US 201101.89680A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2011/0189680 A1 KeoWn et al. (43) Pub. Date: Aug. 4, 2011

(54) METHODS OF DIAGNOSING REJECTION OF Related U.S. Application Data A KIDNEY ALLOGRAFT USING GENOMIC (60) Provisional application No. 61/129,022, filed on May OR PROTEOMC EXPRESSION PROFILNG 30, 2008. Publication Classification (75) Inventors: Paul Keown, Delta (CA); Andreas (51) Int. Cl. Scherer, Kontiolahti (FI): Oliver CI2O I/68 (2006.01) Gunther, Vancouver (CA); Robert GOIN 33/53 (2006.01) Balshaw, Vancouver (CA); GOIN 33/68 (2006.01) Raymond Ng, Vancouver (CA); CI2O 1/48 (2006.01) Alice Mui, Burnaby (CA); Robert CI2O I/00 (2006.01) McMaster, Vancouver (CA); Bruce CI2O I/37 (2006.01) McManus, Vancouver (CA); GOIN 33/573 (2006.01) Gabriela Cohen Freue, Vancouver HOIJ 49/26 (2006.01) (CA); Anna Meredith, Vancouver (52) U.S. Cl...... 435/6.12: 436/94; 436/86; 436/501; (CA) 435/7.92; 435/15; 435/4; 435/23: 435/7.4: 250/282 (73) Assignee: The University of British (57) ABSTRACT Columbia, Vancouver, BC (CA) A method of determining the acute allograft rejection status of a subject, the method comprising the steps of determining (21) Appl. No.: 12/991,922 the nucleic acid expression profile of one or more than one nucleic acid markers, or one or more than one proteomic markers in a biological sample from the Subject; comparing (22) PCT Filed: May 29, 2009 the expression profile of the one or more than one nucleic acid markers to a control profile; and determining whether the (86). PCT No.: PCTACA2O09/OOOT44 expression level of the one or more than one nucleic acid markers is increased relative to the control profile, wherein S371 (c)(1), the increase of the one or more than one nucleic acid markers (2), (4) Date: Mar. 15, 2011 is indicative of the acute rejection status of the subject. Patent Application Publication Aug. 4, 2011 Sheet 1 of 31 US 2011/0189680 A1

Figure 1A

w O -O- BCAR - C - Controls

cy) o -

c\ O

v c t

d -- C

-200 -100 O 1OO 200 300 400 Linear Discriminant SCOre

Figure 1B

w cs I, : -o- BCAR - C - Controls ; : -

NS :

dw | st raiso, H. mains a -222 -218 -214 -210 426 430 434 438 Linear Discriminant Score Linear Discriminant Score Patent Application Publication Aug. 4, 2011 Sheet 2 of 31 US 2011/O189680 A1

Figure 1C

5 fore 5 i 300-200-100 0 100 200 300 400 500 Discriminant war. 1 Patent Application Publication Aug. 4, 2011 Sheet 3 of 31 US 2011/O189680 A1

Figure 2

N 5 www.

S 2.5 O 8 0. 0.

O O -2.5 {0

-5 --- -3 -1 1 3 Discriminant War. 1 0 Acute Rejection O No Rejection Patent Application Publication Aug. 4, 2011 Sheet 4 of 31 US 2011/O189680 A1

Figure 3

Og foid-change Patent Application Publication Aug. 4, 2011 Sheet 5 of 31 US 2011/O189680 A1

Figure 4

10

-10 -28 -24 -20 - 16 -12 -8 56% 8 12 16 20 24, 28 Patent Application Publication Aug. 4, 2011 Sheet 6 of 31 US 2011/O189680 A1

Figure 5A

actin cytoskeletor organization and biogenesis cytoskeleton organization and biogenesis actr; filarret-based process irrirrture systern process positive regulation of irrtune system process ce activation eukocyte activation response to bacterium regulation of protein retabolic process | protein kinase cascade positive regulation of response to stirrus actin filament organization cell motility localization of ce. regulation of irrirune systern process : regulation of cellular protein retabolic process signal transduction regation of response to simulus regulation of epiderral growth factor receptor activity regulation af receptor activity is i

Figure 5B

Cytoskeeter. Atif farerts Cytoskeleton_Regulation of cytoskeleton. infarrirration jak-SA Pathway it rephagocytosis riarratior Enterferor sigraig 3 8 Ce adhesioi etcote citerrotaxis Cell adhesior Gircoconjugates reproduction feedirig and era horrores sigFairg 8 : Celadhesior Arryloid proteins : : Proliferatior y rr photcyte proferation : exeoprent terror oiesis, Erythropoietir pathway : irtfar ratif -2 signerg : irrurie Phagosore in antiger presentation : Celadhesio regrin prinrirg : rarsatioregatio of iritiation Signal trarseiuctioS2 pathway Sigrial trarsdiction ESri-rticlear pathway Ce adhesior integrif-prediated ceil-rratrix acresion Cardiac developresert FGF Era sigrating ap optosis beath sorrain recepters & aspases if... Patent Application Publication Aug. 4, 2011 Sheet 7 of 31 US 2011/O189680 A1

Figure 6A

3 - |

5: g/

-- I - - I I I : : t

Figure 6B

5 O 5 O Linear Discriminant Score Figure 6C

: - BCAR K - or - no BCAR

W 2 N - / \ s \ } : f : - - - d o Ho-3...... 3 3- r :

-T T I I B. W1 W2. W3 WA W2 Patent Application Publication Aug. 4, 2011 Sheet 8 of 31 US 2011/O189680 A1

Figure 7

KP3: 11 ARVS 21 NR O

w -

cyd - an O 9. (s >

O) O 8 o 86°GO 0

O - t -0.4 -0.2 0.0 0.2 0.4 Log mean fold-change Patent Application Publication Aug. 4, 2011 Sheet 9 of 31 US 2011/O189680 A1

Figure 8

---- BPAR

Controls S3 s

Linear Discriminant Wariable

Figure 9

c ------w

8

S.

S

START 111 224 23 18 100 116 38 135 125

PGC

US 2011/O 189680 A1 Aug. 4, 2011

METHODS OF DAGNOSING REUECTION OF ~6-12 months of the subject receiving the allograft. Rejection A KIDNEY ALLOGRAFT USING GENOMIC or acute rejection may be characterized by cellular and OR PROTEOMC EXPRESSION PROFILNG humoral insults on the donor tissue, leading to rapid graft dysfunction and failure of the tissue or organ. Rejection of a tissue or organ allograft beyond 6-12 months is generally 0001. This application claims priority benefit of U.S. Pro considered to be chronic rejection, and may occur several visional application 61/129,022, filed May 30, 2008, the con years after receiving the allograft. Such late or chronic rejec tents of which is herein incorporated by reference. tion may be the result of sub-clinical or not fully resolved acute rejection episodes. Later-onset or chronic rejection may FIELD OF INVENTION be characterized by progressive tissue remodeling triggered 0002 The present invention relates to methods of diagnos by the alloimmune response may lead to gradual neointimal ing rejection of a kidney allograft using genomic expression formation within arteries, contributing to obliterative vascu profiling or proteomic expression profiling. lopathy, parenchymal fibrosis and consequently, failure and loss of the graft. Depending on the nature and severity of the BACKGROUND OF THE INVENTION rejection, there may be overlap in the indicators or clinical variables observed in a Subject undergoing, or Suspected of 0003 Transplantation is considered the primary therapy undergoing, allograft rejection—either chronic or acute. for patients with end-stage vital organ failure. While the avail 0008. The scientific and patent literature is blessed with ability of immunosuppressants such as cyclosporine and tac reports of this marker or that being important for identifica rolimus has improved allograft recipient survival and wellbe tion/diagnosis/prediction/treatment of every medical condi ing, identification of rejection of the allograft as early and as tion that can be named. Even within the field of allograft accurately as possible, and effective monitoring and adjusting rejection, a myriad of markers are recited (frequently singly), immunosuppressive medication doses is still of primary and conflicting results may be presented. This conflict in the importance to the continuing Survival of the allograft recipi literature, added to the complexity of the genome (estimates ent. range upwards of 30,000 transcriptional units), the variety of 0004 Rejection of an allograft results from a recipient's cell types (estimates range upwards of 200), organs and tis immune response to nonself antigens expressed by the donor Sues, and expressed proteins or polypeptides (estimates range tissues, and may occur with hours or days of receiving the upwards of 80,000) in the human body, renders the number of allograft, or months to years later. Renal allograft rejection is possible nucleic acid sequences, genes, proteins, metabolites characterized by features comprising oliguria, rapid deterio or combinations thereof useful for diagnosing acute organ ration of renal function and mild proteinuria. Renal allograft rejection is staggering. Variation between individuals pre rejection can lead to nephropathy and kidney failure. sents additional obstacles, as well as the dynamic range of 0005. At present, invasive biopsies (e.g. endomyocardial, protein concentration in plasma (ranging from 10 to 10 liver core, and renal fine-needle aspiration) are regarded as ug/mL) with many of the proteins of potential interest exist the gold standard for the Surveillance and diagnosis of ing at very low concentrations) and the overwhelming quan allograft rejections, but are invasive procedures which carry tities of the few, most abundant plasma proteins (constituting risks of their own (e.g. Mehra MR, et al. Curr. Opin. Cardiol. ~99% of the total protein mass. 2002 March; 17(2): 131-136.). Biopsy results may also be 0009 PCT Publication WO 2006/125301 discloses Subject to reproducibility and interpretation issues due to nucleic acids that are differentially expressed in transplanted sampling errors and inter-observer variabilities, despite the tissue, and methods and materials for detecting kidney tissue availability of international guidelines such as the Banff rejection. schema for grading kidney and liver allograft rejection (Solez et al 2008 Am J Transplant 8: 753: Table 1) An allograft (0010 U.S. Pat. No. 7,235,258 discloses methods of diag recipient may be exposed to the biopsy procedure multiple nosing or monitoring transplant rejection, including kidney times in the first year following the transplant. Noninvasive transplant rejection in a Subject, by detecting the expression Surveillance techniques are currently used (the increase in level of one or more genes in the Subject. Oligonucleotides blood creatinine levels), however serum creatinine levels are useful in these methods are also described. non-specifically reflective of kidney injury. The kidney injury (0011 Flechner et al. (Am J Transplant 2004: 4 (9) 1475 can be from rejection, infection, or even recurrence of the 1489) identifies several publications that employed DNA or original disease, thus, the test is not specific for rejection. microarrays to identify differential expression of various 0006 Indicators of allograft rejection may include a genes in Subjects receiving kidney transplants, and also heightened and localized immune response as indicated by describes use of microarray analysis and RT-PCR to examine one or more of localized or systemic inflammation, tissue gene expression profile of peripheral blood lymphocytes and injury, allograft infiltration of immune cells, inflammatory kidney biopsy samples from kidney transplant Subjects, and cells which recognize donor-specific antigens on the graft, identified over 60 genes that were differentially expressed. allospecific antibodies, cytotoxic T-cell activation, altered (0012 Alakulppi et al., 2007 (Transplantation 83:791-798) composition and concentration of tissue- and blood-derived discloses the diagnosis of acute renal allograft rejection using proteins, differential oxygenation of allograft tissue, edema, RT-PCT foreight nucleic acid markers. Further investigations infection, necrosis of the allograft and/or Surrounding tissue, by Alakulppi et al. (2008, Transplantation 86:1222-8) were and the like. unable to identify a robust whole blood gene expression 0007 Allograft rejection may be described as acute or nucleic acid marker for Subclinical rejection. chronic'. Acute rejection (also known as acute antibody (0013 Sarwal et al. 2003 (N. Engl. J. Med 349:125) mediated rejection, AMR or active rejection) is generally reported that genes associated with apoptosis were increased considered to be rejection of a tissue or organ allograft within in renal biopsies during acute rejection and found transcript US 2011/O 189680 A1 Aug. 4, 2011 groups indicating lymphocyte infiltration and activation rejection) as such samples may be obtained in a minimally driven by NF-kappaB and IFNY. invasive manner (a peripheral blood sample, for example), 0014) Mueller et al., 2007. Am J. Transplant 7:2712 iden with no requirement for biopsy of the allograft. Use of a blood tified transcripts in the kidney tissue associated with cytotoxic or plasma sample provides a further advantage, in that it may T-lymphocytes, IFNY signaling, and epithelial cell injury in reduce sampling error, and detection of proteomic or nucleic both mouse and human. acid markers may be less Subject to interpretation—the 00.15 Mehra et al., 2008 suggests that pathways regulating marker is present or it is not, or it is increased or decreased T-cell homeostatis and corticosteroid sensitivity may be asso relative to a baseline, control or the like as described herein. ciated with future acute rejection of cardiac transplants, but 0024. Some current surveillance techniques that do offers no comment with respect to kidney transplantation. employ blood sampling (e.g. serum creatine levels) may not Expression of ITGAX is one of the 33 genes addressed. be specific for rejection; the nucleic acid or proteomic mark 0016. A review by Fildes et al 2008 (Transplant Immunol ers described herein, when obtained from a blood or plasma ogy 19:1-11) discusses the role of cell types in immune pro sample are specific for acute kidney allograft rejection, thus cesses following lung transplantation, and discloses that provide a further advantage of specificity. AICL (CLEC2B) interaction with NK cell proteins may have 0025. The complex pathobiology of acute kidney allograft a role in acute and chronic rejection. rejection is reflected in the heterogeneity of markers identi 0017 Integration of multiple platforms (proteomics, fied herein. Markers identified herein distribute over a range genomics) has been suggested for diagnosis and monitoring of biological processes: immune signal transduction, cytosk of various cancers, however discordance between protein and eletal reorganization, apoptosis, T-cell activation and prolif mRNA expression is identified in the field (Chen et al., 2002. eration, cellular and humoral immune responses, acute phase Mol Cell Proteomics 1:304-313; Nishizuka et al., 2003 Can inflammatory pathways, and the like. cer Research 63:5243-5250). Previous studies have reported 0026. In accordance with another aspect of the invention, low correlations between genomic and proteomic data (Gygi there is provided a method of determining the acute allograft S Petal. 1999. Mol Cell Biol. 19:1720-1730; Huber et al., rejection status of a Subject, the method comprising the steps 2004 Mol Cell Proteomics 3:43-55). of: a) determining the nucleic acid expression profile of one or 0018 Several studies have been done looking at the urine more than one nucleic acid markers in a biological sample proteome of kidney transplant recipients (reviewed in Schaub from the subject, the nucleic acid markers selected from the et al., 2008. Contrib. Nephrol 160:65-75. group comprising TncRNA, FKSG49, ZNF438, 1558448 a 0019. Bottelliet al., 2008 (J. AmSoc. Nephrol 19:1904-18) at, CAMKK2, LMAN2, 237442 at, FKSG49/LOC730444, teaches that macrophage stimulating protein (MSP) is JUNB, PRO1073 and ITGAX; b) comparing the expression upregulated during regeneration of injured tubule cells, and profile of the one or more than one nucleic acid markers to a Suggests that it may aid recovery from acute kidney injury. control profile; and c) determining whether the expression Gorgi et al. (2009 Transplantation Proceedings 41:660-662) level of the one or more than one nucleic acid markers is investigated the association between acute kidney transplant increased relative to the control profile; wherein the increase rejection, and a polymorphism of the MBL gene, and con of the one or more than one nucleic acid markers is indicative cluded that the polymorphism could be involved in suscepti of the acute rejection status of the subject. bility to acute allograft rejection in the study population. 0027. In some aspects the biological sample is blood or Fiane et al., 2005 (Eur Heart J26:1660-5) disclosed that a low plasma. MBL level was related to the development of acute rejection in cardiac transplant recipients. Fildes 2008 (J. Heart Lung 0028. In some aspects, the group of nucleic acid markers Transplant 27:1353-1356) teaches that heart transplant further comprises one or more than one of SFRS16, NFYC, recipients with MBL deficiency had fewer rejection episodes. NCOA3, PGS1, NEDD9, LIMK2, NASP, 240057 at, Neither Fiane nor Fildes offers comment with respect to LOC730399/LOC731974, FKBP1A, HLA-G, RBMS1 and kidney transplants. SLC6A6. 0020 Berger et al., 2005 (Am J. Transplant 5:1361-1366) 0029. In some aspects, the control profile is obtained from teaches that higher MBL (Mannose-binding lectin) may be a non-rejecting, allograft recipient Subject or a non-allograft associated with a more severe form of rejection in kidney recipient Subject. transplant recipients, and Suggests that pre-transplantation 0030. In some aspects, the method further comprises MBL levels may be useful for risk stratification prior to kid obtaining a value for one or more clinical variables. ney transplantation. 0031. In some aspects, the method further comprises at 0021 Methods of assessing or diagnosing allograft rejec step a) determining the expression profile of one or more than tion that are less invasive, repeatable and more robust (less one of the nucleic acid markers selected from Table 2. Susceptible to sampling and interpretation errors) are greatly 0032. In some aspects, the nucleic acid expression profile desirable. of the one or more than one nucleic acid markers is deter mined by detecting an RNA sequence corresponding to one or SUMMARY OF THE INVENTION more than one markers. 0022. The present invention relates to methods of diagnos 0033. In some aspects, the nucleic acid expression profile ing rejection of a kidney allograft using genomic expression of the one or more than one nucleic acid markers is deter profiling or proteomic expression profiling of one or more mined by PCR. biological samples obtained from a subject. 0034. In some aspects, the nucleic acid expression profile 0023 The biological sample may be a blood or a plasma of the one or more than one nucleic acid markers is deter sample; use of Such samples in the methods described herein mined by hybridization. The hybridization may be to an oli provides an advantage over biopsy-based assessment and/or gonucleotide. monitoring of kidney allograft rejection (including acute 0035. In some aspects the control is an autologous control. US 2011/O 189680 A1 Aug. 4, 2011

0036. In accordance with another aspect of the invention, one or more than one of TTN, MSTP9, MST1, PI16, C2, there is provided a method of determining acute allograft MBL2, SERPINA10, F9 and UBR4 are increased relative to rejection status of a subject, the method comprising the steps a control profile. ofa) determining a proteomic expression profile of proteomic 0051. In some aspects the control profile is obtained from markers in a biological sample from the Subject, the pro a non rejecting, allograft recipient Subject or a non-allograft teomic markers including a polypeptide encoded by one or recipient Subject. more than one of KNG1, AFM, TTN, MSTP9/MST1, PI16, 0052. In some aspects, the method further comprises C2, MBL2, SERPINA10, F9 and UBR4; b) comparing the obtaining a value for one or more clinical variables. expression profile of the proteomic markers to a control pro 0053. In some aspects, the proteomic expression profile is file; and c) determining whether the expression level of the determined by an immunologic assay. one or more than one proteomics markers is increased or 0054. In some aspects, the proteomic expression profile is decreased relative to the control profile; wherein the increase determined by ELISA. or decrease of the five or more proteomic markers is indica 0055. In some aspects the proteomic expression profile is tive of the acute rejection status of the subject. determined by mass spectrometry. 0037. In some aspects the biological sample is blood or 0056. In some aspects the proteomic expression profile is plasma. determined by an isobaric or isotope tagging method. 0038. In some aspects, the level of polypeptides encoded 0057. In some aspects the proteomic markers further by one or more than one of KNG1 and AFM are decreased include a polypeptide encoded by one or more than one of relative to a control, and the level of polypeptides encoded by LBP, VASN, ARNTL2, PI16, SERPINA5, CFD, USH1C, C9, one or more than one of TTN, MSTP9, MST1, PI16, C2, LCAT, B2M, SHBG and C1S. MBL2, SERPINA10, F9 and UBR4 are increased relative to 0058. In some aspects the control is an autologous control. a control profile. 0059. In accordance with another aspect of the invention, 0039. In some aspects the control profile is obtained from there is provided an array comprising one or more probe sets a non rejecting, allograft recipient Subject or a non-allograft for one or more than one of the nucleic acid markers TncRNA, recipient Subject. FKSG49, ZNF438, 1558448 a at, CAMKK2, LMAN2, 0040. In some aspects, the method further comprises 237442 at FKSG49/LOC730444, JUNEB, PRO1073, obtaining a value for one or more clinical variables. ITGAX. 0041. In some aspects, the proteomic expression profile is 0060. In some aspects, the array further comprises one or determined by an immunologic assay. more additional probe sets for one or more than one of the nucleic acid markers, SFRS16, NFYC, NCOA3, PGS1, 0042. In some aspects, the proteomic expression profile is NEDD9, LIMK2, NASP, 240057 at, LOC730399/ determined by ELISA. LOC731974, FKBP1A, HLA-G, RBMS1 and SLC6A6. 0043. In some aspects the proteomic expression profile is 0061. In some aspects, the array further comprises one or determined by mass spectrometry. more additional probe sets for the nucleic acid markers of 0044. In some aspects the proteomic expression profile is Table 2. determined by an isobaric or isotope tagging method. 0062. In accordance with another aspect of the invention, 0045. In some aspects the proteomic markers further there is provided an array comprising one or more detection include a polypeptide encoded by one or more than one of reagents for one or more than one of the proteomic markers LBPVASN, ARNTL2, PI16, SERPINA5, CFD, USH1C, C9, KNG1, AFM, TTN, MSTP9, MST1, PI16, C2, MBL2, SER LCAT, B2M, SHBG and C1S. PINA10, F9 and UBR4. 0046) In Some aspects the control is an autologous control. 0063. In some aspects, the array further comprises one or 0047. In accordance with another aspect of the invention, more additional detection reagents for one or more than one there is provided a method of determining acute allograft of LBP, VASN, ARNTL2, PI16, SERPINA5, CFD, USH1C, rejection status of a subject, the method comprising the steps C9, LCAT, B2M, SHBG and C1S. of a. determining a proteomic expression profile of pro 0064. In accordance with another aspect of the invention, teomic markers in a biological sample from the Subject, the there is provided a method of assessing, monitoring or diag proteomic markers including a polypeptide included in one or nosing kidney allograft rejection in a Subject, the method more than one of protein group codes 111, 224, 23, 18, 100, comprising: a) determining the expression profile of at least 116, 38, 135, 125; b. comparing the expression profile of the one or more nucleic acid markers presented in Table 2 in a proteomic markers to a control profile; and c. determining biological sample from the Subject; b) comparing the expres sion profile of the at least one or more markers to a non whether the expression level of the one or more than one rejector profile; and c) determining whether the expression proteomics markers is increased or decreased relative to the level of the at least one or more markers is up-regulated control profile; wherein the increase or decrease of the five or (increased) or down-regulated (decreased) relative to the con more proteomic markers is indicative of the acute rejection trol profile, wherein up-regulation or down-regulation of the status of the subject. at least one or more markers is indicative of the rejection 0048. In some aspects the protein group codes further Status. includes one or more than one of groups 18, 108,222,97, 104, 0065. In some embodiments, the method further com 26, 230, 103, 69 or 29. prises obtaining a value for one or more clinical variables and 0049. In some aspects the biological sample is blood or comparing the one or more clinical variables to a control. The plasma. control is a non-rejection, allograft recipient Subject or a 0050. In some aspects, the level of polypeptides encoded non-allograft recipient Subject. In some embodiments, the by one or more than one of KNG1 and AFM are decreased rejection is acute rejection. In some embodiments, the one or relative to a control, and the level of polypeptides encoded by more nucleic acid markers includes 2,3,4,5,6,7,8,9, 10, 11, US 2011/O 189680 A1 Aug. 4, 2011

12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 or 24 nucleic acid Subjects). The percentage variance as explained by the prin markers selected from those presented in Table 2. In some cipal components are provide on the X axis (56%) and Y axis embodiments, the nucleic acid markers may include one or (12%). more than one of the nucleic acid markers presented in Table 0074 FIG. 5. Gene ontologies and network analysis of 5. 183 probe sets differentially expressed in BCAR. The x-axis 0066. In accordance with another aspect of the invention, shows -log10 (p-values). A Most significantly enriched Gene there is provided a kit for assessing or diagnosing kidney ontology categories ("Biological processes'), Sorted by allograft rejection in a subject, the kit comprising reagents for increasing p-value. BMost significantly enriched Gene ontol specific and quantitative detection of at least one or more ogy categories (GeneGO MetaCore Biological Categories), markers presented in Table 2, along with instructions for the Sorted by increasing p-value. use of such reagents and methods for analyzing the resulting (0075 FIG. 6. Performance of classifier. (A) Incremental data. The kit may further comprise one or more oligonucle classification accuracy demonstrating step-wise inclusion of otides for selective hybridization to one or more of a gene, 11 common most highly predictive probe-sets. Y-axis—clas transcript or sequence unit representing one or more of the sification accuracy: X-axis, biomarkers. (B) Linear discrimi markers. Instructions or other information useful to combine nant analysis showing performance of 11 probe-set classifiers the kit results with those of other assays to provide a non in distinguishing cases with (, Solid line) and without (, rejection cutoff index or control for the diagnosis of a Sub stippled line) BCAR (biopsy-confirmed acute rejection). (C) ject's rejection status may also be provided in the kit. Change in classifier score post-transplant relative to indi 0067. In some embodiments, the kit may further comprise vidual pre-transplant (baseline) value. The difference instructions or materials for obtaining a value for one or more between cohorts is significant only at the time of rejection clinical variables and comparing the one or more clinical (week 1) (p=0.0001). Y axis—change from baseline variables to a control. The control is a non-rejection, allograft (mean+/-2 se); X axis BL-baseline; W1-W12, week 1-week recipient Subject or a non-allograft recipient Subject. In some 12. “START indicates the beginning of the tsep-wise analy embodiments, the rejection is acute rejection. In some sis where there are no probe-set classifiers. embodiments, the one or more nucleic acid markers includes 0076 FIG. 7: Volcano plot showing all 144 protein group 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, codes that were found in at least two thirds of the BCAR 21, 22, 23 or 24 nucleic acid markers selected from those positive samples and two thirds of the BCAR negative presented in Table 2. In some embodiments, the nucleic acid samples. Circled points indicate the 18 protein groups whose markers may include one or more than one of the nucleic acid markers presented in Table 5. plasma concentration differed significantly (p<0.05) between 0068. This summary of the invention does not necessarily subjects with or without BCAR. describe all features of the invention. Other aspects, features 0077 FIG. 8: Linear discriminant analysis showing sepa and advantages of the present invention will become apparent ration of patients with or without BCAR based upon plasma to those of ordinary skill in the art upon review of the follow protein biomarkers. Solid line/X BCAR subjects: ing description of specific embodiments of the invention. stippled line?"' control (non-rejector) subjects. 0078 FIG. 9: Estimated classification accuracy demon BRIEF DESCRIPTION OF THE DRAWINGS strating step-wise inclusion of protein groups as chosen by forward-selection stepwise discriminant analysis (SDA). Y 0069. These and other features of the invention will Axis-classification accuracy; X axis—PGC codes. become more apparent from the following description in “START is as for FIG. 6. which reference is made to the appended drawings wherein: (0079 FIG. 10 shows target sequences of (SEQ ID NO: 0070 FIG. 1 shows the results of a subject classification 1-183) of nucleic acid markers useful for diagnosis of acute using a panel of 24 nucleic acid biomarkers (presented in kidney allograft rejection, listed in Table 2. Table 5). Subjects were determined to have. A) 24-probe-set classifier; B) Zoomed-in view of A) to more clearly illustrate the Gaussian peaks and samples below. For A and B, acute DETAILED DESCRIPTION rejection—Solid circle; no rejection—open circle. C). The same dataset as in A and B, displaying the data in the same 0080. The present invention provides for methods of diag format as for FIG. 2. Acute rejection (solid diamond) or no nosing rejection in a Subject that has received a tissue or organ rejection (solid circle) allograft, specifically a kidney allograft. 0071 FIG. 2 shows the result of a subject classification I0081. The present invention provides genomic and pro using only clinical parameters (serum creatinine, GFR, teomic expression profiles related to the assessment, predic BUN). Subjects were determined to have acute rejection tion or diagnosis of allograft rejection in a subject. While (Solid diamond) or no rejection (solid circle). several of the elements in the genomic or proteomic expres 0072 FIG. 3: Differential expression of probe-sets sion profiles may be individually known in the existing art, between subjects with and without BCAR detected by micro the specific combination of the altered expression levels (in array analysis. Points in grey indicate the probe-sets identi creased or decreased relative to a control) of specific sets of fied by LIMMA alone, while those in black indicate the 183 genomic, T-cell, proteomic or metabolite markers comprise a probe-sets identified by the intersection of LIMMA, robust novel combination useful for assessment or diagnosis or LIMMA and SAM. Circles indicate the 24 probe-sets allograft rejection in a Subject. included in the primary classifier. I0082 An allograft is an organ or tissue transplanted 0073 FIG. 4: Principal componentanalysis showing sepa between two genetically different subjects of the same spe ration of same Subject groups, demonstrating that the cen cies. The subject receiving the allograft is the recipient, troids of all groups are clearly separated. AR-acute rejector; while the subject providing the allograft is the donor. A NR—non-rejector; N—normal control (20 non-recipient tissue or organ allograft may alternately be referred to as a US 2011/O 189680 A1 Aug. 4, 2011

transplant, a graft, an allograft, a donor tissue or donor for modification of the immunosuppressive drug therapy of organ, or similar terms. A transplant between two Subjects of the subject. Examples of clinical variables are presented in Table 1. different species is a Xenograft. I0084 Clinical variables (optionally accompanied by 0083) Subjects may present with a variety of symptoms or biopsy), while currently the only practical tools available to a clinical variables well-known in the literature as an aid for clinician in mainstream medical practice, are not always able monitoring allograft rejection. A myriad of clinical variables to cleanly differentiate between rejecting and a non-rejecting may be used in assessing a Subject having, or Suspected of subject, as is illustrated in FIG. 2. While the extreme left and right Subjects are correctly classified as rejecting or non having, allograft rejection, in addition to biopsy of the rejecting, the bulk of the subjects are represented in the allograft. The information from these clinical variables is middle range and their status is unclear. This does not negate then used by a clinician, physician, Veterinarian or other the value of the clinical variables in the assessment of practitioner in a clinical field in attempts to determine if allograft rejection, but instead indicates their limitation when rejection is occurring, and how rapidly it progresses, to allow used in the absence of other methods.

TABLE 1. Clinical variables for possible use in assessment of allograft relection. Renal Heart Clinical Variable Name Liver All Variable Explanation Primary Diagnosis A. Diagnosis leading to transplant Secondary Diagnosis A. Diagnosis leading to transplant “Transplant Procedure - Living related, Living unrelated, or cadaveric Blood Type Blood Type Blood Rh Blood Rh Height (cm) Height (cm) Weight (kg) Weight (kg) BMI Calculation: Weight (Height)2 Liver Ascites HLA-A1 HLA-A2 HLAB1 HLAB2 HLA-DR1 HLA DR2 CMV Viral Status CMV Date Date of viral status HIV Viral Status HBV Viral Status HBV Date Date of viral status HbSAb Viral Status HbcAb (Total) Viral Status HBvDNA Viral Status HCV Viral Status HCV Genotype Hepatitis C genotype HCV Genotype Sub “Hepatitis C genotype, subtype' EBV Viral Status Zoster Viral Status Dialysis Start Date Dialysis Start Date Dialysis Type Dialysis Type Cytoxicity Current Level Cytoxicity Current Date Cytoxicity Peak Level Cytoxicity Peak Date Flush Soln Type of Flush Solution used at transplant Cold Time 1 Cold Time 2 Re-Warm Time 1 Re-Warm Time 2 HTLV 1 HTLV 2 HCV RNA 24hr Urine 24 Hour urine output Systolic Blood Pressure Blood Pressure reading Diastolic Blood Pressure Blood Pressure reading 24 Hr Urine 24 hour urine Sodium Blood test Potassium Blood test Chloride Blood test Total CO2 Blood test Albumin Blood test Protein Blood test US 2011/O 189680 A1 Aug. 4, 2011

TABLE 1-continued Clinical variables for possible use in assessment of allograft relection. Renal Heart Clinical Variable Name Liver All Variable Explanation Calcium A. Blood tes norganic Phosphate A. Blood tes Magnesium A. Blood tes Oric Acid A. Blood tes Glucose A. Blood tes Hemoglobin A1C A. Blood tes CPK A. Blood tes Parathyroid Hormone A. Blood tes Homocysteine A. Blood tes Orine Protein A. Orine test Creatinine A. Blood tes BUN A. Blood tes Hemoglobin A. Blood tes Platelet Count A. Blood tes WBC Count A. Blood tes Prothrombin Time A. Blood tes Partial Thromboplastin Time A. Blood tes NR A. Blood tes Gamma GT A. Blood tes AST A. Blood tes Alkaline Phosphatase A. Blood tes Amylase A. Blood tes Total Bilirubin A. Blood tes Direct Bilirubin A. Blood tes LDH A. Blood tes ALT A. Blood tes Triglycerides A. Blood tes Cholesterol A. Blood tes HDL Cholesterol A. Blood tes LDL Cholesterol A. Blood tes FEV1 A. Lung function test FVC A. Lung function test Total Ferritin A. Blood tes TIBC A. Blood tes Transferrin Saturated A. Blood tes Ferritin A. Blood tes Angiography Heart Heart function test intravascular ultrasound Heart Heart function test Dobutamine Stress Echocardiography Heart Heart function test Cyclosporine WB A. mmunosuppressive levels Cyclosporine 2 hr A. mmunosuppressive levels Tacrolimus WB A. mmunosuppressive levels Sirolimus WB A. mmunosuppressive total daily dose Solumedrol A. mmunosuppressive total daily dose Prednisone A. mmunosuppressive total daily dose Prednisone ALT A. mmunosuppressive total daily dose Tacrolimus A. mmunosuppressive total daily dose Cyclosporine A. mmunosuppressive total daily dose Imuran A. mmunosuppressive total daily dose Mycophonelate Mofetil A. mmunosuppressive total daily dose Sirolimus A. mmunosuppressive total daily dose OKT3 A. mmunosuppressive total daily dose ATG A. mmunosuppressive total daily dose ALG A. mmunosuppressive total daily dose Basiliximab A. mmunosuppressive total daily dose Daclizumab A. mmunosuppressive total daily dose Ganciclovir A. Anti-viral total daily dose Lamivudine A. Anti-viral total daily dose Riboviron A. Anti-viral total daily dose Interferon A. Anti-viral total daily dose Hepatitis C Virus RNA A. test for presence of HCV values () CMV Antigenemia A. Antiviral and Virus Valganciclovir A. Anti-viral total daily dose Neutrophil Number A. Blood test C Peptide A. Blood test Peg Interferon A. Anti-viral total daily dose GFR A. Glomerular Filtration Rate Complication Events A. Complication Type Biopsy Scores Re l al Borderline 1A, 1B, 2A, 2B, 3 Hyperacute US 2011/O 189680 A1 Aug. 4, 2011

TABLE 1-continued Clinical variables for possible use in assessment of allograft relection. Renal Heart Clinical Variable Name Liver All Variable Explanation Biopsy Scores Liver Portal inflammation, Bile duct inflammation damage, Venous endothelial inflammation, each scored from 1-2 Donor Blood Type A. Donor Blood Type Donor Blood Rh A. Donor Rh Donor HLA-A1 A. Donor HLAA1 Donor HLA-A2 A. Donor HLA-A2 Donor HLAB1 A. Donor HLAB1 Donor HLAB2 A. Donor HLAB2 Donor HLA-DR1 A. Donor HLA-DR1 Donor HLA DR2 A. Donor HLA DR2 Donor CMV A. Donor CMV Donor HIV A. Donor HIV Donor HBW A. Donor HBW Donor HbSAb A. Donor HbSAb Donor HbcAb (total) A. Donor HbcAb (total) Donor Hbdna A. Donor Hbdna Donor HCV A. Donor HCV Donor EBV A. Donor EBV

0085. The multifactorial nature of allograft rejection pre fragments or portions thereof for proteomic markers, or diction, diagnosis and assessment is considered in the art to selected molecules, their precursors, intermediates or break exclude the possibility of a single biomarker that meets even down products (e.g. fatty acid, amino acid, Sugars, hormones, one of the needs of prediction, diagnosis or assessment of or fragments or subunits thereof). In some usages, these terms allograft rejection. Strategies involving a plurality of markers may reference the level or quantity of a particular protein, may take into account this multifactorial nature. Alternately, peptide, nucleic acid or polynucleotide, or metabolite (in a plurality of markers may be assessed in combination with absolute terms or relative to another sample or standard value) clinical variables that are less invasive (e.g. a biopsy not or the ratio between the levels of two proteins, polynucle required) to tailor the prediction, diagnosis and/or assessment otides, peptides or metabolites, in a subject's biological of allograft rejection in a Subject. sample. The level may be expressed as a concentration, for I0086) Regardless of the methods used for prediction, diag example micrograms per milliliter; as a colorimetric inten nosis and assessment of allograft rejection, earlier is better— sity, for example 0.0 being transparent and 1.0 being opaque from the viewpoint of preserving organ or tissue function and at a particular wavelength of light, with the experimental preventing more systemic detrimental effects. There is no sample ranked accordingly and receiving a numerical score cure for allograft rejection, only maintenance of the Subject based on transmission or absorption of light at a particular at a suitably immunosuppressed State, or in some cases, wavelength; or as relevant for other means for quantifying a replacement of the organ if rejection has progressed too rap marker, such as are known in the art. In some examples, a ratio idly or is too severe to correct with immunosuppressive drug may be expressed as a unitless value. A "marker” may also intervention therapy. reference to a ratio, or a net value following Subtraction of a 0087 Applying a plurality of mathematical and/or statis baseline value. A marker may also be represented as a fold tical analytical methods to a protein or polypeptide dataset, change, with or without an indicator of directionality (in metabolite concentration data set, or nucleic acid expression crease or decreasefup or down). The increase or decrease in dataset may indicate varying Subsets of significant markers, expression of a marker may also be referred to as down leading to uncertainty as to which method is best or more regulation or up-regulation, or similar indicators of an accurate. Regardless of the mathematics, the underlying increase or decrease in response to a stimulus, physiological biology is the same in a dataset. By applying a plurality of event, or condition of the Subject. A marker may be present in mathematical and/or statistical methods to a microarray a first biological sample, and absent in a second biological dataset and assessing the statistically significant Subsets of sample; alternately the marker may be present in both, with a each for common markers, uncertainty may be reduced, and statistically significant difference between the two. Expres clinically relevant core group of markers may be identified. sion of the presence, absence or relative levels of a marker in I0088 “Markers”, “biological markers” or “biomarkers' a biological sample may be dependent on the nature of the may be used interchangeably and refer generally to detectable assay used to quantify or assess the marker, and the manner of (and in some cases quantifiable) molecules or compounds in such expression will be familiar to those skilled in the art. a biological sample. A marker may be down-regulated (de I0089. A marker may be described as being differentially creased), up-regulated (increased) or effectively unchanged expressed when the level of expression in a subject who is in a subject following transplantation of an allograft. Markers rejecting an allograft is significantly different from that of a may include nucleic acids (DNA or RNA), a gene, or a tran Subject or sample taken from a non-rejecting Subject. A dif Script, or a portion or fragment of a transcript in reference to ferentially expressed marker may be overexpressed or under genomic markers (alternately referred to as “nucleic acid expressed as compared to the expression level of a normal or markers’); polypeptides, peptides, proteins, isoforms, or control sample. US 2011/O 189680 A1 Aug. 4, 2011

0090 A“profile' is a set of one or more markers and their While several of the elements in the genomic or T-cell expres presence, absence, relative level or abundance (relative to one sion profiles or proteomic expression profiles may be indi or more controls). For example, a metabolite profile is a vidually known in the existing art, the specific combination of dataset of the presence, absence, relative level or abundance the altered expression levels (increased or decreased relative of metabolic markers. A proteomic profile is a dataset of the to a control) of specific sets of genomic or proteomic markers presence, absence, relative level or abundance of proteomic comprise a novel combination useful for assessment or diag markers. A genomic or nucleic acid profile a dataset of the nosis of allograft rejection in a Subject. presence, absence, relative level or abundance of expressed (0095 183 probe sets were found to specifically detect (by nucleic acids (e.g. transcripts, mRNA, EST or the like). A hybridization and detection of a label) and allow for quanti profile may alternately be referred to as an expression profile. tation of the expression level of the expressed nucleic acids. 0091. The increase or decrease, or quantification of the Of this set of 183 (listed in Table 2), representing 183 indi markers in the biological sample may be determined by any of vidual expressed transcripts or nucleic acids, a Subset of 24 several methods known in the art for measuring the presence probe sets (Table 5) were detected, quantified and found to and/or relative abundance of a gene product or transcript, or a demonstrate a statistically significant fold change in the AR nucleic acid molecule comprising a particular sequence, samples relative to non-rejecting transplant (NR). FIG. 10 polypeptide or protein, metabolite or the like. The level of the provides nucleic acid sequence information of a portion of the markers may be determined as an absolute value, or relative to nucleic acid identified by the probe sets listed in Tables 2 and a baseline value, and the level of the subject's markers com 5. Sequences in FIG. 10 (SEQID NO: 1-183) may be useful pared to a cutoff index (e.g. a non-rejection cutoff index). as probes for specific hybridization to the indicated gene (e.g. Alternately, the relative abundance of the marker may be in a microarray, blot, or other hybridization based assay), or determined relative to a control. The control may be a clini for the design of a primer or primers for specific amplification cally normal Subject (e.g. one who has not received an of the indicated gene (e.g. by PCR, RT-PCR or other ampli allograft) or may be an allograft recipient that has not or is not fication-based assay). demonstrating rejection. 0096 18 significant protein group codes were found to 0092. In some embodiments, the control may be an autolo have differential relative levels (relative to a reference gous control, for example a sample or profile obtained from sample) in AR and NR subjects, using a multiplexed iTRAO the Subject before undergoing allograft transplantation. In methodology (Table 7). These protein group codes included Some embodiments, the profile obtained at one time point proteomic markers encoded by one or more than one of TTN, (before, after or before and after transplantation) may be KNG1, LBP, VASN, ARNTL2, AFM, MSTP9, MST1, PI16, compared to one or more than one profiles obtained previ SERPINA5, CFD, USH1C, C2, MBL2, SERPINA10, C9, ously from the same Subject. By repeatedly sampling the LCAT, B2M, SHBG, C1S, UBR4 and F9. As described same biological sample from the same Subject over time, a below, accession numbers providing specific reference to the composite profile, illustrating marker level or expression over nucleic acid sequences encoding these polypeptides, and the time may be provided. Sequential samples can also be amino acid sequences of these polypeptides are provided obtained from the subject and a profile obtained for each, to herein. Unique identifiers (International Protein Index acces allow the course of increase or decrease in one or more sion numbers) for each member of the indicated protein group markers to be followed over time For example, an initial codes are found in Table 7. Polypeptides comprisingaportion sample or samples may be taken before the transplantation, of one or more of these sequences may be useful for the with Subsequent samples being taken weekly, biweekly, preparation of antibodies that specifically detect one or more monthly, bimonthly or at another Suitable, regular interval of the proteomic markers, alternately, the sequences may be and compared with profiles from samples taken previously. used to identify one or more proteomic markers in a sample Samples may also be taken before, during and after adminis Subjected to tryptic digest and analysis by mass spectroscopy tration of a course of a drug, for example an immunosuppres by comparison of the peptide fragments generated to the sive drug. sequences, or to a database comprising such sequences. 0093 Techniques, methods, tools, algorithms, reagents 0097. Detection or determination, and in some cases quan and other necessary aspects of assays that may be employed tification, of a nucleic acid may be accomplished by any one to detect and/or quantify a particular marker or set of markers of a number methods or assays employing recombinant DNA are varied. Of significance is not so much the particular technologies known in the art, including but not limited to, method used to detect the marker or set of markers, but what sequence-specific hybridization, polymerase chain reaction markers to detect. As is reflected in the literature, tremendous (PCR), RT-PCR, microarrays and the like. Such assays may variation is possible. Once the marker or set of markers to be include sequence-specific hybridization, primer extension, or detected or quantified is identified, any of several techniques invasive cleavage. Furthermore, there are numerous methods may be well suited, with the provision of appropriate for analyzing/detecting the products of each type of reaction reagents. One of skill in the art, when provided with the set of (for example, fluorescence, luminescence, mass measure markers to be identified, will be capable of selecting the ment, electrophoresis, etc.). Furthermore, reactions can occur appropriate assay (for example, a PCR based or a microarray in Solution or on a Solid Support Such as a glass slide, a chip, based assay for nucleic acid markers, an ELISA, protein or a bead, or the like. antibody microarray or similar immunologic assay, or in 0.098 Methods of designing and selecting probes for use some examples, use of an iTRAO, iCAT or SELDI proteomic in microarrays or biochips, or for selecting or designing prim mass spectrometric based method) for performing the meth ers for use in PCR-based assays are known in the art. Once the ods disclosed herein. marker or markers are identified and the sequence of the 0094. The present invention provides nucleic acid expres nucleic acid determined by, for example, querying a database sion profiles and proteomic expression profiles related to the comprising such sequences, or by having an appropriate assessment or diagnosis of allograft rejection in a subject. sequence provided (for example, a sequence listing as pro US 2011/O 189680 A1 Aug. 4, 2011

vided herein), one of skill in the art will be able to use such In: Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, information to select appropriate probes or primers and per Inc., pp. 77-96). Human, or humanized antibodies may be form the selected assay. used and can be obtained by using human hybridomas (Cote 0099 Standard reference works setting forth the general et al., 1983, Proc. Natl. Acad. Sci. USA 80:2026-2030) or by principles of recombinant DNA technologies known to those transforming human B cells with EBV virus in vitro (Cole et of skill in the art include, for example: Ausubel et al. Current al., 1985, In: Monoclonal Antibodies and Cancer Therapy, Protocols In Molecular Biology, John Wiley & Sons, New Alan R. Liss, Inc., pp. 77-96). Techniques developed for the York (1998 and Supplements to 2001); Sambrook et al. production of “chimeric antibodies' (Morrison et al., 1984, Molecular Cloning: A Laboratory Manual. 2d Ed., Cold Proc. Natl. Acad. Sci. USA 81:6851-6855; Neuberger et al. Spring Harbor Laboratory Press, Plainview, N.Y. (1989); 1984, Nature 312:604-608: Takeda et al., 1985, Nature 314: Kaufman et al, Eds., Handbook Of Molecular And Cellular 452-454) by splicing a sequence encoding a mouse antibody Methods In Biology And Medicine, CRC Press, Boca Raton molecule specific for a particular biomarker together with a (1995); McPherson, Ed., Directed Mutagenesis: A Practical sequence encoding a human antibody molecule of appropri Approach, IRL Press, Oxford (1991). ate biological activity may be used; Such antibodies are within 0100 Proteins, protein complexes or proteomic markers the scope of this invention. Techniques described for the may be specifically identified and/or quantified by a variety of production of single chain antibodies (U.S. Pat. No. 4,946, methods known in the art and may be used alone or in com 778) may be adapted to produce a biomarker-specific anti bination. Immunologic- or antibody-based techniques bodies. An additional embodiment of the invention utilizes include enzyme-linked immunosorbent assay (ELISA), the techniques described for the construction of Fab expres radioimmunoassay (RIA), western blotting, immunofluores sion libraries (Huse et al., 1989, Science 246:1275-1281) to cence, microarrays. Some chromatographic techniques (i.e. allow rapid and easy identification of monoclonal Fab frag immunoaffinity chromatography), flow cytometry, immuno ments with the desired specificity for a biomarker proteins. precipitation and the like. Such methods are based on the Non-human antibodies can be “humanized by known meth specificity of an antibody or antibodies for a particular ods (e.g., U.S. Pat. No. 5.225,539). epitope or combination of epitopes associated with the pro 0103) Antibody fragments that contain an idiotype of a tein or protein complex of interest. Non-immunologic meth biomarker can be generated by techniques known in the art. ods include those based on physical characteristics of the For example, Such fragments include, but are not limited to, protein or protein complex itself. Examples of Such methods the F(ab')2 fragment which can be produced by pepsin diges include electrophoresis, Some chromatographic techniques tion of the antibody molecule; the Fab' fragment that can be (e.g. high performance liquid chromatography (HPLC), fast generated by reducing the disulfide bridges of the F(ab')2 protein liquid chromatography (FPLC), affinity chromatog fragment; the Fab fragment that can be generated by treating raphy, ion exchange chromatography, size exclusion chroma the antibody molecular with papain and a reducing agent, and tography and the like), mass spectrometry, sequencing, pro FV fragments. Synthetic antibodies, e.g., antibodies produced tease digests, and the like. Such methods are based on the by chemical synthesis, may also be useful in the present mass, charge, hydrophobicity or hydrophilicity, which is invention. derived from the amino acid complement of the protein or 0.104 Standard reference works described herein and protein complex, and the specific sequence of the amino knownto those skilled in the relevant art describe both immu acids. Exemplary methods include those described in, for nologic and non-immunologic techniques, their suitability example, PCT Publication WO 2004/019000, WO 2000/ for particular sample types, antibodies, proteins or analyses. 00208, U.S. Pat. No. 6,670,194. Immunologic and non-im Standard reference works setting forth the general principles munologic methods may be combined to identify or charac of immunology and assays employing immunologic methods terize a protein or protein complex. Furthermore, there are known to those of skill in the art include, for example: Harlow numerous methods for analyzing/detecting the products of and Lane, Antibodies: A Laboratory Manual. 2d Ed., Cold each type of reaction (for example, fluorescence, lumines Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. cence, mass measurement, electrophoresis, etc.). Further (1999); Harlow and Lane. Using Antibodies: A Laboratory more, reactions can occur in Solution or on a solid Support Manual. Cold Spring Harbor Laboratory Press, New York; Such as a glass slide, a chip, a bead, or the like. Coligan et al. eds. Current Protocols in Immunology, John 0101 Methods of producing antibodies for use in protein Wiley & Sons, New York, N.Y. (1992-2006); and Roittet al., or antibody arrays, or other immunology based assays are Immunology, 3d Ed. Mosby-Year Book Europe Limited, known in the art. Once the marker or markers are identified London (1993). Standard reference works setting forth the and the amino acid sequence of the protein or polypeptide is general principles of peptide synthesis technology and meth identified, either by querying of a database or by having an ods known to those of skill in the art include, for example: appropriate sequence provided (for example, a sequence list Chan et al., Fmoc Solid Phase Peptide Synthesis, Oxford ing as provide herein), one of skill in the art will be able to use University Press, Oxford, United Kingdom, 2005; Peptide Such information to prepare one or more appropriate antibod and Protein Drug Analysis, ed. Reid, R., Marcel Dekker, Inc., ies and perform the selected assay. 2000; Epitope Mapping, ed. Westwood et al., Oxford Univer 0102 For preparation of monoclonal antibodies directed sity Press, Oxford, United Kingdom, 2000; Sambrook et al., towards a biomarker, any technique that provides for the Molecular Cloning: A Laboratory Manual, 3" ed., Cold production of antibody molecules may be used. Such tech Spring Harbor Press, Cold Spring Harbor, N.Y. 2001; and niques include, but are not limited to, hybridomas or triomas Ausubel et al., Current Protocols in Molecular Biology, (e.g. Kohler and Milstein 1975, Nature 256:495-497; Greene Publishing Associates and John Wiley & Sons, NY. Gustafsson et al., 1991, Hum. Antibodies Hybridomas 2:26 1994). 32), human B-cell hybridoma or EBV hybridomas e.g. (Koz 0105. A subject's rejection status may be described as bor et al., 1983, Immunology Today 4:72; Cole et al., 1985, “rejector (R or “acute rejector” or AR) or as a “non-rejector” US 2011/O 189680 A1 Aug. 4, 2011

(NR) and is determined by comparison of the concentration the to allograft and assessed for the presence of nucleic acid of the markers to that of a non-rejector cutoff index. A “non markers or proteomic markers listed in Tables 2 or 7. rejector cutoff index' is a numerical value or score, beyond or 0108. The term “subject” or “patient” generally refers to outside of which a Subject is categorized as having rejector mammals and other animals including humans and other status. The non-rejector cutoff index may be alternately primates, companion animals, Zoo, and farm animals, includ referred to as a control value, a control index’, or simply as ing, but not limited to, cats, dogs, rodents, rats, mice, ham a control. A non-rejector cutoff-index may be the concen sters, rabbits, horses, cows, sheep, pigs, goats, poultry, etc. A tration of individual markers in a control Subject population subject includes one who is to be tested, or has been tested for and considered separately for each marker measured; alter prediction, assessment or diagnosis of allograft rejection. The nately the non-rejector cutoff index may be a combination of Subject may have been previously assessed or diagnosed the concentration of the markers, and compared to a combi using other methods, such as those described herein or those nation of the concentration of the markers in the subject's in current clinical practice, or may be selected as part of a sample provided for diagnosing. The control Subject popula general population (a control Subject). tion may be a normal or healthy control population, or may be 0109. A fold-change of a marker in a subject, relative to a control may be at least 0.1, 0.2,0.3,0.4,0.5,0.6,0.7, 0.8, 0.9, an allograft recipient population that has not, or is not, reject 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, ing the allograft. A control, or pool of controls, may be con 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, stant e.g. represented by a static value, or may be cumulative, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0 or in that the sample population used to obtain it may change more, or any amount there between. The fold change may from site to site, or over time and incorporate additional data represent a decrease, or an increase, compared to the control points. For example, a central data repository, Such as a cen value. One or more than one includes 1,2,3,4,5,6,7,8,9, 10, tralized healthcare information system, may receive and store 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or more. data obtained at various sites (hospitals, clinical laboratories 0110) “Down-regulation' or down-regulated may be or the like) and provide this cumulative data set for use with used interchangeably and refer to a decrease in the level of a the methods of the invention at a single hospital, community marker, Such as a gene, nucleic acid, metabolite, transcript, clinic, for access by an end user (i.e. an individual medical protein or polypeptide. “Up-regulation” or "up-regulated practitioner, medical clinic or center, or the like). In some may be used interchangeably and refer to an increase in the embodiments the cutoff index may be further characterized as level of a marker, such as a gene, nucleic acid, metabolite, being a genomic cutoff index (for genomic expression profil transcript, protein or polypeptide. Also, a pathway, Such as a ing of Subjects), a proteomic cutoff index (for proteomic signal transduction or metabolic pathway may be up- or profiling of Subjects), or the like. down-regulated. 0106 A“biological sample” refers generally to body fluid 0111. Once a subject is identified as an acute rejector, or at or tissue or organ sample from a subject. For example, the risk for becoming an acute rejector by any method (genomic biological sample may be a body fluid Such as blood, serum, or proteomic, or a combination thereof), therapeutic mea plasma, lymph fluid, urine or saliva. A tissue or organ sample, Sures may be implemented to alter the Subject's immune Such as a non-liquid tissue sample may be digested, extracted response to the allograft. The Subject may undergo additional or otherwise rendered to a liquid form—examples of Such monitoring of clinical values more frequently, or using more tissues or organs include cultured cells, blood cells, skin, sensitive monitoring methods. Additionally the Subject may liver, heart, kidney, pancreas, islets of Langerhans, bone mar be administered immunosuppressive medicaments to row, blood, blood vessels, heart valve, lung, intestine, bowel, decrease or increase the Subject's immune response. Even spleen, bladder, penis, face, hand, bone, muscle, fat, cornea or though a subject's immune response needs to be suppressed the like. A plurality of biological samples may be collected at to prevent rejection of the allograft, a suitable level of immune any one time. A biological sample or samples may be taken function is also needed to protect against opportunistic infec from a subject at any time, including before allograft trans tion. Various medicaments that may be administered to a plantation, at the time of transplantation or at anytime follow Subject are known; see for example, Goodman and Gilman's ing transplantation. A biological sample may comprise The Pharmacological Basis of Therapeutics 11" edition. Ch “nucleic acid, such as deoxyribonucleic acid (also DNA) 52, pp 1405-1431 and references therein; L L Brunton, JS or ribonucleic acid (also RNA or mRNA), or a combina Lazo, K L Parker editors. Standard reference works setting tion thereof, in either single or double-stranded form. A forth the general principles of medical physiology and phar nucleic acid may also be referred to as a transcript. macology known to those of skill in the art include: Fauci et 0107 The methods described herein may be employed al., Eds. Harrison's Principles Of Internal Medicine, 14th before a subject receives an allograft, or at any time following Ed., McGraw-Hill Companies, Inc. (1998). Other preventa receipt of an allograft to determine whether or not the allogaft tive and therapeutic strategies are reviewed in the medical is being rejected. For example, a sample obtained from a literature—see, for example Djamali et al., 2006. Clin JAm Subject at any time following the receipt of the allogaft may be Soc Nephrol 1:623-630. assessed for the presence of altered levels (increased or 0112 Genomic Nucleic Acid Expression Profiling decreased) of one or more than one nucleic acid marker or 0113. A method of diagnosing acute allograft rejection in proteomic marker listed in Tables 2 or 7. In some cases, a a Subject as provided by the present invention comprises 1) sample can be obtained from the subject 1, 2, 3, 4, 5, 6, 7, 8, determining the expression profile of at least one or more or more hours after the allograft is received. In some cases, a markers in a biological sample from the Subject, the markers sample can be obtained from the Subject one or more days selected from the group presented in Table 2; 2) comparing (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, or more days) the expression profile of the at least one or more markers to a after the allograft is received. In some examples, a sample can non-rejector profile; and 3) determining whether the expres be obtained from 2 to 7 days (e.g., 5 to 7 days) after receipt of sion level of the at least one or more markers is up-regulated US 2011/O 189680 A1 Aug. 4, 2011

(increased) or down-regulated (decreased) relative to the con ing groups may be removed and the oligonucleotides trol profile, wherein up-regulation or down-regulation of the removed from their solid supports for purification of the at least one or more markers is indicative of the rejection complete chains if so desired. Status. 0118. A “gene' is an ordered sequence of nucleotides 0114. The invention also provides for a method of predict located in a particular position on a particular chromosome ing, assessing or diagnosing kidney allograft rejection in a that encodes a specific functional product and may include Subject as provided by the present invention comprising 1) untranslated and untranscribed sequences in proximity to the measuring the increase or decrease of at least one or more coding regions (5' and 3' to the coding sequence), as well as markers selected from the group presented in Table 2; and 2) exons and/or introns. Such non-coding sequences may con determining the rejection status of the subject, wherein the tain regulatory sequences needed for transcription and trans determination of rejection status of the subject is based on lation of the sequence or splicing of introns, for example, or comparison of the Subject's marker expression profile to a may as yet to have any function attributed to them beyond the control marker expression profile. occurrence of the mutation of interest. A gene may also 0115 The phrase “gene expression data”, “gene expres include one or more promoters, enhancers, transcription fac sion profile' or “marker expression profile' as used herein tor binding sites, termination signals or other regulatory ele refers to information regarding the relative or absolute level mentS. of expression of a gene or set of genes in a biological sample. 0119) The term “microarray,” “array,” or “chip” refers to a The level of expression of a gene may be determined based on plurality of defined nucleic acid probes coupled to the surface the level of RNA, such as mRNA, encoded by the gene. of a substrate in defined locations. The substrate may be a Alternatively, the level of expression may be determined solid substrate. Microarrays have been generally described in based on the level of a polypeptide or fragment thereof the art in, for example, U.S. Pat. Nos. 5,143,854 (Pirrung): encoded by the gene. 5,424,186, 5,445,934, 5,744,305 and 5,800,992 to Fodor, 0116. A polynucleotide, oligonucleotide, nucleic 5,677,195 and 6,040,193 to Winkler, and Fodor et al. 1991 acid or nucleotide polymer as used herein may include (Science, 251:767-777). Each of these references is incorpo synthetic or mixed polymers of nucleic acids, including RNA, rated by reference herein in their entirety. DNA or both RNA and DNA, both sense and antisense I0120 "Hybridization' includes a reaction in which one or Strands, and may be chemically or biochemically modified or more polynucleotides and/or oligonucleotides interact in an may contain non-natural or derivatized nucleotide bases, as ordered manner (sequence-specific) to form a complex that is will be readily appreciated by those skilled in the art. Such stabilized by hydrogenbonding also referred to as Watson modifications include, for example, labels, methylation, Sub Crick base pairing. Variant base-pairing may also occur stitution of one or more of the naturally occurring nucleotides through non-canonical hydrogen bonding includes Hoogs with an analog, internucleotide modifications such as teen base pairing. Under some thermodynamic, ionic or pH uncharged linkages (e.g., methyl phosphonates, phosphotri conditions, triple helices may occur, particularly with ribo esters, phosphoamidates, carbamates, etc.), charged linkages nucleic acids. These and other variant hydrogen bonding or (e.g., phosphorothioates, phosphorodithioates, etc.), pendent base-pairing are known in the art, and may be found in, for moieties (e.g., polypeptides), and modified linkages (e.g., example, Lehninger Principles of Biochemistry,3" edition alpha anomeric polynucleotides, etc.). Also included are syn (Nelson and Cox, eds. Worth Publishers, New York.), herein thetic molecules that mimic polynucleotides in their ability to incorporated by reference. bind to a designated sequence via hydrogen bonding and I0121 Hybridization reactions can be performed under other chemical interactions. conditions of different “stringency’. The stringency of a 0117. An oligonucleotide includes variable length nucleic hybridization reaction can determine the ease or difficulty acids, which may be useful as probes, primers and in the with which any two nucleic acid molecules will hybridize to manufacture of microarrays (arrays) for the detection and/or one another. Stringency may be increased, for example, by amplification of specific nucleic acids. Oligonucleotides may increasing the temperature at which hybridization occurs, by comprise DNA, RNA, PNA or other polynucleotide moieties decreasing the ionic (salt) concentration at which hybridiza as described in, for example, U.S. Pat. No. 5.948,902. Such tion occurs, or a combination thereof. Under stringent condi DNA or RNA strands may be synthesized by the sequential tions, nucleic acid molecules at least 60%, 65%, 70%, 75% or addition (5'-3' or 3'-5') of activated monomers to a growing more identical to each other remain hybridized to each other, chain which may be linked to an insoluble support. Numerous whereas molecules with low percent identity generally do not methods are known in the art for synthesizing oligonucle remain hybridized. An example of stringent hybridization otides for Subsequent individual use or as a part of the conditions are hybridization in 6x sodium chloride/sodium insoluble Support, for example in arrays (Lashkari DA. et al. citrate (SSC) at about 44-45° C., followed by one or more PNAS (1995) 92(17):7912-5; McGall G. et al. PNAS (1996) washes in 0.2xSSC, 0.1% SDS at 50° C., 55° C., 60° C., 65° 93(24):13555-60; Albert T.J. et al. Nucleic Acid Res. (2003) C., or at a temperature there between. 31(7):e35; Gao X. et al. Biopolymers (2004) 73(5):579–96: I0122) Hybridization between two nucleic acids may occur and Moorcroft M.J. etal. Nucleic Acid Res. (2005) 33(8):e75 in an antiparallel configuration—this is referred to as anneal and references therein). In general, oligonucleotides are syn ing, and the paired nucleic acids are described as comple thesized through the stepwise addition of activated and pro mentary. A double-stranded polynucleotide may be “comple tected monomers under a variety of conditions depending on mentary', if hybridization can occur between one of the the method being used. Subsequently, specific protecting strands of the first polynucleotide and the second. The degree groups may be removed to allow for further elongation and of which one polynucleotide is complementary with another Subsequently and once synthesis is complete all the protect is referred to as homology, and is quantifiable in terms of the US 2011/O 189680 A1 Aug. 4, 2011

proportion of bases in opposing strands that are expected to to detect the presence of a nucleic acid molecule (a nucleic hydrogen bond with each other, according to generally acid marker) in a sample; the detection may be quantitative, or accepted base-pairing rules. semi-quantitative. Detection may be, for example, through 0123. In general, sequence-specific hybridization involves amplification as in PCR and RT-PCR, or through hybridiza a hybridization probe, which is capable of specifically hybrid tion, as on a microarray, or through selective destruction and izing to a defined sequence. Such probes may be designed to protection, as in assays based on the selective enzymatic differentiate between sequences varying in only one or a few degradation of single or double stranded nucleic acids. Probes nucleotides, thus providing a high degree of specificity. A in a probe set may be labeled with one or more fluorescent, strategy which couples detection and sequence discrimina radioactive or other detectable moieties (including enzymes). tion is the use of a “molecular beacon', whereby the hybrid Probes may be any size so long as the probe is sufficiently ization probe (molecular beacon) has 3' and/or 5' reporter and large to selectively detect the desired gene generally a size quencher molecules and 3' and 5' sequences which are range from about 15 to about 25, or to about 30 nucleotides is complementary Such that absent an adequate binding target of Sufficient size. A probe set may be in Solution, e.g. for use for the intervening sequence the probe will form a hairpin in multiplex PCR. Alternately, a probe set may be adhered to loop. The hairpin loop keeps the reporter and quencher in a solid Surface, as in an array or microarray. A probe set may close proximity resulting in quenching of the fluorophor (re detect the expression level of a full-length gene, a splice porter) which reduces fluorescence emissions. However, variant of a full-length gene, a transcriptional unit, or a frag when the molecular beacon hybridizes to the target the fluo ment of a gene or transcriptional unit. A probe set identifies a rophor and the quencher are sufficiently separated to allow nucleic acid marker that is present in the sample. fluorescence to be emitted from the fluorophor. I0129. In some embodiments of the invention, a probe set 0.124 Probes used in hybridization may include double for detection of nucleic acids expressed by a set of nucleic stranded DNA, single-stranded DNA and RNA oligonucle acid markers comprising one or more than one of TncRNA, otides, and peptide nucleic acids. Hybridization conditions FKSG49, ZNF438, SFRS16, 1558448 a at, CAMKK2, and methods for identifying markers that hybridize to a spe NFYC, NCOA3, LMAN2, PGS1, NEDD9, 237442 at, cific probe are described in the art—see, for example, Brown, FKSG49/LOC730444, LIMK2, UNB, NASP PRO1073, T. “Hybridization Analysis of DNA Blots” in Current Proto 240057 at, ITGAX, LOC730399/LOC731974, FKBP1A, cols in Molecular Biology. F M Ausubel et al, editors. Wiley HLA-G, RBMS1 and SLC6A6 is provided. Such a probe set & Sons, 2003. doi:10.1002/0471142727.mb0210s21. Suit may be useful for determining the rejection status of a Subject. able hybridization probes for use in accordance with the The probe set may comprise one or more pairs of primers for invention include oligonucleotides, polynucleotides or modi specific amplification (e.g. PCR, or RT-PCR) of nucleic acid fied nucleic acids from about 10 to about 400 nucleotides, sequences corresponding to one or more than one of alternatively from about 20 to about 200 nucleotides, or from TncRNA, FKSG49, ZNF438, SFRS16, 15584.48 a at, about 30 to about 100 nucleotides in length. CAMKK2, NFYC, NCOA3, LMAN2, PGS1, NEDD9, 0.125 Specific sequences may be identified by hybridiza 237442 at FKSG49/LOC730444, LIMK2, UNB, NASP. tion with a primer or a probe, and this hybridization subse PRO1073, 240057 at, ITGAX, LOC730399/LOC731974, quently detected. FKBP1A, HLA-G, RBMS1 and SLC6A6. In another 0126. A "primer' includes a short polynucleotide, gener embodiment of the invention, the probe set is part of a ally with a free 3'-OH group that binds to a target or “tem microarray. In another embodiment of the invention, the plate' present in a sample of interest by hybridizing with the nucleic acid markers include one or more than one of target, and thereafter promoting polymerization of a poly TncRNA, FKSG49, ZNF438, 1558448 a at, CAMKK2, nucleotide complementary to the target. A polymerase chain LMAN2, 237442 at, FKSG49/LOC730444, JUNEB, reaction” (“PCR) is a reaction in which replicate copies are PRO1073 and ITGAX. The markers are described in further made of a target polynucleotide using a “pair of primers' or detail below. “set of primers' consisting of “upstream” and a “down 0.130. It will be appreciated that numerous other methods stream' primer, and a catalyst of polymerization, such as a for sequence discrimination and detection are known in the DNA polymerase, and typically a thermally-stable poly art and some of which are described in further detail below. It merase enzyme. Methods for PCR are well known in the art, will also be appreciated that reactions such as arrayed primer and are taught, for example, in Beverly, S. M. Enzymatic extension mini sequencing, tag microarrays and sequence Amplification of RNA by PCR (RT-PCR) in Current Proto specific extension could be performed on a microarray. One cols in Molecular Biology. F M Ausubel et al, editors. Wiley Such array based genotyping platform is the microsphere & Sons, 2003. doi:10.1002/0471142727.mb.1505s56. Syn based tag-it high throughput array (Bortolin S. et al. 2004 thesis of the replicate copies may include incorporation of a Clinical Chemistry 50: 2028-36). This method amplifies nucleotide having a label or tag, for example, a fluorescent genomic DNA by PCR followed by sequence-specific primer molecule, biotin, or a radioactive molecule. The replicate extension with universally tagged primers. The products are copies may subsequently be detected via these tags, using then Sorted on a Tag-It array and detected using the LumineX conventional methods. XMAP system. 0127 Aprimer may also be used as a probe in hybridiza I0131. It will be appreciated by a person of skill in the art tion reactions, such as Southern or Northern blot analyses that any numerical designations of nucleotides within a (see, e.g., Sambrook, J., Fritsh, E. F., and Maniatis, T. sequence are relative to the specific sequence. Also, the same Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold positions may be assigned different numerical designations Spring Harbor Laboratory, Cold Spring Harbor Laboratory depending on the way in which the sequence is numbered and Press, Cold Spring Harbor, N.Y., 1989). the sequence chosen. Furthermore, sequence variations such 0128. A "probe set' (or sometimes primer set) as used as insertions or deletions, may change the relative position herein refers to a group of oligonucleotides that may be used and Subsequently the numerical designations of particular US 2011/O 189680 A1 Aug. 4, 2011

nucleotides at and around a mutational site. For example, the maintained by the Swiss Institute of Bioinformatics, the sequences represented by accession numbers e.g. AC124566, Sanger Centre, or the European Bioinformatics Institute, such AF21 1864, AIO35495, AI326085, AK089167, AK131133, as the International Protein Index (IPI). AK155816, AK170432, BC042840 and BC057200 all repre 0.135 A protein or polypeptide, nucleic acid or fragment sent human ITGAX nucleotide sequences, but may have Some sequence differences, and numbering differences or portion thereof may be considered to be specifically iden between them. As another example, the sequences repre tified when its sequence may be differentiated from others sented by accession numbers NP 115925, NP 444509, found in the same phylogenetic Species, Genus, Family or P20702, NP 776169, NP 000878, NP 001706, Order. Such differentiation may be identified by comparison NP 04223, AAA59180, AAA51620 all represent human of sequences. Comparisons of a sequence or sequences may ITGAX polypeptide sequences, but may have some sequence be done using a BLAST algorithm (Altschul et al. 1009. J. differences, and numbering differences between them. Other Mol. Biol 215:403-410). A BLAST search allows for com nucleic acid markers may demonstrate variants, and are parison of a query sequence with a specific sequence or group described below. of sequences, or with a larger library or database (e.g. Gen 0132) Selection and/or design of probes, primers or probe Bank or GenPept) of sequences, and identify not only sets for specific detection of expression of any gene of inter sequences that exhibit 100% identity, but also those with est, including any of the above genes is within the ability of lesser degrees of identity. For example, regarding a protein one of skill in the relevant art, when provided with one or with multiple isoforms (either resulting from, for example, more nucleic acid sequences of the gene of interest. Further, separate genes or variant splicing of the nucleic acid tran any of several probes, primers or probe sets, or a plurality of Script from the gene, or post translational processing), an probes, primers or probe sets may be used to detect a gene of isoform may be specifically identified when it is differenti interest, for example, an array may include multiple probes ated from other isoforms from the same or a different species, for a single gene transcript—the aspects of the invention as by specific detection of a structure, sequence or motif that is described herein are not limited to any specific probes exem present on one isoform and is absent, or not detectable on one plified. or more other isoforms. 0.133 Sequence identity or sequence similarity may be 0.136. Access to the methods of the invention may be pro determined using a nucleotide sequence comparison program vided to an end userby, for example, a clinical laboratory or (for DNA or RNA sequences, or fragments or portions other testing facility performing the individual marker tests— thereof) or an amino acid sequence comparison program (for the biological samples are provided to the facility where the protein, polypeptide or peptide sequences, or fragments or individual tests and analyses are performed and the predictive portions thereof), such as that provided within DNASIS (for method applied; alternately, a medical practitioner may example, but not limited to, using the following parameters: receive the marker values from a clinical laboratory and use a GAP penalty 5, it of top diagonals 5, fixed GAP penalty 10, local implementation or an internet-based implementation to k-tuple 2, floating gap 10, and window size 5). However, other access the predictive methods of the invention. methods of alignment of sequences for comparison are well 0.137 Determination of statistical parameters such as mul known in the art for example the algorithms of Smith & tiples of the median, standard error, standard deviation and Waterman (1981, Adv. Appl. Math. 2:482), Needleman & the like, as well as other statistical analyses as described Wunsch (J. Mol. Biol. 48:443, 1970), Pearson & Lipman herein are known and within the skill of one versed in the (1988, Proc. Natl. Acad. Sci. USA 85:2444), and by com relevant art. Use of a particular coefficient, value or index is puterized implementations of these algorithms (e.g. GAP, exemplary only and is not intended to constrain the limits of BESTFIT. FASTA, and BLAST), or by manual alignment and the various aspects of the invention as disclosed herein. visual inspection. 0.138 Interpretation of the large body of gene expression 0134. If a nucleic acid or gene, polypeptide or sequence of data obtained from, for example, microarray experiments, or interest is identified and a portion or fragment of the sequence complex RT-PCR experiments may be a formidable task, but (or sequence of the gene polypeptide or the like) is provided, is greatly facilitated through use of algorithms and statistical other sequences that are similar, or Substantially similar may tools designed to organize the data in a way that highlights be identified using the programs exemplified above. For systematic features. Visualization tools are also of value to example, when constructing a microarray or probe represent differential expression by, for example, varying sequences, the sequence and location are known, Such that if intensity and hue of colour (Eisen et al. 1998. Proc Natl Acad a microarray experiment identifies a hit (the probe at a Sci 95:14863-14868). The algorithm and statistical tools particular location hybridizes with one or more nucleic acids available have increased in Sophistication with the increase in in a sample, the sequence of the probe will be known (either complexity of arrays and the resulting datasets, and with the by the manufacturer or producer of the microarray, or from a increase in processing speed, computer memory, and the rela database provided by the manufacturer for example the tive decrease in cost of these. NetAffx databases of Affymetrix, the manufacturer of the 0.139. Mathematical and statistical analysis of nucleic acid Human Genome U133 Plus 2.0 Array). If the identity of the or protein expression profiles may accomplish several sequence Source is not provided, it may be determined by things—identification of groups of genes that demonstrate using the sequence of the probe in a sequence-based search of coordinate regulation in a pathway or a domain of a biological one or more databases. For peptide or peptide fragments system, identification of similarities and differences between identified by proteomics assays, for example iTRAQ, the two or more biological samples, identification of features of a sequence of the peptide or fragment may be used to query gene expression profile that differentiate between specific databases of amino acid sequences as described above. events or processes in a Subject, or the like. This may include Examples of Such a database include those maintained by the assessing the efficacy of a therapeutic regimen or a change in National Centre for Biotechnology Information, or those a therapeutic regimen, monitoring or detecting the develop US 2011/O 189680 A1 Aug. 4, 2011 ment of a particular pathology, differentiating between two represent an increasefup-regulation or decrease? down-regu otherwise clinically similar (or almost identical) pathologies, lation of the gene or transcript in question. Of these 24 probe or the like. sets, at least 18 detect specific genes (known, or known but 0140 Clustering methods are known and have been not described) genes or transcripts. FIG. 10 provides nucleic applied to microarray datasets, for example, hierarchical acid sequence information of a portion of the nucleic acid clustering, self-organizing maps, k-means or deterministic identified by the probe sets listed in Tables 2 and 5. annealing. (Eisen et al., 1998 Proc Natl Acad Sci USA 0146 In some embodiments, the present invention pro 95:14863-14868; Tamayo, P., et al. 1999. Proc Natl Acad Sci vides a method for the assessment, monitoring, prediction or USA 96:2907-2912; Tavazoie, S., et al. 1999. Nat Genet. diagnosis of allograft rejection, including acute kidney 22:281-285; Alon, U., et al. 1999. Proc Natl Acad Sci USA 96:6745-6750). Such methods may be useful to identify allograft rejection, comprising measuring the expression groups of genes in a gene expression profile that demonstrate level of at least one or more of the markers or probe sets coordinate regulation, and also useful for the identification of selected from the group listed in Table 2, and referred to by the novel genes of otherwise unknown function that are likely to indicated gene symbol. These probe sets are associated with participate in the same pathway or system as the others dem and may specifically measure the expression level individual onstrating coordinate regulation. and unique genes or gene fragments referenced by the gene 0141. The pattern of nucleic acid or proteomic expression symbol. in a biological sample may also provide a distinctive and 0147 The genes or markers indicated in Tables 2 or 5 may accessible molecular picture of its functional state and iden have a biological role in the allograft rejection process, and tity. Two different samples that have related gene expression represent a therapeutic target. patterns are may be biologically and functionally similar to one another, conversely two samples that demonstrate sig 0.148. In another embodiment, the present invention pro nificant differences in the pattern of nucleic acid or proteomic vides for a group of nucleic acid markers, useful for the expression may not only be differentiated by the complex assessment or diagnosis of acute allograft rejection, including expression pattern displayed, but may indicate a diagnostic kidney allograft rejection, comprising one or more than one Subset of gene products or transcripts that are indicative of a of TncRNA, FKSG49, ZNF438, SFRS16, 1558448 a at, specific pathological state or other physiological condition, CAMKK2, NFYC, NCOA3, LMAN2, PGS1, NEDD9, Such as allograft rejection. 237442 at FKSG49/LOC730444, LIMK2, UNB, NASP. 0142. Applying a plurality of mathematical and/or statis PRO1073, 240057 at, ITGAX, LOC730399/LOC731974, tical analytical methods to a microarray dataset may indicate FKBP1A, HLA-G, RBMS1 and SLC6A6. varying Subsets of significant markers, leading to uncertainty 0149. In another embodiment, the present invention pro as to which method is best or more accurate. Regardless of vides for a subset of markers selected from the group of 24, the mathematics, the underlying biology is the same in a that may be useful for the assessment, monitoring, prediction dataset. By applying a plurality of mathematical and/or sta or diagnosis of allograft rejection, including acute kidney tistical methods to a microarray dataset and assessing the allograft rejection, comprising one or more than one of statistically significant Subsets of each for common markers TncRNA, FKSG49, ZNF438, 1558448 a at, CAMKK2, to all, the uncertainty is reduced, and clinically relevant core LMAN2, 237442 at, FKSG49/LOC730444, JUNEB, group of markers is identified. PRO1073 and ITGAX. 0143 Genomic Expression Profiling Markers 0150. In another embodiment, the present invention pro 0144. The present invention provides for a core group of vides for a subset of markers selected from the group of 24, nucleic acid markers useful for the assessment or diagnosis of that may be useful for the assessment, monitoring, prediction allograft rejection, including acute kidney allograft rejection, or diagnosis of allograft rejection, including acute kidney comprising one or more than one of the nucleic acid markers allograft rejection, comprising TncRNA, FKSG49, ZNF438, presented in Table 2, and may include one or more than one of 1558448 a at, CAMKK2, LMAN2, 237442 at, FKSG49/ TncRNA, FKSG49, ZNF438, SFRS16, 1558448 a at, LOC730444, JUNB, PRO1073 and ITGAX and one or more CAMKK2, NFYC, NCOA3, LMAN2, PGS1, NEDD9, than one of SFRS16, NFYC, NCOA3, PGS1, NEDD9, 237442 at FKSG49/LOC730444, LIMK2, UNB, NASP. LIMK2, NASP, 240057 at, LOC730399/LOC731974, PRO1073, 240057 at, ITGAX, LOC730399/LOC731974, FKBP1A, HLA-G, RBMS1 and SLC6A6. One or more than FKBP1A, HLA-G, RBMS1 and SLC6A6. one includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or more. 0145 183 probe sets were detected, quantified and found 0151. The results of Examples 1-3 illustrate the above to demonstrate a statistically significant discrimination, with embodiments—a 24 nucleic acid classifer set (TncRNA, a false discovery rate (FDR) below 1%, comparing the rejec FKSG49, ZNF438, 1558448 a at, CAMKK2, LMAN2, tion (AR) samples and non-rejecting transplant (NR) controls 237442 at FKSG49/LOC730444, JUNEB, PRO1073, in all of the three moderated t-tests applied, and may represent ITGAX; SFRS16, NFYC, NCOA3, PGS1, NEDD9, LIMK2, an increasefup-regulation or decrease? down-regulation of the NASP, 240057 at, LOC730399/LOC731974, FKBP1A, gene or transcript in question. These probe sets specifically HLA-G, RBMS1 and SLC6A6) are useful for discerning detect (by hybridization and detection of a label) and allow acute rejecting Subjects from non-rejecting Subjects. Any for quantitation of the expression level of the expressed combination of one or more than one of the set of 24 may also nucleic acids. Of this set of 183 (listed in Table 2), represent be useful for discerning acute rejecting Subjects from non ing 183 individual expressed transcripts or nucleic acids, a rejecting Subjects. The intersecting set of 11 nucleic acid subset of 24 probe sets (Table 5) were detected, quantified and markers (TncRNA, FKSG49, ZNF438, 1558448 a at, found to demonstrate a statistically significant fold change in CAMKK2, LMAN2, 237442 at, FKSG49/LOC730444, the AR samples relative to non-rejecting transplant (NR) con JUNB, PRO1073 and ITGAX) may also be useful for dis trols in all of the three moderated t-tests applied, and may cerning acute rejecting Subjects from non-rejecting Subjects. US 2011/O 189680 A1 Aug. 4, 2011 15

TABLE 2 Differentially expressed probe sets, exhibiting about a 1.39 to 1.4-fold difference (or greater) between AR and NR subject. The target sequence is the portion of the consensus or exemplar sequencer from which the probe sequences were selected (Affymetrix TM NetAffx TM Annotation database Update Release 25, Mar. 2008). The consensus or exemplary sequence is the sequence used at the time of design of the array to represent the transcript that the GeneChip U1332.0 probe set measures. A consensus sequence results from base calling algorithms that align and combine sequence data into groups. An exemplar sequence is a representative cDNA sequence for each (le. log2 Representative Affymetrix RefSeq, (Fold Fold Direction sequence (SEQ Probe Set ID Gene Symbol Gene Title Accession No. Change) Change (AR vs NR) FDR value ID NO:) 552264 a at MAPK1 mitogen-activated NM OO2745 0.73 1.66 l O.OO749 1 protein kinase 1 NM 138957 55.2542 S at TAGAP T-cell activation NM 054114 O.95 1.93 l O.OO996 2 GTPase activating NM 1388.10 protein NM 1521.33 553186 X at RASEF RAS and EF-hand NM 152573 1.12 2.18 l O.OO760 3 domain containing 553297 a. at CSF3R colony stimulating factor NM OOO760 O.81 1.76 l O.OOS/4 4 3 receptor (granulocyte) NM 156038 NM 156039 NM 172313 554691 a. at PACSIN2 protein kinase C and NM OO7229 O.74 1.67 l O.OOS/4 5 casein kinase substrate in neurons 2 555420 a. at KLF7 Kruppel-like factor 7 NM 003709 1.08 2.11 l O.OO638 6 (ubiquitous) 555467 a at CUGBP1 CUG triplet repeat, NM 001025596 0.79 73 l O.00363 7 RNA binding protein 1 NM OO6560 NM 1987OO 555797 a. at ARPC5 actin related protein 2/3 NM OO5717 O.76 70 l O.OO711 8 complex, Subunit 5. 16 kDa 555852 at 1555852 at O.90 87 l O.OO721 9 555950 a. at CD55 CD55 molecule, decay NM 000574 O.85 80 l O.OO703 10 accelerating factor for complement (Cromer blood group) 557924 S at ALPL alkaline phosphatase, NM 000478 0.77 .71 l O.OO758 11 liver/bone/kidney 5584.48 a at 15584.48 a at CDNA FLJ35687 fis, 0.79 73 l O.OO677 12 clone SPLEN2019349 563509 at 1563509 at MRNA, cDNA O.84 .79 l O.OO219 13 DKFZp313O229 (from clone DKEZp313O229) 565484 x at EGFR epidermal growth factor NM OO5228 -1.23 2.35 down O.OOS62 14 receptor (erythroblastic NM 201282 leukemia viral (v-erb-b) NM 201283 Oncogene homolog, NM 201284 avian) 1565599 at 1565599 at Clone 23712 mRNA O.49 140 up O.OO760 15 Sequence 1565717 s at FUS fusion (involved in NM 001010850 1.04 2.06 up O.OO375 16 (12; 16) in malignant NM 004960 iposarcoma) 1568609 S at FAM91A2 amily with sequence NM 207400 O.87 1.83 up O.OO703 17 FLJ39739, similarity 91, member XM OO1125827 LOCA2782O A2 XM 934503 hypothetical FLJ39739 hypothetical protein LOC72782O 1569003 at TMEM49 transmembrane protein NM 030938 O.95 1.94 up O.00769 18 49 200709 at FKBP1A FK506 binding protein NM 000801 O.S9 1...SO up O.OO775 19 A, 12 kDa NM 054014 200739 s at SUMO3 SMT3 suppressor of mif NM OO6936 O.S9 1...SO up O.OO711 2O two 3 homolog 3 (S. cerevisiae) 200796 S. at MCL1 myeloid cell leukemia NM O21960 1.32 2.50 up O.OO269 21 sequence 1 (BCL2- NM 182763 related) 200797 s at MCL1 myeloid cell leukemia NM O21960 O.60 1.52 up O.OO872 22 sequence 1 (BCL2- NM 182763 related) 200805 at LMAN2 lectin, mannose-binding 2 NM OO6816 0.72 1.64 up O.OO26S 23 US 2011/O 189680 A1 Aug. 4, 2011 16

TABLE 2-continued Differentially expressed probe sets, exhibiting about a 1.39 to 1.4-fold difference (or greater) between AR and NR subject. The target sequence is the portion of the consensus or exemplar sequencer from which the probe sequences were selected (Affymetrix TM NetAffx TM Annotation database Update Release 25, Mar. 2008). The consensus or exemplary sequence is the sequence used at the time of design of the array to represent the transcript that the GeneChip U1332.0 probe set measures. A consensus sequence results from base calling algorithms that align and combine sequence data into groups. An exemplar sequence is a representative cDNA sequence for each (le. log2 Representative Affymetrix RefSeq, (Fold Fold Direction sequence (SEQ Probe Set ID Gene Symbol Gene Title Accession No. Change) Change (AR vs NR) FDR value ID NO:) 2008.52 x at GNB2 guanine nucleotide NM OO5273 O.S3 .44 l O.OO872 24 binding protein (G protein), beta polypeptide 2 200904 at HLA-E major histocompatibility NM OO5516 O.66 S8 l O.OO760 25 complex, class I, E 200959 at FUS fusion (involved in NM 001010850 O.74 .67 l O.OO2S4 26 (12; 16) in malignant NM 004960 iposarcoma) 201043 s at ANP32A acidic (leucine-rich) NM OO6305 O.81 .75 l O.OOO87 27 nuclear phosphoprotein 32 family, member A 201090 X at TUBA1B tubulin, alpha1b NM OO6082 O.63 55 l O.OO468 28 201440 at DDX23 DEAD (Asp-Glu-Ala- NM 004.818 O.S4 46 l O.OO826 29 Asp) box polypeptide 23 201473 at JUNB jun B proto-oncogene NM OO2229 O.76 69 l O.OO638 30 201531 at ZFP36 Zinc finger protein 36, NM OO3407 O.86 81 l O.OO26S 31 C3H type, homolog (mouse) 201651 S. at PACSIN2 protein kinase C and NM OO7229 O.68 60 l O.OO891 32 casein kinase substrate in neurons 2 201729 s at KIAAO100 KIAAO1OO NM 014680 O.S9 S1 l O.OO711 33 201861 S. at LRRFIP1 eucine rich repeat (in NM OO4735 1.11 2.16 l O.OO222 34 FLII) interacting protein 1 201950 X. at CAPZB capping protein (actin NM OO4930 O.70 62 l O.OO872 35 filament) muscle Z-line, beta 201954 at ARPC1B, actin related protein 2/3 NM OO5720 O.68 60 l O.OO219 36 LOC653888 complex, Subunit 1B, XM 93.6251 41 kDa similar to Actin-related protein 2/3 complex subunit 1 B (ARP2/3 complex 41 kDa subunit) (p41-ARC) 201970 S. at NASP nuclear autoantigenic NM OO2482 O.S2 43 l O.O0917 37 sperm protein (histone- NM 152298 binding) NM 172164 202150 S at NEDD9 neural precursor cell NM OO6403 O.49 40 l O.OO879 38 expressed, NM 182966 developmentally down regulated 9 202180 S. at MVP major vault protein NM OO5115 O.82 77 l O.OO703 39 NM 017458 202216 x at NFYC nuclear transcription NM O14223 0.55 46 l O.OO775 40 factorY. gamma 202423 at MYST3 MYST histone NM 0010994.12 O.S2 43 l O.OO798 41 acetyltransferase NM 0010994.13 (monocytic leukemia) 3 NM OO6766 2025.10 S. at TNFAIP2 tumor necrosis factor, NM OO6291 O.86 81 l O.OO46S 42 alpha-induced protein 2 202531 at IRF1 interferon regulatory NM 002198 O.85 81 l O.00998 43 factor 1 202897 at SIRPA signal-regulatory protein NM 00104.0022 O.99 .99 l O.OO219 44 alpha NM OO1040023 NM 080792 202910 S. at CD97 CD97 molecule NM 001025160 O.93 90 l O.OO760 45 NM OO1784 NM O784.81 202951 at STK38 serine/threonine kinase NM OO7271 O.78 .71 l O.OO879 46 38 203233 at IL4R interleukin 4 receptor NM 000418 O.92 90 l O.OO912 47 NM OO1008699 US 2011/O 189680 A1 Aug. 4, 2011 17

TABLE 2-continued Differentially expressed probe sets, exhibiting about a 1.39 to 1.4-fold difference (or greater) between AR and NR subject. The target sequence is the portion of the consensus or exemplar sequencer from which the probe sequences were selected (Affymetrix TM NetAffx TM Annotation database Update Release 25, Mar. 2008). The consensus or exemplary sequence is the sequence used at the time of design of the array to represent the transcript that the GeneChip U1332.0 probe set measures. A consensus sequence results from base calling algorithms that align and combine sequence data into groups. An exemplar sequence is a representative cDNA sequence for each (le. log2 Representative Affymetrix RefSeq, (Fold Fold Direction sequence (SEQ Probe Set ID Gene Symbol Gene Title Accession No. Change) Change (AR vs NR) FDR value ID NO:) 203239 s at CNOT3 CCR4-NOT NM 014516 O.69 61 l O.OO857 48 transcription complex, subunit 3 203254 s at TLN1 talin 1 NM OO6289 O.83 .78 l O.00434 49 203471 S. at PLEK pleckstrin NM 002664 O.80 .74 l O.OO879 50 203509 at SORL1 sortilin-related receptor, NM OO3105 O.68 60 l O.OO652 51 L(DLR class) A repeats containing 203591 S. at CSF3R colony stimulating factor NM OOO760 O.88 .85 l O.OO638 52 3 receptor (granulocyte) NM 156038 NM 156039 NM 172313 203624 at SFRS17A splicing factor, NM 005088 0.72 .65 l O.OO972 53 arginine serine-rich 17A 203748 x at RBMS1 RNA binding motif, NM 002897 O.80 .74 l O.OO219 S4 single stranded NM O16836 interacting protein 1 NM O16839 204166 at SBNO2 strawberry notch NM 00110.0122 O.80 .74 l O.OO314 55 homolog 2 (Drosophila) NM O14963 204978 at SFRS16 splicing factor, NM 007056 O.76 70 l O.OOSS2 56 arginine serine-rich 16 205220 at GPR109B G protein-coupled NMOO6018 1.15 2.22 l O.OOSS2 57 receptor 109B XM 001134375 205285 s at FYB FYN binding protein NM OO1465 O.62 53 l O.OO872 58 (FYB-120/130) NM 1993.35 205539 at AVIL advillin NM OO6576 O.92 89 l O.OOO87 59 205921 S at SLC6A6 solute carrier family 6 NM 003043 O.65 57 l O.OO756 60 (neurotransmitter transporter, taurine). member 6 206130 s at ASGR2 asialoglycoprotein NM 001181 O.83 .78 l O.OO419 61 receptor 2 NM 080912 NM 080913 NM 080914 206323 x at OPHN1 oligophrenin 1 NM OO2547 0.57 48 l O.OO922 62 207127 s at HNRPH3 heterogeneous nuclear NM 012207 O.64 S6 l O.OO749 63 ribonucleoprotein H3 NM 021644 (2H9) 207266 x at RBMS1 RNA binding motif, NM 002897 O.92 89 l O.OO222 64 single stranded NM O16836 interacting protein 1 NM O16839 207446 at TLR6 toll-like receptor 6 NM OO6068 O.78 72 l O.OO470 65 2O7643 s at TNFRSF1A tumor necrosis factor NM OO1065 0.77 .71 l O.OO288 66 receptor Superfamily, member 1A 2O778.2 s at PSEN1 presenilin 1 (Alzheimer NM OOOO21 O.70 63 l O.OO971 67 disease 3) 208018 S at HCK hemopoietic cell kinase NM 002110 O.87 .83 l O.OO930 68 208120 x at FKSG49, FKSG49 hypothetical XM OO1125803 O.S6 47 l O.OO356 69 LOCA3O444 protein LOC730444 208488 s at CR1 complement component NM OOO573 O.78 72 l O.OO749 70 (3b/4b) receptor 1 NM OOO651 (Knops blood group) XM OO1126036 208702 x at APLP2 amyloid beta (A4) NM OO1642 O.76 69 l O.OO870 71 precursor-like protein 2 208772 at ANKHD1, ankyrin repeat and KH NM O17747 O.85 81 l O.OO775 72 MASK-BP3 domain containing 1 NM O17978 MASK-4E-BP3 NM O2O690 alternate reading frame NM 024668 gene 20881.1 s at DNAJB6 DnaJ (Hsp40) homolog, NM OO5494 O.82 1.77 up O.OO777 73 Subfamily B, member 6 NM 058246 208885 at LCP1 lymphocyte cytosolic NM 002298 0.77 1.70 up O.OO912 74 protein 1 (L-plastin) 208919 s at NADK NAD kinase NM O23.018 O.81 1.76 up O.OO872 75 US 2011/O 189680 A1 Aug. 4, 2011 18

TABLE 2-continued Differentially expressed probe sets, exhibiting about a 1.39 to 1.4-fold difference (or greater) between AR and NR subject. The target sequence is the portion of the consensus or exemplar sequencer from which the probe sequences were selected (Affymetrix TM NetAffx TM Annotation database Update Release 25, Mar. 2008). The consensus or exemplary sequence is the sequence used at the time of design of the array to represent the transcript that the GeneChip U1332.0 probe set measures. A consensus sequence results from base calling algorithms that align and combine sequence data into groups. An exemplar sequence is a representative cDNA sequence for each (le. log2 Representative Affymetrix RefSeq, (Fold Fold Direction sequence (SEQ Probe Set ID Gene Symbol Gene Title Accession No. Change) Change (AR vs NR) FDR value ID NO:) 208922 S at NXF1 nuclear RNA export NM 001081491 O.64 S6 l O.OO703 76 factor 1 NM OO6362 209060 x at NCOA3 nuclear receptor NM OO6534 O.83 77 l O.OO652 77 coactivator 3 NM 181659 209083 at CORO1A coronin, actin binding NM 007074 O.82 77 l O.OO760 78 protein, 1A 209286 at CDC42EP3 CDC42 effector protein NM OO6449 O.91 88 l O.OO222 79 (Rho GTPase binding) 3 209868. S. at RBMS1 RNA binding motif, NM 002897 O.88 84 l O.OO337 8O single stranded NM O16836 interacting protein 1 NM O16839 210184 at ITGAX integrin, alpha X NM OOO887 O.65 57 l O.OO392 81 (complement XM OO1127869 component 3 receptor 4 Subunit) 210190 at STX11 Syntaxin 11 NM 003764 1.OO .99 l O.OO684 82 210191 S. at PHTF1 putative homeodomain NM OO6608 O.90 87 l O.OO972 83 transcription factor 1 210483 at MGC31957 hypothetical protein O.S9 S1 l O.OO652 84 MGC31957 210484 S at MGC31957. tumor necrosis factor NM 003841 O.89 .85 l O.OO262 85 TNFRSF10C receptor Superfamily, member 10c, decoy without an intracellular domain hypothetical protein MGC31957 21051.4 x at HLA-G HLA-G NM 002127 O.S8 1...SO up O.OO875 86 histocompatibility antigen, class I, G 210563 x at CFLAR CASP8 and FADD-like NM OO3879 O.83 1.78 up O.OO722 87 apoptosis regulator 210569 s at SIGLEC9 sialic acid binding Ig- NM O14441 0.67 1.59 up O.OOO87 88 like lectin 9 210686 X at SLC25A16 solute carrier family 25 NM 152707 O.74 1.67 up O.OO179 89 (mitochondrial carrier; Graves disease autoantigen), member 16 210754 S at LYN v-yes-1 Yamaguchi NM 002350 O.71 1.64 up O.OO758 90 sarcoma viral related oncogene homolog 210787 s at CAMKK2 calcium calmodulin- NM OO6549 O.62 1.54 up O.OOS60 91 dependent protein NM 153499 kinase kinase 2, beta NM 153500 NM 172214 NM 172215 NM 172216 NM 172226 210992 X at FCGR2C c fragment of IgG, low NM 001005410 O.83 1.77 up O.OOS22 92 affinity IIc, receptor for NM 001005411 (CD32) NM 001005412 NM 201563 211058 x at TUBA1B tubulin, alpha 1b NM OO6082 0.57 148 up O.00761 93 211072 X at TUBA1B tubulin, alpha 1b NM OO6082 O.60 1.51 up O.004.09 94 211251 x at NFYC nuclear transcription NM O14223 O.49 140 up O.OO888 95 factorY. gamma 211395 x at FCGR2C c fragment of IgG, low NM 001005410 O.84 1.79 up O.OOS62 96 affinity IIc, receptor for NM 001005411 (CD32) NM 001005412 NM 201563 211454 x at FKSG49 FKSG49 0.75 1.69 up O.OOO87 97 211521 S at PSCD4 pleckstrin homology, NM 013385 O.69 1.61 up O.OO219 98 Sec7 and coiled-coil domains 4 US 2011/O 189680 A1 Aug. 4, 2011 19

TABLE 2-continued Differentially expressed probe sets, exhibiting about a 1.39 to 1.4-fold difference (or greater) between AR and NR subject. The target sequence is the portion of the consensus or exemplar sequencer from which the probe sequences were selected (Affymetrix TM NetAffx TM Annotation database Update Release 25, Mar. 2008). The consensus or exemplary sequence is the sequence used at the time of design of the array to represent the transcript that the GeneChip U1332.0 probe set measures. A consensus sequence results from base calling algorithms that align and combine sequence data into groups. An exemplar sequence is a representative cDNA sequence for each (le. log2 Representative Affymetrix RefSeq, (Fold Fold Direction sequence (SEQ Probe Set ID Gene Symbol Gene Title Accession No. Change) Change (AR vs NR) FDR value ID NO:) 211571 S. at WCAN versican NM 004385 1.47 2.77 l O.OO470 99 211750 X. at TUBA1C tubulin, alpha 1c NM 032704 O.61 52 l O.OO840 OO 211787 s at EIF4A1 eukaryotic translation NM 001416 O.S8 SO l O.OO715 O1 initiation factor 4A, isoform 1 211794 at FYB FYN binding protein NM OO1465 0.79 73 l O.OO711 O2 (FYB-120/130) NM 1993.35 211795 s at FYB FYN binding protein NM OO1465 1.02 2.03 l O.OO756 O3 (FYB-120/130) NM 1993.35 211797 s at NFYC nuclear transcription NM O14223 O.81 .76 l O.OO760 O4 actorY. gamma 211823 s at PXN paxillin NM 002859 O.65 57 l O.OO356 05 XM 001132665 211974 X at RBPJ recombination signal NM OO5349 O.70 63 l O.OO179 O6 binding protein for NM O15874 immunoglobulin kappa J NM 203283 region NM 203284 211996 s at DKFZp547E087 KIAAO220-like protein NR OO2555 O.88 84 l O.OO711 O7 LOC23117. hypothetical gene NR 002603 LOC440345. LOC283846 XM 496.136 LOC44O3S3, hypothetical protein XM 93.1802 LOC613O37. LOC440345 XM 93.1808 LOC728888 nuclear pore complex XM 93.1814 interacting protein XM 93.1818 pseudogene similar to XM 931827 Protein KIAAO220 XM 93.1837 XM 93.1840 XM 933,834 XM 93.3869 XR O15786 XR O15889 212036 s at PNN pinin, desmosome NM 002687 1.34 2.53 up O.OO688 108 associated protein 212550 at STATSB signal transducer and NM 012448 O.66 1.58 up O.OO760 109 activator of transcription 5B 212639 X at TUBA1B tubulin, alpha 1b NM OO6082 O.65 1.56 up O.OO369 110 212680 x at PPP1R14B protein phosphatase 1, NM 138689 0.77 1.71 up O.OOS19 111 regulatory (inhibitor) subunit 14B 212708 at MSL-1 male-specific lethal-1 NM 001012241 O.80 1.74 up O.OO826 112 homolog XM 93.2082 XM 93.2097 XM 93.2107 XM 943.695 XM 94.3702 212974 at DENND3 DENNMADD domain NM O14957 O.91 1.87 up O.OOS64 113 containing 3 213505 s at SFRS14 splicing factor, NM 001017392 0.55 1.46 up O.00998 114 arginine serine-rich 14 NM O14884 213596 at CASP4 caspase 4, apoptosis- NM OO1225 1.OO 2.00 up O.OO996 115 related cysteine NM 033.306 peptidase NM 033307 213646 x at TUBA1B tubulin, alpha 1b NM OO6082 O.63 1.55 up O.OO468 116 214369 S at RASGRP2 RAS guanyl releasing NM 001098670 0.67 1.59 up O.OO703 117 protein 2 (calcium and NM 001098671 DAG-regulated) NM OO5825 NM 153819 21521.0 s at DLSTDLSTP dihydrolipoamide S- NM OO1933 O.48 1.39 up O.OO826 118 Succinyltransferase (E2 component of 2-oxo glutarate complex) dihydrolipoamide S Succinyltransferase pseudogene (E2 US 2011/O 189680 A1 Aug. 4, 2011 20

TABLE 2-continued Differentially expressed probe sets, exhibiting about a 1.39 to 1.4-fold difference (or greater) between AR and NR subject. The target sequence is the portion of the consensus or exemplar sequencer from which the probe sequences were selected (Affymetrix TM NetAffx TM Annotation database Update Release 25, Mar. 2008). The consensus or exemplary sequence is the sequence used at the time of design of the array to represent the transcript that the GeneChip U1332.0 probe set measures. A consensus sequence results from base calling algorithms that align and combine sequence data into groups. An exemplar sequence is a representative cDNA sequence for each (le. log2 Representative Affymetrix RefSeq, (Fold Fold Direction sequence (SEQ Probe Set ID Gene Symbol Gene Title Accession No. Change) Change (AR vs NR) FDR value ID NO:) component of 2-oxo glutarate complex) 215236 s at PICALM phosphatidylinositol NM OO1008660 1.21 2.31 up O.OO869 119 binding clathrin NM 007166 assembly protein 215415 S. at LYST ysosomal trafficking NM OOOO81 O.74 1.67 up O.OO369 120 regulator NM 001005736 215646 s at VCAN versican NM 004385 1.39 2.61 up O.00761 121 215760 S at SBNO2 strawberry notch NM 00110.0122 O.80 1.74 up O.OO339 122 homolog 2 (Drosophila) NM O14963 215832 X at PICALM phosphatidylinositol NM OO1008660 O.71 1.63 up O.OO879 123 binding clathrin NM 007166 assembly protein 215990 S. at BCL6 B-cell CLL/lymphoma 6 NM OO1706 1.64 3.13 up O.00439 124 (Zinc finger protein 51) NM 138931 216236 s at SLC2A14f solute carrier family 2 NM OO6931 O.90 1.86 up O.OO959 125 SLC2A3 (facilitated glucose NM 153449 transporter), member 3 solute carrier family 2 (facilitated glucose transporter), member 14 216950s at FCGR1A Fc fragment of IgG, high NMOOO566 1.44 2.70 l O.OO653 26 affinity Ia, receptor (CD64) 21 6985 S at STX3 Syntaxin 3 NM OO4177 O.92 1.89 l O.OO996 27 217436 X at LOC730399. hypothetical protein XR O15561 O.60 1.51 l O.OO777 28 LOCA31974 LOC73O399 XR O15670 hypothetical protein LOC731974 217475 S. at LIMK2 LIM domain kinase 2 NM OO1031801 O.78 1.71 l O.OO468 29 NM 005569 NM O16733 217507 at SLC11A1 solute carrier family 11 NM 000578 1.09 2.13 l O.OO864 30 (proton-coupled divalent metal ion transporters), member 1 217728 at S100A6 S100 calcium binding NM 014624 O.84 1.79 l O.OO745 31 protein A6 217992 s at EFHD2 EF-hand domain family, NM O24329 0.77 1.70 l O.OO879 32 member D2 218157 X at CDC42SE1 CDC42 Small effector 1 NM OO1038707 0.72 1.65 l O.OO591 33 NM O2O239 218380 at NLRP1 NLR family, pyrin NM OO 1033053 0.75 1.68 l O.OO333 34 domain containing 1 NM O14922 NM 033004 NM 033006 NM 033.007 219100 at OBFC1 oligonucleotidefoligosaccharide- NM 024928 O.69 1.62 l O.00998 35 binding fold containing 1 219183 s at PSCD4 pleckstrin homology, NM 013385 O.80 1.74 l O.OOS/4 36 Sec7 and coiled-coil domains 4 219394 at PGS1 phosphatidylglycerophosphate NM 024419 1.02 2.03 l O.OO293 37 synthase 1 22004.6 s at CCNL1 cyclin L1 NM O2O307 1.OS 2.08 l O.OO919 38 220305 at MGC3260 hypothetical protein NM 024030 0.97 1.96 l O.OO219 39 MGC3260 220326 S. at FLJ10357 hypothetical protein NM 018071 O.91 1.88 l O.OO909 40 FLJ10357 221432 S at SLC25A28 solute carrier family 25, NM 03.1212 O.S6 1.47 l O.OO671 41 member 28 221 695 S at MAP3K2 mitogen-activated NM OO6609 O.89 1.85 l O.OO995 42 protein kinase kinase XM OO1128799 kinase 2 US 2011/O 189680 A1 Aug. 4, 2011 21

TABLE 2-continued Differentially expressed probe sets, exhibiting about a 1.39 to 1.4-fold difference (or greater) between AR and NR subject. The target sequence is the portion of the consensus or exemplar sequencer from which the probe sequences were selected (Affymetrix TM NetAffx TM Annotation database Update Release 25, Mar. 2008). The consensus or exemplary sequence is the sequence used at the time of design of the array to represent the transcript that the GeneChip U1332.0 probe set measures. A consensus sequence results from base calling algorithms that align and combine sequence data into groups. An exemplar sequence is a representative cDNA sequence for each (le. log2 Representative Affymetrix RefSeq, (Fold Fold Direction sequence (SEQ Probe Set ID Gene Symbol Gene Title Accession No. Change) Change (AR vs NR) FDR value ID NO:) 222244 s at TUG1 taurine upregulated gene 1 NR 002323 0.57 148 up O.OO711 143 222435 S. at UBE21 ubiquitin-conjugating NM 016021 0.97 1.96 up O.OO658 144 enzyme E2, J1 (UBC6 homolog, yeast) 222955 S at FAM45A family with sequence NM 018472 O.66 1.58 up O.OO814 145 FAM45B. similarity 45, member B NM 207009 LOCA31832 family with sequence XM OO1130983 similarity 45, member A similar to family with sequence similarity 45, member A 223009 at C11orf59 chromosome 11 open NM O17907 O.63 1.55 up O.OO760 146 reading frame 59 2235.78 x at PRO1073 PRO1073 protein O.84 1.79 up O.OO991 147 223591 at RNF135 ring finger protein 135 NM 032322 0.72 1.64 up O.OO879 148 NM 197939 224254 x at 224254 x at O.88 1.84 up O.00499 149 224,566 at TncRNA trophoblast-derived NR 002802 1.33 2.52 up O.OOS36 150 noncoding RNA 224807 at GRAMD1A GRAM domain NM O2O895 O.74 1.67 up O.OO219 151 containing 1A 224909s at PREX1 phosphatidylinositol NMO2O820 O.94 1.91 up O.OO468 152 3,4,5-trisphosphate dependent RAC exchanger 1 225673 at MYADM myeloid-associated NM 001020818 O.88 1.84 up O.OO749 153 differentiation marker NM 001020819 NM 001020820 NM 001020821 NM 138373 226266 at PGS1 phosphatidylglycerophosphate NM 024419 O.91 1.88 l O.OOSS2 S4 synthase 1 226334 S at AHSA2 AHA1, activator of heat NM 152392 1.01 2.01 l O.OO468 55 shock 90 kDa protein ATPase homolog 2 (yeast) 226872 a RFX2 regulatory factor X, 2 NM OOO635 O.81 .76 l O.OO879 56 (influences HLA class II NM 134433 expression) 227396 a PTPRT protein tyrosine NM 0010985 03 O.86 82 l O.OO814 57 phosphatase, receptor NM 002843 type, J 227490 a WDFY2 WD repeat and FYVE NM 052950 O.S1 43 l O.00342 58 domain containing 2 227510 x at PRO1073 PRO1073 protein 1.16 2.24 l O.OO26S 59 227697 a SOCS3 Suppressor of cytokine NM OO3955 1.12 2.18 l O.OO470 60 signaling 3 228216 a 228216 at Transcribed locus O.91 88 l O.OO982 61 228582 X at 228582 x at Transcribed locus 1.20 2.30 l O.OO591 62 228793 a JMJD1C jumonji domain NM 004241 1.31 2.48 l O.OO870 63 containing 1C NM 032776 229120 S. at CDC42SE1 CDC42 Small effector 1 NM OO1038707 O.92 89 l O.OO362 64 NM O2O239 230735 a. 230735 at Transcribed locus O.93 91 l O.OO652 65 232555 a. 232555 at CDNA FLJ11431 fis, O.89 86 l O.OO362 66 clone HEMBA1001094 233303 a 233303 at Homo sapiens, clone 1.20 2.30 l O.OO872 67 IMAGE:4295366, mRNA 234640 x at 234.640 x at CDNA: FLJ22614 fis, 186 3.64 l O.OO425 68 clone HSIO5089 235167 at DKFZp547E087 hypothetical gene XM 496.136 1.56 2.94 l O.OO326 69 LOC283846 XM 93.1802 XM 93.1808 XM 93.1814 US 2011/O 189680 A1 Aug. 4, 2011 22

TABLE 2-continued Differentially expressed probe sets, exhibiting about a 1.39 to 1.4-fold difference (or greater) between AR and NR subject. The target sequence is the portion of the consensus or exemplar sequencer from which the probe sequences were selected (Affymetrix TM NetAffx TM Annotation database Update Release 25, Mar. 2008). The consensus or exemplary sequence is the sequence used at the time of design of the array to represent the transcript that the GeneChip U1332.0 probe set measures. A consensus sequence results from base calling algorithms that align and combine sequence data into groups. An exemplar sequence is a representative cDNA sequence for each (le. log2 Representative Affymetrix RefSeq, (Fold Fold Direction sequence (SEQ Probe Set ID Gene Symbol Gene Title Accession No. Change) Change (AR vs NR) FDR value ID NO:) XM 93.1818 XM 931827 XM 93.1837 XM 93.1840 236155 at ZCCHC6 Zinc finger, CCHC NM O246.17 1.07 2.10 up O.OO823 170 domain containing 6 236528 at 236528 at Transcribed locus 1.14 2.20 up O.OO677 171 237442 at 237442 at 1.03 2.05 up O.OOS62 172 237544 at 237544 at Transcribed locus 1.07 2.10 up O.OO711 173 238320 at TncRNA trophoblast-derived NR 002802 1.34 2.54 up O.OOO23 174 noncoding RNA 238712 at 238712 at Transcribed locus O.78 1.71 up O.O0917 175 239021 at 239021 at Transcribed locus, 1.19 2.28 up O.OO891 176 moderately similar to XP 530714.1 hypothetical protein XP 530714 Pan troglodytes 240057 at 240057 at Transcribed locus O.S2 1.43 up O.OO703 177 241774 at 241774 at Transcribed locus 1.20 2.29 up O.OO891 178 242907 at 242907 at 1.16 2.23 up O.00494 179 244356 at 244356 at Transcribed locus 1.17 2.25 up O.OO2S4 18O 244556 at LCP2 Lymphocyte cytosolic NM 005565 O.87 1.83 up O.OO777 181 protein 2 (SH2 domain containing leukocyte protein of 76 kDa) 244752 at ZNF438 Zinc finger protein 438 NM 182755 0.67 1.59 up O.OO468 182 37028 at PPP1R15A protein phosphatase 1, NM O14330 O.S2 1.43 up O.OO470 183 regulatory (inhibitor) subunit 15A

The Representative sequence indicated in Table 6 refers to the categories of processes related to immune signal transduc target sequences for the corresponding probe set. The target tion, cytoskeletal reorganization, and apoptosis, and empha sequence comprises a portion of the expressed nucleic acid size the participation of the cytokine-activated Jak-Stat path marker found to be differentially expressed in the AR and NR way, interferon signaling, and lymphocyte activation, Subject samples. A target sequence may be used to obtain a proliferation, chemotaxis and adhesion. sequence of the full gene or expressed nucleic acid markerby, 0155 Upregulation of 4 mammalian Jak family kinases for example, use of a BLAST search at a suitable database, was identified in the rejecting subjects, as well as STAT3, Such as is described herein. STATS and STAT6 in patients with BCAR the Jak tyrosine 0152 Biological Pathways Associated with Genomic kinase-Stat transcription factor pathway is known to be Biomarkers of the Invention involved in immune cell development, proliferation and func 0153. Large scale gene expression analysis methods. Such tion While acute rejection may be classically ascribed to as microarrays have indicated that groups of genes that have cytotoxic T cell mediated events, these data demonstrate that an interaction (often with two or more degrees of separation) Th2/STAT6 processes are also important. Genes involved in are expressed together and may have common regulatory interferon (IFN) signaling are also upregulated in BCAR, elements. Other examples of Such coordinate regulation are including interferon-inducible guanylate-binding protein known in the art, see, for example, the diauxic shift of yeast (GBP), the interferon-response factor 1 (IRF1) and STAT1. (DiRisi et al 1997 Science 278:680-686: Eisen et al. 1998. Two MHC class I genes, HLA-E and HLA-G are known to Proc Natl AcadSci 95:14863-14868). have immunomodulatory functions and are increased in AR 0154 Microarray analysis using peripheral blood samples Subjects. may be used to document the biological processes invoked 0156 T cell activation and proliferation are known to during graft rejection; identification of nucleic acid markers involve actin remodeling. On MHC-peptide/TCR engage of BCAR has also been demonstrated in the preceding ment, the actin cytoskeleton is bundled at the site of engage examples. These markers have been demonstrated to cor ment and is essential to forming the immune synapse; this rectly classify samples with high cross-validation specificity. bundling is known to be mediated by structural proteins like The biological functions of the genes differentially expressed SLP-76, and ADAP, CDC42EP, and the actin bundling pro during rejection (Table 2) encompass three major biological tein LCP-2. The actin cytoskeleton is remodeled to link to the US 2011/O 189680 A1 Aug. 4, 2011

integrin-receptor complex through proteins like talinandpax 0163 A product of the LIMK2 (LIM domain kinase 2) illin. The genes encoding these proteins are upregulated in gene encodes a protein which belongs to the LIM-domain AR subjects. AVIL (Advillin) was one of the most highly containing family of proteins. LIMK2 is involved in regula differentially expressed genes, and codes for known to be a tion of actin cytoskeleton. Nucleotide sequences of human Ca" regulated actin-binding protein and a member of the LIMK2 are known (e.g. NC 000022.9 NT 011520.11). gelsolin/villin family of actin regulatory proteins. 0164. A product of the LMAN2 (lectin, mannose-binding 0157 Apoptotic cell death, another central theme detected 2) gene encodes an intracellular lectin which is known to in this dataset, was represented by caspase 4, presenilin 1, function as a chaperone protein and transmembrane cargo NACHT leucine rich repeat and PYD containing 1 (NLRP1), receptor in the endoplasmic reticulum and golgi apparatus. and tumor necrosis factor receptor 1 (TNF-R1). ANP32A Nucleotide sequences of human LMAN2 are known (e.g. (Acidic nuclearphosphoprotein 32 family, member a), was a X76392). highly differentially expressed nucleic acid marker and this 0.165. A product of the NASP (nuclear autoantigenic gene encodes a protein known to have pro-apoptotic function sperm protein (histone-binding)) gene encodes a protein and as illustrated in this dataset, is linked to acute rejection in which is involved in transporting histones into the nucleus of AR Subjects. The apoptotic signature detected in peripheral dividing cells. Multiple isoforms are encoded by transcript blood samples of AR Subjects may thus represent a combina variants of this genes. The nucleotide sequence of the human tion of T cell activation (TNF-R1 is a T cell co-receptor) and NASP are known (e.g. BC081913, CH474008). activation induced cell death (AICD) of cells which have 0166 A product of the NCOA3 (nuclear receptor coacti transited from the organ. Interestingly, SIGLEC-9 (Sialic vator 3) gene encodes a nuclear receptor coactivator that acid binding Ig-like lectin 9), another of the most highly interacts with nuclear hormone receptors to enhance their differentially-expressed genes, encodes a cell-adhesion mol transcriptional activator functions. Nucleotide sequences of ecule expressed on blood leukocytes which is upregulated the human NCOA3 are known (e.g. AF322224, BC088343, during inflammation and is known to negatively regulate T CH474005). cell and other leukocytes through induction of apoptosis. (0167 A product of the NEDD9 (neural precursor cell 0158. A product of the CAMKK2 (calcium/calmodulin expressed, developmentally down-regulated 9) gene encodes dependent protein kinase kinase 2, beta) gene encodes a pro a docking protein which plays a central coordinating role for tein which belongs to the Serine/Threonine protein kinase tyrosine-kinase-based signaling related to cell adhesion. family, and plays a role in calcium-mediated signaling. Seven Nucleotide sequences of the human NEDD9 are known (e.g. transcript variants encoding six distinct isoforms have been AC167669, AF009366, AK030985, AK033729, AK046357, identified for this gene. CAMKK2 beta is ubiquitously AK054179, AK083374, BB458177, BC004696, BC053713, expressed and known to regulate activation of the transcrip CH466546, CTO25639, D10919). tion factor NfkappaB. Additional splice variants have been 0168 A product of the NFYC (nuclear transcription factor described but their full-length nature has not been deter Y. gamma) gene encodes one subunit of a trimeric complex, mined. The identified isoforms undergo autophosphorylation forming a highly conserved transcription factor that binds and also phosphorylate other kinases. Nucleotide sequences with high specificity to CCAAT motifs in the promoter of human CAMKK2 are known (e.g. GenBank Accession No. regions in a variety of genes. Nucleotide sequences of human AB018081, CH473973). MFYC are known (e.g. BC045364, BC065645, BC155102, 0159. A product of the FKBP1A (FK506 binding protein CR388024, CT027763). 1A, 12 kDa) gene encodes a protein which is a member of the 0169. A product of the PGS1 (phosphatidylglycerophos immunophilin protein family, which play a role in immuno phate synthase 1) gene encodes a protein which is a phos regulation and basic cellular processes involving protein fold phatidyltransferase and participates in metabolic pathways. ing and trafficking. Nucleotide sequences of human FKBP1A Nucleotide sequences of human PGS1 are known (e.g. are known (e.g. AB241120, AB241121, AB241122, AC061992, AK024529, AK225030, AL359590, BC008903, AF483488, AF483489, AI847849, AKO02777, AKO10693, BCO15570, BC025951, BC035662, BC108732, CH471099, AKO19362, AKO85599, AK141261, AK145400, AK145986, CR594.011, CR749720, DQ892813, DQ896059). AK151047, AK154751, AK168333, AK1691.86, AK169242, (0170 A product of the RBMS1 (RNA binding motif, AL928719, BC004671, BG074872, BYO65108, CH466551, single stranded interacting protein 1) gene encodes a protein U65098, U65099, U65100, X60203). which is a member of a small family of proteins which bind 0160 A product of the HLA-G (HLA-G histocompatibil single stranded DNA/RNA. Nucleotide sequences of human ity antigen, class I, G) gene encodes a protein which belongs RBMS1 are known (e.g. AB009975). to the HLA class I heavy chain paralogues and is a het 0171 A product of the SFRS16 (splicing factor, arginine/ erodimer consisting of a heavy chain and a light chain. Nucle serine-rich 16) gene encodes a protein which may participate otide sequences of human HLA-G are known (e.g. in processes such as mRNA processing or RNA splicing. AB088083, AB103589). Nucleotide sequences for human SFRS16 are known (e.g. 0161 A product of the ITGAX (integrin, alphaX (comple ACO1 1489, AF042800, AF042802, AF042803, AF042804, ment component 3 receptor 4 subunit) gene encodes a het AF042805, AF042806, AF042807, AF042808, AF042809, erodimeric integral membrane protein composed of an alpha AF042810, AKO74590, AKO94681, AL080189, AY358944, chain and a beta chain. Nucleotide sequences of human BC013178, BC080554, BC131496, CH471126, CR604154). ITGAX are known (e.g. AC124566, AF21 1864, A1035495, (0172 A product of the SLC6A6 (solute carrier family 8 AI326085, AK089167, AK131133, AK155816, AK170432, (neurotransmitter transporter, taurine) member 6) gene BC042840, BC057200). encodes a protein which may have a role in amino acid trans 0162 A product of the JUNB (jun B proto-oncogene) gene port or neurotransmitter transport. Nucleotide sequences of encodes a. Nucleotide sequences of human JUNB are known human SLC6A6 are known (e.g. NC 006602, (e.g. BC053234, BX548032, EC268690). NW 876271). US 2011/O 189680 A1 Aug. 4, 2011 24

0173 A short noncoding RNA, designated TncRNA (tro 0183 Proteomic Profiling for Diagnosing Allograft phoblast-derived incRNA), originates from the 3-prime end of Rejection NEAT 1 and is expressed exclusively in trophoblasts. 0.184 Proteomic profiling may also be used for diagnosing TncRNA is known to suppress MHC class II expression in allograft rejection. Proteomic profiling may be used alone, or mice through inhibition of CIITApIII activity, and may be a in combination with genomic expression profiling or metabo target for TP53 (p53), Suggesting involvement in apoptosis or lite profiling. cell cycle control Nucleotide sequences of human TncRNA 0185. In some embodiments, the invention provides for a are known (e.g. AF001892, AF001893, AF080092, method of assessing or diagnosing allograft rejection, includ AF508303, AK027191, AP000769, AP000944, CR611820, ing acute kidney allograft rejection in a subject comprising 1) CR618687, U60873). determining the expression profile of one or more than one proteomic markers in a biological sample from the Subject, (0174) A product of the ZNF438 (zinc finger protein 438) the proteomic markers selected from the group comprising a gene encodes a protein which belongs to the family of zinc polypeptide encoded by TTN, KNG1, LBP, VASN, ARNTL2, finger motif containing proteins and may play a role in regu AFM, MSTP9, MST1, PI16, SERPINA5, CFD, USH1C, C2, lation of DNA-dependent transcription of immunoglobulins. MBL2, SERPINA10, C9, LCAT, B2M, SHBG, C1S, UBR4 Nucleotide sequences of human ZNF438 are known (e.g. and F9; 2) comparing the expression profile of the one or AF428258, AF440405, AK057323, AK131357, AK292730, more than one proteomic markers to a non-rejector profile; AL359532, AL591707, AL596113, AL833056, BC101622, and 3) determining whether the expression level of the one or BC104757, CH471072, DQ356011, DQ356012). more than one proteomic markers is increased or decreased (0175. A product of the PRO1073 gene (MALAT1, relative to the control profile, wherein increase or decrease of metastasis associated lung adenocarcinoma transcript 1) the one or more than one proteomic markers is indicative of encodes a protein which may be involved in cell cycle pro the acute rejection status. These markers are described in gression. Nucleotide sequences of human PRO1073 are further detail below. known (e.g. AE017126, NP 875465). 0186 The invention also provides for a method of assess ing or diagnosing allograft rejection, including acute kidney 0176 Probe set 1558448 a at is unannotated in the allograft rejection, in a subject as provided by the present AffymetrixTM NetAffxTM Annotation database, but the target invention comprises 1) measuring the increase or decrease of sequence is part of the IMAGE clone 52 15251, according to one or more than one proteomic markers selected from the NCBI Blast. IMAGE clone 52 15251 is uncharacterized. A group comprising a polypeptide encoded by TTN, KNG 1. nucleotide sequence of IMAGE clone 52 15251 is known (e.g. LBP, VASN, ARNTL2, AFM, MSTP9, MST1, PI16, SER GenBank Accession No. BC0324515.1). PINA5, CFD, USH1C, C2, MBL2, SERPINA10, C9, LCAT, 0177 Probe set 208120 x at is unannotated in the B2M, SHBG, CIS, UBR4, and F9; and 2) determining the AffymetrixTM NetAffxTM Annotation database, but the target rejection status of the subject, wherein the determination of sequence is part of the gene FKSG63, according to NCBI rejection status of the Subject is based on comparison of the Blast. FKSG63 is uncharacterized. A nucleotide sequence of Subject's proteomic marker expression profile to a control FKSG63 is known (e.g. GenBank Accession No. AF338192). proteomic marker expression profile. (0178 Probe set 237442 is unannotated in the Affyme 0187. In some embodiments, the one or more than one trixTM NetAffxTM Annotation database identifies a nucleic proteomic markers are KNG1, AFM, TTN, MSTP9/MST1, acid marker that includes sequences on chromosome 10 and PI16, C2, MBL2, SERPINA10 and UBR4. may be part of the gene APBB1 IP (amyloid beta (A4) pre 0188 A myriad of methods for protein identification and cursor protein-binding family B member 1 interacting pro quantitation are currently available. Such as glycopeptide tein). Nucleotide sequence of APBB1 IP is known (e.g. Gen capture (Zhang et al., 2005. Mol Cell Proteomics 4: 144-155), Bank Accession No. A160287.18). multidimensional protein identification technology (Mud PIT) Washburn et al., 2001 Nature Biotechnology (19:242 (0179 Probe set 240057 at is unannotated in the Affyme 247), and Surface-enhanced laser desorption ionization trixTM NetAffxTM Annotation database, and is part of an EST, (SELDI-TOF) (Hutches et al., 1993. Rapid Commun Mass according to NCBI Blast. Nucleotide sequence of the human Spec 7:576-580). In addition, several isotope labelling meth EST is known (e.g. GenBank Accession No. AP000763.5). ods which allow quantification of multiple protein samples, 0180 Probe set 217436 X at is annotated as coding for a Such as isobaric tags for relative and absolute protein quanti “hypothetical protein' in the AffymetrixTM NetAffxTM Anno fication (iTRAQ) (Ross et al., 2004 Mol Cell Proteomics tation database, but was found to be part of Homo sapiens 3:1154-1169); isotope coded affinity tags (ICAT) (Gygiet al., major histocompatibility complex, class I, G. mRNA (cDNA 1999 Nature Biotechnology 17:994-999), isotope coded pro clone IMAGE:4694038), partial cds in NCBI Blast. Nucle tein labelling (ICPL) (Schmidt et al., 2004. Proteomics 5:4- otide sequences of human HLA-I, G, are known (e.g. Gen 15), and N-terminal isotope tagging (NIT) (Fedjaev et al., Bank Accession No. BC020891.1) 2007 Rapid Commun Mass Spectrom 21:2671-2679; Nam et 0181 FKSG49 is unannotated in the AffymetrixTM al., 2005. J Chromatogr B Analyt Technol Biomed Life Sci. NetAffxTM Annotation database. Nucleotide sequence of the 826:91-107), provide a format suitable for high-throughput human FKSG49 is known (e.g. GenBank Accession No. performance, a trait particularly useful in biomarker screen AC113404.3). ing/identification studies. 0182. While the specific biological roles of FKSG49, 0189 A multiplexed iTRAO methodology was employed FKSG49/LOC730444, and 1558448 a at are as yet for identification of plasma proteomic markers in allograft unknown, their identification and upregulation in AR samples recipients. iTRAQ was first described by Ross et al., 2004 is indicative of their suitability as nucleic acid markers of (Mol Cell Proteomics 3:1154-1169). Briefly, subject plasma acute rejection. samples (control and allograft recipient) were depleted of the US 2011/O 189680 A1 Aug. 4, 2011

14 most abundant proteins and quantitatively analyzed by (e.g. GenPept Accession Nos. NP 004130.2, AAC39547.1, iTRAQ-MALDI-TOF/TOF, resulting in the identification of AAD21962.1, AAA59493.1, ABM853.60.1, P18428.3, 460 protein group codes in at least one BCAR positive and Q8TCFO). BCAR negative sample. 144 protein group codes were 0.197 A polypeptide encoded by VASN (vasorin) is a detected in at least 8 out of 11 BCAR positive samples, and in TGF-beta binding protein found in vascular smooth muscle at least 14 of 21 controls. Table 7 presents the 18 significant cells. Nucleotide sequences encoding VASN are known (e.g. protein group codes identified. GenBank Accession Nos. NM 138440.2, CH471112.2, 0190. Thus, while a single candidate biomarkers may not AY166584.1). Amino acid sequences for VASN are known clearly differentiate AR and NR subjects, together, a set of (e.g. GenPept Accession Nos. NP 612449.2, EAW85311.1, proteomic markers comprising KNG1, AFM, TTN, MSTP9/ Q6EMK4.1, AAO27704.1). MST1, PI16, C2, MBL2, SERPINA10 and UBR4 achieved a 0198 A polypeptide encoded by ARNTL2 (arylhydrocar satisfactory classification (63% sensitivity and 86% specific bon receptor nuclear translocator-like-2, BMAL2, MOP9) is ity). As described below and in the accompanying examples, a member of the basic helix-loop-helix family of transcription amino acids sequences of the isoforms of the proteomic factors, which may have roles in various physiological pro markers identified as members of the protein group codes are cesses including circadian rhythms. Nucleotide sequences known, and may be specifically identified by the accession encoding ARNTL2 are known (e.g. GenBank Accession Nos. numbers described herein (e.g. GenBank, GenPept, IPI or the NM 020183.3, AC068794.25, AB03992.1). Amino acid like). sequences for ARNTL2 are known (e.g. GenPept Accession 0191) While iTRAQ was one exemplary method used to Nos. NP 064568.3, Q8WYA1.2, BAB01485.4). detect the peptides, other methods described herein, for (0199. A polypeptide encoded by AFM (afamin, ALB2, example immunological based methods such as ELISA may ALBA, ALF, MGC125338, MGC125339, AFM) is a serum also be useful. Alternately, specific antibodies may be raised transport protein of the albumin gene family. Nucleotide against the one or more proteins, isoforms, precursors, sequences encoding AFM are known (e.g. GenBank Acces polypeptides, peptides, or portions or fragments thereof, and sion Nos. NM 001133.2, AC108157.3, AK290556.1). the specific antibody used to detect the presence of the one or Amino acid sequences for AFM are known (e.g. GenPept more proteomic marker in the sample. Methods of selecting Accession Nos. NP 001124.1, BAF83245.1, P43652.1, Suitable peptides, immunizing animals (e.g. mice, rabbits or Q4W5C5). the like) for the production of antisera and/or production and (0200. A polypeptide encoded by MSTP9 is a putative screening of hybridomas for production of monoclonal anti macrophage-stimulating protein (brain rescue factor 1), and a bodies are known in the art, and described in the references homolog of hepatocyte growth factor-like protein. Nucle disclosed herein. otide sequences encoding MSTP9 are known (e.g. GenBank (0192 Proteomic Expression Profiling Markers (“Pro Accession Nos. AF083416.1, AF 116647.1, AY192149.1, teomic Markers') U28055.1). Amino acid sequences for MSTP9 are known 0.193) One or more precursors, splice variants, isoforms (e.g. GenPept Accession Nos. Q2TV78.2, AAP20103.12. may be encoded by a single gene Examples of genes and the AAC35412.1). isoforms, precursors and variants encoded are provided in 0201 A polypeptide encoded by MST 1 (macrophage Table 7, under the respective Protein Group Code (PGC). stimulating 1, MSP, HGFL, NF15S2, D3F15S2) may have a 0.194. A polypeptide encoded by TTN (Titin, Connectin, role in inflammatory bowel disease. Nucleotide sequences TMD, CMH9, CMD1G, CMPD4, EOMFC, HMERF, encoding MST1 are known (e.g. GenBank Accession Nos. LGMD2J, FLJ26020, FLJ26409, FLJ32040, FLJ34413, NM020998.3, AC099668.2, AK222893.1, M74178.1). FLJ39564, FLJ43066, DKFZp451N061) is a muscle protein Amino acid sequences for MST1 are known (e.g. GenPept expressed in regions of cardiac and skeletal muscle. Nucle Accession Nos. NP 066278.3, P26928.2, Q13208, Q49A61, otide sequences encoding TTN are known (e.g. GenBank Q53GN8, BAD96613.1, AAA50165.1). Accession Nos. AC009948.3, AF321609.2, NM 133437.2, 0202 A polypeptide encoded by PI16 (Peptidase inhibitor NM 133432.2, NM 003319.3, NM 133378.3, 16, PSPBP, CRISP9, MSMBBP, MGC45378, NM133379.2.). Amino acid sequences for TTN are known DKFZp586B1817) is a blood protein that may interact with (e.g. GenPept Accession Nos. NP 597676.2, NP 596870.2, prostate secretory proteins. Nucleotide sequences encoding NP 597681.2NP 003310.3, NP 596869.3, Q4ZG20, PI16 are known (e.g. GenBankAccession Nos. NM 153370. Q8 WZ50, Q6ZP81, Q8WZ42.2). 2, AL122034.29, AK075470.1, AK124589.1, AK302193.1, 0.195 A polypeptide encoded by KNG 1 (Kininogen 1, AK312785.1, BC022399.1). Amino acid sequences for PI16 BDK) may have a role in assembly of plasma kallikrein, and are known (e.g. GenPept Accession Nos. NP 6992.01.2, has high and low molecular weight isoforms, generated by Q6UXB8.1, BAC11640.1, BAG35648.1, AAH22399.2). alternate splicing. Nucleotide sequences encoding KNG1 are (0203 A polypeptide encoded by SERPINA5 (serpin pep known (e.g. GenBank Accession Nos. NM 000893.2, tidase inhibitor, clade A member 5, PAI3, PCI, PROCI, pro NM001102416.1, AC1097807, AI133186.1, BC060039.1). tein C inhibitor) is a plasma protein inhibitor of activated Amino acid sequences for KNG1 are known (e.g. GenPept protein C. Nucleotide sequences encoding SERPINA5 are Accession Nos. NP 000884.1, NP 001095886.1, known (e.g. GenBank Accession Nos. NM 000624.4, AAH600396.1, P01042.2, Q05CF8). AF361796.1, AK0961311, BC018915.2, U35464.1). Amino 0196. A polypeptide encoded by LBP (lipopolysaccharide acid sequences for SERPINA5 are known (e.g. GenPept binding protein) may have a role in an acute-phase immuno Accession Nos. NP 000615.3, P051542AAB60386.1, logic response to a bacterial infection. Nucleotide sequences AAHO8915.1, BAG53218.1). encoding LBP are known (e.g. GenBank Accession Nos. 0204. A polypeptide encoded by CFD (complement factor NM 004139.2, AF013512.1, AF106067/1, M35533.1, D. adipsin) is a member of the trypsin factor of peptidases. DQ891394.2). Amino acid sequences for LBP are known Nucleotide sequences encoding CFD are known (e.g. Gen US 2011/O 189680 A1 Aug. 4, 2011 26

Bank Accession Nos. NM 001928.2, AC112706.2, 1, NM 001040.2). Amino acid sequences for SHBG are AJ313463.1, BC034529.1, BC057807.1, M84526.1). Amino known (e.g. GenPept Accession No. P04728.2, CAA34400. acid sequences for CFD are known (e.g. GenPept Accession 1, NPO01031.2). 0212 A polypeptide encoded by C1S (complement com Nos. NP 001919.2, P00746.5, Q6FHW3, AAA35527.1, ponent 1, SSubcomponent) is a serine protease and a compo AAH570807.1, CAC483.04.1). nent of the human complement C1. Nucleotide sequences 0205. A polypeptide encoded by USH1C is a scaffold encoding C1S are known (e.g. GenBank Accession Nos. protein that functions in the assembly of Usher protein com NM 001734.3, NM 201442.2, AB009076.1, AKO25309.1, plexes. Nucleotide sequences encoding USH1C are known J04080.1, M18767.1). Amino acid sequences for C1S are (e.g. GenBank Accession Nos. NM 005709.3, known (e.g. GenPept Accession Nos. NP 001725.1, NM 153676.3, kAC124799.5, AB006955.1, AF039699.1, NP 958850.1, BAA86864.1, AAA51852.1, AAA51853.1). AK000936.1, BK000147.1). Amino acid sequences for 0213 A polypeptide encoded by UBR4 (ubiquitin protein USH1C are known (e.g. GenPept Accession Nos. ligase D3 component n-recognin 4, p.600; ZUBR1; NP 005700.2, NP 710142.1, AAC18049.1, BAG62565.1, RBAF600; FLJ41863; KIAAO462; KIAA1307; RP5 DAA00086.1, Q7RTU8, Q9H758, Q9Y6N9.3). 1126H10.1) may have a role in regulation of anchorage 0206. A polypeptide encoded by C2 (complement compo independent growth associated with some oncogenic viruses. nent 2, CO2, DKFZp779M0311) is a serum glycoprotein Nucleotide sequences encoding UBR4 are known (e.g. Gen Bank Accession Nos. NM 020765.2, AL137127.7, having a role in the classical complement pathway. Nucle AA748129.1, AB007931.1, BC096758.1). Amino acid otide sequences encoding C2 are known (e.g. GenBank sequences for UBR4 are known (e.g. GenPept Accession Accession Nos. NM 000063.4, NM 001145.903.1, Nos. NP 065816.2, CAI19268.1, BAA323.07.1, AF0194 13.1, AK096258.1, BC0297811, BX537504.1, AAH96758.1, Q5T4S7.1, Q6ZUC7, Q96HY5). M26301.1, X04481.1). Amino acid sequences for C2 are 0214) A polypeptide encoded by F9 (coagulation factor known (e.g. GenPept Accession Nos. NP 000054.2, XI) is a vitamin K-dependent coagulation factor found in the NP 001139375.1, AAA35604.1, CAA28169.1, blood as an active Zymogen. Nucleotide sequences encoding CAD97767.1). F9 are known (e.g. GenBank Accession Nos. NM 000133.3, 0207. A polypeptide encoded by MBL2 (mannose binding A01819.1, AB186358.1, A13997.1, M11390.1). Amino acid lectin 2, MBL, MBP. MBP1, COLEC1, HSMBPC, sequences for F9 are known (e.g. GenPept Accession Nos. MGC1 16832, MGC116833) is a soluble mannose-binding NP 1000124.1, CAA00205.1, BAD89383.1, P0074.0.2, lectin found in serum. Nucleotide sequences encoding MBL2 Q14316, CAA01140.1, AAA52023.1). are known (e.g. GenBank Accession Nos. NM 000242.2, 0215 Table 7 and the IPI accession numbers provided AB025350.1, AF360991.1, BC0961812). Amino acid therein further indicate database records where the amino sequences for MBL2 are known (e.g. GenPept Accession acid sequence information of specific isoforms of the indi Nos. NP 000233.1, BAB17020.1, AAK52907.1, cated protein group code members may be obtained. AAH961823, P11226.2, Q5SQS3, Q9HCS8). 0216) Interpretation of the large body of expression data 0208. A polypeptide encoded by SERPINA10 (serpin obtained from, for example, iTRAO protein or proteomic peptidase inhibitor clade A ember 10, ZPI, PDI) is a serpin experiments, but is greatly facilitated through use of algo that inhibits the activated coagulation factors X and XI. rithms and Statistical tools designed to organize the data in a Nucleotide sequences encoding SERPINA10 are known (e.g. way that highlights systematic features. Visualization tools GenBank Accession Nos. NM 001100607.1, NM 016186. are also of value to represent differential expression by, for 2, CH471061.1, AF181467.1, BC022261.1, CR606434.1). example, varying intensity and hue of colour. The algorithm Amino acid sequences for SERPINA10 are known (e.g. Gen and Statistical tools available have increased in Sophistication Pept Accession Nos. NP 001094077.1, NP 057270.1, with the increase in complexity of arrays and the resulting EAW81564.1, AAD53962.1, CAD62339.1, Q9UK55.1). datasets, and with the increase in processing speed, computer 0209. A polypeptide encoded by LCAT (lecithin-choles memory, and the relative decrease in cost of these. terol acetyltransferase) is an extracellular cholesterol esteri 0217 Mathematical and statistical analysis of protein or fying enzyme, affecting cholesterol transport. Nucleotide polypeptide expression profiles may accomplish several sequences encoding LCAT are known (e.g. GenBank Acces things—identification of groups of genes that demonstrate sion Nos. NM 000229.1, AC040162.5, BC01478.1.1, coordinate regulation in a pathway or a domain of a biological X06537.1). Amino acid sequences for LCAT are known (e.g. system, identification of similarities and differences between GenPept Accession Nos. NP 000299.1, P04180.1, two or more biological samples, identification of features of a Q53XQ3, Q9Y5N3, AAH1478.1.1, CAB56610.1). gene expression profile that differentiate between specific events or processes in a Subject, or the like. This may include 0210 A polypeptide encoded by B2M (Beta-2-Microglo assessing the efficacy of a therapeutic regimen or a change in bulin) is a serum protein found in association with the major a therapeutic regimen, monitoring or detecting the develop histocompatibility complex (MHC) class 1 heavy chain on ment of a particular pathology, differentiating between two the Surface of most nucleated cells. Nucleotide sequences otherwise clinically similar (or almost identical) pathologies, encoding B2M are known (e.g. GenBank Accession No. or the like. NM 004.048, BU658737.1, BC032589.1 and AI6869 16.1). 0218 Methods for selecting and manufacturing such anti Amino acid sequences for B2M are known (e.g. GenPept bodies, as well as their inclusion on a chip or an array, or in Accession No. P61769, AAA51811, CAA23830). an assay, and methods of using Such chips, arrays or assays 0211 A polypeptide encoded by SHBG (Sex-hormone are referenced or described herein. binding globulin, androgen-binding protein, ABP testoster one-binding beta-globulin, TEBG) is a plasma glycoprotein Other Embodiments that binds sex steroids. Nucleotide sequences encoding 0219. Nucleic acid profiling may also be used in combi SHBG are known (e.g. GenBank Accession No. AK302603. nation with metabolite (“metabolomics’) or proteomic pro US 2011/O 189680 A1 Aug. 4, 2011 27 filing. Minor alterations in a Subject's genome, such as a example, Handbook of Pharmaceutical Biotechnology, (ed. S single nucleotide change or polymorphism, or expression of C Gad) John Wiley & Sons, Inc., Hoboken, N.J., (2007), the genome (e.g. differential gene expression) may result in Chromatographic Methods in Clinical Chemistry and Toxi rapid response in the Subject's Small molecule metabolite cology (RBertholf and R. Winecker, eds.) John Wiley & Sons, profile. Small molecule metabolites may also be rapidly Inc., Hoboken, N.J., (2007), Basic One-and Two-Dimen responsive to environmental alterations, with significant sional NMR Spectroscopy by H., Friebolin. Wiley-VCH 4' metabolite changes becoming evident within seconds to min Edition (2005). utes of the environmental alteration—in contrast, protein or 0223) Access to the methods of the invention may be pro gene expression alterations may take hours or days to become vided to an end userby, for example, a clinical laboratory or evident. The list of clinical variables includes, for example, other testing facility performing the individual marker tests— cholesterol, homocysteine, glucose, uric acid, malondialde the biological samples are provided to the facility where the hyde and ketone bodies. Other non-limiting examples of individual tests and analyses are performed and the predictive small molecule metabolites are listed in Table 3. method applied; alternately, a medical practitioner may receive the marker values from a clinical laboratory and use a TABLE 3 local implementation or an internet-based implementation to access the predictive methods of the invention. Metabolites identified and quantified in NMR spectra of serum samples 0224 Kits obtained from subject population. 0225. The invention also provides for a kit for use in Compound Name assessing or diagnosing a Subject's rejection status. The kit Glucose Lactate may comprise reagents for specific and quantitative detection Glutamine Alanine of one or more nucleic acid markers, selected from the group Glycine Proline comprising TncRNA, FKSG49, ZNF438, SFRS16, Glycerol Valine 1558448 a at, CAMKK2, NFYC, NCOA3, LMAN2, PGS1, Taurine Lysine Citrate Serine NEDD9, 237442 at, FKSG49/LOC730444, LIMK2, UNB, Leucine Ornithine NASP, PRO1073, 240057 at, ITGAX, LOC730399/ Creatinine Tyrosine LOC731974, FKBP1A, HLA-G, RBMS1 and SLC6A6, Phenylalanine Pyruvate along with instructions for the use of such reagents and meth Histidine Carnitine Glutamate Acetate ods for analyzing the resulting data. In some embodiments, Isoleucine Asparagine the nucleic acid markers are TncRNA, FKSG49, ZNF438, Betaine 3-Hydroxybutyrate 1558448 a at, CAMKK2, LMAN2, 237442 at, FKSG49/ Creatine Propylene glycol LOC730444, JUNB, PRO1073 and ITGAX. The kit may be 2-Hydroxybutyrate Formate Methionine Choline used alone for predicting or diagnosing a subject's rejection Acetone status, or it may be used in conjunction with other methods for determining clinical variables, or other assays that may be deemed appropriate. The kit may include, for example, a 0220 Various techniques and methods may be used for labelled oligonucleotide capable of selectively hybridizing to obtaining a metabolite profile of a subject. The particulars of the marker. The kit may further include, for example, an sample preparation may vary with the method used, and also oligonucleotide operable to amplify a region of the marker on the metabolites of interest for example, to obtain a (e.g. by PCR). Instructions or other information useful to metabolite profile of amino acids and Small, generally water combine the kit results with those of other assays to provide a soluble molecules in the sample may involve filtration of the non-rejection cutoff index for the prediction or diagnosis of a sample with a low molecular weight cutoff of 2-10 kDa, while Subject's rejection status may also be provided. obtaining a metabolite profile of lipids, fatty acids and other 0226. The invention also provides for a nucleic acid array. generally poorly-water Soluble molecules may involve one or The array may be a two-dimensional array, and may contain more steps of extraction with an organic solvent and/or drying at least 10 different nucleic acid molecules (e.g., at least 20, at and resolubilization of the residues. While some exemplary least 30, at least 50, at least 100, or at least 200 different methods of detecting and/or quantifying markers have been nucleic acid molecules). Each nucleic acid molecule may indicated herein, others will be known to those skilled in the have any length sufficient to specifically identify a nucleic art and readily usable in the methods and uses described in acid marker by hybridization. For example, each nucleic acid this application. molecule may be between 10 and 250 nucleotides (e.g., 0221) Some examples oftechniques and methods that may between 12 and 200, 14 and 175, 15 and 150, 16 and 125, 18 be used (either singly or in combination) to obtain a metabo and 100, 20 and 75, or 25 and 50 nucleotides, or any amount lite profile of a subject include, but are not limited to, nuclear therebetween) in length. For example, the nucleic acid mol magnetic resonance (NMR), gas chromatography (GC), gas ecules of the arrays provided herein may comprise sequences chromatography in combination with mass spectroscopy that hybridize with and specifically identify one or more than (GC-MS), mass spectroscopy, Fourier transform MS (FT one of the nucleic acid markers presented in Table 2. MS), high performance liquid chromatography or the like. Examples of such sequences include SEQID NO: 1-183. Exemplary methods for sample preparation and techniques 0227. The invention also provides for a kit for use in for obtaining a metabolite profile may be found at, for assessing or diagnosing a Subject's rejection status. The kit example, the Human Metabolome Project website (Wishart D may comprise reagents for specific and quantitative detection Set al., 2007. Nucleic Acids Research 35:D521-6). of one or more than one proteomic markers selected from the 0222 Standard reference works setting forth the general group comprising TTN, KNG1, LBP, VASN, ARNTL2, principles of Such methods useful in metabolite profiling as AFM, MSTP9, MST1, PI16, SERPINA5, CFD, USH1C, C2, would be known to those of skill in the art include, for MBL2, SERPINA10, C9, LCAT, B2M, SHBG, C1S, UBR4 US 2011/O 189680 A1 Aug. 4, 2011 28 and F9, along with instructions for the use of Such reagents municate with a computer system. Alternatively, Such instruc and methods for analyzing the resulting data. In some tions can be implemented in assembly or machine language. embodiments, the one or more than one proteomic markers The language further can be compiled or interpreted lan are KNG1, AFM, TTN, MSTP9, MST1, PI16, C2, MBL2, gllage. SERPINA10, F9 and UBR4. For example, the kit may com 0229. The nucleic acid detection signals can be obtained prise antibodies or fragments thereof, specific for the pro using an apparatus (e.g., a chip or an array reader) and a teomic markers (primary antibodies), along with one or more determination of tissue rejection can be generated using a secondary antibodies that may incorporate a detectable label; separate processor (e.g., a computer). Alternatively, a single Such antibodies may be used in an assay Such as an ELISA. apparatus having a programmable processor may combine Alternately, the antibodies or fragments thereof may be fixed these and/or other functions and obtain the detection signals to a solid Surface, e.g. an antibody array. The kit may be used and process the signals to generate a determination of the alone for predicting or diagnosing a Subject's rejection status, rejection status of the Subject. The processing step may be or it may be used in conjunction with other methods for performed simultaneously with the step of collecting the determining clinical variables, or other assays that may be detection signals (e.g., “real-time'). deemed appropriate. Instructions or other information useful 0230 Methods for selecting and manufacturing such anti to combine the kit results with those of other assays to provide bodies, as well as their inclusion on a chip or an array, or in a non-rejection cutoff index for the prediction or diagnosis of an assay, and methods of using Such chips, arrays or assays a subject's rejection status may also be provided. are referenced or described herein. 0228. The invention also provides for computer-readable 0231. Methods storage medium configured with instructions for causing a programmable processor to determine whether an allograft is Subjects and Specimens being rejected. Methods for determining whetheran allograft 0232 All subjects in this study received a renal transplant is being rejected (rejection status of the Subject) are described between 2005 and 2007 at St. Paul's Hospital or Vancouver herein, and the processor comprises instructions to receive a General Hospital, Vancouver, UBC, Canada, and appropriate signal (e.g. light emission, a change in intensity or frequence consent was obtained. Immunosuppression was mainly based of fluorescence, or the like, representative of the relative on Mycophenolate Mofetil (MMF) in combination with Tac quantity of the nucleic acid or proteomic marker present in the rolimus and/or Prednisolone. Age, gender, ethnicity and pri sample) and assess the level of a nucleic acid or proteomic mary disease of the Subjects are Summarized in Table 4. marker relative to a control and determine if the level is below. Whole blood was drawn using PAXgeneTM tubes pre increased or decreased. The processor may be further pro transplant (baseline) and post-transplant at 0.5, 1, 2, 3, 4, 8, vided with instructions to interpret the pattern of increase 12, and 26 weeks, every 6 months through year 3, and at the and/or decrease of the indicated nucleic acid or proteomic time of suspected rejection. Urine samples were obtained for marker, and provide information to a user (for example a the same time points. PAXgeneTM whole blood samples were physician) on the rejection status of the Subject. Instruction also taken from a cohort of control Subjects with no disease and information for removal of baseline noise or other aber using representative ages and sexes from the transplant rant signals from the detected signals may also be included. patients. All samples were stored at -80°C. until selection for The instructions may be provided on a computer-readable analysis. 33 subjects were included in the genomic marker storage medium and may be implemented in a high level study, and 32 of these 33 were included in the proteomic procedural or objectoriented programming language to com marker study.

TABLE 4 Kidney transplant subject demographics. Subjects Subjects with AR without AR (n = 11) (n = 22) Mean Age (standard deviation) 41.85 (11.98) 48.97 (10.57) Gender (n, % male) 8 (72.73%) 14 (63.64%) Ethnicity (n, %) Caucasian 9 (81.82%) 15 (68.18%) North American Indian 1 (9.09%) 2 (9.09%) Asian 0 (0%) 2 (9.09%) Indian Sub-continent 1 (9.09%) 2 (9.09%) Other 0 (0%) 1 (4.55%) Primary Disease (n, %) Chronic renal failure, aetiology uncertain 4 (36.36%) 2 (9.09%) Cortical or tubular necrosis 1 (9.09%) 1 (4.55%) Diabetic nephropathy associated with Type II 1 (9.09%) 1 (4.55%) Focal glomerulosclerosis - adults 3 (27.27%) 4 (18.18%) Polycystic kidneys, adult type (dominant) 0 (0%) 5 (22.73%) IgA Nephropathy (proven by immunofluorescence) 2 (18.18%) 1 (4.55%) Other 0 (0%) 8 36.36%) US 2011/O 189680 A1 Aug. 4, 2011 29

TABLE 4-continued Kidney transplant subject demographics. Subjects Subjects with AR withoutAR (n = 11) (n = 22) Donor Living 3 (27.3%) 8 (38.1%) Deceased 8 (72.7%) 13 (61-9%)

0233 All kidney transplant subject clinical data was tacrolimus 0.075 mg/kg b.i.d and mycophenolate 1000 mg reviewed. Samples were selected from subjects with acute b.i.d. Drug concentrations were measured by tandem mass rejection, borderline rejection or no rejection who had no spectrometry; the tacrolimus dose was adjusted to achieve significant co-morbidities (infections, disease recurrence, or 12-hour trough levels of 8-12 ng/mL for the first month post other co-morbid events). To ensure homogeneous phenotypes transplant, 6-9 ng/ml for the second month, then 4-8 ng/ml and to minimize biological variability for this analysis, thereafter. First graft and non-sensitized subjects received patients were considered eligible if they were less than 75 methylprednisolone 125 mg iv on the day of transplantation, years of age; were not receiving immunosuppression prior to and oral prednisone of 1 mg/kg on day 1, declining to Zero by transplantation; had not received pre-transplant immunologi day 3 post-transplant. For recipients of a second or Subse cal desensitization; had received a kidney transplant from a quent graft, the prednisone dose was reduced slowly and in a deceased or non-HLA-identical living donor, had a negative stepwise fashion to a maintenance dose of 10 mg on alternate AHG-CDC anti-donor T-cell cross-match; had not received days after three months. Rejection episodes were treated with depleting antibody induction therapy with ATG or OKT3: methylprednisolone 500 mg i.v. daily for 3-5 days. Steroid were able to receive oral medication, had immediate graft resistant rejections were treated with OKT35 mg i.v. or ALG function, and had no clinical or laboratory evidence of infec 15 mg/kg i.v. daily for 7-10 days. tions, disease recurrence, and other major co-morbid events. 0236 Plasma collection and depletion: Whole blood Biopsies were diagnosed and recorded using the Banff crite samples from transplant recipients, taken at the scheduled ria (Solez et al 2008 Am J Transplant 8: 753: Table 1). The time-points and at the time of Suspected rejection, and similar cohort for this study consisted of 11 acute rejection (AR) blood samples from normal disease-free controls of compa subjects within the first week, and 22 non-rejection (NR) rable ages and sexes, were drawn into EDTA tubes, stored on subjects within the first week (biopsy-confirmed acute rejec ice before processing. Plasma was separated and stored at tion, BCAR). For all NR subjects data was available at weeks -80°C. within2 hours then transferred to liquid nitrogen until 1, 2, 3, 4 and baseline (BL). One AR subject did not have a selected for analysis. Plasma samples were then thawed to baseline sample, and three Subjects did not have a week 1, room temperature, diluted 5 times with 10 mM phosphate week 2 and week 4 sample, respectively. Several subjects had buffered saline (PBS) at pH 7.6, and filtered with spin-X data for additional time points at weeks 8 and 12. Two AR centrifuge tube filters. Diluted plasma was injected via a 325 patients had their rejection at day 3. For the analysis, these LL sample loop onto a 5 mL avian antibody affinity column rejections were considered in the week 1 group. 20 normal (Genway Biotech: San Diego, Calif.) capable of removing the samples from 20 healthy individuals are included to calculate 14 most abundant plasma proteins: HAS, IgG, fibrinogen, results relative-to-normal. Thus, the analysis includes transferring, IgA, IgM, haptoglobin, C.2-macroglobulin, samples from 53 individuals, 33 of which were patients who C.1-acid glycoprotein, C.1-antitrypsin, Apoliprotein-I. Apo provided samples at different time points during the 3-month liprotein-II, Complement C3 and low density lipoproteins post-transplant period (mainly Apoliprotein B). Flow-through fractions were col 0234. The study employed a closed cohort case-control lected and precipitated by adding TCA to a final concentra design to compare differential gene expression in Subjects tion of 10% and incubated at 4° C. for 16-18 hours. The with or without BCAR during the first 3 months post-trans protein precipitate was recovered by centrifugation at 3200 g plant. Patients with BCAR (cases) diagnosed during the first at 4°C. for 1 hour, washed three times with ice cold acetone 12 weeks post-transplant were matched 1:2 with those who (EMD; Gibbstown, N.J.) and re-hydrated with 200-300 uL did not have evidence of clinical or BCAR (controls) during iTRAQ buffer consisting of 45:45:10 saturated urea (J. T. the same period of observation. All rejection episodes were Baker; Phillipsburg, N.J.), 0.05 MTEAB buffer (Sigma-Al diagnosed by conventional clinical and laboratory param drich: St Louis, Mo.), and 0.2% SDS (Sigma-Aldrich; St eters, were confirmed by biopsy, and graded according to the Louis, Mo.). Each sample was then stored at -80°C. Banff criteria for working classification of renal allograft pathology. Banff categories 2 and 4 (antibody-mediated or RNA Extraction and Microarray Analysis acute/active cellular rejection) were considered significant. 0237 RNA extraction was performed on thawed samples Subjects with borderline changes (Category 3) were analyzed using the PAXgeneTM Blood RNA Kit Cat #762134 to iso separately. All baseline demographic and follow-up data were late total RNA. Between 4 and 10 ug of RNA was routinely recorded in the transplant program electronic database and isolated from 2.5 ml whole blood and the RNA quality con there was no loss to follow-up during the period of study. firmed using the Agilent BioAnalyzer. Samples with 1.5ug of 0235 Immunosuppression: Immunosuppression con RNA, an RIN (RNA integrity number) >5, and A240/ sisted of basiliximab at 20 mg i.v. on days 0 and 4, with A280>1.9 were packaged on dry ice and shipped by overnight US 2011/O 189680 A1 Aug. 4, 2011 30 courier to the Microarray Core (MAC) Laboratory, Chil 0241 Reduced and blocked samples were then digested dren's Hospital, Los Angeles, Calif. for Affymetrix microar with sequencing grade modified trypsin (Promega; Madison, ray analysis. The microarray analysis was performed by a Wis.) and incubated at 37° C. for 16-18 hours. Trypsin single technician at the CAP/CLIA accredited MAC labora digested peptide samples were then dried in a speed vacuum tory. Nascent RNA was used for double stranded cDNA syn (Thermo Savant; Holbrook, N.Y.) and labeled with iTRAQ thesis. The cDNA was then labeled using the Affymetrix reagent according to the manufacturer's protocol (Applied cDNA Synthesis Kit (Affymetrix Inc., Santa Clara, Calif.), Biosystems; Foster City, Calif.). Labeled samples were fragmented, mixed with hybridization cocktail and hybrid pooled and acidified to pH 2.5-3.0 with concentrated phos ized onto GeneChip Human Genome U133 Plus 2.0 Arrays. phoric acid (ACP Chemicals Inc.; Montreal, QC, Canada). The arrays were scanned with the Affymetrix System in 0242 2D-LC Chromatography: iTRAQ labeled peptides batches of 48 with an internal RNA control made from pooled were separated by strong cation exchange chromatography normal whole blood. Microarrays were checked for quality (SCX) using a 4.6 mm internal diameter (ID) and 100 mm in issues using Affymetrix version 1.16.0 and affyPLM version length polysulphoethyl A column packed with 5 um beads 1.14.0 BioConductor packages (Bolstad, B., Low Level with 300 A pores (PolyLC Inc., Columbia, Md. USA) on a Analysis of High-density Oligonucleotide Array Data. Back VISION workstation (Applied Biosystems; Foster City, ground, Normalization and Summarization. 2004, University Calif.). Mobile phases used were Buffer A composed of 10 of California, Berkeley; Irizarry et al. 2003. Biostatistics 4(2): mM monobasic potassium phosphate (Sigma-Aldrich; St 249-64). The arrays with lower quality were repeated with a Louis, Mo.) and 25% acetonitrile (EMD Chemicals; Gibb different RNA aliquot from the same time point. The Affyme stown, N.J.) pH 2.7, and Buffer B that was the same as A trixTM NetAffxTM Annotation database Update Release 25 except for the addition of 0.5 M potassium chloride (Sigma (March 2008) was used for identification and analysis of Aldrich St Louis, Mo., USA). Fractions of 500 uL were microarray results. collected over an 80 minute gradient divided into two linear profiles: 1) 0-30 min with 5% to 35% of Buffer B, and 2) Gene Expression Analysis 30-80 min with 35% to 100% of Buffer B. The 20 to 30 0238. The microarray analysis produced one Cel file per fractions with the most peptides detected by UV trace were sample with 54,000 probe sets that analyzes over 47,000 selected and their volumes were reduced to 150 uL in prepa transcripts and variants from over 38,500 well-substantiated ration for nano reverse phase chromatography. Peptides were human genes. All Cel files were pre-processed before the final desalted by loading fractions onto a C18 PepMap guard col analysis. The pre-processing steps were: (1) quality control of umn (300 um IDx5 mm, 5um, 100A, LC Packings, Amster gene chip results, (2) adjustment of background intensities, dam) and washing for 15 min at 50LL/min with mobile phase (3) normalization of all data together, (4) Summarization of A consisting of waterfacetonitrile/TFA 98:2:0.1 (v/v). The probe-level data into probe-set intensity values, and (5) fil trapping column was then Switched into the nano flow stream tering of probe-sets to removed probe-sets that did not show at 200 mL/min where peptides were loaded onto a Magic C18 a high enough intensity across samples. nano LC column (15 cm, 5um pore size, 100 A, Michrom 0239 Quality control was performed using issues using Bioresources Inc., Auburn Calif., USA) for high resolution Affy version 1.16.0 and affyPLM version 1.14.0 BioConduc chromatography. Peptides were eluted by the following gra tor packages. Samples with low quality were repeated. Cel dient: 0–45 min with 5% to 15% B (acetonitrile/water/TFA files were RMA normalized (Bolstad, et al. Bioinformatics, 98:2:0.1, v/v): 45-100 min with 15% to 40% B, and 100-105 2003. 19(2): p. 185-93) and log 2-transformed with the Affy min with 40% to 75% B. The eluent was spotted directly onto BioConductor package version 1.16.0 (Bolstad, 2004, supra). MALDI ABI 4800 plates using a Probot microfraction col A raw expression filter left 21,771 probe sets with a signal lector (LC Packings, Amsterdam, Netherlands). Matrix solu intensity of 2-64 in at least 3 of 416 samples. The filtering tion, 3 mg/mL C-cyano-4-hydroxycinnamic acid (Sigma-Al step was then used to include probe-sets with a log 2-expres drich, St Louis, Mo. USA) in 50% ACN, 0.1%TFA, was then sion value of at least 6 in at least 3 samples over all 416 added at 0.75 uL per spot. samples that were used in the normalization. The overall 0243 Proteomic Methodology: Proteomic analysis was number of samples included in the pre-processing steps was performed using iTRAQ-MALDI-TOF/TOF methodology. 416:33 of these were from transplant subject samples were The multiplexing capability of iTRAO technology allows used in the final analysis. simultaneous processing of four samples per experimental 0240 Trypsin Digest and iTRAO labeling: Total protein run. To ensure interpretable results across different experi concentration was determined using the bicinchoninic acid mental runs, a reference sample was processed together with assay (BCA) (Sigma-Aldrich, St Louis, Mo. USA) were used 3 patient samples in all iTRAQ runs. The reference sample to obtain 100 ug of total protein from each sample. Each consisted of a pool of plasma from 16 healthy individuals and sample was then precipitated by the addition of 10 volumes of was consistently labeled with iTRAO reagent 114. Patient HPLC grade acetone at -20°C. (Sigma-Aldrich, Seelze, Ger samples were randomly labeled between reagents 115, 116 many) and incubated for 16-18 hours at -20°C. The protein and 117. Each iTRAQ run enabled the identification and precipitate was recovered by centrifugation at 16,110 g for 10 quantitation of proteins of 3 patient samples relative to the minand dissolved in 50 mM TEAB buffer (Sigma-Aldrich; St reference sample. Louis, Mo.) and 0.2% electrophoresis grade SDS (Fisher 0244 Mass Spectrometry and Data Processing: For each Scientific; Fair Lawn, N.J.). Proteins in each sample were experiment, peptides spotted on MALDI plates and analyzed reduced with TCEP (Sigma-Aldrich: St Louis, Mo.) at 3.3 using the 4800 MALDITOF/TOF analyzer (Applied Biosys mM and incubated at 60° C. for 60 min. Cysteines were tems; Foster City, Calif.) controlled using 4000 series blocked with methyl methane thiosulfonate at a final concen Explorer version 3.5 software. The mass spectrometer was set tration of 6.7 mM and incubated at room temperature for 10 in the positive ion mode with an MS/MS collision energy of 1 1. keV. A maximum of 1400 shots/spectrum were collected for US 2011/O 189680 A1 Aug. 4, 2011

each MS/MS run causing the total mass time to range from 35 (RMA) (Bolstad, 2003, supra) technique was used for back to 40 hours. Peptide identification and quantitation was car ground correction, normalization and Summarization as ried out by ProteinPilot'TM Software v2.0 (Applied Biosys available in the Affy BioConductor package. A noise mini tems/MDSSciex, Foster City, Calif. USA) with the integrated mization was then performed; probe sets with expression ParagonTM Search Algorithm (Applied Biosystems) and Pro values consistently lower than 50 across at least 3 samples Group'TM Algorithm. Database searching was performed were considered as noise and eliminated from further analy against the International protein index (IPI HUMAN V3.39) sis. The remaining probe sets were analyzed using three dif (Kersey et al., 2004. Proteomics 4:1985-8) to identify the ferent moderated T-tests. Two of the methods are available in polypeptides present in the samples. The precursor tolerance the Linear Models for Microarray data (limma) BioConduc was set to 150 ppm and the iTRAO fragment tolerance was set tor package—robust fit combined with eBayes and least to 0.2 Da. Identification parameters were set for trypsin cleav square fit combined with eBayes. The third statistical analysis ages, cysteine alkylation by MMTS, with special factors set at method, Statistical Analysis of Microarrays (SAM), is avail urea denaturation and an ID focus on biological modifica able in the same BioConductor package. A gene was consid tions. The detected protein threshold was set at the 85% ered statistically significant if it had a false discovery rate confidence interval. (FDR) <0.01 in all three methods (Smyth, G., Limma: linear 0245 Pro GroupTM Algorithm (Applied Biosystems) models for microarray data, in Bioinformatics and Compu assembled the peptide evidence from the ParagonTM Algo tational Biology Solutions using R and Bioconductor, R. rithm into a comprehensive Summary of proteins in the Gentleman, et al., Editors. 2005, Springer: N.Y.). The fold sample. The set of identified proteins from each iTRAQ run change and maximum FDR value the highest FDR from the were organized into protein groups to avoid redundancies. 3 methods are presented in Table 2. Relative protein levels (levels of labels 115, 116 and 117 0249. The nucleic acid markers were identified by apply relative to 114, respectively) were estimated for each protein ing Stepwise Discriminant Analysis (SDA) with forward group by Protein Pilot based on a weighted average of the log selection on the statistically significant probe sets. Linear ratios of the individual peptides for each protein. The weight Discriminant Analysis (LDA) was used to train and test the of each log ratio is the inverse of the Error Factor, an estimate biomarker panel as a classifier marker to generate a minimal of the error in the quantitation, calculated by Pro Group or Small Subset of markers with optimal diagnostic qualities. Algorithm. These weighted averages were then converted An 11-fold cross-validation of the entire process of classifier back into the linear space and corrected for experimental bias construction was used to evaluate the performance of the using the Auto Bias correction option in Pro Group Algo principal classifier based on the biomarker panel. Samples rithm. Peptide ratios coming from the following cases are were randomly divided into 11 disjoint sets, each consisting excluded from the calculation of the corresponding average of one sample from subjects with and two without BCAR, protein ratios: shared peptides (i.e., the same peptide mirroring the one-to-two distribution in the overall study sequence is claimed by more than one protein), peptides with cohort. For each of the 11 disjoint sets, a new classifier was a precursor overlap (i.e., the spectrum yielding the identified constructed in the same manner as the principal classifier: peptide is also claimed by a different protein but with an identification of a list of differentially expressed probe sets unrelated peptide sequence), peptides with a low confidence based on 3 moderated t-tests, followed by forward selection (i.e., peptide ID confidence <1.0%), peptides that do not have discriminantanalysis. The classification accuracy (sensitivity an iTRAQ modification, peptides with only one member of and specificity) of each of the 11 classifiers was then deter the reagent pair identified, and peptide ratios where the Sum mined based on the 3 samples left out at each fold. Sensitivity of the signal-to-noise ratio for all of the peak pairs is less than and specificity for the principal classifier were estimated by 9. When all (non-blank) peptide ratios are 0 or 9999 (indicat averaging the performance across the 11-fold cross-valida ing that only one member of the reagent pair was identified), tion samples. the average ratio for the corresponding protein is shown as 0 0250 Statistical analysis for proteomics: A one-protein at or 9999. Further information on these and other quantitative a time evaluation of differential relative levels was performed measures assigned to each protein and on the bias correction using a robust moderated t-test (empirical Bayes, eBayes; are given in ProteinPilot Software documentation. Smyth et al., 2004 Stat Appl Genet Mol Biol 3: Article 3) on 0246 Although each protein group in an iTRAQ experi a set of proteins that have been detected, using the assigned ment may consist of more than one identified protein, a single protein group code by PGCA, in at least two thirds within set of three iTRAQ ratios was assigned for the entire group each analyzed group). Using the eBayes approach decreases based on its corresponding list of identified peptides. An the number of false positives caused by artificially low sample in-house algorithm, called the Protein Group Code Algorithm variance estimates when the sample size in the study is Small. (PGCA) was employed to link protein groups across all In addition, its robust version assigns less analytical weight to iTRAQ experiments. PGCA assigns an identification code to protein levels that are statistical outliers. This makes the pro all the protein groups within each iTRAO run and a common cedure less sensitive to observations deviating from the bulk code to similar protein groups across runs. The latter code, of the data than classical, non-robust tests. Protein group also referred to as the protein group code (PGC), was then codes with mean relative concentrations (relative to pool used to match proteins across different iTRAQ runs. This control's level) differing significantly between BCAR posi process ensures common identifier nomenclature for related tive and negative (i.e., with p-value <0.05) were identified as proteins and protein families across all experimental runs. potential markers. 0247 Statistical Analysis 0251. The proteomic biomarker panel proteins were then 0248. The statistical analysis for the microarray experi determined using a forward selection stepwise discriminant ments was performed using SAS version 9.1, R version 2.6.1 analysis (SDA) based on the identified list of potential mark and BioConductor version 2.1 (Gentleman, R., et al., Genome ers. The SDA algorithm incorporates one protein group code Biology, 2004. 5: p. R80). Robust Multi-array Average at a time from the list of potential markers. In the first step it US 2011/O 189680 A1 Aug. 4, 2011 32 identifies the protein group code that best classifies samples 0253 Technical validation: 2 proteins from a panel of 9 based on leave-one-out cross validation. In the second step it proteomic biomarkers were selected for validation by identifies the second protein group code that, together with Enzyme-LinkedImmunoSorbent Assay (ELISA) using com mercially available kits, following manufacturer's directions: the previously identified code, best classify samples in a Hepatocyte growth factor-like protein homolog (R&D leave-one-out cross validation. This procedure is repeated DHG00) and E3 ubiquitin-protein ligase UBR4 (DiaP until all protein group codes are sequentially incorporated or harma DPGRO32A). until (n-2) steps are performed, where n is the number of 0254 The present invention will be further illustrated in available samples. The proteomic biomarker panel is defined the following examples. However it is to be understood that by the first k protein group codes selected by the SDA algo these examples are for illustrative purposes only, and should rithm, where k-k-ki, is the step at which the maximum not be used to limit the scope of the present invention in any cross-validation accuracy is reached for the first time (ko) and a. maintained fork, additional steps. In each cross-validation, sample classification is performed using a linear discriminant Example 1 analysis (LDA) with prior probabilities for each group set to Comparison of Biomarkers with Clinical Diagnosis 0.5. In LDA, the relative concentration for each protein unde 0255. A total of 33 subjects were included in the study, tected in patient sample(s) and/orpooled control was imputed comprising 11 patients with an acute rejection within the first using the average relative concentration calculated from week of transplantation, and 22 patients who were free of remaining training samples in each group (BCAR positive rejection for at least 6 months following transplantation. The and negative). 33 transplanted patients were clinically stable 3 months fol 0252 Internal validation (proteomics data): Statistical lowing renal transplantation. A total of 183 probe sets repre validation was performed by a leave-one-out cross-validation senting 160 genes were found to be statistically significantly of the entire process of biomarker panel selection. More spe and consistently differentially expressed between AR and NR cifically, at each step of the leave-one-out cross-validation subjects (Table 2). The sequences that the probesets represent one sample is left out for classification (test set) and the are presented in FIG. 10. Samples from subjects with acute remaining samples are used to build a classifier (training set). rejection within the first week after transplantation clustered The entire biomarker selection process is then performed on together, separately from samples from non-rejection the training set, i.e., from the selection of protein group codes patients. detected in at least 2/3 of the samples in each group through the 0256 Classifying the test subjects using the panel of biomarker panel selection by SDA. A classifier based on the nucleic acid markers listed in Table 5 divided the subjects into resulting proteomic biomarker panel is built using LDA and rejectors (AR) or non-rejectors (NR) (FIG. 1A-C). tested on the test set (priors and missing values have been 0257. As a comparison, an independent classification of a treated as explained above). This process is repeated until all set of Subjects using only clinical parameters did allow for samples are used as test set once. The overall specificity and separation of AR and NR subject, however the boundary sensitivity are estimated based on the classification accuracy between the two groups was not as clear as demonstrated for of each run. All statistical analyses were implemented using R the set of subjects illustrated in FIGS. 1A-C, as some overlap version 2.7.0 (The R Project for Statistical Computing). of AR subjects and NR subjects was observed (FIG. 2).

TABLE 5 Primary classifier (24 nucleic acid markers) associated with acute graph reiection.

Direction Affymetrix log2 (AR Probe Set (Fold Fold versus SEQ ID ID Gene Symbol Gene Title Change) Change NR) NO: 238320 at ++TncRNA trophoblast-derived 1.34 2.54 l 150 noncoding RNA 211454 x at ++FKSG49 FKSG49 0.75 69 l 69 244752 at --ZNF438 Zinc finger protein 438 O.67 59 l 182 204978 at SFRS16 splicing factor, O.76 70 l 56 arginine serine-rich 16 1558.448 a. at ++1558,448 a. at CDNA FLJ35687 fis, 0.79 73 l 12 clone SPLEN2019349 210787 s at ++CAMKK2 calcium calmodulin- O.62 54 l 91 dependent protein kinase kinase 2, beta 211251 x at NFYC nuclear transcription O49 40 l 40 factorY. gamma 209060 x at NCOA3 nuclear receptor O.83 77 l 77 coactivator 3 200805 at ++LMAN2 lectin, mannose-binding 2 0.72 .64 l 23 226266 at PGS1 phosphatidylglycerophosphate O.91 88 l 137 synthase 1 202150 S at NEDD9 neural precursor cell O49 40 l 38 expressed, developmentally down regulated 9 US 2011/O 189680 A1 Aug. 4, 2011

TABLE 5-continued Primary classifier (24 nucleic acid markers) associated with acute graph reiection.

Direction Affymetrix log2 (AR Probe Set (Fold Fold versus SEQ ID ID Gene Symbol Gene Title Change) Change NR) NO:

237442 at ++237442 at 1.03 2.05 l 172 208120 x at ++FKSG49/LOC730444 FKSG49 hypothetical OS6 47 l 69 protein LOC730444 217475 S. at LIMK2 LIM domain kinase 2 O.78 .71 l 129 201473 at --JUNB jun B proto-oncogene O.76 69 l 30 201970 S. at NASP nuclear autoantigenic OS2 43 l 37 sperm protein (histone binding) 227510 X at ++PRO1073 PRO1073 protein 1.16 2.24 l 147 240057 at 240057 at Transcribed locus OS2 43 l 177 210184 at ++ITGAX integrin, alpha X O6S 57 l 81 (complement component 3 receptor 4 Subunit) 217436 x at LOC730399/LOC731974 hypothetical protein O60 S1 l 128 LOCA3O399 hypothetical protein LOCA31974 200709 at FKBP1A FK506 binding protein OS9 SO l 19 1A, 12 kDa 21051.4 x at HLA-G HLA-G OS8 SO l 86 histocompatibility antigen, class I, G 203748 x at RBMS1 RNA binding motif, O8O .74 l S4 single stranded interacting protein 1 205921 s at SLC6A6 solute carrier family 6 O6S 57 l 60 (neurotransmitter transporter, taurine), member 6 ++intersection of the 11 probe sets identified in the cross-validation process to estimate out-of-sample performance

Example 2 and were compared with samples from normal comparators. Microarray analysis of the samples from patients with or 0258 Subjects: Of the 305 subjects who received a renal without BCAR at an FDR <0.01 identified a total of 239 transplant during the period of observation, 27 (8.9%) devel probe-sets that were differentially expressed using LIMMA, oped BCAR with a Banff grade of 21 a during the first 3 575 probe-sets with robust LIMMA and 2677 probe-sets months post-transplant, while a further 24 (7.9%) had only using SAM. The intersection of the three methods found a borderline changes. A total of 1 1/27 (40.74%) subjects with more restricted set of 183 probe sets which were differentially grade 21a rejection on biopsy (range: 3-10 days, mean: 6 expressed between cases (BCAR) and controls (no BCAR) days) fulfilled the case selection criteria with immediate graft for all three analytical methods. Of the 183 significantly function, and absence of infection or other confounding co differentially expressed probe sets, 182 were over-expressed morbid events, as did 5/24 (20.83%) subjects with borderline in subjects with BCAR while one (1565484 x at coding for changes on biopsy (range: 5-7 days, mean: 6 days). A further the epidermal-growth factor receptor; EGFR) was under-ex 22 subjects who had immediate graft function, with no clini pressed (FIG. 3). cal or BCAR for at least 6 months following transplantation, 0260 Unsupervised two-way hierarchical clustering and and no confounding clinical co-morbid events, were selected principal component analysis based upon these probe-sets as matched controls, and 20 normal control Subjects served as showed discrete separation between normal Subjects, patients a comparator group. Demographic details are shown in Table with BCAR and those without BCAR. A principle component 4. Graft function was significantly inferior in cases with analysis (FIG. 4) illustrates the separation of the subject BCAR at the first week post-transplant (27+10 vs. 42-13 groups (AR, NRandN), demonstraing that the centroids of all ml/min/1.73M, P=0.004), but was comparable in both cases groups are clearly separated. When samples from Subjects and controls by month 3 (48+11 vs. 51+8 ml/min/1.73M, with borderline changes were introduced, they were distrib P=0.359) and remained clinically stable with good allograft uted heterogeneously among the cases and controls with and function throughout the 12 months period of observation without BCAR. The biological processes encompassed by the (54+13 vs. 53+15 ml/min/1.73M at month 12, P=0.859). 183 differentially expressed probe sets, representing approxi 0259 Micro-array expression: Peripheral blood samples mately 160 genes, are shown in FIG. 5. Combination of were selected from each of the cases with BCAR at the time overlapping networks in which probe-sets were shared iden of biopsy for acute rejection, and from the respective controls tified three major biological categories implying involvement without BCAR at a time-point identical to the respective case, of processes related to immune responses, signal transduc US 2011/O 189680 A1 Aug. 4, 2011 34 tion, and cytoskeletal reorganization. Analysis of gene-gene and protein-protein networks (Ekins et al., 2007. Methods TABLE 6 Mol Biol 356:319-50) revealed that the cytokine-activated Sensitivity and specificity outcome of cross-validation analysis of nucleic Jak-Stat pathway, interferon signaling, lymphocyte activa acid markers. tion, proliferation, chemotaxis, and apoptosis were promi nently represented among the 183 differentially expressed Sensitivity Specificity probe-sets. Fold 1 100% 100% Fold 2 O% 100% 0261 Classifier selection: Although many genes were Fold 3 100% 100% highly associated with BCAR, co-linearity implied that not Fold 4 100% 100% Fold S 100% 100% all were necessary to develop a classifier for this event. For Fold 6 100% 100% ward selection discriminant analysis was therefore employed Fold 7 100% 100% to identify a linear discriminant function consisting of a more Fold 8 100% 100% Fold 9 O% 100% parsimonious classifier from among the 183 differentially Fold 10 100% SO% expressed probe-sets initially documented. The principal 24 Fold 11 O% SO% probe-sets identified within this classifier, and their respective genes, are shown in Table 5. Example 4 Example 3 Proteomics Biomarker Identification and Validation Cross Validation of Nucleic Acid Biomarkers 0266. A total of 305 subjects received a renal transplant during the period of observation, of whom 27 (8.8%) devel 0262 Cross-validation of the entire gene set using the oped BCAR 21a during the first 3 months post-transplant. same reductive process was employed to enhance the robust Eleven of these fulfilled the case selection criteria, with ness of this classifier and to estimate the out-of-sample per immediate graft function, BCAR 21a within the first 4 weeks formance. An 11 nucleic acid marker setlists produced by this post transplant (range: 3-10 days, mean: 6 days), and no process contained a mean of 103 probe-sets, and the six most infection or other confounding co-morbid events. A further significantly differentially expressed of the original 183 21 subjects who had immediate graft function, with no clini probe-sets (TncRNA, FKSG49, AVIL, SIGLEC9, ANP32A, cal or BCAR for at least 6 months following transplantation, SLC25A16) were present in each list. Forward selection dis and no confounding clinical co-morbid events, were selected criminant analysis identified a group of 11 classifiers with a as controls; for a total of 32 transplanted subjects. Except for union of 87 probe-sets. Eleven of these probe-sets, depicted in the incidence of BCAR, all patients were otherwise clinically Table 5, were contained within the original 24 probe-set clas stable, with good allograft function throughout the 12-month sifier. Cross-validation yielded an overall mean sensitivity of period of observation. Six additional BCAR negative samples 73% and specificity of 91% for the identification of samples were selected for an internal validation, one each from three with or without BCAR. patients without BCAR included in the discovery study, and three from new patients. 0263 Performance of the final 11 probe-set (nucleic acid 0267. After depletion of the 14 most abundant proteins marker) classifier is shown in FIG. 6. The set of 11 nucleic (albumin, fibrinogen, transferin, IgG, IgA, IgM, haptoglobin, acid markers included TncRNA, FKSG49, ZNF438, C.2-macroglobulin, C.1-acid glycoprotein, C.1-antitrypsin, 15584.48 a at, CAMKK2, LMAN2, 237442 at, FKSG49/ Apoliprotein-I. Apoliprotein-II, complement C3 and Apolip LOC730444, JUNB, PRO1073 and ITGAX. rotein B) by immuno-affinity chromatography (Genway Bio 0264. Diagnostic accuracy improved rapidly with addition tech: San Diego, Calif.), less than 5% of the total protein mass of sequential probe-sets (FIG. 6A), and the linear discrimi remained. The remaining protein was trypsin digested with nant scores for the full 11 probe-set classifier showed clear sequencing grade modified trypsin (Promega; Madison, Wis.) separation of the samples with and without BCAR (FIG. 6B). and labelled with iTRAO reagents according to manufactur Finally, longitudinal monitoring over the first 3 months post er's (Applied Biosystems; Foster City, Calif.) protocol and transplant showed a significant increase in classifier score at was examined to identify plasma proteomic markers of renal the time of BCAR (p=0.001), with a subsequent return to the acute rejection. A total of 460 protein group codes were baseline value following treatment and resolution of the identified in at least one BCAR positive sample and one rejection episode. No comparable increase occurred in Sub BCAR negative sample, among which 144 protein group jects who did not experience BCAR and there was no signifi codes were detected in at least 8 out of 11 BCAR positive samples and in at least 14 out of 21 controls, passing the cant difference between these curves at any other time post two-thirds selection criteria per group. Analysis of the 144 transplant (FIG. 6C). protein group codes with the robust eBayes identified a total 0265 An 11 cross-validation analysis demonstrated an of 18 protein group codes whose concentrations differed sig average prediction accuracy of 72.7% (sensitivity) for AR and nificantly (p<0.05) between the two groups (FIG. 7). The 90.9% (specificity) for NR (Table 6) and is an estimate of the results for the 18 significant protein group codes are shown in prediction accuracy of the panel of 24 biomarkers listed pre Table 7. sented in Table 5. The "++’ designation in Table 5 indicates 0268 Forward selection stepwise discriminant analysis the nucleic acid markers in the intersecting set of the 11 probe (SDA) identified a subset of 9 protein group codes that con sets identified in the cross-validation process to estimate out stitutes the proteomic biomarker panel (blue bold font in of-sample performance. Table 7). Seven of the biomarker panel PGCs were up-regu US 2011/O 189680 A1 Aug. 4, 2011 35 lated (TTN, MSTP9, PI16, C2, MBL2, SERPINA10, UBR4) protein group codes selected in previous steps. The y-axis and two were down-regulated (KNG 1 and AFM) in patients shows the classification accuracy achieved by each Succes with compared to those without BCAR. FIG. 8 illustrates the sively larger panel. The marginal gain in prediction accuracy marginal classification performance achieved by protein quickly stabilized as protein group codes were added into the group codes at each step of the forward selection. The X-axis panel, and even three proteins were sufficient to achieve shows the protein group code selected at each step to join the maximum accuracy (FIG. 8).

TABLE 7 Plasma proteins with differential relative concentrations at p-value < 0.05. Protein group identified in the column AR vs NR constitute the plasma proteomic biomarker panel. The column “PGC contains the code assigned by the PGCA. Accession numbers and protein names of all proteins in each group, corresponding genes, p-values calculated by the robust-eBayes test, fold changes and their directions (up- or down-regulated) in BCAR positive relative to negative are given in the remaining columns. Ad. AR Gene P- P- Fold WS Accession # PGC Symbol Protein Name Value Value Change NR PIOO7597541 ** 111 TTN soform 1 of Titin O.OOOO3 O.OO45 1.21 up PIOO749O39.2 TTN itin isoform N2-A PIOO179357.2 TTN soform 7 of Titin PIOOO23283.3 TTN soform 2 of Titin PIOO759.542.1 TTN soform 8 of Titin PIOO759637.1 TTN soform 4 of Titin PIOO759613.1 TTN soform 5 of Titin PIOO375.499.2 TTN itin isoform novex-2 PIOO375498.2 TTN itin isoform novex-1 PIOO455.1734 TTN soform 3 of Titin PIOO4123O7.8 TTN 2268 kDa protein PIOO436O21.3 TTN Titin (Fragment) PIOO884109.1 Cellular tiltin isoform PEVK Variant 3 (Fragment) PIOO7893.76.1 ** 18 KNG1 KNG1 protein O.OO149 0.1108 1.18 down PIOO797833.3 KNG1 Kininogen PIOOO32328.2 KNG1 Soform HMW of Kininogen-1 precursor PIOO2.15894.1 KNG1 Soform LMW of Kininogen-1 precursor PIOOO323114 108 LBP Lipopolysaccharide- O.OO641 0.2024 1.22 up binding protein precursor PIOO3.95488.2 222 WASN Vasorin precursor O.OO666 0.2024 1.14 up PIOO827866.1 ARNTL2 soform 7 of Ary hydrocarbon receptor nuclear translocator-like protein 2 PIOO142781.3 ARNTL2 soform 1 of Ary hydrocarbon receptor nuclear translocator-like protein 2 PIOO163662.3 ARNTL2 soform 2 of Ary hydrocarbon receptor nuclear translocator-like protein 2 PIOO465306.3 ARNTL2 soform 5 of Ary hydrocarbon receptor nuclear translocator-like protein 2 PIOO788724.2 ARNTL2 soform 6 of Ary hydrocarbon receptor nuclear translocator-like protein 2 PIOO789255.2 ARNTL2 soform 3 of Ary hydrocarbon receptor nuclear translocator-like protein 2 PIOO795339.2 ARNTL2 soform 4 of Ary hydrocarbon receptor nuclear translocator-like protein 2 PIOO827897.1 ARNTL2 soform 8 of Ary hydrocarbon receptor CI(88SIOC8O-Ke protein 2 PIOOO19943.1 ** 23 AFM Afamin precursor O.OO679 0.2024 1.29 down US 2011/O 189680 A1 Aug. 4, 2011 36

TABLE 7-continued Plasma proteins with differential relative concentrations at p-value < 0.05. Protein group identified in the column AR vs NR constitute the plasma proteomic biomarker panel. The column “PGC contains the code assigned by the PGCA. Accession numbers and protein names of all proteins in each group, corresponding genes, p-values calculated by the robust-eBayes test, fold changes and their directions (up- or down-regulated) in BCAR positive relative to negative are given in the remaining columns. Adj. AR Gene P- P- Fold vs Accession # PGC Symbol Protein Name Value Value Change NR PIOO873854.1 ** 224 MSTP9 64 kDa protein 0.00863 0.2143 1.09 up PIOO2922.18.4 MST1 Hepatocyte growth factor ike protein precursor PIOO384647.1 MST1 Hepatocyte growth factor ike protein homolog PIOO718805.1 MSTP9 Brain-rescue-factor-1 PIOO816378.1 21 kDa protein PIOO8477.02.2 MST1 4 kDa protein PIOO301143.5 ** 135 PI16 soform 1 of Peptidase 0.01286 0.2738 1.25 up inhibitor 16 precursor PIOO845S06.1 PI16 soform 2 of Peptidase inhibitor 16 precursor PIOOOO7221.1 97 SERPINA5 Plasma serine protease 0.01925 0.2870 1.22 down inhibitor precursor PIOO165972.3 104 CFD Complement factor D 0.02044 0.2870 143 up preproprotein PIOO218.195.3 USH1C Harmonin (Usher syndrome type-1C protein) (Autoimmune enteropathy-related antigen AIE-75) (Antigen NY-CO-38/NY-CO-37) (PDZ-73 protein) (Renal carcinoma antigen NY REN-3). Isoform 3 PIOO412105.2 USH1C harmonin isoform b3 PIOO478105.4 USH1C Isoform 4 of Harmonin PIOO4785.19.3 USH1C Isoform 3 of Harmonin PIOO790818. USH1C 29 kDa protein PIOO872537. USH1C 60 kDa protein PIOO3O3963. **38 C2 Complement C2 precursor 0.01939 0.2870 .09 up (Fragment) PIOO643S06.3 C2 Complement component 2 PIOOOO4373. ** 116 MBL2 Mannose-binding protein O.O2119 O.2870 .3678 up C precursor PIOOOO7199.4 ** 125 SERPINA10 Protein Z-dependent O.O2335 0.2899 .2317 up protease inhibitor (CSO PIOOO22395. 26 C9 Complement component O.O2917 O.2962 .1321 up C9 precursor PIOOO22331. 230 LCAT Phosphatidylcholine- O.O3O31 O.2962 .1822 down sterol acyltransferase (CSO PIOO868938. 103 — Beta-2-microglobulin O.O3179 0.2962 .2735 up PIOO796379. B2M B2M protein PIOOOO4656.2 B2M Beta-2-microglobulin PIOO219583. 69 SHBG soform 2 of Sex O.03180 0.2962 .1924 down hormone-binding globulin (CSO PIOOO23019. SHBG soform 1 of Sex hormone-binding globulin (CSO PIOO749179.2 29 C1S Uncharacterized protein 0.04030 0.3532 1.0817 up C1S PIOOO17696.1 C1S Complement C1s Subcomponent precursor Putative uncharacterized protein PIOO385294.2 C1S DKFZp686M10257 PIOO791987.1 C1S 7 kDa protein PIOO877989.1 C1S Protein PIOO878772.1 C1S 9 kDa protein PIOO843999.2 **100 UBR4 soform 1 of E3 ubiquitin- 0.04317 0.3574 1.0943 up protein ligase UBR4 US 2011/O 189680 A1 Aug 4, 2011 37

TABLE 7-continued Plasma proteins with differential relative concentrations at p-value < 0.05. Protein group identified in the column AR vs NR constitute the plasma proteomic biomarker panel. The column “PGC contains the code assigned by the PGCA. Accession numbers and protein names of all proteins in each group, corresponding genes, p-values calculated by the robust-eBayes test, fold changes and their directions (up- or down-regulated) in BCAR positive relative to negative are given in the remaining columns. Adj. AR Gene P- P- Fold vs Accession # PGC Symbol Protein Name Value Value Change NR IPIOO64O981.3 UBR4 Isoform 4 of E3 ubiquitin protein ligase UBR4 IPIOO296,176.2 F9 Coagulation factor IX precursor IPIOO18O305.7 UBR4 Isoform 5 of E3 ubiquitin protein ligase UBR4 IPIOO646.605.3 UBR4 Isoform 3 of E3 ubiquitin protein ligase UBR4 IPIOO746934.2 UBR4 Isoform 2 of E3 ubiquitin protein ligase UBR4 IPIOO816532.1 F9 Coagulation factor IX (Fragment) *Up” with respect to “AR vs NR” indicates that one or more members of the specified protein group code are increased in the AR subjects, relative to the NR subjects, “Down” with respect to AR vs NR” indicates that one or more members of the specified protein group code are decreased in the AR subjects, relative to the NR subjects. **Indicates the protein group codes selected by SDA. One or more of the members of the indicated protein group code are increased or decreased (as indicated in the right-most column) in the AR subject, relative to the NR subject,

0269. The Accession it is the International Protein Index ally indicated to be incorporated by reference herein and as (IPI) accession number, the amino acid sequence of the cor though it were fully set forth herein. Citation of references responding polypeptide is available from the IPI database as herein is not to be construed nor considered as an admission indicated in the methods section. that such references are prior art to the present invention. 0270. In an internal validation, two approaches were taken 0272. One or more currently preferred embodiments of the to estimate the ability of the proteomic biomarker panel to invention have been described by way of example. The inven classify new samples. First, a leave-one-out cross-validation tion includes all embodiments, modifications and variations using LDA estimated a sensitivity of 63% and a specificity of substantially as hereinbefore described and with reference to 86% associated with the outlined discovery strategy. Second, the examples and figures. It will be apparent to persons skilled a classifier based on the 9 protein group codes in the biomar in the art that a number of variations and modifications can be ker panel was built using LDA and was tested on 6 new NR made without departing from the scope of the invention as samples. Four out of these 6 samples were correctly classi defined in the claims. Examples of such modifications include fied. the Substitution of known equivalents for any aspect of the 0271 All citations are herein incorporated by reference, as invention in order to achieve the same result in substantially if each individual publication was specifically and individu the same way.

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS : 183

SEO ID NO 1 LENGTH: 391 TYPE: DNA ORGANISM: Artificial sequencce FEATURE; OTHER INFORMATION: Prole No. 1. FEATURE; NAME/KEY: misc feature LOCATION: (44) ... (44) OTHER INFORMATION: n is a

<4 OOs SEQUENCE: 1

titcCagggala gcatt at Ctt gaccagctga accacattitt gggntatt ct toggat.ccc.ca 60

tolacaagaag acctgaattig tataataaat ttaaaagcta ggaact attt gotttct citt 12O

ccacacaaaa at aaggtgcc atggaac agg ctgttcc caa atgctgactic caaagctctg 18O US 2011/O 189680 A1 Aug. 4, 2011 38

- Continued gact tattgg acaaaatgtt gacattcaac C cacacaaga ggattgaagt agaac aggct 24 O Ctggcc cacc cat atctgga gcagt attac gaccc.gagtg acgagcc cat cqc.cgaagca 3OO c cattcaagt togacatgga attggatgac ttgcc talagg aaaagct caa agaactaatt 360 tittgaagaga Ctgctagatt C cago Cagga t 391

<210s, SEQ ID NO 2 &211s LENGTH: 452 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223 OTHER INFORMATION: Prole No. 2

<4 OOs, SEQUENCE: 2 ggaagctact ttcaag.cgac Ctctttgagg agtggatggg tectctggag atgcaggacg 6 O aggaggacag aatcgaggcc ctgaaac agg ttgcagataa gct cocccgg cccalacct cc 12 O tgct acticaa gcacttgg to tatgtgctgc acct catcag caagaactict gaggtgaaca 18O ggatggactic cagcaatctg gcc atctgca ttggacc caa catgctic acc Ctggagaatg 24 O accagagcct gtcatttgaa goccagaagg acctgaacaa caaggtttgt totgct tact 3OO gatgagaaat coccaactta tdatc to acc atctgtttgc caagt coagg caataaaatg 360 citt cagaatgtct coaactg act cagaatc acagtgaaaa tataaaatgc aaaatgctitt 42O tgtcat agtt coactict citc agata catgt at 452

<210s, SEQ ID NO 3 &211s LENGTH: 556 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223 OTHER INFORMATION: Prole No. 3

<4 OOs, SEQUENCE: 3 aagaaacggc gcaccacaag act at at CCC acacctggct cagagggtcc tacgc.ccacg 6 O gaat ct cqct gattgctago acagcagt ct gagat caaac ticaaggcgg caacgaggct 12 O gggggagggg cqC cc.gc.cat tccCaggct tcc ttaggta aacaaag cag cctggaagct 18O cgaactgggt ggagcc cacc acagotcaag gaggcctgcc tic ct ctgta ggcticcacct 24 O Ctgggggcag ggcacagaca aacaaaaaga cagcagtaac Ctctgcagac ttalagtgtc.c 3OO

Ctgtctgaca gctittgaaga gag cagtggt t ct cocagda cqcagatgga gatctgagaa 360 cgggcagact gccticcitcaa gtgggtc.cct gaccc.ctgac C cc caag cag cctaactggg 42O aggcaccc cc caa.caggggc acactgacac ct cacacggc aggg tatt CC alacagacct a 48O Cagctgaggg to Ctgtctgt tagaaggaaa act aacaac C agaaaggaca t ct acaccga 54 O aaac ccatct gtacat 556

<210s, SEQ ID NO 4 &211s LENGTH: 519 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223 OTHER INFORMATION: Prole No. 4 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (325) ... (331) <223> OTHER INFORMATION: n is a, c, g, or t

US 2011/O 189680 A1 Aug. 4, 2011 41

- Continued

&212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223 OTHER INFORMATION: Prole No. 9 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (152) ... (152) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (157) . . (157) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (169) . . (169) <223> OTHER INFORMATION: n is a, c, g, or t <4 OOs, SEQUENCE: 9 c cattctgag tacttctic cq caaac cctitt gttt cattaa gogactgttitt acatgaaggg 6 O tgcaaaagta ggataaaaat gagaacccta gggtgaalaca C9tgacagala gaataaagac 12 O tattgaatag tocticttct c tacccatgga cnttggnatt tittatatting attittaagga 18O aatata actt agtagtaaag agatgagc at t caagttcagg Cagacctgaa tittgggit caa 24 O ggctg.cgc.ca citcaaaagct atatgacctic tatatgagca gct tatt caa cct cittittaa 3OO cctic catttit gtcatctgta gaatgatgat aaatgcc tag ct cagaagga titcc 3.54

<210 SEQ ID NO 10 &211s LENGTH: 220 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223 OTHER INFORMATION: Prole No. 10

<4 OOs, SEQUENCE: 10 taact tccaa got cocacca acagttcaga aacctaccac agtaaatgtt coaactacag 6 O aagttct cacc aacttcticag aaaaccacca caaaaac cac cacaccalaat gct caa.gcaa. 12 O cacggagtac acctgtttico aggacaacca agcatttitca togaaacaacc ccaaataaag 18O gaagtggaac cactitcaggit act accc.gtc ttctatotgg 22 O

<210s, SEQ ID NO 11 &211s LENGTH: 439 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223 OTHER INFORMATION: Prole No. 11 22 Os. FEATURE: <221s NAME/KEY:A misc feature <222s. LOCATION: (264) ... (264) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (270) ... (270) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (32O) ... (320) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (328) ... (328) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (352) ... (352) <223> OTHER INFORMATION: n is a, c, g, or t US 2011/O 189680 A1 Aug. 4, 2011 42

- Continued

22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (369) . . (369) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (381) ... (381) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (393) ... (393) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (396) ... (396) <223> OTHER INFORMATION: n is a, c, g, or t <4 OOs, SEQUENCE: 11 Caagtactgg Cagaccalag cqcaa.gagac actgaaatat gcc ctggagc titcagaa.gct 6 O

Calacac caac gtggctaaga atgtcatCat gttcc tdgga gatgggatgg gtgtctic cac 12 O agtgacggct gcc.cgcatcc tica agggit ca gct coaccac aaccctgggg aggagaccag 18O gctggagatg gaCaagttcc cct tcgtggC cct ct coaag acgtacaiaca C caatgcc.ca 24 O ggtc.cctgac agcgc.cggca ccgnc accgn Ctacctgtgt ggggtgaagg C caatgaggg 3OO

Caccgtgggg gtaagcgcan ccactgancg titc.ccggtgc alacaccaccc angggaacga 360 ggtcacctnc atcctg.cgct ngggccaagg acnctnggga aatctgtggg cattgttgacc 42O accacgagag talaccatg 439

<210s, SEQ ID NO 12 &211s LENGTH: 305 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223 OTHER INFORMATION: Prole No. 12

<4 OOs, SEQUENCE: 12 ttgggaggcc Cttgaagaat CCC ct cocac agc actgaca gacagagctg. galagatagga 6 O aggat Cagga agt cagaggc gtagt ctagg aaatctagoc cct gatagga gtttcagaaa 12 O aagaaaagtg tcc.cgggacc caaaggctitt gcattt C cag gttaaaaagt ccaccagaaa 18O gtcc.gc.ccaa gaatggaaat tacccaaacc acaatgcatc gctgtgaaat titcacaattic 24 O ctggattaaa caaaggcc ct gaaagct tcc agagcaaaca gat cacataa acagotcacc 3OO agact 305

<210s, SEQ ID NO 13 &211s LENGTH: 155 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223 OTHER INFORMATION: Prole No. 13

<4 OOs, SEQUENCE: 13 gaccactitat caaaggcatgttgttgcagg acaggct tcg ccgalaggttt gaggagc.ca.g 6 O aggggtttac attgcaccitt gagctggaaa agtaaaat at ticagt ct c catcc ttcaa 12 O aaac agcagg tattttgtaa ct caggct co togc ct 155

<210s, SEQ ID NO 14 &211s LENGTH: 92 US 2011/O 189680 A1 Aug. 4, 2011 43

- Continued

&212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223 OTHER INFORMATION: Prole No. 14

<4 OOs, SEQUENCE: 14 ctgcacctac giggit cotaat aaatc.ttcac tdtctgactt tagt citcc.ca ctaaaactgc 6 O attt cott to tacaattit ca atttgtc.cct tt 92

<210s, SEQ ID NO 15 &211s LENGTH: 564 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223 OTHER INFORMATION: Prole No. 15

<4 OOs, SEQUENCE: 15 aatgttaact tccatctgtg ttgttggcgt gtgagcgcac Ctgtgcgtgt gcacagaagt 6 O gctgggctitt gggaat ct ct tact aggcaa agttgct cog tigtttcaac agttgggctg 12 O tgtttgctitt aaaggcaata toggggaatac tdaacacacic cqgctitt citt citcagtttitt 18O ttggittitt co agtgacaagt tagt cataca attcatc.ccc caaattic cca ttctgagggit 24 O c cctaa.ca.gc tittgtaaa.ca ttctacaaga acacagttat tittgagttca cittaacttitt 3OO titat caactt ttgatgaccg. tcttggtgag tttitt cotgagtatt cacgg gcactaagta 360 t ct cactitat tttittcaa.cc tacaggaaag toagtttaaa tdaaacgcac tdtgttcaca 42O gtattotgct aggtgctitta aggaattaaa aaaacaaaac caaaacaaaa caaaacaaaa 48O aaac acttga agggitaaaag ticatttitcca tacggacac taataaggg Cagggaaatg 54 O cittittacaca tdaagtgctg. caca 564

<210s, SEQ ID NO 16 &211s LENGTH: 73 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223 OTHER INFORMATION: Prole No. 16

<4 OOs, SEQUENCE: 16 gcagagcagt cagcc.ctacg gacagcagag ttacagtggit tatagc.cagt c cacgga cac 6 O ttcaggct at ggc 73

<210s, SEQ ID NO 17 &211s LENGTH: 70 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223 OTHER INFORMATION: Prole No. 17

<4 OOs, SEQUENCE: 17 ggatgtgttcaaggcaagac caattcaga aggatat ca C9tcgtgat C Cagaagt cca 6 O gagctgagga 70

<210s, SEQ ID NO 18 &211s LENGTH: 551 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223 OTHER INFORMATION: Prole No. 18

US 2011/O 189680 A1 Aug. 4, 2011 49

- Continued cc.gc.cgtcac cagctatoca tt cacticcgt titc.ca.gtgag cagatgtc.tt gcttggaaag 3OO tggacctgtg totgtgtctg. tcc tdagaac ttaccagcag aaatcct cat ttctgtgcta 360 cgga 364

<210s, SEQ ID NO 33 &211s LENGTH: 438 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223 OTHER INFORMATION: Prole No. 33

<4 OOs, SEQUENCE: 33 ggct agacitt to catggct gtcaaaaggg acagcc.gcaa agc cctggitt gcc caggtaa 6 O tcaaagagaa gctaaggctgaagttctgcaa Caggctctgaggit cogggga aagctagaaa 12 O Ctaaatcgga cctgaacatg caa.ca.gcagg aagaggagga gaaagcc.cgg Ctic ct cattg 18O gtttalagtgt gggcgacaag aaccctggca agaagtic cat CtttggCagg cqcaaatgat 24 O ttggcgattic gagtggctgc agtacaggat Ctgactctgg Ctcaggct cc agggacttgt 3OO ggggtgggag gggctt CCC titatic cacga ggatttgttgg gtgtcagagc C catagg cat 360 Cact Cttcag cacctggit ct gttcgctgca gggcatggtg gacagtaatg Ctgagttctg 42O t ct cacactg at caggct 438

<210s, SEQ ID NO 34 &211s LENGTH: 504 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223 OTHER INFORMATION: Prole No. 34

<4 OOs, SEQUENCE: 34 gcagttct Ct c cctgaaaac acagtacagg ttgagtcaaa tagg to atg ggtgcaccag 6 O atgacaggac Cagaactic cc ctitgagcc at C caactgttg gagtgactta gatggtggga 12 O accacacaga gaatgtggga gaggcagcag tact caggit taagagcag gCagg cacag 18O tggcct cqtg tcc tittaggg cat agtgatg acacagttta t catgatgac aaatgitatgg 24 O tagaggtocc ccalagagitta gagacaagca Caggg catag tittagagaala gaatt Cacca 3OO accaggaagc agctgagc cc aaggaggttc cagcgcacag tacagaagta gg tagggat C 360 acaacgaaga agagggtgaa gaaac aggat taagggacga gaalaccalat C aagacagaag 42O titcCtggttc. tccagcagga actgagggca actgtcagga agcgacaggit C caagtacag 48O taga cactica aaatgaac cc ttag SO4

<210s, SEQ ID NO 35 &211s LENGTH: 494 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223 OTHER INFORMATION: Prole No. 35

<4 OOs, SEQUENCE: 35 acaagttgac Ctccacggtg atgctgtggc tigcagaccala caaatctggc tictggcacca 6 O tgaacct cqg aggcagcctt accagacaga tiggagaagga tigaaactgtg agtgactgct 12 O

CCCC acacat agccaa.catc gggcgc.ctgg tagagga cat ggaaaataala at Cagaagta 18O

US 2011/O 189680 A1 Aug. 4, 2011 59

- Continued aggagagagg accCattagc tiggcagaccc aggg 514

<210s, SEQ ID NO 61 &211s LENGTH: 534 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223 OTHER INFORMATION: Prole No. 61

<4 OOs, SEQUENCE: 61 ggagaacgca Cacctggtgg to at Caactic Ctgggaggag Cagaaattica ttgtacaiaca 6 O cacgaacc cc ttcaatacct ggataggit ct cacggacagt gatggct citt ggaaatgggt 12 O ggatggcaca gactataggc acaactacaa gaactgggct gtcacticago Cagataattg 18O gcacgggcac gagctgggtg gaagtgaaga Ctgttgttgaa gtc.ca.gc.cgg atggcc.gctg 24 O gaacgatgac ttctgcctgc aggtgtaccg Ctgggtgtgt gagaaaaggc ggaatgccac 3OO cggcgaggtg gcctgacc cc agcacacctic tigct aaccc at accc.caca Cctgcc.ca.gc 360 tctggcttct Ctgttgagga ttittgaggaa aggaagaaac actgaga cag ggg tatgggg 42O alaga.gctgag caaagagaga aaggaggtag tittaa.gagtic cct gaccct g gaggactgag 48O atcc cacctic cittctgtaat t cattgtaat tattataatc git cagcct ct tcaa 534

<210 SEQ ID NO 62 &211s LENGTH: 527 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223 OTHER INFORMATION: Probe no. 62

<4 OOs, SEQUENCE: 62 ggcc ttgaca cattacaa.gc ctdgaaaaaa a catcagaaa taataaaaaa titt cagaga.g 6 O aatcaagata cctttitttitt totttitttitt ttcttitttitt tattatactic taagttt tag 12 O ggtacatgtg cacattgtgc aggttagtta catatgtata catgtgc.cat gctggtgcgc 18O tgcacc cact aatgtgtcat ctago attag gtatat citcc cagtgctatic cct cocc cct 24 O ccc.ccgaccc caccacagtic cccagagtgt gat attc.ccc titcctgtgtc. catgtgatct 3OO cattgttcaa titc.ccaccita tdagtgagaa tatgcggtgt ttggittttitt gttcttgcga 360 tagttt actg agaatgatgg titt coaattt catccatgtc. cct acaaagg atatgaactic 42O at cattttitt atggctgcat agtatt coat gigtgtatatg togccacattt tottaatcca 48O gtctat catt gttgga catt togggttggitt coaagttctitt gctattg 27

<210s, SEQ ID NO 63 &211s LENGTH: 370 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223 OTHER INFORMATION: Prole No. 63

<4 OOs, SEQUENCE: 63 atgcagtagc tigc catgtct aaagataaaa atalacatgca acatcgatat attgaactict 6 O tcttgaattic tactCctgga ggcggctctg gCatgggagg ttctggaatg ggaggctacg 12 O gaagagatgg aatggata at Cagggaggct atggat cagt tdgaagaatg ggaatgggga 18O acaattacag taggat at ggtacticcitg atggtttggg ttt atggc C9tggtggtg 24 O

US 2011/O 189680 A1 Aug. 4, 2011 63

- Continued <210s, SEQ ID NO 72 &211s LENGTH: 344 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223 OTHER INFORMATION: Prole No. 72 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (93) . . (93) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (121) ... (121) <223> OTHER INFORMATION: n is a, c, g, or t 22 Os. FEATURE: <221 > NAMEAKEY: misc feature <222s. LOCATION: (177) . . (177) <223> OTHER INFORMATION: n is a, c, g, or t <4 OOs, SEQUENCE: 72 tctt accc cc ttgatggaag cagct tctgg aggg tatgca gaggttggala gagttcttct 6 O tgataaagga gcagatgtta atgct coccc tongcct tcc ticaagagata citgctittaac 12 O natago agca gacaaagg to act acaaatt ttgttgaactic Ctgatt cata ggggagncCC 18O acattgatgt togtaacaaa aagggaaata cqc cactittg gctggcatcc aatggaggit c 24 O attittgatgt ttgcagttg ctagtgcaag Caggtgctga tigtggatgca gcagatalacc 3OO ggaaaatcac acct cittatgtcago atttic gcaagggit ca tota 344

<210s, SEQ ID NO 73 &211s LENGTH: 321 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223 OTHER INFORMATION: Prole No. 73

<4 OO > SEQUENCE: 73 ggacccattt to atttgact tctittgaaga ccc.ttittgag gacttctittg ggaatcgaag 6 O gggit coccga ggalagcagaa gcc.gagggac ggggit cqttt ttctict cq t t cagtggatt 12 O tcc.gtc.ttitt ggaagtggat titt Cttcttt tdata cagga titt actt cat ttggg to act 18O aggit cacggg ggcctic actt cattct ctitc. cacgt cattt ggtgg tagtg gcatgggcaa. 24 O cittcaaatcg at atcaactt caactaaatg gttaatggca gaaaaat cac tacaaagaga 3OO attgtc.gaga acggtcaaga a 321

<210s, SEQ ID NO 74 &211s LENGTH: 514 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223 OTHER INFORMATION: Prole No. 74

<4 OOs, SEQUENCE: 74 gaagtaagcc ticatcatcag agc ctitt.cct caaaactgga gtc.ccaaatgtcatcaggtt 6 O ttgtttittitt toagccacta agaac ccctic togcttittaac totagaattt gggcttggac 12 O cagatctaac atcttgaata citctg.ccctic tagagcc titc agc cittaatg gaaggttgga 18O tccaaggagg ttaatggaa ticggaatcaa gocacticggc aggcatggag ctatalactaa 24 O gcatcct tag gigttctgcct citccaggcat tagcc ct cac attagat ct a gttactgtgg 3OO tatggctaat acctgtcaac atttggaggc aatcc tacct togcttittgct tctagagctt 360

US 2011/O 189680 A1 Aug. 4, 2011 65

- Continued aactitctgaa aacccaaggc cagg tact.gc attctgaatc agaat ct cqc agtgtttctg 18O tgaatagatt tttttgtaaa tatgacctitt aagatattgt attatgtaaa atatgtatat 24 O acct ttttitt gtaggit caca acaact catt tttacagagt ttgttgaagct aaatatttaa 3OO cattgttgat ttcagtaagc tigtgtggtga ggctaccagt ggaagagaca t c ccttgact 360 tttgttggcct gggggagggg tagtgcticca cagctttitcc titc.cccaccC cccagcctta 42O gatgcct cqc tottttcaat ct cittaatct aaatgcttitt taaagagatt atttgtttag 48O atgtagg.cat tittaatttitt taaaaatticc tictaccagaa citaag cact 529

<210s, SEQ ID NO 78 &211s LENGTH: 514 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223 OTHER INFORMATION: Prole No. 78

<4 OO > SEQUENCE: 78 tat citctic catttcagttc Caaggagt cc cagcggggga tigggctacat gcc caaacgt. 6 O ggcctggagg taacaagtg tagat.cgcc aggttctaca agctgcacga gcggaggtgt 12 O gaggcc attg C catgacagt gcctcaaag. tcggacctgt to Caggagga cct gtaccca 18O

Cccaccgcag ggc.ccgaccc tic cct cacg gctgaggagt ggctgggggg. tcgggatgct 24 O gggc.ccct Co. t catct coct Caaggatggc tacgt acccc caaagagc.cg ggagctgagg 3OO gtcaaccggg gcc tigacac cqggcgcagg agggcagcac cagaggc.ca.g. tcact coc 360 agct cqgatg ccgtgtct cq gctggaggag gagatgcgga agctic caggc cacggtgcag 42O gagotccaga agcgcttgga Caggctggag gagacagtcc aggccaagta gagcc.ccgca 48O gggcct coag Cagggit caga cattcacacic catc 514

<210s, SEQ ID NO 79 &211s LENGTH: 45.5 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223 OTHER INFORMATION: Prole No. 79

<4 OO > SEQUENCE: 79 tgaacaccitt ctacagdaaa citcttgcaag to cagttt catcc ctdtaag goaaatgtct 6 O titt Cacgcag aaagtgcc at at agacgaga taaaggcagc taaaacgagg gcagtagaga 12 O gCactt accc gacccCaagg to cagagat gcc ctgagga tiggtggittaa ggaaacagga 18O gcaggaaatg tacacacaga titcctgtc.cc tittgccaact act cott coc catcaaagaa 24 O aaac acttgc acacagtaac taccagotcc ttct citcaaa cittgt atttic ticcitggaaat 3OO gtat ct caga aatgacct co tot cocaa.cc acttcaacga ttctittctitt gggtttgggg 360 ttcttgcagt totatcatct aaaataacct ttggactgca ggtaaaatgc aattaggaca 42O actalaccalag tagacgaaac aagttc.ccct aggca 45.5

<210s, SEQ ID NO 8O &211s LENGTH: 352 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223 OTHER INFORMATION: Prole No. 8 O

US 2011/O 189680 A1 Aug. 4, 2011 68

- Continued

<210s, SEQ ID NO 87 &211s LENGTH: 517 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223 OTHER INFORMATION: Prole No. 87

<4 OO > SEQUENCE: 87 gagtgaggcg atttgacctg. Ctcaaacgta t ctitgaagat ggacagaaaa gCtgtggaga 6 O

Cccacctgct Caggalacc ct caccttgttt C9gactatag agtgctgatg gcagagattg 12 O gtgaggattt ggataaatct gatgtgtc.ct cattaattitt cot catgaag gattacatgg 18O gcc.gaggcaa gataagcaag gagaagagtt tottggacct ttggttgag ttggagaaac 24 O taaatctggit togc.cccagat caactggatt tattagaaaa atgcc taaag aac atccaca 3OO gaatagacct galagacaaaa atccagaagt acaag cagtic tittcaagga gcaggga caa 360 gttacaggaa tdttct coaa gcagdaatcc aaaagagt ct caaggat.cct tcaaataact 42O t caggatgat aac accct at gcc cattgtc. citgatctgaaaattcttgga aattgttcca 48O tgttgattaac atggaactgc ctic tacttaa to attct 17

<210s, SEQ ID NO 88 &211s LENGTH: 473 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223 OTHER INFORMATION: Prole No. 88

<4 OOs, SEQUENCE: 88 cggctict cag Caggtotacic talacgt.ctic cctgcagagc aaa.gc.cacat Caggagtgac 6 O t cagggggtg gtcgggggag ctggagccac agc cctggtc titcCtgtc.ct tctgcgt cat 12 O Cttcgttgta gtgagg to ct gcaggaagaa atcggcaagg C cagcagcgg gcgtgggaga 18O tacgggcata gaggatgcaa acgctgtcag gggttcagoc tict Caggggc ccctgactga 24 O accttgggca gaagacagtic ccc.ca.gacca gcct c cc cca gctitctg.ccc gct cotcagt 3OO gggtgaagga gagctic cagt atgcatcc ct cagct tccag atggtgaagc Cttgggactic 360 gcggggacag gaggcc actg acaccgagta Ctcggagatc aagat.ccaca gatgagaaac 42O tgcagagact caccctgatt gagggat cac agc.ccct coa ggcaagggag aag 473

<210s, SEQ ID NO 89 &211s LENGTH: 525 &212s. TYPE: DNA <213> ORGANISM: Artificial sequence 22 Os. FEATURE: 223 OTHER INFORMATION: Prole No. 89

<4 OOs, SEQUENCE: 89 tggacaatac Ctggctitt Co. taggcagagg tocctg.cggc Ctt Cogcagt ttttgttgtc.c 6 O

Ctggg tactt gagattaggg agtggtgatg act cittalagg agcatgctgc Cttcaag cat 12 O ctgtttaa.ca aag cacatct togcaccgc.cc ttaatccatt caactctgtg acacago aca 18O tgtttcagag agcacggggt tdgggtaag gttatagatt alacagaatct Caaggcagaa 24 O gaatttittct tag tacagaa caaaatggag tot cotatgt c tact tctitt ctacacagac 3OO acagtaacaa totgat ct ct cittgcttitt.c cccacaggitt gtc attactt aattatttaa 360