence for reversible

tight-binding inhibition, J. Biol. Chem. 276, 45969-45978.

47. Kale, S., and Jordan, F. (2009) Conformational Ensemble Modulates

Cooperativity in the Rate-determining Catalytic Step in the E1 Component of the

Escherichia coli Pyruvate Dehydrogenase Multienzyme Complex, J. Biol. Chem.

284, 33122-33129.

48. Ciszak, E. M., Korotchkina, L. G., Dominiak, P. M., Sidhu, S., and Patel, M. S.

(2003) Structural basis for flip-flop action of thiamin pyrophosphate-dependent

enzymes revealed by human pyruvate dehydrogenase, J Biol Chem 278, 21240-

21246.

49. Gudi, R., Melissa, M. B.-K., Kedishvili, N. Y., Zhao, Y., and Popov, K. M.

(1995) Diversity of the Pyruvate Dehydrogenase Kinase Gene Family in Humans,

J. Biol. Chem. 270, 28989-28994.

50. Lawson, J. E., Niu, X. D., Browning, K. S., Trong, H. L., Yan, J., and Reed, L. J.

(1993) Molecular cloning and expression of the catalytic subunit of bovine

pyruvate dehydrogenase phosphatase and sequence similarity with protein

phosphatase 2C, Biochemistry 32, 8987-8993.

155

51. Kato, J., and Kato, M. (2010) Crystallization and preliminary crystallographic

studies of the catalytic subunits of human pyruvate dehydrogenase phosphatase

isoforms 1 and 2, Acta Crystallographica Section F 66, 342-345.

52. Ling, M., McEachern, G., Seyda, A., MacKay, N., Scherer, S. W., Bratinova, S.,

Beatty, B., Giovannucci-Uzielli, M. L., and Robinson, B. H. (1998) Detection of a

homozygous four base pair deletion in the protein X gene in a case of pyruvate

dehydrogenase complex deficiency, Hum Mol Genet 7, 501-505.

53. Gawin, B., Niederfuhr, A., Schumacher, N., Hummerich, H., Little, P. F., and

Gessler, M. (1999) A 7.5 Mb sequence-ready PAC contig and gene expression

map of human chromosome 11p13-p14.1, Genome Res 9, 1074-1086.

54. Aral, B., Benelli, C., Ait-Ghezala, G., Amessou, M., Fouque, F., Maunoury, C.,

Creau, N., Kamoun, P., and Marsac, C. (1997) Mutations in PDX1, the human

lipoyl-containing component X of the pyruvate dehydrogenase-complex gene on

chromosome 11p1, in congenital lactic acidosis, Am J Hum Genet 61, 1318-1326.

55. Reed, L. J., and Cox, D. J. (1970) The enzymes, Vol. 1, 3rd ed.

56. Eley, M. H., Namihira, G., Hamilton, L., Munk, P., and Reed, L. J. (1972) α-Keto

acid dehydrogenase complexes: XVIII. Subunit composition of the Escherichia

coli pyruvate dehydrogenase complex Arch Biochem Biophys 152, 655-669.

57. Angelides, K. J., Akiyama, S. K., and Hammes, G. G. (1979) Subunit

stoichiometry and molecular weight of the pyruvate dehydrogenase multienzyme

complex from Escherichia coli, Proc Natl Acad Sci U S A 76, 3279-3283.

156

58. Bleile, D. M., Munk, P., Oliver, R. M., and Reed, L. J. (1979) Subunit structure of

dihydrolipoyl transacetylase component of pyruvate dehydrogenase complex from

Escherichia coli, Proc. Natl. Acad. Sci. U. S. A. 76, 4385-4389.

59. Yang, Y. S., Datta, A., Hainfeld, J. F., Furuya, F. R., Wall, J. S., and Frey, P. A.

(1994) Mapping the lipoyl groups of the pyruvate dehydrogenase complex by use

of gold cluster labels and scanning transmission electron microscopy,

Biochemistry 33, 9428-9437.

60. Koike, M., Reed, L. J., and Carroll, W. R. (1963) alpha-Keto acid

dehydrogenation complexes. IV. Resolution and reconstitution of the Escherichia

coli pyruvate dehydrogenation complex, J Biol Chem 238, 30-39.

61. Akiyama, S. K., and Hammes, G. G. (1980) Elementary steps in the reaction

mechanism of the pyruvate dehydrogenase multienzyme complex from

Escherichia coli: kinetics of acetylation and deacetylation, Biochemistry 19, 4208-

4213.

62. Angelides, K. J., and Hammes, G. G. (1979) Structural and mechanistic studies of

the alpha-ketoglutarate dehydrogenase multienzyme complex from Escherichia

coli, Biochemistry 18, 5531-5537.

63. Bates, D. L., Danson, M. J., Hale, G., Hooper, E. A., and Perham, R. N. (1977)

Self-assembly and catalytic activity of the pyruvate dehydrogenase multienzyme

complex of Escherichia coli, Nature 268, 313-316.

157

64. CaJacob, C. A., Gavino, G. R., and Frey, P. A. (1985) Pyruvate dehydrogenase

complex of Escherichia coli. Thiamin pyrophosphate and NADH-dependent

hydrolysis of acetyl-CoA, J Biol Chem 260, 14610-14615.

65. Collins, J. H., and Reed, L. J. (1977) Acyl group and electron pair relay system: a

network of interacting lipoyl moieties in the pyruvate and alpha-ketoglutarate

dehydrogenase complexes from Escherichia coli, Proc Natl Acad Sci U S A 74,

4223-4227.

66. Yi, J., Nemeria, N., McNally, A., Jordan, F., Machado, R. S., and Guest, J. R.

(1996) Effect of substitutions in the thiamin diphosphate-magnesium fold on the

activation of the pyruvate dehydrogenase complex from Escherichia coli by

cofactors and substrate, J Biol Chem 271, 33192-33200.

67. Berg, A., and de Kok, A. (1997) 2-Oxo acid dehydrogenase multienzyme

complexes. The central role of the lipoyl domain, Biol Chem 378, 617-634.

68. Perham, R. N. (1991) Domains, motifs, and linkers in 2-oxo acid dehydrogenase

multienzyme complexes: a paradigm in the design of a multifunctional protein,

Biochemistry 30, 8501-8512.

69. Reed, L. J., and Hackert, M. L. (1990) Structure-function relationships in

dihydrolipoamide acyltransferases, J Biol Chem 265, 8971-8974.

70. Frank, R. A., Pratap, J. V., Pei, X. Y., Perham, R. N., and Luisi, B. F. (2005) The

molecular origins of specificity in the assembly of a multienzyme complex,

Structure 13, 1119-1130.

158

71. Zhu, X. L., Ohta, Y., Jordan, F., and Inouye, M. (1989) Pro-sequence of subtilisin

can guide the refolding of denatured subtilisin in an intermolecular process,

Nature 339, 483-484.

72. Volkov, A., and Jordan, F. (1996) Evidence for intramolecular processing of

prosubtilisin sequestered on a solid support, J Mol Biol 262, 595-599.

73. Sergienko, E. A., and Jordan, F. (2002) Yeast pyruvate decarboxylase tetramers

can dissociate into dimers along two interfaces. Hybrids of low-activity D28A (or

D28N) and E477Q variants, with substitution of adjacent active center acidic

groups from different subunits, display restored activity, Biochemistry 41, 6164-

6169.

74. Smolle, M., and Lindsay, J. G. (2006) Molecular architecture of the pyruvate

dehydrogenase complex: bridging the gap, Biochem Soc Trans 34, 815-818.

75. Hiromasa, Y., Fujisawa, T., Aso, Y., and Roche, T. E. (2004) Organization of the

cores of the mammalian pyruvate dehydrogenase complex formed by E2 and E2

plus the E3-binding protein and their capacities to bind the E1 and E3 components,

J Biol Chem 279, 6921-6933.

76. Vijayakrishnan, S., Kelly, S. M., Gilbert, R. J., Callow, P., Bhella, D., Forsyth, T.,

Lindsay, J. G., and Byron, O. (2010) Solution structure and characterisation of the

human pyruvate dehydrogenase complex core assembly, J Mol Biol 399, 71-93.

77. Park, Y.-H., and Patel, M. S. (2010) Characterization of interactions of

dihydrolipoamide dehydrogenase with its binding protein in the human pyruvate

159

dehydrogenase complex, Biochemical and Biophysical Research Communications

395, 416-419.

78. Dyda, F., Furey, W., Swaminathan, S., Sax, M., Farrenkopf, B., and Jordan, F.

(1993) Catalytic centers in the thiamin diphosphate dependent enzyme pyruvate

decarboxylase at 2.4-A resolution, Biochemistry 32, 6165-6170.

79. Patel, M. S., and Roche, T. E. (1990) Molecular biology and biochemistry of

pyruvate dehydrogenase complexes, FASEB J 4, 3224-3233.

80. Patel, M. S., and Korotchkina, L. G. (2003) The biochemistry of the pyruvate

dehydrogenase complex, Biochemistry and Molecular Biology Education 31, 5-15.

81. Holness, M. J., and Sugden, M. C. (2003) Regulation of pyruvate dehydrogenase

complex activity by reversible phosphorylation, Biochem Soc Trans 31, 1143-

1151.

160

CURRICULUM VITAE

Jaeyoung Song

1975 Born September 25 in Seoul, South Korea.

1994 Graduated from Dong Sung High School, Seoul, South Korea.

1994-2001 Attened Myong Ji University, Yong In, South Korea.

1995-1997 Served in Korean Military.

2001 B.S. in Chemistry, Myong Ji University, Yong In, South Korea.

2001-2002 Employed by KCI Co. Kyoung Ki Do, South Korea.

2004-2010 Graduate work in Chemistry, Rutgers University, Newark, New Jersey.

2004-2008 Teaching Assistantship, Department of Chemistry.

2008-2010 Graduate Assistantship, National Institutes of Health.

2007 Article: " Efficient Coupling of Catalysis and Dynamics in the E1

Component of Escherichia coli Pyruvate Dehydrogenase Multienzyme

Complex, " Proc. Natl. Acad. Sci. U. S. A., vol. 105, p. 1158-1163.

2010 Article: " Nuclear Magnetic Resonance Evidence for the Role of the

Flexible Regions of the E1 Component of the Pyruvate Dehydrogenase

Complex from Gram-negative Bacteria, " J. Biol. Chem. vol. 285, p. 4680-

4694