Implementing Morpholino-Based Nucleic Acid Sensing on a Portable Surface Plasmon Resonance Instrument for Future Application in Environmental Monitoring

sensors

Article Implementing Morpholino-Based Nucleic Acid Sensing on a Portable Surface Plasmon Resonance Instrument for Future Application in Environmental Monitoring

Andrea Bagi 1,*,† , Scott D. Soelberg 2, Clement E. Furlong 2 and Thierry Baussant 1,†

1 International Research Institute of Stavanger, 4068 Stavanger, Norway; [email protected] 2 Departments of Medicine-Division of Medical Genetics and Genome Sciences, University of Washington, Seattle, WA 98195-5852, USA; [email protected] (S.D.S.); [email protected] (C.E.F.) * Correspondence: [email protected]; Tel.: +47-4664-0398 † The International Research Institute of Stavanger will become part of (and renamed to): “NORCE Norwegian Research Center” from the ﬁrst of October 2018.

Received: 3 September 2018; Accepted: 26 September 2018; Published: 28 September 2018

Abstract: A portable surface plasmon resonance (SPR) instrument was tested for the first time for the detection of oligonucleotide sequences derived from the 16S rRNA gene of Oleispira antarctica RB-8, a bioindicator species of marine oil contamination, using morpholino-functionalized sensor surfaces. We evaluated the stability and specificity of morpholino coated sensor surfaces and tested two signal amplification regimes: (1) sequential injection of sample followed by magnetic bead amplifier and (2) a single injection of magnetic bead captured oligo. We found that the sensor surfaces could be regenerated for at least 85 consecutive sample injections without significant loss of signal intensity. Regarding specificity, the assay clearly differentiated analytes with only one or two mismatches. Signal intensities of mismatch oligos were lower than the exact match target at identical concentrations down to 200 nM, in standard phosphate buffered saline with 0.1 % Tween-20 added. Signal amplification was achieved with both strategies; however, significantly higher response was observed with the sequential approach (up to 16-fold), where first the binding of biotin-probe-labeled target oligo took place on the sensor surface, followed by the binding of the streptavidin magnetic beads onto the immobilized targets. Our experiments so far indicate that a simple coating procedure in combination with a relatively cost-efficient magnetic-bead-based signal amplification will provide robust SPR based nucleic acid sensing down to 0.5 nM of a 45-nucleotide long oligo target (7.2 ng/mL).

Keywords: surface plasmon resonance; 16S rRNA; bacterial detection; hydrocarbon biodegradation; magnetic bead based biosensing; portable biosensor

1. Introduction Molecular techniques in general, and more speciﬁcally, nucleic acid sensing techniques are gradually replacing standard cultivation-dependent laboratory methods in both the public health sector, and environmental monitoring [1–5]. Biosensors in particular are very promising due to their versatility and suitability for miniaturization and integration in autonomous devices [6–8]. A number of signal transduction mechanisms exist and have been explored over the last decades for nucleic acid biosensing. Electrochemical sensors are utilized in the majority of the studies reviewed recently by Du et al. [9]. Surface plasmon resonance (SPR) is a relatively young approach in nucleic acid biosensing, nevertheless it is becoming a popular tool for label-free sensing of a variety of analytes [10,11]. To mention a few nucleic acid sensing examples, SPR has been applied for bacterial

Sensors 2018, 18, 3259; doi:10.3390/s18103259 www.mdpi.com/journal/sensors Sensors 2018, 18, 3259 2 of 17

16S rRNA, single-nucleotide polymorphism and microRNA detection [12–14]. SPR sensing is also currently being implemented on the third generation environmental sample processor (3G-ESP), a device capable of fully autonomous sample collection, analysis, and data transmission over extended deployment periods in the pelagic marine environment [15]. More specifically, the custom-made portable SPR instrument used in this study [16] has been integrated into the 3G-ESP recently. In situ ocean observing systems, such as the ESP have long been recognized as promising tools to provide real-time and high-resolution spatiotemporal data for risk assessment and monitoring of marine environments. Tools like ESP are needed especially in the new frontier of future oil and gas exploration and production activities, i.e., the Arctic and deep waters, to address the problems associated with traditional monitoring approaches [17–19]. Autonomous devices equipped with molecular tools can rapidly detect changes in environmental indicators, including bacterial species that are well-known to respond quickly to oil discharges. Among the obligate hydrocarbon (HC) degraders, the genus Oleispira is one of the most commonly reported cold-adapted alkane degrading genus. It has been identified both in deep-water sediments and the pelagic zone of cold marine habitats. Its genome has been sequenced and biodegradation potential mapped using various HC sources [20,21]. Oleispira was also among the HC-degraders monitored by Królicka et al. who proposed the use of mainly obligate HC degrading bacterial indicator species for the detection of oil leaks [22]. Their study showed the potential application of qPCR quantification of Oleispira antarctia 16S rRNA gene copy number as an indicator of oil exposure, using DNA extraction and qPCR protocols mimicking 2G-ESP procedures. Nevertheless, qPCR is a rather complex and time-consuming technique in comparison to nucleic acid sensing, particularly label-free SPR. SPR-based nucleic acid sensing can be achieved using various recognition elements, including natural DNA oligonucleotides and artificial analogues, such as peptide nucleic acids (PNA), linked nucleic acids (LNA), and morpholinos [23]. These analogues have properties such as better stability on the sensor surface and higher binding strength in comparison to natural DNA probes. Morpholinos are of particular interest as they are extremely stable and show a number of other advantages over their natural DNA counterparts and the other synthetic analogues [24]. Morpholinos are mainly used for in vivo silencing and knock-out experiments due to their resistance to enzymatic degradation [25]. Nevertheless, they are becoming increasingly used in biosensing and biodistribution measurements [26]. The SPR instrument developed in 2007 [16] has so far been used for antibody-based assays, with the aim to detect small molecules, as well as viruses and whole bacteria. Its sensor chip can also be coated with other types of recognition molecules. In this study, we have explored morpholinos as recognition elements to be applied for nucleic acid sensing on this platform. We chose to work with synthetic oligonucleotides representing the 16S rRNA gene sequence of Oleispira antarctica RB-8 in order to develop an assay for future use in 16S rRNA based environmental monitoring of oil pollution events. Our goals were: (1) to test whether an extremely simple coating procedure using morpholinos as recognition elements can provide suitable and robust (regenerable) sensor surface, (2) to assess the specificity of the assay, and (3) to test magnetic-bead-based signal amplification strategies.

2. Materials and Methods

2.1. General Assay Procedures and Materials

2.1.1. SPR Instrument All experiments were carried out with a 4-chip, 12-channel portable SPR instrument (Figure1) manufactured at the University of Washington (Seattle, WA, USA). The current model is a modified version of the instrument described in [27]. The system is housed in a 27 × 25 × 12 cm case and incorporates miniature electronic and fluidic components. It includes temperature control and conditioning of the injected sample (≈±0.01 ◦C), which is a critical parameter of SPR use in field applications or for autonomous environmental sensor applications. The four-chip system is low power (2.6 watts average at 12 volts) and has low flow cell volume (1 µL per channel) and can be used as a 12-channel system. A computer graphical user interface (GUI) was also developed for data display Sensors 2018, 18, x FOR PEER REVIEW 3 of 17

Sensors 2018, 18, 3259 3 of 17 power (2.6 watts average at 12 volts) and has low flow cell volume (1 µL per channel) and can be used as a 12-channel system. A computer graphical user interface (GUI) was also developed for data anddisplay system and control. system Thecontrol. system The was system also was designed also designed to run semi-autonomously. to run semi-autonomously. Autonomous Autonomous operation requiresoperation a ‘start’requires signal a ‘start’ be sent, signal followed be sent, by afollowed sample being by a pumpedsample being or injected pumped into or the injected holding into loop the by theholding user loop or an by outside the user sample or an processor.outside sample The systemprocessor. then The processes system thethen injected processes sample the injected automatically sample throughautomatically a series through of low a power/lowseries of low dead-volume power/low dead-volume valves. Following valves. a Following detection sequence,a detection the sequence, system automaticallythe system automatically performs aperforms regeneration a regeneration sequence sequ by ﬂowingence by a flowing regeneration a regenera solutiontion solution over the over surface the followedsurface followed by ﬂow by of flow starting of starting buffer buffer to reset to the reset system the system for another for another detection detection cycle. cycle.

Figure 1. Photo of the portable surface plasmon resonance instrument connected to a 13” laptop. Figure 1. Photo of the portable surface plasmon resonance instrument connected to a 13” laptop. 2.1.2. Probes 2.1.2. Probes A 24-nucleotide hybridization probe previously used in a sandwich hybridization assay (personal communicationA 24-nucleotide Królicka, hybridization A.) was employedprobe previously as the surface used in immobilized a sandwich detection hybridization probe assay (DP). A(personal morpholino communication oligo of this Królicka, DP sequence A.) was with employ a disulfide-amideed as the surface modification immobilized at detection the 30 end probe was purchased(DP). A morpholino from Gene oligo Tools of LLC this (Philomath, DP sequence OR, with USA). a disulfide-amide The disulfide-amide modification modification at the at 3 the′ end 30 wasend waspurchased used for from attachment Gene Tools of the LLC morpholino (Philomath, to OR, the goldUSA). sensor The disulfide-amide surface. DP was modification checked against at the the 3′ Silvaend was small used subunit for attachment ribosomal of RNA the (16Smorpholino SSU) database to the gold (Version sensor 132, surface. on 3 September DP was checked 2019) using against the onlinethe Silva SILVA small probe subunit match ribosomal and evaluation RNA (16S tool, SSU) TestProbe database 3.0 (Version [28]. Hits 132, with on 0 3 mismatches September all 2019) belonged using tothe the online genus SILVA Oleispira, probe confirming match and the evaluation specificity tool, of the TestProbe DP probe. 3.0 A [28]. previously Hits with published 0 mismatches universal all bacterialbelonged primer to the genus was used Oleispira, as the captureconfirming probe the (CP) specificity [29]. This of wasthe DP purchased probe. A in previously 50-biotinylated published DNA oligouniversal form bacterial (IDT, San primer Jose, CA, was USA). used Sequences as the arecapture shown probe in Table (CP)1. [29]. This was purchased in 5′-biotinylated DNA oligo form (IDT, San Jose, CA, USA). Sequences are shown in Table 1. Table 1. Sequences of probes and target analyte oligonucleotides Table 1. Sequences of probes and target analyte oligonucleotides Name Sequence (50-30) MW (g/mol) Name Sequence (5′-3′) MW (g/mol) DP CTAGCTAATCTCACTCAGGCTCAT-S-S-amide 8243 DP CTAGCTAATCTCACTCAGGCTCAT-S-S-amide 8243 CP Bio-TCTACGCATTTCACCGCTACA 6706 CP Bio-TCTACGCATTTCACCGCTACA 6706 REF ATGAGCCTGAGTGAGATTAGCTAG 7457 REFPC ATGAGCCTGAGTGAGATTAGCTAG/iSp18/TGTAGCGGTGAAATGCGTAGAATGAGCCTGAGTGAGATTAGCTAG 14,3687457 PCM1 ATGAGCCTGAGTGAGATTAGCTAG/iSp18/TGTAGCGGTGAAATGCGTAGAATGAACCTGAGTGAGATTAGCTAG 744114,368 M1M2 ATGAACCTGAGTGAGATTAGCTAGATGAACCTGAGTTAGATTAGCTAG 74167441 M2NC ATGAACCTGAGTTAGATTAGCTAGTGTAGCGGTGAAATGCGTAGA 65507416 NCS-S-amide = disulfide-amide modification.TGTAGCGGTGAAATGCGTAGA Bio = biotin modification. Mismatched nucleotides in M1 (1 mismatch6550 containingS-S-amide oligo)= disulfide-amide and M2 (2 mismatch modification. containing Bio oligo) = biot arein highlighted modification. in bold Mismatched and underlined. nucleotides DP = detection in M1 probe, CP = capture probe, REF = reference Oleispira oligo, PC = positive control combined oligo, and NC = negative (1 mismatch containing oligo) and M2 (2 mismatch containing oligo) are highlighted in bold and control (non-complementary oligo). underlined. DP = detection probe, CP = capture probe, REF = reference Oleispira oligo, PC = positive 2.1.3.control Analytes combined oligo, and NC = negative control (non-complementary oligo). A 24-nucleotide-long segment of the Oleispira 16S rRNA gene (100% complementary to DP) was used as a reference sequence (REF) in all experiments, while a 45-nucleotide long combined

Sensors 2018, 18, 3259 4 of 17 oligo, complementary to both DP and CP was used as positive control (PC) in the amplification tests. PC contained an internal spacer (iSp18, an 18-mer hexa-ethylene-glycol spacer) between the segments complementary to DP and CP. For specificity testing, mismatched oligos containing 1 (M1) or 2 (M2) mismatches to DP were used. To test specificity, an oligo complementary to the universal CP was used as a negative control (NC, 15 mismatches to REF). Sequences are summarized in Table1.

2.1.4. Buffers Dulbecco’s phosphate buffered saline (DPBS) purchased from Sigma-Aldrich Norway AS (Oslo, Norway) containing KCl (0.2 g/L), NaCl (8.0 g/L), KH2PO4 (0.2 g/L), anhydrous Na2HPO4 (1.15 g/L), and DPBS amended with 0.1% Tween-20 (DPBS-T) were used as hybridization and running buffer solutions, respectively. A 50 mM NaOH denaturing solution was used for regenerating the SPR surfaces.

2.1.5. Preparation of Sensor Surfaces Gold surfaces of the SPR sensors were cleaned with a piranha solution (Caution: piranha solution is extremely oxidizing and must not be stored in tightly capped containers on account of gas evolution) prepared by slowly adding 30% H2O2 to a concentrated sulfuric acid solution (three drops H2O2 added to nine drops H2SO4). Approximately 40 µL of this solution was used to cover the gold surface of the sensor for 20 min. The sensor surfaces were then washed with deionized water. Morpholino stock (1 mM in molecular grade water) was ﬁrst diluted to 100 µM in DPBS, then a 20 µL droplet was carefully applied onto the clean gold surface of a sensor chip. Coated sensors were incubated at room temperature in a dark humid chamber at least overnight. Prior to use, the gold surface was rinsed with 1 mL DPBS-T, placed in the sensor slot and referenced with sucrose solution (30 w/v %). For storage, the functionalized surfaces were wicked dry and then stored in a plastic case under dark and dry conditions for up to two months.

2.1.6. Experimental Procedures Each analysis was performed using the fluidics program outlined in Table2. Note that the baseline was established during the two-minute-long initialization step, then the sensors were ‘zeroed’ during the baseline step. The fluidics program was slightly modified for testing the sequential approach, where an additional injection step and subsequent flow and flush steps were included. The total duration of one measurement was between 12 and 24 min, with binding time kept constant at 6 min with a flush step after 4 min.

Table 2. Fluidics program set-up showing the duration and ﬂow rate (controlled by the peristaltic pump) of either buffer (during initialization, binding, and ﬂow) or regeneration solution (during regeneration) for each programmed step.

Step Duration (s) Pump Speed (µL/min) Initialization 120 20 Baseline 0 0 Injection 10 0 Flow 240 20 Flush 7 n.a. Flow 120 20 Regeneration 120 100 Flow 120 100 n.a. = not applicable. The ﬂow rate at the ﬂush step is constant 5 mL/min, regulated by the air pump.

To monitor stability and potential degradation of the signal, a 500 µL aliquot of the reference oligo (REF) at 5 µM concentration was injected and analyzed at the beginning and at the end of each Sensors 2018, 18, 3259 5 of 17 experiment. RIU values at 6 min were recorded and tracked over time. Similarly, the signal of buffer injections was also tracked.

2.1.7. Preparation of Oligos and Magnetic Beads All oligos were prepared in molecular grade water as 1 mM concentration stocks and stored at 4 ◦C. These were diluted in DPBS-T prior to injection and analysis unless otherwise stated. Streptavidin coated magnetic beads (500 nm diameter, 2 mg/mL, BD IMag™ Streptavidin Particles Plus-DM, catalog no. 557812, BD Biosciences, Franklin Lakes, NJ, USA) were washed twice in DPBS and were resuspended in DPBS, in a volume equal to that taken from the original stock. This solution is subsequently called: 1× beads.

2.2. Testing Speciﬁcity The reference sequence (REF), two mismatch oligos (M1 and M2), and a negative control (NC) oligo were injected at various concentrations (50–5000 nM) and RIU values recorded after 6 min of binding were compared. A buffer injection was always carried out between different samples and the RIU values of these injections were used as background values. Oligos were diluted in DPBS-T to ﬁnal concentrations of 50, 200, 1000, or 5000 nM. Measurements were carried out in triplicate except for the 5000 nM samples. Pairwise comparisons between the signal of different oligos at a given concentration were carried out with JMP 5.1 software using Student’s t-test (α = 0.05).

2.3. Testing Two Signal Ampliﬁcation Strategies

2.3.1. Sequential Assay PC oligo and biotin labeled CP probe stock solutions (1 mM) were diluted 10-fold in DPBS buffer. Then 2.5 µL of diluted PC (100 µM) and 2.5 µL of diluted CP (100 µM) were mixed and allowed to hybridize for 20 min at room temperature (approx. 20 ◦C). DPBS-T buffer (495 µL) was then added and the hybridized oligo and probe complex was injected. The binding curve was recorded for 6 min then 1× beads (5, 10, 25, or 50 µL = 10, 20, 50, and 100 µg, respectively) resuspended in DPBS-T (ﬁnal volume of 500 µL) were injected for the ampliﬁcation step (Figure2B). Refractive index units (RIU) values were recorded after 6 min. Measurements were carried out in triplicates. The signal of the bead solution alone was also recorded in triplicate at the beginning of the experiment for each bead concentration as background and subtracted from the sample signals.

2.3.2. Capture Assay PC oligo and biotin labeled CP probe stock solutions (1 mM) were diluted 10-fold in DPBS buffer, then 2.5 µL diluted PC (100 µM) and 2.5 µL diluted CP (100 µM) was mixed and allowed to hybridize for 20 min at room temperature (approx. 20 ◦C). Afterwards, DPBS buffer (445–490 µL depending on the volume of streptavidin beads) and 1× beads (5, 10, 25, or 50 µL = 10, 20, 50, and 100 µg, respectively) were added and mixed. Following a 10 min incubation at room temperature, the mix was placed on a magnetic rack and separation was carried out for at least 10 min. Supernatant was then removed with a pipette, conjugated beads were resuspended in 500 µL DPBS-T running buffer and injected immediately (Figure2A). RIU values were recorded after 6 min. Measurements were carried out in triplicates. Sensors 2018, 18, 3259 6 of 17 Sensors 2018, 18, x FOR PEER REVIEW 6 of 17

Figure 2. Illustration of the two different ampliﬁcation strategies: capture approach (A) and sequential Figure 2. Illustration of the two different amplification strategies: capture approach (A) and approach (B). The ﬁrst step (1) was identical in both cases: the hybridization of positive control (PC) sequential approach (B). The first step (1) was identical in both cases: the hybridization of positive oligo with the biotin labeled capture probe (CP) took place. The second step (2) in the capture approach control (PC) oligo with the biotin labeled capture probe (CP) took place. The second step (2) in the was to conjugate the biotin labeled hybridized oligo-probe complex to the streptavidin coated magnetic capture approach was to conjugate the biotin labeled hybridized oligo-probe complex to the beads, while in the sequential approach, the oligo-probe complex was injected and its binding to the streptavidin coated magnetic beads, while in the sequential approach, the oligo-probe complex was morpholino functionalized surface was recorded. Finally, in the third step (3) of the capture approach, injected and its binding to the morpholino functionalized surface was recorded. Finally, in the third oligo-probe complex conjugated magnetic beads were injected and a single binding curve was recorded. step (3) of the capture approach, oligo-probe complex conjugated magnetic beads were injected and a In case of the sequential approach, streptavidin coated magnetic beads were injected and the second single binding curve was recorded. In case of the sequential approach, streptavidin coated magnetic binding curve, binding of beads to immobilized biotin-labeled oligo-probe complex was recorded. beads were injected and the second binding curve, binding of beads to immobilized biotin-labeled 2.4. Testingoligo-probe the Detection complex Limitswas recorded.

2.4. TestingDetection the Detection limits were Limits tested using the REF oligo alone and using the PC oligo in combination with sequential magnetic bead signal amplification. For the first experiment, a serial dilution of the REF oligoDetection samples limits at were concentrations tested using of the 50, REF 200, oligo 500, 1000,alone andand 5000using nM the were PC oligo analyzed in combination using the samewith sequential fluidics program magnetic described bead signal in Table amplification.2. For the secondFor the experiment,first experiment, a 10-fold a serial serial dilution dilution of the of theREF PC oligo oligo samples (0.1–100 at concentrationsµM) was prepared of 50, and 200, assays 500, 1000, were and carried 5000 out nM as were described analyzed for using the sequential the same approachfluidics program with final described concentrations in Table of2. PCFor atthe 0.5, second 5, 50, experiment, and 500 nM. a The10-fold concentration serial dilution of CPof the probe PC workingoligo (0.1–100 solution µM) was was kept prepared constant and at 100assaysµM were for all carried tested out PC concentrationsas described for to the ensure sequential excess. Allapproach measurements with final were concentrations carried out in of triplicates. PC at 0.5, 5, 50, and 500 nM. The concentration of CP probe working solution was kept constant at 100 µM for all tested PC concentrations to ensure excess. All 3.measurements Results and Discussionwere carried out in triplicates.

3.1.3. Results General and Assay Discussion Procedures Preparation of SPR sensor surfaces can require elaborate procedures (largely depending on the chemistry3.1. General used Assay for Procedures binding the oligo to the gold surface) in order to ensure optimal coverage, probe orientation,Preparation and to of minimize SPR sensor the surfacesurfaces area can of require bare-gold elaborate sites available procedures for non-specific (largely depending adsorption on [ 30the]. Thischemistry is however used for not binding always the necessary, oligo to instead the gold rather surface) simple in order coating to ensure procedures optimal can coverage, be sufficient probe to improveorientation, the and orientation to minimize of the the DNA surface probes area andof bare-gold to attenuate sites non-specific available for binding, non-specific such adsorption as a short post-treatment[30]. This is however with 6-mercapto-1-hexanol not always necessary, [12] orin usingstead 11-mercaptoundecanoicrather simple coating procedures acid as a linker can forbe immobilizingsufficient to improve ssDNA probesthe orientation [31]. Surface of the passivation DNA probes of thiol-modified and to attenuate morpholino non-specific coated binding, sensors such can beas performeda short post-treatment similarly by with applying 6-mercapto-1-hexanol short alkanethiols, [12] but or this using process 11-mercaptoundecanoic requires careful optimization acid as a oflinker alkanethiol for immobilizing concentration ssDNA and probes incubation [31]. timeSurface [32 passivation]. Our approach of thiol-modified was even simpler, morpholino similar coated to the strategysensors can reported be performed by Liu et similarly al. [33]. After by applying cleaning short the surfaces alkanethiols, with piranha but this solution, process therequires morpholino careful optimization of alkanethiol concentration and incubation time [32]. Our approach was even simpler,

Sensors 2018,, 18,, 3259x FOR PEER REVIEW 77 of of 17 similar to the strategy reported by Liu et al. [33]. After cleaning the surfaces with piranha solution, layerthe morpholino was created layer by incubating was created the surfaceby incubating with a dropletthe surface (20 µ L)with of concentrateda droplet (20(100 µL)µ ofM) concentrated morpholino probe(100 µM) solution morpholino overnight. probe The disulfide-amidesolution overnight. modification The disulfide-amide used here, in modification contrast to the used more here, widely in usedcontrast thiol to (–SH)the more modification, widely used enabled thiol a(–SH) strong modi andfication, long-lasting enabled bond a strong between and the long-lasting gold surface bond and thebetween morpholino the gold probes. surface Measurement and the morpholino results of theprob REFes. oligoMeasurement were nearly results constant of the for REF over oligo 85 sample were injectionsnearly constant (approx. for 100 over regeneration 85 sample cycles)injections with (app no significantrox. 100 regeneration decrease in signalcycles) intensity with no as significant shown in Figuredecrease3. Thisin signal ability intensity of maintaining as shown responsivity in Figure 3. (reusability)This ability of for maintaining such a large responsivity number of samples (reusability) (i.e., regenerationfor such a large cycles) number is extremely of samples advantageous (i.e., regene whenration considering cycles) potentialis extrem long-termely advantageous deployment when of automatedconsidering remote potential sensing long-term equipment. deployment of automated remote sensing equipment.

Figure 3. Refractive index unit (RIU) measured after 6 min of incubation for the reference sequence (REF) at the beginningbeginning (REF-start)(REF-start) andand atat thethe endend (REF-end)(REF-end) ofof eacheach experiment.experiment.

A possible reason reason for for such such a arobust robust surface, surface, besi besidesdes the the nature nature of ofsulfhydryl sulfhydryl linkage, linkage, might might be bedue due to the to thehigh high probe probe coverage coverage of the of thesensor sensor (Figure (Figure 4). The4). Thegold gold surface surface area areaon the on SPREETA the SPREETA chip 2 21 chipis approximately is approximately 4.5 × 4.5 9.5× 9.5mm mm (0.4275 (0.4275 cm cm2). During). During the the coating coating procedure procedure ~10 ~1021 moleculesmolecules are 21 2 introduced ontoonto this this area. area. Theoretically, Theoretically, this this could could result result is a is coverage a coverage of 2.8 of× 2.810 × 10molecules/cm21 molecules/cmif all2 if moleculesall molecules could could form form a sulfhydryl a sulfhydryl linkage linkage with the with gold the surface, gold surface, however however this is unlikely. this is Aunlikely. maximum A coveragemaximum can coverage be estimated can be assumingestimated thatassuming the diameter that the of diameter the morpholino of the morpholino probe is similar probe tois ssDNAsimilar 2 (~0.5to ssDNA nm) [(~0.534], hencenm) [34], the hence area occupied the area byoccu a singlepied by probe a single would probe be would 0.785 nm be 0.785leading nm2 to leading an estimate to an 13 forestimate the maximum for the maximum number ofnumber molecules of molecules (of the DP (of probe) the DP to probe) attach to to attach be ~5.4 to ×be10 ~5.4. × This 1013 is. This much is 12 closermuch closer to the coverageto the coverage reported reported for a morpholino for a morpholino based based biosensor biosensor (on the (on order the oforder magnitude of magnitude ~10 2 molecules/cm~1012 molecules/cm)[35].2) The[35]. coverage The coverage of the sensorsof the sensors used here used was here most was likely most higher likely than higher the minimum than the 11 2 coverageminimum establishedcoverage established for a surface for a plasmon surface plasmon diffraction diffraction sensor (~1.1 sensor× (~1.110 ×molecules/cm 1011 molecules/cm)[362].) For[36]. comparison, For comparison, an optimal an optimal morpholino morpholino monolayer monolayer was prepared was prepared by incubation by incubation with 0.25 withµM 0.25 solution µM 12 2 (insolution deionized (in deionized water) resultingwater) resulting in 5 × in10 5 ×probes/cm 1012 probes/cmfor2 anfor electrochemicalan electrochemical sensor sensor [32 [32]] while while a self-assembleda self-assembled DNA DNA oligo oligo layer layer was preparedwas prepared by incubating by incubating 10 µL of a10 10 µL ng/ ofµL a (1 10µM) ng/µL concentration (1 µM) oligoconcentration solution oligo on a solution gold surface on a gold by [ 33surface]. The by large [33]. excess The large of morpholino excess of morpholino introduced introduced to the gold to surfacethe gold used surface inthis used study, in this most study, likely most resulted likely resulted in maximal in maximal coverage, coverage, ensuring ensuring high enough high enough density ofdensity the morpholino of the morpholino probes on probes the SPR on chip,the SPR leaving chip no, leaving bare-gold no sitesbare-gold for non-speciﬁc sites for non-specific adsorption (Figureadsorption4). This (Figure may 4). have This also may been have the also reason been for the the reason observed for the low observed levels of low non-speciﬁc levels of non-specific adsorption onadsorption morpholino on morpholino coated sensors coated in comparison sensors in comparison to bare-gold to surfaces bare-gold used surfaces as control used (data as control not shown). (data not shown).

Sensors 2018, 18, 3259 8 of 17 Sensors 2018, 18, x FOR PEER REVIEW 8 of 17

Figure 4. Illustration of the potential difference between a short alkanethiol passivated gold surface Figure 4. Illustration of the potential difference between a short alkanethiol passivated gold surface with lower probe coverage (A) and a high-density probe coverage without passivation step such as with lower probe coverage (A) and a high-density probe coverage without passivation step such as the case in this study (B). Chemical structure of the disulfide-amide modification at the 30-end of the the case in this study (B). Chemical structure of the disulfide-amide modification at the 3′-end of the morpholino oligos is shown in the inset. DP probe = detection probe. morpholino oligos is shown in the inset. DP probe = detection probe. 3.2. Testing Specificity 3.2. Testing Specificity Morpholino probe-based biosensors are expected to exhibit superior selectivity over DNA oligo-basedMorpholino counterparts probe-based as mismatches biosensors haveare expected a higher to destabilizing exhibit superior effect selectivity on morpholino-DNA over DNA hybridsoligo-based than counterparts on DNA–DNA as hybridsmismatches [23]. have Morpholino-functionalized a higher destabilizing electrochemicaleffect on morpholino-DNA biosensors in particularhybrids than have on reported DNA–DNA high specificityhybrids [23]. discriminating Morpholino-functionalized one mismatch target electrochemical from 100% complementary biosensors in targetsparticular [29 ,36have]. Observed reported lowerhigh affinityspecificity of morpholinodiscriminating probes, one inmismatch comparison target the DNAfrom probes,100% wascomplementary hypothesized targets to be responsible[29,36]. Observed for enhanced lower affinity selectivity–since of morpholino longer probes, perfect in match comparison regions the are necessaryDNA probes, for awas high-enough-affinity hypothesized to be binding responsible between for morpholinoenhanced selectivity–since probe and its DNA longer target perfect [37 ]. Moreover,match regions morpholino-DNA are necessary for hybrids a high-enough-af can be formedfinity at binding such low between salt concentrations, morpholino probe which and would its normallyDNA target prohibit [37]. DNA–DNA Moreover, hybridization. morpholino-DNA While thehybrids binding can affinity be offormed morpholino at such probes low towards salt DNAconcentrations, in solution which is insensitive would tonormally the ionic prohibit strength DNA–DNA of the buffer, hybridization. surface immobilized While the morpholinos binding exhibitaffinity fasterof morpholino binding kineticsprobes towards under high DNA salt in concentrationssolution is insensitive [23]. Signal to the intensity ionic strength for the of 100%the buffer, surface immobilized morpholinos exhibit faster binding kinetics under high salt complementary oligo (REF), 1 mismatch (M1), 2 mismatch (M2), and non-complementary (NC) concentrations [23]. Signal intensity for the 100% complementary oligo (REF), 1 mismatch (M1), 2 sequences in this study, was recorded at four different oligo concentrations using a medium salt mismatch (M2), and non-complementary (NC) sequences in this study, was recorded at four buffer (~150 mM NaCl in DPBS-T) (Figure5, Left panel). As expected, the REF oligo gave the highest different oligo concentrations using a medium salt buffer (~150 mM NaCl in DPBS-T) (Figure 5, Left signal intensity, except for the lowest tested concentration (50 nM) where surprisingly the 1 mismatch panel). As expected, the REF oligo gave the highest signal intensity, except for the lowest tested containing oligo gave a higher signal, although the difference between REF and M1 was not significant concentration (50 nM) where surprisingly the 1 mismatch containing oligo gave a higher signal, (Student’s t-test, p > 0.05). The non-complementary sequence (containing 15 mismatches to DP) was although the difference between REF and M1 was not significant (Student’s t-test, p > 0.05). The nearly indistinguishable from the background (buffer injected), except for the 200 nM case where it non-complementary sequence (containing 15 mismatches to DP) was nearly indistinguishable from was higher than the buffer signal, again, the difference was not significant (Student’s t-test, p > 0.05). the background (buffer injected), except for the 200 nM case where it was higher than the buffer DNA-probe based studies often reported similar results, in the sense that DNA or RNA analytes with signal, again, the difference was not significant (Student’s t-test, p > 0.05). DNA-probe based studies only one or two mismatches give relatively high signals [38,39]. In contrast, a morpholino capture often reported similar results, in the sense that DNA or RNA analytes with only one or two probe based electrochemical sensor for microRNA showed excellent selectivity at 100 fM miRNA mismatches give relatively high signals [38,39]. In contrast, a morpholino capture probe based concentration,electrochemical with sensor a signal for microRNA of the one-mismatch showed excellent target selectivity being 7% andat 100 a signalfM miRNA of the concentration, two-mismatch targetwith a being signal only of the 2% one-mismatch of the signal measuredtarget being for 7% the and fully a signal complementary of the two-mismatch sequence [ 40target]. This being was mostonly likely2% of achievable the signal asmeasured a result offor the the temperature fully complementary control employed, sequence namely [40]. This that thewas hybridization most likely ◦ stepachievable took place as a atresult 60 C of ensuring the temperature specific annealingcontrol employed, of probe namely to template. that the Such hybridization temperature step control took is usuallyplace at not 60 incorporated°C ensuring specific in SPR annealing systems, which of probe generally to template. seem Such to struggle temperature with mismatched control is usually targets containingnot incorporated only one in or SPR two mismatchedsystems, which oligonucleotides. generally seem Even to astruggle highly sensitivewith mismatched assay presented targets by Dingcontaining et al. [ 14only] was one characterized or two mismatched by a signal oligonucleot of the one-mismatchides. Even a targethighly being sensitive approx. assay 20% presented of the fully by complementaryDing et al. [14] sequencewas characterized at 10 nM. by This a valuesignal droppedof the one-mismatch to approx. 16% target at the being 1 nM approx. concentration 20% of level.the Nevertheless,fully complementary the signal sequence intensity at of 10 the nM. one- This and two-mismatchvalue dropped targets to approx. at such 16% low at concentration the 1 nM (1concentration and 10 nM) waslevel. very Nevertheless, close to that the of signal the background intensity of the while one- the and 100% two-mismatch complementary targets target at such was significantlylow concentration higher. It(1 willand be 10 interesting nM) was to very perform close a mismatchto that oftest the with background an optimized while amplification the 100% complementary target was significantly higher. It will be interesting to perform a mismatch test with

Sensors 2018, 18, x FOR PEER REVIEW 9 of 17 Sensors 2018, 18, 3259 9 of 17

an optimized amplification protocol and assess the selectivity of our assay at lower than 50 nM protocolconcentration. and assess Finally, the it selectivity is worth ofnoting our assaythat one at lower way proposed than 50 nM to concentration.distinguish mismatched Finally, it isoligos worth in notingcase of thatDNA–DNA one way hybridization, proposed to distinguish was to compare mismatched the kinetics oligos of in the case rinsing of DNA–DNA step, as the hybridization, mismatched wastargets to compare were apparently the kinetics washed of the rinsingout faster step, [34]. as the This mismatched was however targets not were observed apparently in our washed case. The out fastersignal [ 34of ].M1 This and was M2 howeversamples notat 5 observedµM concentration in our case. did Thenot show signal the of M1large and drop M2 found samples by atYu 5 etµ Mal. concentration2004 (Figure 5, did right not panel) show the[36]. large drop found by Yu et al. 2004 (Figure5, right panel) [36].

FigureFigure 5.5. RefractiveRefractive indexindex unitsunits (RIU)(RIU) measuredmeasured afterafter 66 minmin ((LeftLeft panel)panel) andand bindingbinding curvescurves atat 55 µµMM concentrationconcentration ((RightRight panel)panel) forfor 100%100% complementarycomplementary (REF),(REF), one-mismatchone-mismatch (M1),(M1), two-mismatchtwo-mismatch (M2)(M2) andand non-complementarynon-complementary (NC)(NC) sequencessequences atat fourfour differentdifferent concentrations.concentrations. n == 3 exceptexcept forfor thethe 55 µµMM casecase wherewhere onlyonly oneone setset ofof measurementsmeasurements werewere carried carried out. out.

Usually,Usually, the the observations observations regarding regarding mismatched mismatched targets targets are interpretedare interpreted as the as ability the ability of the sensorof the tosensor distinguish to distinguish one- or two-mismatchone- or two-mismatch oligos from oligos the from target. the Under target. circumstances, Under circumstances, when the when analyte the isanalyte extremely is extremely pure, and pure, its concentration and its concentration is known, suchis known, ability cansuch be ability indeed can used be to indeed discriminate used to a ‘mutant’discriminate nucleic a ‘mutant’ acid sequence nucleic fromacid thesequence ‘wild-type’ from the [13 ,‘wild-type’41]. However, [13,41]. when However, it comes when to specifically it comes detectingto specifically a target detecting biomarker a target species biomarker from an entire species community from an ofentire bacteria, community this ‘ability’ of bacteria, can prove this to be‘ability’ less advantageous. can prove to Detection be less advantageous. of 16S rRNA genes Detection from otherof 16S non-oil rRNA degrading genes from bacteria other with non-oil one ordegrading two mismatches bacteria compared with one to or the two target mismatches species could compared lead to to false-positive the target results,species suggestingcould lead the to presencefalse-positive of oil results, degrading suggesting bacteria the when presence they are of not oil present.degrading Nevertheless, bacteria when bacteria they with are not only present. one or twoNevertheless, mismatches bacteria in a given with region only on ofe the or 16Stwo rRNA mismatches are likely in a phylogenetically given region of closelythe 16S relatedrRNA are and likely may evenphylogenetically be functionally closely similar related to each and other. may Thiseven appears be functionally to be the similar case for to some each of other. the Oleispira-related This appears to marinebe the case hydrocarbon for some degradingof the Oleispira-related bacteria. Thalassolituus marine hydrocarbon oleivorans strain degrading MIL-1, bacteria. contains Thalassolituus only a single mismatcholeivorans instrain the DP-targetedMIL-1, contains region only of a its single 16S rRNA mismatch in comparison in the DP-targeted to Oleispira region antarctica of itsRB-8, 16S rRNA despite in thecomparison overall sequence to Oleispira identity antarctica of 92%RB-8, between despite the the overall two strains. sequence The identity 16S rRNA of 92% gene between sequence the two of Spongiispirastrains. The norvegica16S rRNAstrain gene Gp_4_7.1, sequence a of closely Spongiispira related norvegica Oceanospirillacaea strain Gp_4_7.1, member a closely had only related two mismatches.Oceanospirillacaea Other closely member related had non-Oleispiraonly two mismatch strainses. reported Other toclosely have similarrelated physiology,non-OleispiraBermanella strains marisrubrireported tostrain have RED65, similar and physiology,Oceaniserpentilla Bermanella haliotis marisrubristrain DSMstrain 19503 RED65, had and three Oceaniserpentilla and two mismatches, haliotis respectively.strain DSM 19503 These observationshad three and illustrate two mismatches, that perhaps respectively. the approach These reported observat hereions could illustrate be suitable that toperhaps detect athe suit approach of bacteria reported belonging here to could a functionally be suitable similar to detect phylogenetic a suit of assemblagebacteria belonging rather thanto a afunctionally single species. similar Such aphylogenetic case was demonstrated assemblage byrather a chemiluminescence than a single species. assay designed Such afor case marine was Vibriodemonstrated species, whereby a chemiluminescence the two selected Vibrio-specific assay designed probes for (capturemarine Vibrio and signal) species, could where differentiate the two 21selected Vibrio Vibrio-specific vs. 10 non-Vibrio probes species (capture at 20 and ng/ signµLal) (~50 could nM, differentiate M16Sr RNA 21 = 491.528Vibrio vs. kDa) 10 non-Vibrio total RNA concentrationspecies at 20 ng/µL [42]. Using(~50 nM, a dual M16Sr Oleispira-specific RNA = 491.528 kDa) probe total (both RNA capture concentration and detection [42]. Using probe a to dual be designedOleispira-specific specifically probe for Oleispira) (both capture may beand an detection alternative probe to increase to be designed specificity. specifically In any case, for assessment Oleispira) ofmay hybridization-based be an alternative assaysto increase as performed specificity. by In Da-Silva any case, et al. assessment [42] are necessary of hybridization-based and should be carried assays outas performed to validate by results Da-Silva with et our al. SPR [42] systemare necessary as well. and should be carried out to validate results with our SPR system as well.

Sensors 2018, 18, 3259 10 of 17

3.3. Testing Two Signal Amplification Strategies Magnetic beads (usually 1 µm diameter) are routinely used for nucleic acid separation procedures. In SPR systems, usually smaller diameter gold-nanoparticles are used for signal amplification [31,37,38]. However, they are more expensive and due to small size are amenable to colloidal aggregation. We chose to work with larger beads coated with a streptavidin monolayer as a more cost-efficient and a more stable alternative. Streptavidin alone was shown to be a promising signal amplifier [14]. Larger beads will also result in greater signal amplification as long as they can be captured by the evanescent wave. The sensor chip in the SPR system used in this study uses an 830 nm light-emitting diode light source, providing a probing distance of approximately 400 nm into the medium. Thus the 500 nm beads, which are polydisperse, ranging in size from 50–450 nm, with a mean of 200 nm are still within the range of detection of the SPREETA sensor. Another reason for focusing on using larger beads was that in the future, we plan to implement magnetic separation-based capture of bacterial rRNA prior to injection into the SPR system. This step can be carried out fastest by using larger diameter beads. The two signal amplification strategies reported here were designed in accordance with the findings of Da-Silva et al. [39]. There the authors established that a prior hybridization of the biotin labeled capture probe with the target sequence followed by binding of this complex to the immobilized detection probe resulted in the highest response out of the three different strategies tested. Another possible approach would be to first conjugate the magnetic beads with the biotin labeled probes then perform the capture by hybridizing the target with the already conjugated probes (direct capture). However, indirect capture approach (hybridizing DNA-probe first then adding beads) seems better than direct capture (saturating beads with probes and then capturing by hybridization) according to [40]. Although the authors did not provide discussion regarding the possible reasons, this phenomenon may be explained in terms of relief of steric repulsion during binding of the oligonucleotides. In this study, we first tested whether 500 nm diameter beads resulted in significant signal amplification in our SPR system, then a capture approach was also evaluated. An example binding curve for the two strategies is shown in Figure6. The first 6 min of the capture approach (Figure6B) were set at constant 0 as there was nothing being injected at this stage while the oligo-probe complex was being injected in the sequential approach. The first downward facing arrow in Figure6A points at the second injection step of the sequential approach, while in Figure6B, it points at the first and only injection step of the capture approach. Both curves were recorded at 500 nM PC oligo concentration and 50 µL 1× bead amount. The results showed that the magnetic beads indeed resulted in signal amplification (Figure7) in comparison to injecting only the hybridized oligo-probe complex. Using 50 µL of the 1× bead stock solution (100 µg beads) resulted in the highest amplification factor for both strategies (Table3). Sensors 2018, 18, x FOR PEER REVIEW 10 of 17

3.3. Testing Two Signal Amplification Strategies Magnetic beads (usually 1 µm diameter) are routinely used for nucleic acid separation procedures. In SPR systems, usually smaller diameter gold-nanoparticles are used for signal amplification [31,37,38]. However, they are more expensive and due to small size are amenable to colloidal aggregation. We chose to work with larger beads coated with a streptavidin monolayer as a more cost-efficient and a more stable alternative. Streptavidin alone was shown to be a promising signal amplifier [14]. Larger beads will also result in greater signal amplification as long as they can be captured by the evanescent wave. The sensor chip in the SPR system used in this study uses an 830 nm light-emitting diode light source, providing a probing distance of approximately 400 nm into the medium. Thus the 500 nm beads, which are polydisperse, ranging in size from 50–450 nm, with a mean of 200 nm are still within the range of detection of the SPREETA sensor. Another reason for focusing on using larger beads was that in the future, we plan to implement magnetic separation-based capture of bacterial rRNA prior to injection into the SPR system. This step can be carried out fastest by using larger diameter beads. The two signal amplification strategies reported here were designed in accordance with the findings of Da-Silva et al. [39]. There the authors established that a prior hybridization of the biotin labeled capture probe with the target sequence followed by binding of this complex to the immobilized detection probe resulted in the highest response out of the three different strategies tested. Another possible approach would be to first conjugate the magnetic beads with the biotin labeled probes then perform the capture by hybridizing the target with the already conjugated probes (direct capture). However, indirect capture approach (hybridizing DNA-probe first then adding beads) seems better than direct capture (saturating beads with probes and then capturing by hybridization) according to [40]. Although the authors did not provide discussion regarding the possible reasons, this phenomenon may be explained in terms of relief of steric repulsion during Sensors 2018, 18, 3259 11 of 17 binding of the oligonucleotides.

Sensors 2018, 18, x FOR PEER REVIEW 11 of 17 curve for the two strategies is shown in Figure 6. The first 6 min of the capture approach (Figure 6B) were set at constant 0 as there was nothing being injected at this stage while the oligo-probe complex was being injected in the sequential approach. The first downward facing arrow in Figure 6A points at theFigureFigure second 6.6. Refractiveinjection Refractive indexstep index of units theunits (RIU) sequential (RIU) recorded recorded approa over timeoverch, for whiletime the two forin Figure amplificationthe two 6B, amplification it strategies,points at sequential strategies,the first and only (sequentialinjectionA) and capture (stepA) and (Bof) capture atthe identical capture (B) at target identical approach. analyte target (PC Bo analyte oligo)th curves (PC concentration olig wereo) concentration recorded (500 nM) andat(500 500 using nM) nM and the PC sameusing oligo × µ µ concentrationamountthe same of amountand 1 50beads µLof 1× 1× (50 beads beadL= (50 amount. 100 µL g).= 100 The µg). illustrations The illustrations correspond correspond to the to steps the steps described described in the in Materials and Methods section and symbols are identical to those used in Figure2. The y axes were Thethe resultsMaterials showed and Methods that the section magnetic and symbolsbeads indeed are identical resulted to thosein signal used amplification in Figure 2. The (Figure y axes 7) in scaled to maximum 1600 RIU for both plots. The second, upward pointing arrow marks the ‘flush’ step, comparisonwere scaled to injecting to maximum only the1600 hybridized RIU for both oligo-probe plots. The second,complex. upward Using pointing 50 µL of arrow the 1×marks bead the stock where the injection loop was flushed with buffer, hence no more analyte was being introduced from solution‘flush’ (100 step, µg beads)where theresulted injection in theloop highest was flushe amplificationd with buffer, factor hence for bothno more strategies analyte (Table was being 3). the injection loop to the sensor surface after this point. introduced from the injection loop to the sensor surface after this point.

In this study, we first tested whether 500 nm diameter beads resulted in significant signal amplification in our SPR system, then a capture approach was also evaluated. An example binding

FigureFigure 7. 7. ComparisonComparison between thethe twotwo signalsignalamplification amplification strategies strategies at at different different bead bead amounts amounts (5, (5, 10, 10,25, 25, and and 50 µ50L) µL) at constantat constant oligo oligo and and probe probe concentration concentration (500 (500 nM). nM). Table 3. The extent of signal amplification achieved using 4 different 1× bead amounts (5, 10, Table25, or 3. 50 TheµL) extent by either of signal thecapture amplification or the achieved sequential using approach 4 different in comparison 1× bead amounts to no amplification. (5, 10, 25, or 50The µL) amplification by either factorsthe capture were calculatedor the sequential by dividing approach the signal in ofcomparison either sequential to no oramplification. capture enhanced The amplificationrefractive index factors units were (RIU) calculated by that ofby thedividing RIU of the oligo-probe signal of either complexes sequential alone. or Thecapture signal enhanced of bead refractivesolutions injectedindex units alone (RIU) was by subtracted that of the prior RIU to calculatingof oligo-probe the ratioscomplexes (n = 3).alone. The signal of bead solutions injected alone was subtracted prior to calculating the ratios (n = 3). Amplification Factors (±SD) Amplification Factors (±SD) 5 µL 10 µL 25 µL 50 µL 5 µL 10 µL 25 µL 50 µL ± ± ± ± CaptureCapture 1.1 1.1 ±0.03 0.03 2.0 2.0 ± 0.220.22 3.5 3.5 ± 0.310.31 6.0 ± 6.0 0.6 0.6 Sequential 3.2 ± 0.32 5.8 ± 0.38 9.7 ± 3.08 15.5 ± 0.70 Sequential 3.2 ± 0.32 5.8 ± 0.38 9.7 ± 3.08 15.5 ± 0.70

However, the signal observed with the sequential approach was significantly higher than that of the capture approach. After the capture experiment, the supernatant was collected and injected separately to confirm the presence of ‘leftover’ oligo-probe complexes. Such experiments showed that most likely there is a low efficiency in capturing the hybridized oligo-probe complexes onto the beads as there was clear binding taking place when injecting the supernatant (data not shown). This indicated the need for further optimizing the protocol for oligo capture in our future experiments. There could have been reasons, other than the capture procedure not being optimized yet, for the observed differences between the two strategies. To illustrate in a realistic manner the difference between the capture and the sequential approach, particularly in the bead injection step, a size-proportional image was created (Figure 8). This representation clearly shows that unless the coverage of the magnetic bead with conjugated oligo-probe complexes is as high as that of the gold surface, the probability of the bead binding to the surface seems to be reduced in the capture scenario (Figure 8A). It is also worth noticing that while in the sequential scenario, a biotin–streptavidin binding takes place, which is a fast and extremely high-affinity process (Kd on the order of ≈10−14 mol/L), in

Sensors 2018, 18, 3259 12 of 17

However, the signal observed with the sequential approach was significantly higher than that of the capture approach. After the capture experiment, the supernatant was collected and injected separately to confirm the presence of ‘leftover’ oligo-probe complexes. Such experiments showed that most likely there is a low efficiency in capturing the hybridized oligo-probe complexes onto the beads as there was clear binding taking place when injecting the supernatant (data not shown). This indicated the need for further optimizing the protocol for oligo capture in our future experiments. There could have been reasons, other than the capture procedure not being optimized yet, for the observed differences between the two strategies. To illustrate in a realistic manner the difference between the capture and the sequential approach, particularly in the bead injection step, a size-proportional image was created (Figure8). This representation clearly shows that unless the coverage of the magnetic bead with conjugated oligo-probe complexes is as high as that of the gold surface, the probability of the bead binding to the surface seems to be reduced in the capture scenario (Figure8A). It is alsoSensors worth 2018, 18 noticing, x FOR PEER that REVIEW while in the sequential scenario, a biotin–streptavidin binding takes12 place, of 17 −14 which is a fast and extremely high-affinity process (Kd on the order of ≈10 mol/L), in the case of thethe capturecase of the approach, capture a approach, morpholino–DNA a morpholino–DNA hybridization hybridization must occur must in order occur for in the order bead for to the become bead bound.to become While bound. morpholino–DNA While morpholino–DNA hybridization hybridization is still a high is affinity still a high binding affinity process, binding the dissociationprocess, the constantsdissociation (K dconstants) of this reaction (Kd) of this were reaction found towere be overfound 3 ordersto be over of magnitude 3 orders of higher, magnitude on the higher, order on of −10 10the ordermol/L of (0.18 10−10± mol/L0.02 nM (0.18 for a± 25-nucleotide0.02 nM for tetramethyla 25-nucleotide rhodamine tetramethyl labeled rhodamine morpholino labeled probe andmorpholino 0.31 ± 0.04 probe nM and for a0.31 25-nucleotide ± 0.04 nM Alexa488for a 25-nucl labeledeotide morpholino Alexa488 labeled probe) inmorpholino a solution probe) containing in a 10solution mM Tris containing (pH 7.5) and10 mM 1 mM Tris EDTA (pH 7.5) [41]. and The 1 same mM authorsEDTA [41]. also The determined same authors hybridization also determined rates of thehybridization morpholino rates probes of the to morpholino the target DNA probes in highto the salt target (150 DNA mM NaCl,in high similar salt (150 to themM DPBS-T NaCl, similar buffer usedto the in DPBS-T this study) buffer and used in low in this salt study) (5 mM and NaCl) in bufferslow salt and (5 mM found NaCl) that buffers the rate and was found three timesthat the higher rate 5 −1 −1 5 −1 −1 inwas the three low times salt ((15 higher± 2) in× the10 lowM salt·s ((15) in ± comparison2) × 105 M−1·s to−1) the in comparison high salt ((4.8 to ±the0.5) high× salt10 ((4.8M ·±s 0.5)). This× 105 suggests M−1·s−1). thatThis lowering suggests the that salt lowering concentration the salt in ourconcentration assay may in improve our assay the conditionsmay improve for thethe bindingconditions of conjugatedfor the binding magnetic of conjugated beads. magnetic beads.

Figure 8. Illustration of the difference between the two signal ampliﬁcation strategies, capture (A) and Figure 8. Illustration of the difference between the two signal amplification strategies, capture (A) sequential (B) when it comes to the bead injection step. Oligo-probe conjugated beads are binding to the and sequential (B) when it comes to the bead injection step. Oligo-probe conjugated beads are morpholino functionalized gold surface in the case of the capture approach (A) and bare-streptavidin binding to the morpholino functionalized gold surface in the case of the capture approach (A) and coated beads are binding to the biotin labeled and immobilized oligo-probe complexes in the case of bare-streptavidin coated beads are binding to the biotin labeled and immobilized oligo-probe the sequential approach (B). The illustration is size-proportional, diameter of the magnetic particles is complexes in the case of the sequential approach (B). The illustration is size-proportional, diameter 500 nm while the length of DP and CP is ~8 nm while PC is ~17 nm long. of the magnetic particles is 500 nm while the length of DP and CP is ~8 nm while PC is ~17 nm long.

3.4. Testing the Detection Limits The average buffer signal over the 85 sample injections was 7.3 ± 2.5 RIU estimating an LOD at approximately 30 RIU (considering the limit to be at three times the background signal). Taking this into account, the lowest detectable concentration of the Oleispira oligo (REF) without any amplification was 50 nM (373 pg/µL). Results from the serial dilution of the REF oligo are shown in Figure 9.

Sensors 2018, 18, 3259 13 of 17

3.4. Testing the Detection Limits The average buffer signal over the 85 sample injections was 7.3 ± 2.5 RIU estimating an LOD at approximately 30 RIU (considering the limit to be at three times the background signal). Taking this intoSensors account, 2018, 18, the x FOR lowest PEER detectable REVIEW concentration of the Oleispira oligo (REF) without any ampliﬁcation13 of 17 wasSensors 50 2018 nM, 18 (373, x FOR pg/ PEERµL). REVIEW Results from the serial dilution of the REF oligo are shown in Figure913. of 17

FigureFigure 9.9. RefractiveRefractive indexindex unitsunits (RIU)(RIU) atat variousvarious concentrationsconcentrations (50,(50, 200,200, 500,500, 1000,1000, 50005000 nM)nM) ofof thethe Figure 9. Refractive index units (RIU) at various concentrations (50, 200, 500, 1000, 5000 nM) of the OleispiraOleispira oligooligo (REF).(REF). ForFor allall measurementmeasurement pointspointsn n= = 3.3. ErrorError barsbars representrepresent SD.SD. Oleispira oligo (REF). For all measurement points n = 3. Error bars represent SD. MeasuredMeasured RIURIU valuesvalues forfor thethe 10-fold10-fold dilutiondilution seriesseries of thethe oligo-probeoligo-probe complex (0.5, 5, 50, 500 nM) Measured RIU values for the 10-fold dilution series of the oligo-probe complex (0.5, 5, 50, 500 nM) usingusing thethe sequentialsequential strategystrategy atat constantconstant 5050 µµLL 11×× bead stock solution are summarized in Figure 1010.. using the sequential strategy at constant 50 µL 1× bead stock solution are summarized in Figure 10. AA graduallygradually decreasingdecreasing signalsignal waswas observedobserved betweenbetween 500–5500–5 nMnM analyteanalyte concentrationconcentration withwith aa largerlarger A gradually decreasing signal was observed between 500–5 nM analyte concentration with a larger dropdrop fromfrom 55 to to 0.5 0.5 nM. nM. While While the the signal signal of theof the oligo-probe oligo-probe complex complex alone alone at 0.5 at nM0.5 concentrationnM concentration was drop from 5 to 0.5 nM. While the signal of the oligo-probe complex alone at 0.5 nM concentration belowwas below the 30 the RIU 30 established RIU established as the limitas the of limit detection, of detection, this level this of thelevel PC of oligo the wasPC stilloligo detectable was still was below the 30 RIU established as the limit of detection, this level of the PC oligo was still withdetectable magnetic with bead-based magnetic bead-based signal ampliﬁcation. signal amplification. detectable with magnetic bead-based signal amplification.

FigureFigure 10.10. ConcentrationConcentration dependentdependent responseresponse ofof thethe oligo-probeoligo-probe complexcomplex onlyonly andand thethe signalsignal ofof thethe Figure 10. Concentration dependent response of the oligo-probe complex only and the signal of the samesame samplessamples withwith sequentialsequential signalsignal ampliﬁcationamplification approachapproach usingusing 5050µ µLL 1 1×× beadbead stock.stock. AmpliﬁedAmplified same samples with sequential signal amplification approach using 50 µL 1× bead stock. Amplified signalsignal refersrefers toto thethe refractiverefractive indexindex unitsunits (RIU(RIU values)values) recordedrecorded atat 66 minmin ofof bindingbinding onceonce thethe beadsbeads signal refers to the refractive index units (RIU values) recorded at 6 min of binding once the beads werewere injected.injected. were injected. TheThe SPRSPR instrument instrument used used in thisin this study study has beenhas b employedeen employed for antibody-based for antibody-based detection detection of smaller of The SPR instrument used in this study has been employed for antibody-based detection of (domoicsmaller acid,(domoic M = acid, 311 g/mol M = 311 and g/mol cortisol, and M =cortisol, 362 g/mol) M = and 362 larger g/mol) (staphylococcal and larger (staphylococcal enterotoxin B, smaller (domoic acid, M = 311 g/mol and cortisol, M = 362 g/mol) and larger (staphylococcal SEB,enterotoxin M = 28,366 B, SEB, Da) analytesM = 28,366 with Da) detection analytes limits with reaching detection 10 limits nM (3.2 reaching ng/mL) 10 for nM domoic (3.2 ng/mL) acid, 1 nMfor enterotoxin B, SEB, M = 28,366 Da) analytes with detection limits reaching 10 nM (3.2 ng/mL) for fordomoic cortisol acid, (0.36 1 nM ng/mL), for cortisol and 3.5(0.36 pM ng/mL), (0.1 ng/mL) and 3.5 for pM SEB, (0.1 respectively ng/mL) for [ 42SEB,–44 ].respectively Here we reported [42–44]. domoic acid, 1 nM for cortisol (0.36 ng/mL), and 3.5 pM (0.1 ng/mL) for SEB, respectively [42–44]. Here we reported the first application of this portable SPR for oligonucleotide sensing, reaching Here we reported the first application of this portable SPR for oligonucleotide sensing, reaching detectable levels at 0.5 nM for the PC oligo (7.2 ng/mL) with the sequential amplification strategy. The detectable levels at 0.5 nM for the PC oligo (7.2 ng/mL) with the sequential amplification strategy. The lowest measured concentration here (0.5 nM) theoretically corresponds to 250 pg/µL of the ~1500 base lowest measured concentration here (0.5 nM) theoretically corresponds to 250 pg/µL of the ~1500 base long rRNA sequence of Oleispira (491.528 kDa), meaning that approximately 125 ng rRNA would be long rRNA sequence of Oleispira (491.528 kDa), meaning that approximately 125 ng rRNA would be necessary to be injected (given the 500 µL injection volume) in an assay. This is approximately 10 times necessary to be injected (given the 500 µL injection volume) in an assay. This is approximately 10 times more than that can be expected to be obtained from marine microbial communities. more than that can be expected to be obtained from marine microbial communities.

Sensors 2018, 18, 3259 14 of 17 the first application of this portable SPR for oligonucleotide sensing, reaching detectable levels at 0.5 nM for the PC oligo (7.2 ng/mL) with the sequential amplification strategy. The lowest measured concentration here (0.5 nM) theoretically corresponds to 250 pg/µL of the ~1500 base long rRNA sequence of Oleispira (491.528 kDa), meaning that approximately 125 ng rRNA would be necessary to be injected (given the 500 µL injection volume) in an assay. This is approximately 10 times more than that can be expected to be obtained from marine microbial communities. Several approaches can be considered to further improve the LOD of our method. One interesting possibility would be the application of external magnetic field, which resulted in a 10-fold improvement in LOD of an SPR-based immunoassay [45]. This is however not possible to implement on our current sensing system. Modifications that can be tested include exploring the effect of: (1) buffer composition used for hybridization and magnetic bead conjugation; (2) magnetic bead size; (3) adding a crowding agent PEG-20000; and (4) testing a competition assay. Eventually, a comparison between similar sized gold-nanoparticles and streptavidin coated magnetic beads may be worth exploring to investigate the potential role of plasmonic coupling in gold-nanoparticle based signal enhancement. Gold-nanoparticle based studies generally report lower LOD. For example, 1 pM of fragmented 16S rRNA was established as LOD with an SPRi system, where a similar sequential signal amplification strategy was used, however with streptavidin coated quantum dots (~15–20 nm in diameter), instead of magnetic beads and an incubation time of 3 h [12]. Interestingly, streptavidin signal amplification alone was successful in reaching a similarly low detection limit (9 pM of a 22-nucleotide long microRNA) in 30 min with the industry standard Biacore XTM instrument [14]. Another gold-nanoparticle (20 nm) based signal amplification SPR assay reached 0.01 ng/mL detection limit for 16S rRNA of pathogenic bacteria [46]. A competition assay, where oligo-conjugated gold nanoparticles competed with the target analyte for the binding sites on the SPR surface reached a similar LOD (0.5 nM) for a 22-nucleotide long target, miRNA-200b as our approach [31]. The reaction time in their study was 1 h in a stationary mode of a four-channel SPR instrument [47]. Lastly, an ultrasensitive surface plasmon resonance enhanced light scattering assay was reported to reach LOD of 2 attomoles (60 fM, 50 µL) of miRNA-122 (22 nucleotide long) using a novel amplification scheme, taking advantage of specific RNA*DNA hybrid-binding antibodies [48].

4. Conclusions The preliminary results reported here are promising for the use of morpholino probe based SPR detection of nucleic acids in monitoring bacterial species, hence oil pollution events based on the occurrence of bacterial indicators such as Oleispira antarctica RB-8. The applicability of a simple functionalization method using morpholino probes on sensor chip surfaces was conﬁrmed showing excellent regeneration of the surface over 85 sample injections. Selectivity of the assay was comparable to that typically obtained with DNA oligos and other SPR-based morpholino functionalized sensors. Up to 16-fold signal ampliﬁcation was achieved using streptavidin coated magnetic beads in a sequential injection manner. Detection limits were on the same order of magnitude (0.5 nM for short oligonucleotides) as those reported for other portable SPR systems, with assay times half of previously reported.

Author Contributions: Conceptualization, A.B., S.D.S., C.E.F., and T.B.; Methodology, A.B. and S.D.S.; Investigation, A.B.; Writing—original draft preparation, A.B.; Writing—review and editing, T.B., S.D.S., and C.E.F.; Supervision, T.B., S.D.S., and C.E.F.; Project administration and funding acquisition, T.B. Funding: This research was funded by the Research Council of Norway (RCN) through the Petromaks 2 Program, project no. 255494/E30. Conﬂicts of Interest: The authors declare no conﬂict of interest. Sensors 2018, 18, 3259 15 of 17

References

1. Medlin, L.K.; Orozco, J. Molecular techniques for the detection of organisms in aquatic environments, with emphasis on harmful algal bloom species. Sensors 2017, 17, 1184. [CrossRef][PubMed] 2. McQuillan, J.S.; Robidart, J.C. Molecular-biological sensing in aquatic environments: Recent developments and emerging capabilities. Curr. Opin. Biotechnol. 2017, 45, 43–50. [CrossRef][PubMed] 3. Ottesen, E.A. Probing the living ocean with ecogenomic sensors. Curr. Opin. Microbiol. 2016, 31, 132–139. [CrossRef][PubMed] 4. Yamahara, K.M.; Demir-Hilton, E.; Preston, C.M.; Marin, R., 3rd; Pargett, D.; Roman, B.; Jensen, S.; Birch, J.M.; Boehm, A.B.; Scholin, C.A. Simultaneous monitoring of faecal indicators and harmful algae using an in-situ autonomous sensor. Lett. Appl. Microbiol. 2015, 61, 130–138. [CrossRef][PubMed] 5. Palchetti, I.; Mascini, M. Nucleic acid biosensors for environmental pollution monitoring. Analyst 2008, 133, 846–854. [CrossRef][PubMed] 6. Justino, C.I.L.; Duarte, A.C.; Rocha-Santos, T.A.P. Recent progress in biosensors for environmental monitoring: A review. Sensors 2017, 17, 2918. [CrossRef][PubMed] 7. Diercks-Horn, S.; Metfies, K.; Jäckel, S.; Medlin, L.K. The algadec device: A semi-automated rrna biosensor for the detection of toxic algae. Harmful Algae 2011, 10, 395–401. [CrossRef] 8. Soelberg, S.D.; Furlong, C.E. Biosensors and bioassays for ecological risk monitoring and assessment. In Environmental Toxicology; Laws, E., Ed.; Springer: New York, NY, USA, 2013; pp. 121–142. 9. Du, Y.; Dong, S. Nucleic acid biosensors: Recent advances and perspectives. Anal. Chem. 2017, 89, 189–215. [CrossRef][PubMed] 10. Nguyen, H.H.; Park, J.; Kang, S.; Kim, M. Surface plasmon resonance: A versatile technique for biosensor applications. Sensors 2015, 15, 10481–10510. [CrossRef][PubMed] 11. Homola, J.; Yee, S.S.; Gauglitz, G. Surface plasmon resonance sensors: Review. Sens. Actuators B Chem. 1999, 54, 3–15. [CrossRef] 12. Foudeh, A.M.; Daoud, J.T.; Faucher, S.P.; Veres, T.; Tabrizian, M. Sub-femtomole detection of 16s rrna from legionella pneumophila using surface plasmon resonance imaging. Biosens. Bioelectron. 2014, 52, 129–135. [CrossRef][PubMed] 13. Li, Y.; Wark, A.W.; Lee, H.J.; Corn, R.M. Single-nucleotide polymorphism genotyping by nanoparticle-enhanced surface plasmon resonance imaging measurements of surface ligation reactions. Anal. Chem. 2006, 78, 3158–3164. [CrossRef][PubMed] 14. Ding, X.; Yan, Y.; Li, S.; Zhang, Y.; Cheng, W.; Cheng, Q.; Ding, S. Surface plasmon resonance biosensor for highly sensitive detection of microrna based on DNA super-sandwich assemblies and streptavidin signal amplification. Anal. Chim. Acta 2015, 874, 59–65. [CrossRef][PubMed] 15. Scholin, C.; Doucette, G.; Jensen, S.; Roman, B.; Pargett, D.; Marin, R.; Preston, C.; Jones, W.; Feldman, J.; Everlove, C.; et al. Remote detection of marine microbes, small invertebrates, harmful algae, and biotoxins using the environmental sample processor (esp). Oceanography 2009, 22, 158–167. [CrossRef] 16. Chinowsky, T.M.; Soelberg, S.D.; Baker, P.; Swanson, N.R.; Kauffman, P.; Mactutis, A.; Grow, M.S.; Atmar, R.; Yee, S.S.; Furlong, C.E. Portable 24-analyte surface plasmon resonance instruments for rapid, versatile biodetection. Biosens. Bioelectron. 2007, 22, 2268–2275. [CrossRef][PubMed] 17. Kroger, S.; Law, R.J. Biosensors for marine applications. We all need the sea, but does the sea need biosensors? Biosens. Bioelectron. 2005, 20, 1903–1913. [PubMed] 18. Kröger, S.; Parker, E.R.; Metcalfe, J.D.; Greenwood, N.; Forster, R.M.; Sivyer, D.B.; Pearce, D.J. Sensors for observing ecosystem status. Ocean Sci. 2009, 5, 523–535. [CrossRef] 19. Bagi, A.; Knapik, K.; Nilsen, M.M.; Krolicka, A.; Boccadoro, C.; Baussant, T. Environmental surveillance of marine systems using genosensors: Application to offshore activities. In Oilfield Microbiology; Whitby, C., Skovhus, T.L., Eds.; CRC Press: Boca Raton, FL, USA, In Prep. 20. Kube, M.; Chernikova, T.N.; Al-Ramahi, Y.; Beloqui, A.; Lopez-Cortez, N.; Guazzaroni, M.E.; Heipieper, H.J.; Klages, S.; Kotsyurbenko, O.R.; Langer, I.; et al. Genome sequence and functional genomic analysis of the oil-degrading bacterium Oleispira antarctica. Nat. Commun. 2013, 4, 2156. [CrossRef][PubMed] 21. Gentile, G.; Bonsignore, M.; Santisi, S.; Catalfamo, M.; Giuliano, L.; Genovese, L.; Yakimov, M.M.; Denaro, R.; Genovese, M.; Cappello, S. Biodegradation potentiality of psychrophilic bacterial strain Oleispira antarctica rb-8(t). Mar. Pollut. Bull. 2016, 105, 125–130. [CrossRef][PubMed] Sensors 2018, 18, 3259 16 of 17

22. Królicka, A.; Boccadoro, C.; Mæland, M.; Preston, C.; Birch, J.; Scholin, C.; Baussant, T. Detection of oil leaks by quantifying hydrocarbonoclastic bacteria in cold marine environments using the environmental sample processor. In Proceedings of the 37th AMOP Technical Seminar on Environmental Contamination and Response, Canmore, AB, Canada, 3–5 June 2014. 23. Sipova, H.; Homola, J. Surface plasmon resonance sensing of nucleic acids: A review. Anal. Chim. Acta 2013, 773, 9–23. [CrossRef][PubMed] 24. Hu, W.; Fu, G.; Kong, J.; Zhou, S.; Scafa, N.; Zhang, X. Advancement of nucleic acid biosensors based on morpholino. Am. J. Biomed. Sci. 2015, 7, 40–51. [CrossRef] 25. Moulton, H.M.; Moulton, J.D. Morpholino Oligomers: Methods and Protocols, 1st ed.; Humana Press: New York, NY, USA, 2017; p. 284. 26. Levicky, R.; Koniges, U.; Tercero, N. Diagnostic applications of morpholinos and label-free electrochemical detection of nucleic acids. Methods Mol. Biol. 2017, 1565, 181–190. [PubMed] 27. Soelberg, S.D.; Chinowsky, T.; Geiss, G.; Spinelli, C.B.; Stevens, R.; Near, S.; Kauffman, P.; Yee, S.; Furlong, C.E. A portable surface plasmon resonance sensor system for real-time monitoring of small to large analytes. J. Ind. Microbiol. Biotechnol. 2005, 32, 669–674. [CrossRef][PubMed] 28. Quast, C.; Pruesse, E.; Yilmaz, P.; Gerken, J.; Schweer, T.; Yarza, P.; Peplies, J.; Glöckner, F.O. The silva ribosomal rna gene database project: Improved data processing and web-based tools. Nucleic Acids Res. 2013, 41, D590–D596. [CrossRef][PubMed] 29. Sun, C.P.; Liao, J.C.; Zhang, Y.H.; Gau, V.; Mastali, M.; Babbitt, J.T.; Grundfest, W.S.; Churchill, B.M.; McCabe, E.R.; Haake, D.A. Rapid, species-specific detection of uropathogen 16s rdna and rrna at ambient temperature by dot-blot hybridization and an electrochemical sensor array. Mol. Genet. Metab. 2005, 84, 90–99. [CrossRef][PubMed] 30. Liao, T.; Li, X.; Tong, Q.; Zou, K.; Zhang, H.; Tang, L.; Sun, Z.; Zhang, G.J. Ultrasensitive detection of micrornas with morpholino-functionalized nanochannel biosensor. Anal. Chem. 2017, 89, 5511–5518. [CrossRef][PubMed] 31. Hong, L.; Lu, M.; Dinel, M.P.; Blain, P.; Peng, W.; Gu, H.; Masson, J.F. Hybridization conditions of oligonucleotide-capped gold nanoparticles for spr sensing of microrna. Biosens. Bioelectron. 2018, 109, 230–236. [CrossRef][PubMed] 32. Tercero, N.; Wang, K.; Gong, P.; Levicky, R. Morpholino monolayers: Preparation and label-free DNA analysis by surface hybridization. J. Am. Chem. Soc. 2009, 131, 4953–4961. [CrossRef][PubMed] 33. Liu, C.; Zeng, G.M.; Tang, L.; Zhang, Y.; Li, Y.P.; Liu, Y.Y.; Li, Z.; Wu, M.S.; Luo, J. Electrochemical detection of pseudomonas aeruginosa 16s rrna using a biosensor based on immobilized stem-loop structured probe. Enzym. Microb. Technol. 2011, 49, 266–271. [CrossRef][PubMed] 34. Heng, J.B.; Ho, C.; Kim, T.; Timp, R.; Aksimentiev, A.; Grinkova, Y.V.; Sligar, S.; Schulten, K.; Timp, G. Sizing DNA using a nanometer-diameter pore. Biophys. J. 2004, 87, 2905–2911. [CrossRef][PubMed] 35. Tercero, N.; Wang, K.; Levicky, R. Capacitive monitoring of morpholino-DNA surface hybridization: Experimental and theoretical analysis. Langmuir 2010, 26, 14351–14358. [CrossRef][PubMed] 36. Yu, F.; Yao, D.; Knoll, W. Oligonucleotide hybridization studied by a surface plasmon diffraction sensor (spds). Nucleic Acids Res. 2004, 32, e75. [CrossRef][PubMed] 37. Parab, H.J.; Jung, C.; Lee, J.H.; Park, H.G. A gold nanorod-based optical DNA biosensor for the diagnosis of pathogens. Biosens. Bioelectron. 2010, 26, 667–673. [CrossRef][PubMed] 38. Hao, K.; He, Y.; Lu, H.; Pu, S.; Zhang, Y.; Dong, H.; Zhang, X. High-sensitive surface plasmon resonance microrna biosensor based on streptavidin functionalized gold nanorods-assisted signal amplification. Anal. Chim. Acta 2017, 954, 114–120. [CrossRef][PubMed] 39. Da-Silva, E.; Barthelmebs, L.; Baudart, J. Development of a pcr-free DNA-based assay for the specific detection of vibrio species in environmental samples by targeting the 16s rrna. Environ. Sci. Pollut. Res. Int. 2017, 24, 5690–5700. [CrossRef][PubMed] 40. Wages, J.M., Jr.; Wages, G.M.; Matthews, P.; Weller, D.; Summerton, J. Affinity purification of rna: Sequence-specific capture by nonionic morpholino probes. Biotechniques 1997, 23, 1116–1121. [CrossRef] [PubMed] 41. Xiong, Y.; McQuistan, T.J.; Stanek, J.W.; Summerton, J.E.; Mata, J.E.; Squier, T.C. Detection of unique ebola virus oligonucleotides using fluorescently-labeled phosphorodiamidate morpholino oligonucleotide probe pairs. Anal. Biochem. 2018, 557, 84–90. [CrossRef][PubMed] Sensors 2018, 18, 3259 17 of 17

42. Stevens, R.C.; Soelberg, S.D.; Near, S.; Furlong, C.E. Detection of cortisol in saliva with a flow-filtered, portable surface plasmon resonance biosensor system. Anal. Chem. 2008, 80, 6747–6751. [CrossRef][PubMed] 43. Soelberg, S.D.; Stevens, R.C.; Limaye, A.P.; Furlong, C.E. Surface plasmon resonance detection using antibody-linked magnetic nanoparticles for analyte capture, purification, concentration, and signal amplification. Anal. Chem. 2009, 81, 2357–2363. [CrossRef][PubMed] 44. Stevens, R.C.; Soelberg, S.D.; Eberhart, B.-T.L.; Spencer, S.; Wekell, J.C.; Chinowsky, T.M.; Trainer, V.L.; Furlong, C.E. Detection of the toxin domoic acid from clam extracts using a portable surface plasmon resonance biosensor. Harmful Algae 2007, 6, 166–174. [CrossRef] 45. Wang, Y.; Dostalek, J.; Knoll, W. Magnetic nanoparticle-enhanced biosensor based on grating-coupled surface plasmon resonance. Anal. Chem. 2011, 83, 6202–6207. [CrossRef][PubMed] 46. Melaine, F.; Saad, M.; Faucher, S.; Tabrizian, M. Selective and high dynamic range assay format for multiplex detection of pathogenic pseudomonas aeruginosa, salmonella typhimurium, and legionella pneumophila rnas using surface plasmon resonance imaging. Anal. Chem. 2017, 89, 7802–7807. [CrossRef][PubMed] 47. Zhao, S.S.; Bukar, N.; Toulouse, J.L.; Pelechacz, D.; Robitaille, R.; Pelletier, J.N.; Masson, J.F. Miniature multi-channel spr instrument for methotrexate monitoring in clinical samples. Biosens. Bioelectron. 2015, 64, 664–670. [CrossRef][PubMed] 48. Yang, C.T.; Pourhassan-Moghaddam, M.; Wu, L.; Bai, P.; Thierry, B. Ultrasensitive detection of cancer prognostic mirna biomarkers based on surface plasmon enhanced light scattering. ACS Sens. 2017, 2, 635–640. [CrossRef][PubMed]

© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).